NZ749259B2 - Polynucleotides encoding rodent antibodies with human idiotypes and animals comprising same - Google Patents

Abstract

The invention relates to polynucleotides, particularly chimeric polynucleotides useful for optimal production of functional immunoglobulins with human idiotypes in rodents. The invention further relates to rodents comprising such polynucleotides.

Description

POLYNUCLEOTIDES ENCODING RODENT ANTIBODIES WITH HUMAN IDIOTYPES AND ANIMALS COMPRISING SAME REFERENCE TO RELATED APPLICATION This is a divisional application of New Zealand patent application 709608, which is the national phase entry in New Zealand of PCT international application (published as ) dated 13 December 2013. This application claims ty to U.S. provisional patent application U.S.S.N. 61/737,371 filed 14 er 2012. All of these applications are expressly incorporated herein in their entireties by reference.

FIELD OF ION The invention relates to polynucleotides, particularly chimeric polynucleotides useful for the production of immunoglobulins with human idiotypes in rodents. The invention further relates to rodent cells comprising such polynucleotides.

REFERENCE TO A CE LISTING A Sequence Listing is provided in this patent nt as a txt file entitled “189314- .txt” and created December 12, 2012 (size 3MB). The contents of this file is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION Human monoclonal antibodies have proven to be able in therapeutic applications, either as IgG of conventional size, single chains or domain modules1, 2. Despite the successes there are still major shortcomings in their production, which relies either on specificity selection of available human material and subsequent modification of individual products, or the immunization of the limited availability of transgenic animals, mainly mice3. Target antigen restrictions are widely in place for the use of transgenic mice, as well as large enic animals such as cattle, and the development of new specificities is company controlled4-7.

DNA rearrangement and expression of human immunoglobulin (Ig) genes in transgenic mice was pioneered over 20 years ago by stably inserting heavy-chain genes in germline configuration8. Although human antibody oires were obtained in these early animals, major improvements, resulting in higher expression levels and exclusive production of human Ig, combined two new strategies: gene knock-out in embryonic stem (ES) cells9 and locus extension on artificial chromosomes10.

Silencing of the endogenous Ig genes by gene targeting in ES cells produced several inactive mouse lines without the ability to rearrange their IgH and Ig? locus or without producing fully functional IgH, Ig? or Ig? products rized in3). More recently zinc finger nucleases (ZFNs) were designed to generate site-specific double-strand breaks in Ig genes, which d gene disruption by deletion and non-homologous DNA repair. Injection of ZFN plasmids into fertilized eggs ed Ig silenced rats and rabbits with IgH and IgL disruptions11-13.

Efficient expression of antibodies es functional regulatory elements in various locations in immunoglobulin loci. Enhancer sequences have been identified near many active genes by nuclease digest and hypersensitivity to degradation. Hypersensitive sites may precede promoter sequences and the strength of their activity was correlated with the DNA sequence.

Linkage to er genes showed elevated transcription if enhancer function was present (Mundt et al., J. l., , 166, 3315[2001]. In the IgH locus two important transcription or expression regulators have been identified, Eµ and the 3’E at the end of the locus rsson et al., Nature, 344, 165 [1990]). In the mouse the removal of the entire 3’ regulatory region (containing hs3a, hs1,2, hs3b and hs4) allows normal early B-cell development but abrogates switch recombination (Vincent-Fabert et al., Blood, 116, 1895 ) and possibly prevents the optimization of somatic hypermutation na et al., Protein Engineering, Design and Selection, 1, [2011]).

The regulatory function to achieve l e expression is particularly desirable when transgenic human IgH genes are being used. However, in a number of laboratories, transgene constructs with an incomplete 3’E region, typically providing only the hs1,2 element, led to disappointing expression levels in transgenic mice even when the nous IgH locus was knocked-out. This may be one reason why the generation of antigenspecific fully human IgGs from genetically engineered mice has been inefficient thus far.

(Lonberg et al., Nature 368, 856 [1994]; Nicholson et al., J. Immunol., 163, 6898 [1999]; Davis et al., Cancer Metastasis Rev. 18, 421 [1999]; Pruzina et al., Protein Engineering, Design and ion, 1,[2011].

In the rat, the 3’E region has only been poorly analyzed. A comparison of mouse and rat sequences does not allow identification of hs4, the crucial 4th E element with additional ant regulatory sequences further downstream (Chatterjee et al., J. Biol. Chem., 286,29303 ). This could mean the region is not present in the rat, and perhaps not as important as in the mouse, or it could be absent in the analyzed rat genome sequences.

Still needed are methods and materials for the optimal production of immunoglobulins or antibodies having human idiotypes using transgenic animals, which are useful for treating humans in a broad range of disease areas; and/ or which at least e the public with a useful choice.

SUMMARY OF INVENTION ] In a first aspect, the invention relates to a transgenic rat, the rat sing in its germline a heavy chain immunoglobulin locus comprising human unrearranged heavy chain variable region gene segments linked to DNA encoding a rat heavy chain constant region and a rat 3' enhancer comprising the sequence set forth as SEQID NO:1, wherein the heavy chain immunoglobulin locus does not comprise a human immunoglobulin constant region gene. [0010B] In a second , the invention relates to a method of producing an antibody having a human variable region and a rat constant region comprising exposing a transgenic rat to an antigen, the rat comprising in its germline a heavy chain immunoglobulin locus sing human unrearranged heavy chain variable region gene segments linked to DNA ng a rat heavy chain constant region and a rat 3’ enhancer comprising the sequence set forth as SEQ ID NO: 1, wherein the heavy chain immunoglobulin locus does not comprise a human immunoglobulin gene, wherein the exposure to the antigen is such that the enic rat produces an antibody to the n, the antibody having a human heavy chain variable region and a rat heavy chain region.

BRIEF DESCRIPTION OF THE INVENTION Disclosed herein are novel polynucleotides comprising nucleic acid sequences encoding chimeric immunoglobulin chains, particularly chimeric heavy chains for use in creating transgenic animals. The presently described polynucleotides advantageously provide optimal expression due, at least in part, to the inclusion of a 3’ er since transloci lacking this 3’ er result in impaired isotype switching and low IgG expression. Accordingly, in preferred embodiments the ption includes chimeric polynucleotides comprising a rat 3’ enhancer sequence, an Ig constant region gene and at least one human immunoglubulin (Ig) joining (J) region gene. In a preferred embodiment, the rat 3’ enhancer sequence comprises the sequence set forth as SEQ ID NO:1, or a portion thereof.

The chimeric polynucleotides set forth herein may further comprise at least one human variable (V) gene, at least one a diversity (D) gene, or a combination thereof. In one embodiment, the constant region gene of the chimeric polynucleotide is selected from the group consisting of a human constant region gene and a rat constant region gene. In a preferred embodiment, the constant region gene is a rat nt region gene. In another preferred embodiment, the constant region gene is selected from the group consisting of Cµ and C?.

In one embodiment, the chimeric polynucleotide ses a nucleic acid sequence substantially homologous to the bacterial artificial chromosome (BAC) Annabel disclosed herein (e.g., SEQ ID NO:10), or a portion f, and may optionally further comprise at least one human variable Ig gene able from BAC6-VH3-11 and BAC3. In a preferred embodiment, the chimeric polynucleotides contemplated herein comprise nucleic acid sequences (a) and (b) in ’ to 3’ order: (a) a human Ig variable region comprising human V genes in natural configuration isolatable from H3-11 and/or BAC3, and (b) a human Ig g region comprising human J genes in natural configuration isolatable from the BAC Annabel. In another embodiment, each of the human Ig variable region, human Ig diversity , human Ig joining , the Ig constant region and the rat 3’ enhancer region of a chimeric polynucleotide as sed herein are in the relative positions as shown in . In another embodiment, a chimeric polynucleotide as disclosed has a sequence comprising or ntially gous to the sequence set forth as SEQ ID NO:2 or a portion thereof. In another ment, a chimeric polynucleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:11, or a portion thereof. In a further embodiment, a chimeric polynucletoide as disclosed herein comprises a rearranged V-D-J regions, wherein said rearranged V-D-J regions encode a heavy chain variable domain exon.

Also disclosed herein are polynucleotides encoding human kappa light chain genes.

In one embodiment, a polynucleotide as disclosed herein has a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of RP11-1156D9 (set forth as SEQ ID NO:3) and RP11-1134E24 (set forth as SEQ ID NO:4). In r embodiment, the isolated polynucleotide comprises nucleic acid sequences (a) and (b) in ’ to 3’ order: (a) a human Ig variable region comprising human V genes in l configuration isolatable from bacterial artificial chromosomes (BAC) RP11-156D9 and/or RP11-1134E24; (b) a human Ig joining region comprising human J genes in natural configuration isolatable from the bacterial artificial chromosomes (BAC) RP11-1134E24 and/or 44F17 (set forth as SEQ ID NO:5). In a preferred embodiment, each of the human Ig variable region, the human Ig joining region, and the human Ig constant region are in relative position as shown in . In another ment, a chimeric cleotide as disclosed has a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:6 or a portion thereof.

Also described herein is a rodent cell comprising one or more cleotides of the description. For example, described herein is a rodent cell comprising a polynucleotide as sed herein, preferably comprising a nucleic acid sequence encoding for a chimeric heavy chain, e.g., a nucleic acid sequence encoding a rat 3’ enhancer sequence, an Ig constant region gene and at least one human J region gene, and optionally, comprising a nucleic acid sequence substantially gous to the nucleic acid sequence selected from the group ting of RP11-1156D9, RP11-1134E24 and portions thereof. The rodent cell plated herein may further comprise a polynucleotide encoding a functional light chain, e.g., having a nucleic acid sequence comprising or substantially homologous to a nucleic acid sequence selected from the group consisting of the ce shown in (set forth as SEQ ID NO:6), the ce shown in (set forth as SEQ ID NO:7), and portions thereof. In one embodiment, one or more of the polynucleotides are integrated into the rodent cell genome.

BRIEF DESCRIPTION OF THE DRAWINGS ated human Ig loci. (a) The chimeric human-rat IgH region contains 3 overlapping BACs with 22 different and potentially functional human VH segments. BAC6-3 has been ed with VH3-11 to e a 10.6 kb overlap to BAC3, which overlaps 11.3 kb via VH6-1 with the C region BAC Hu-Rat l. The latter is chimeric and contains all human D and JH segments followed by the rat C region with full enhancer sequences. (b) The human Igk BACs with 12 Vks and all Jks e a ~14 kb overlap in the Vk region and ~40 kb in Ck to include the KDE. (c) The human Igl region with 17 Vls and all J-Cls, including the 3’ enhancer, is from a YAC33. -d: Flow cytometry analysis of lymphocyte-gated bone marrow and spleen cells from 3 months old rats. e staining for IgM and CD45R (B220) revealed a similar number of immature and mature B-cells in bone marrow and spleen of HC14 and wt rats, while JKO/JKO animals showed no B-cell pment. Plotting forward (FSC) against site (SSC) scatter showed comparable numbers of lymphocyte (gated) populations, concerning size and shape. Surface staining of spleen cells with anti-IgG (G1, G2a, G2b, G2c isotype) plotted against cell count (x 102) revealed near normal numbers of IgG+ expressers in HC14 rats compared to wt. In , A refers to pro/pre B-cells (CD45R+IgM-) and B refers to immature s (CD45R+IgM+). In , A refers to transitional B cells (CD45R+IgM-), B to follicular B cells (CD45R+IgM+) and C to marginal zone B cells (CD45RlowIgM+).

Mutational changes in IgH and IgL transcripts from PBLs. Unique (VHDJH)s and VLs were from amplifications with V group specific s: IGHV1, 2, 3, 4 and 6 in combination with the universal ?CH2 reverse primer, IGLV2, 3 and 4 with reverse C? primer; and IGKV1, 3, 4 and 5 in with e C? primer (Supplementary Table 1). Mutated trans-switch products were identified for humanVH-rat C?2a (4) and human VH-rat C?2c (2).

Purification of rat Ig with human idiotypes and comparison to human and normal rat Ig levels. OmniRat serum and human or rat wt l serum, 100 µl each, was used for IgM/G purification. (a) IgM was captured with anti-IgM matrix, which identified 14 µg in wt rat, and 30 µg and 10 µg in OmniRats [HC14(a) and HC14(c)]. (b) IgG was purified on protein A and protein G columns, with a yield of up to ~3 mg/ml for OmniRats (Protein A: HC14(a) 1000 µg/ml; HC14(b) 350 µg/ml; wt rat 350 µg/ml; Protein G: HC14(a) 2970 µg/ml; HC14(b) 280 µg/ml; wt rat 1010 µg/ml). (c) Human Ig? and (d) human Ig? was purified on anti-Ig? and anti-Ig? matrix, tively. No purification product was obtained using wt rat serum (not shown). Purified Ig, ~3 µg ntration determined by nano drop), was ted on 4-15% SDS-PAGE under reducing conditions. Comparison by ELISA titration of (e) human Ig? and (f) human Ig? levels in individual OmniRats (8531, 8322, 8199, 8486, 8055), human and wt rat serum. Serum dilution (1:10, 1:100, 1:1,000, 1:10,000) was plotted t binding measured by adsorption at 492 nm. Matching name/numbers refer to s from the same rat.

DETAILED DESCRIPTION Provided herein are chimeric polynucleotides encoding a recombinant or artificial immunoglobulin chain or loci. As described above, the chimeric polynucleotides disclosed herein are useful for the transformation of rodents to include human Ig genes and for the production of globulins or antibodies having human idiotypes using such rodents. [0020A] The term “comprising” as used in this specification and claims means “consisting at least in part of”. When interpreting statements in this specification, and claims which include the term “comprising”, it is to be understood that other es that are additional to the features prefaced by this term in each statement or claim may also be present. Related terms such as “comprise” and “comprised” are to be interpreted in similar manner.

Polynucleotides Immunoglobulin refers to a protein ting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognized human immunoglobulin genes include the kappa, lambda, alpha (IgA1 and IgA2), gamma (IgG1, IgG2, IgG3, IgG4), delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Full-length immunoglobulin "light chains" (about 25 Kd, or 214 amino acids) generally comprise a variable domain encoded by an exon comprising one or more variable region ) and one or more joining region gene(s) at the NH2-terminus (about 110 amino acids) and constant domain d by a kappa or lambda constant region gene at the erminus.

Full-length immunoglobulin "heavy chains" (about 50 Kd, or 446 amino acids), similarly comprise (1) a variable domain (about 116 amino acids) encoded by an exon comprising one or more variable region genes, one or more diversity region genes and one or more joining region genes, and (2) one of the entioned constant domains comprising one or more nt region genes, e.g., alpha, gamma, delta, epsilon or mu (encoding about 330 amino acids). The immunoglobulin heavy chain constant region genes encode for the antibody class, i.e., isotype (e.g., IgM or IgG1).

As used herein, the term "antibody" refers to a protein comprising at least one, and preferably two, heavy (H) chain variable domains (abbreviated herein as VH), and at least one and ably two light (L) chain le domains (abbreviated herein as VL). An ordinarily skilled n will recognize that the variable domain of an immunological chain is encoded in gene segments that must first o somatic recombination to form a complete exon encoding the variable domain. There are three types of s or gene segments that undergo rearrangement to form the variable domain: the variable region comprising variable genes, the diversity region comprising diversity genes (in the case of an immunoglobulin heavy chain), and the joining region comprising joining genes. The VH and VL domains can be further subdivided into regions of hypervariability, termed "complementarity determining s" ("CDRs") interspersed with regions that are more conserved, termed "framework regions" ("FRs"). The extent of the FRs and CDRs has been precisely defined (see, Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 2; and Chothia et al. (1987) J. Mol. Biol. 1-17, which are hereby incorporated by reference). Each VH and VL domain is generally composed of three CDRs and four FRs, arranged from amino-terminus to y-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The antigen binding fragment of an antibody (or simply "antibody portion," or "fragment"), as used herein, refers to one or more fragments of a full-length antibody that retain the ability to ically bind to an antigen (e.g., CD3).

Examples of binding fragments encompassed within the term "antigen binding fragment" of an antibody include (i) an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a ide bridge at the hinge region; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al. (1989) Nature 341:544-46), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two s of the Fv fragment, VL and VH, are coded for by separate genes, they may be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-26; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-83). Such single chain antibodies are also intended to be encompassed within the term "antigen binding fragment" of an antibody. These antibody fragments are ed using conventional techniques known to those skilled in the art, and the nts are screened for utility in the same manner as are intact antibodies.

An dy may r include a heavy and/or light chain constant domain to thereby form a heavy and light immunoglobulin chain, respectively. In one embodiment, the antibody is a tetramer of two heavy immunoglobulin chains and two light immunoglobulin chains, wherein the heavy and light immunoglobulin chains are interconnected, e.g., by disulfide bonds. The heavy chain constant domain is comprised of three gene segments, CH1, CH2 and CH3. The light chain constant domain is comprised of one gene, CL. The variable s of the heavy and/or light chains contain a binding domain that cts with an antigen. The constant domains of the antibodies typically mediate the binding of the dy to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

By cleotide encoding an artificial immunoglobulin locus or artificial immunoglobulin chain is meant an recombinant cleotide comprising multiple immunoglobulin regions, e.g., a variable (V) region or gene segment comprising V genes, a joining (J) gene region or gene segment sing J genes, a diversity (D) region or gene segment comprising D genes in the case of a heavy chain locus and/or at least one constant (C) region comprising at least one C gene. Preferably, each region of the variable domain, e.g., V, D, or J region, comprises or spans at least two genes of the same type. For example a variable region as used herein comprises at least two variable genes, a joining region comprises at least two joining genes and a diversity region comprises two diversity genes. A constant region may comprise only one constant gene, e.g. a ? gene or ? gene, or multiple genes, e.g., CH1, CH2, and CH3.

”Enhancer sequences” or “enhancer” as used herein refers to sequences that have been identified near many active genes by nuclease digest and hypersensitivity to degradation.

Hypersensitive sites may precede promoter sequences and the strength of their ty was correlated with the DNA sequence. Linkage to er genes showed elevated transcription if enhancer function was present (Mundt et al., J. Immunol., 166, 3315[2001]). In the IgH locus two important transcription or expression regulators have been identified, Eµ and the 3’E at the end of the locus (Pettersson et al., Nature, 344, 165 [1990]). In the mouse the l of the whole 3’ tory region (containing hs3a, hs1,2, hs3b and hs4) allows normal early B-cell development but abrogates class-switch recombination (Vincent-Fabert et al., Blood, 116, 1895 ) and possibly prevents the optimization of somatic hypermutation (Pruzina et al., n Engineering, Design and Selection, 1, [2011]). The tory function to e optimal isotype expression is particularly desirable when enic human IgH genes are being used.

Transgene ucts with incomplete 3’E region, usually only providing the hs1,2 element, led to disappointing expression levels in transgenic mice even when the endogenous IgH locus was knocked-out. As a consequence, only few antigen-specific fully human IgGs have been isolated from constructs produced in the last 20 years (Lonberg et al., Nature 368, 856 [1994]; Nicholson et al., J. l., 163, 6898 [1999]; Davis et al., Cancer Metastasis Rev. 18, 421 [1999]; a et al., n Engineering, Design and Selection, 1, [2011]). In the rat IgH locus, the 3’E region has only been poorly analyzed. A ison of mouse and rat sequences did not allow identification of hs4, the crucial 4th element with additional important regulatory sequences further downstream (Chatterjee et al., J. Biol. Chem., 286,29303 [2011]). The presently described polynucleotides advantageously provide optimal expression due, at least in part, to the inclusion of a rat 3’ enhancer since chimeric polynucleotides lacking this 3’ enhancer result in impaired isotype switching and low IgG expression. In one embodiment, the rat 3’ enhancer has a ce comprising or substantially homologous to the sequence set forth as SEQ ID NO:1 or a portion thereof.

As used herein, a polynucleotide having a sequence comprising or substantially homologous to a portion, e.g., less than the entirety, of second ce (e.g., SEQ ID NO:1, SEQ ID NO:2, etc.) preferably retains the biological activity of the second sequence (e.g., retains the ical activity of a 3’ enhancer to provide optimal expression and/or isotype switching of immunoglobulins, is capable of rearrangement to provide a humanized chimeric heavy chain, etc.) . In one ment, a nucleic acid comprising a sequence comprising or substantially homologous to a portion of SEQ ID NO:1 comprise at least 8 kB, preferably at least kB of continuous nucleic acids that are substantially gous to SEQ ID NO:1.

“Artificial Ig locus” as used herein may refer to polynucleotides that (e.g., a sequence sing V-,D-, and/or J regions in the case of heavy chain, or V- and/or J regions in the case of light chain, and optionally a constant region for either or both a heavy and light chgin) that are ranged, partially rearranged, or rearranged. cial Ig loci include artificial Ig light chain loci and artificial Ig heavy chain loci. In one embodiment, an artificial immunoglobulin locus of the ption is functional and e of rearrangement and producing a repertoire of immunoglobulin chains. In a preferred embodiment, the variable domain or portion thereof of a polynucleotide disclosed herein comprises genes in natural configuration, i.e., naturally occurring sequences of an human Ig gene segment, degenerate forms of naturally occurring sequences of a human Ig gene t, as well as synthetic sequences that encode a ptide ce substantially identical to the polypeptide encoded by a naturally occurring sequence of a human Ig gene segment. In another preferred ment, the polynucleotide comprises a variable domain or portion thereof in a natural configuration found in humans. For example, a polynucleotide encoding an artificial Ig heavy chain as disclosed herein may comprise in natural configuration at least two human V genes, at least two D genes, at least two J genes or a combination thereof.

In a preferred embodiment, an artificial Ig locus comprises a non-human C region gene and is capable of producing a repertoire of immunoglobulins including chimeric immunoglobulins having a non-human C region. In one embodiment, an artificial Ig locus comprises a human C region gene and is capable of producing a repertoire of globulins including immunoglobulins having a human C region. In one embodiment, an artificial Ig locus comprises an ”artificial constant region gene”, by which is meant a constant region gene comprising nucleotide sequences derived from human and non-human constant regions genes.

For example, an exemplary artificial C constant region gene is a constant region gene encoding a human IgG CH1 domain and rat IgG CH2 and CH3 .

In a preferred embodiment, an cial Ig locus comprises 3’ enhancer sequences, including hs1,2, hs3a, hs3b and sequences (500-2500 nt) downstream of hs3b. In transgenic animals, artificial loci comprising the full ~30 kb 3’E region from Calpha to 3’ hs3b result in high level IgG expression, extensive utation and large numbers of antigen-specific hybridomas of high (pM) affinity. However, shorter enhancer ces reduce Ig sion.

In a preferred embodiment, an artificial Ig locus comprises the 3’ enhancer sequence shown in Fig 1a. This sequence is derived from the rat Ig heavy chain locus and contains about 30kb of the 3’ region from Calapha to 3’ hs3b. The sequence of the rat 3’ er sequence is set forth as SEQ ID NO:1. In another embodiment, the artificial Ig locus comprises a sequence comprising or substantially homologous to the sequence set forth as SEQ ID NO:1, or a portion thereof.

In some embodiments, an artificial Ig heavy chain locus lacks CH1, or an equivalent sequence that allows the resultant immunoglobulin to circumvent the typical immunoglobulin: chaperone association. Such artificial loci provide for the production of heavy chain-only antibodies in transgenic s which lack a functional Ig light chain locus and hence do not express functional Ig light chain. Such artificial Ig heavy chain loci are used in methods contemplated herein to e transgenic animals lacking a functional Ig light chain locus, and comprising an cial Ig heavy chain locus, which animals are e of producing heavy chain-only antibodies. Alternatively, an artificial Ig locus may be manipulated in situ to disrupt CH1 or an equivalent region and te an artificial Ig heavy chain locus that provides for the production of heavy chain-only antibodies. Regarding the production of heavy chain-only antibodies in light chain-deficient mice, see for example Zou et al., JEM, 204:3271-3283, 2007.

By “human idiotype” is meant a polypeptide sequence present on a human antibody encoded by an immunoglobulin V-gene segment. The term “human pe” as used herein includes both naturally occurring sequences of a human antibody, as well as synthetic sequences substantially identical to the polypeptide found in naturally occurring human dies. By “substantially” is meant that the degree of amino acid sequence identity is at least about 85%-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%.

By a “chimeric antibody” or a “chimeric immunoglobulin” is meant an immunoglobulin molecule comprising a portion of a human immunoglobulin ptide sequence (or a ptide sequence encoded by a human Ig gene segment) and a portion of a non-human immunoglobulin ptide sequence. The chimeric immunoglobulin molecules of the present ption are immunoglobulins with man Fc-regions or artificial Fc-regions, and human idiotypes. Such immunoglobulins can be isolated from animals of the description that have been engineered to produce chimeric globulin molecules.

By “artificial Fc-region” is meant an Fc-region encoded by an artificial constant region gene.

The term “Ig gene segment” as used herein refers to regions of DNA encoding various portions of an Ig molecule, which are present in the germline of non-human animals and humans, and which are brought together in B cells to form rearranged Ig genes. Thus, Ig gene segments as used herein include V gene segments, D gene segments, J gene segments and C gene segments.

The term “human Ig gene segment” as used herein includes both naturally occurring ces of a human Ig gene segment, degenerate forms of naturally occurring ces of a human Ig gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially identical to the polypeptide encoded by a naturally occurring sequence of a human Ig gene segment. By “substantially” is meant that the degree of amino acid sequence identity is at least about %. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95% cleotides related to the present description may comprise DNA or RNA and may be wholly or partially synthetic. Reference to a nucleotide sequence as set out herein encompasses a DNA molecule with the specified sequence, and encompasses an RNA molecule with the specified sequence in which U is substituted for T, unless t es otherwise.

Calculations of "homology" or "sequence identity" n two sequences (the terms are used interchangeably herein) are performed as s. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and mologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or tide positions are then compared.

When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid ogy"). The percent identity between the two sequences is a function of the number of identical positions shared by the ces, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal ent of the two sequences.

The comparison of ces and determination of percent sequence identity between two sequences may be accomplished using a mathematical algorithm. In a red embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. -53) algorithm, which has been orated into the GAP program in the GCG software package (available online at gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly red set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a ce identity or homology limitation of the description) is a m 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of Meyers and Miller ((1989) CABIOS 4:11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

Artificial Ig Loci The present description further includes artificial Ig loci and their use in making transgenic animals capable of producing immunoglobulins having a human idiotype. Each cial Ig locus comprises multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present description, at least one of the V gene segments encodes a germline or hypermutated human V-region amino acid sequence. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype. In heavy chain loci human or non-human-derived D-gene segments may be ed in the artificial Ig loci. The gene segments in such loci are juxtaposed with respect to each other in an unrearranged configuration (or “the germline configuration”), or in a partially or fully rearranged configuration. The cial Ig loci have the capacity to o gene rearrangement (if the gene segments are not fully rearranged) in the t animal y producing a diversified repertoire of immunoglobulins having human idiotypes.

Regulatory elements like promoters, enhancers, switch regions, recombination signals, and the like may be of human or non-human origin. What is required is that the ts be operable in the animal species concerned, in order to render the artificial loci functional. Preferred regulatory elements are described in more detail .

In one embodiment, the description includes transgenic constructs containing an artificial heavy chain locus capable of undergoing gene rearrangement in the host animal thereby producing a diversified repertoire of heavy chains having human idiotypes. An artificial heavy chain locus of the transgene contains a V-region with at least one human V gene segment.

Preferably, the V-region includes at least about 5-100 human heavy chain V (or “VH”) gene segments. As described above, a human VH segment encompasses naturally occurring ces of a human VH gene segment, degenerate forms of naturally occurring sequences of a human VH gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about 85%-95%) identical to a human heavy chain V domain polypeptide.

In a preferred embodiment, the cial heavy chain locus contains at least one or several rat nt region genes, e.g., Cd, Cµ and C? (including any of the C? sses).

In another preferred ment, the artificial heavy chain locus contains cial constant region genes. In a preferred embodiment, such artificial constant region genes encode a human CH1 domain and rat CH2 CH3 domains, or a human CH1 and rat CH2, CH3 and CH4 domains. A hybrid heavy chain with a human CH1 domain pairs effectively with a fully human light chain.

In a preferred embodiment, an artificial Ig locus comprises 3’ enhancer sequences, including hs1,2, hs3a, hs3b and sequences between rat Calpha and 3’hs3b.

In another preferred embodiment, the artificial heavy chain locus contains cial constant region genes lacking CH1 s In a preferred embodiment, such artificial constant region genes encode truncated IgM and/or IgG lacking the CH1 domain but comprising CH2, and CH3, or CH1, CH2, CH3 and CH4 domains. Heavy chains lacking CH1 domains cannot pair effectively with Ig light chains and form heavy chain only antibodies.

In another embodiment, the description includes transgenic constructs containing an artificial light chain locus capable of undergoing gene rearrangement in the host animal y producing a diversified repertoire of light chains having human idiotypes. An artificial light chain locus of the ene contains a V-region with at least one human V gene segment, e.g., a V-region having at least one human VL gene and/or at least one rearranged human VJ segment.

Preferably, the V-region es at least about 5-100 human light chain V (or “VL”) gene segments. Consistently, a human VL t encompasses naturally ing sequences of a human VL gene segment, degenerate forms of naturally occurring sequences of a human VL gene segment, as well as synthetic sequences that encode a polypeptide sequence substantially (i.e., at least about %) identical to a human light chain V domain polypeptide. In one ment, the artificial light chain Ig locus has a on having at least one rat C gene (e.g., rat C? or C?).

Another embodiment of the present description is directed to methods of making a transgenic vector containing an artificial Ig locus. Such methods involve isolating Ig loci or nts thereof, and combining the same, with one or l DNA fragments comprising sequences encoding human V region elements. The Ig gene segment(s) are ed into the artificial Ig locus or a portion thereof by ligation or homologous recombination in such a way as to retain the capacity of the locus to undergo effective gene rearrangement in the subject animal.

Preferably, a non-human Ig locus is isolated by screening a library of plasmids, cosmids, YACs or BACs, and the like, prepared from the genomic DNA of the same. YAC clones can carry DNA fragments of up to 2 megabases, thus an entire animal heavy chain locus or a large portion f can be isolated in one YAC clone, or reconstructed to be contained in one YAC clone. BAC clones are capable of carrying DNA fragments of smaller sizes (about 50- 500 kb). However, multiple BAC clones containing overlapping fragments of an Ig locus can be separately altered and subsequently ed together into an animal recipient cell, wherein the pping fragments recombine in the recipient animal cell to generate a continuous Ig locus.

Human Ig gene segments can be integrated into the Ig locus on a vector (e.g., a BAC clone) by a variety of methods, including ligation of DNA fragments, or insertion of DNA fragments by homologous recombination. Integration of the human Ig gene segments is done in such a way that the human Ig gene t is operably linked to the host animal sequence in the transgene to produce a functional humanized Ig locus, i.e., an Ig locus e of gene rearrangement which lead to the production of a diversified oire of antibodies with human idiotypes. Homologous recombination can be performed in bacteria, yeast and other cells with a high frequency of homologous recombination . Engineered YACs and BACs can be readily isolated from the cells and used in making transgenic animals Rodent oocytes and transgenic animals sing artificial Ig loci and capable of ing antibodies having human idiotypes In one embodiment, the description includes transgenic animals capable of producing immunoglobulins having human idiotypes, as well as methods of making the same.

The transgenic animals used are selected from rodents (e.g., rats, hamsters, mice and guinea pigs).

The transgenic animals used for humanized antibody production as described carry germline mutations in endogenous Ig loci. In a preferred embodiment, the transgenic animals are homozygous for mutated endogenous Ig heavy chain and/or endogenous Ig light chain genes.

Further, these animals carry at least one artificial Ig locus that is functional and capable of producing a repertoire of immunoglobulin molecules in the transgenic animal. The artificial Ig loci used in the description e at least one human V gene segment.

In a preferred embodiment, the transgenic animals carry at least one artificial Ig heavy chain locus and at least one artificial Ig light chain locus that are each onal and e of producing a repertoire of immunoglobulin les in the transgenic animal, which repertoire of immunoglobulin molecules includes antibodies having a human idiotype. In one embodiment, artificial loci including at least one non-human C gene are used, and animals capable of producing chimeric antibodies having a human idiotype and non-human constant region are bed. In one embodiment, artificial loci including at least one human C gene are used, and animals e of producing antibodies having a human idiotype and human constant region are described.

In another preferred ment, the transgenic animals carry at least one artificial Ig heavy chain locus, and lack a functional Ig light chain locus. Such animals find use in the production of heavy chain–only antibodies.

Production of such transgenic animals involves the integration of one or more artificial heavy chain Ig loci and one or more artificial light chain Ig loci into the genome of a transgenic animal having at least one endogenous Ig locus that has been or will be inactivated by the action of one or more cleases. ably, the transgenic animals are nullizygous for endogenous Ig heavy chain and/or endogenous Ig light chain and, accordingly, incapable of producing endogenous immunoglobulins. Regardless of the chromosomal location, an artificial Ig locus of the present description has the capacity to undergo gene rearrangement and thereby produce a diversified repertoire of immunoglobulin molecules. An Ig locus having the capacity to undergo gene rearrangement is also referred to herein as a ional” Ig locus, and the antibodies with a ity generated by a functional Ig locus are also referred to herein as “functional” antibodies or a “functional” repertoire of antibodies.

The artificial loci used to generate such transgenic animals each include multiple immunoglobulin gene segments, which include at least one V region gene segment, one or more J gene segments, one or more D gene segments in the case of a heavy chain locus, and one or more constant region genes. In the present ption, at least one of the V gene segments encodes a germline or hypermutated human V-region amino acid sequence. Accordingly, such transgenic animals have the ty to produce a ified repertoire of immunoglobulin molecules, which include antibodies having a human pe.

In one ment, the artificial loci used comprise at least one man C region gene segment. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which e chimeric antibodies having a human idiotype.

In one embodiment, the artificial loci used comprise at least one human C region gene segment. Accordingly, such transgenic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype and a human constant region.

In one embodiment, the artificial loci used comprise at least one cial constant region gene. For example, an exemplary artificial C constant region gene is a constant region gene encoding a human IgG CH1 domain and rat IgG CH2 and CH3 domain. Accordingly, such enic animals have the capacity to produce a diversified repertoire of immunoglobulin molecules, which include antibodies having a human idiotype and an artificial constant region comprising both human and non-human components.

The transgenic vector containing an artificial Ig locus is introduced into the recipient cell or cells and then integrated into the genome of the recipient cell or cells by random integration or by targeted integration.

For random integration, a transgenic vector containing an artificial Ig locus can be introduced into a recipient cell by rd transgenic technology. For example, a transgenic vector can be directly injected into the pronucleus of a fertilized . A transgenic vector can also be introduced by co-incubation of sperm with the transgenic vector before fertilization of the oocyte. Transgenic animals can be developed from fertilized oocytes. Another way to introduce a transgenic vector is by transfecting embryonic stem cells or other pluripotent cells (for example dial germ cells) and subsequently injecting the genetically modified cells into developing embryos. Alternatively, a transgenic vector (naked or in combination with facilitating reagents) can be directly injected into a developing embryo. Ultimately, chimeric transgenic animals are produced from the s which contain the artificial Ig transgene ated in the genome of at least some somatic cells of the transgenic animal. In another embodiment, the transgenic vector is introduced into the genome of a cell and an animal is derived from the transfected cell by nuclear er cloning.

In a preferred embodiment, a ene ning an cial Ig locus is randomly integrated into the genome of recipient cells (such as fertilized oocyte or developing embryos).

In a preferred embodiment, offspring that are nullizygous for endogenous Ig heavy chain and/or Ig light chain and, accordingly, ble of producing endogenous immunoglobulins and capable of producing transgenic immunoglobulins are obtained.

For targeted integration, a transgenic vector can be uced into appropriate recipient cells such as embryonic stem cells, other pluripotent cells or already differentiated somatic cells. Afterwards, cells in which the transgene has integrated into the animal genome can be selected by standard methods. The selected cells may then be fused with enucleated nuclear transfer unit cells, e.g. oocytes or embryonic stem cells, cells which are totipotent and capable of forming a functional neonate. Fusion is performed in accordance with conventional techniques which are well established. See, for example, Cibelli et al., Science (1998) 280:1256; Zhou et al. Science (2003) 301: 1179. Enucleation of oocytes and nuclear transfer can also be performed by urgery using injection pipettes. (See, for example, Wakayama et al., Nature (1998) 394:369.) The resulting cells are then cultivated in an appropriate medium, and transferred into synchronized recipients for generating transgenic animals. Alternatively, the selected genetically ed cells can be injected into developing embryos which are subsequently developed into chimeric animals.

In one embodiment, a clease is used to se the ncy of homologous recombination at a target site through double-strand DNA cleavage. For ation into a specific site, a site specific meganuclease may be used. In one embodiment, a meganuclease targeting an endogenous Ig locus is used to increase the frequency of gous ination and replacement of an nous Ig locus, or parts thereof with an artificial Ig locus, or parts thereof. In one embodiment, the transgenic animal lacks a functional Ig light chain locus and comprises an artificial Ig heavy chain locus.

Immunoglobulins having a human idiotype Once a transgenic animal e of producing immunoglobulins having a human idiotype is made, immunoglobulins and dy preparations against an antigen can be readily obtained by immunizing the animal with the antigen. “Polyclonal antisera composition” as used herein includes affinity purified polyclonal antibody preparations.

A variety of antigens can be used to immunize a transgenic animal. Such antigens e but are not limited to, microorganisms, e.g. viruses and unicellular organisms (such as bacteria and , alive, attenuated or dead, fragments of the microorganisms, or antigenic les isolated from the microorganisms.

Preferred bacterial antigens for use in immunizing an animal include ed antigens from Staphylococcus aureus such as capsular ccharides type 5 and 8, recombinant versions of virulence factors such as alpha-toxin, adhesin binding proteins, collagen binding proteins, and fibronectin binding proteins. Preferred bacterial antigens also include an attenuated version of S. aureus, Pseudomonas aeruginosa, enterococcus, enterobacter, and Klebsiella pneumoniae, or culture supernatant from these bacteria cells. Other bacterial antigens which can be used in immunization include purified lipopolysaccharide (LPS), capsular antigens, capsular polysaccharides and/or recombinant versions of the outer membrane ns, fibronectin binding proteins, endotoxin, and exotoxin from Pseudomonas nosa, enterococcus, enterobacter, and Klebsiella pneumoniae.

Preferred antigens for the generation of antibodies against fungi include attenuated version of fungi or outer membrane proteins thereof, which fungi include, but are not limited to, Candida albicans, a parapsilosis, Candida tropicalis, and Cryptococcus neoformans.

Preferred antigens for use in zation in order to generate dies against s include the envelop proteins and attenuated versions of viruses which include, but are not d to respiratory synctial virus (RSV) (particularly the F-Protein), Hepatitis C virus (HCV), Hepatits B virus (HBV), cytomegalovirus (CMV), EBV, and HSV.

Antibodies specific for cancer can be generated by immunizing transgenic animals with isolated tumor cells or tumor cell lines as well as tumor-associated antigens which include, but are not limited to, Herneu antigen (antibodies against which are useful for the treatment of breast cancer); CD20, CD22 and CD53 antigens (antibodies against which are useful for the treatment of B cell lymphomas), te specific membrane antigen (PMSA) (antibodies t which are useful for the treatment of prostate cancer), and 17-1A le (antibodies against which are useful for the treatment of colon cancer).

The antigens can be administered to a enic animal in any convenient manner, with or without an adjuvant, and can be administered in accordance with a predetermined schedule.

For making a onal antibody, spleen cells are isolated from the immunized enic animal and used either in cell fusion with transformed cell lines for the production of hybridomas, or cDNAs encoding antibodies are cloned by standard molecular biology techniques and expressed in transfected cells. The procedures for making monoclonal antibodies are well established in the art. See, e.g., European Patent Application 0 583 980 A1 (“Method For Generating Monoclonal Antibodies From Rabbits”), U.S. Patent No. 081 (“Stable - Mouse omas And Secretion ts Thereof”), WO 97/16537 (“Stable Chicken B-cell Line And Method of Use Thereof”), and EP 0 491 057 B1 (“Hybridoma Which Produces Avian Specific Immunoglobulin G”), the disclosures of which are incorporated herein by reference. In vitro production of monoclonal antibodies from cloned cDNA molecules has been described by Andris-Widhopf et al., “Methods for the generation of chicken onal antibody fragments by phage display”, J Immunol Methods 242:159 , and by Burton, D. R., “Phage display”, Immunotechnology 1:87 (1995).

Once chimeric monoclonal antibodies with human idiotypes have been generated, such chimeric dies can be easily converted into fully human antibodies using standard molecular y techniques. Fully human monoclonal antibodies are not immunogenic in humans and are riate for use in the therapeutic treatment of human subjects.

Antibodies of the description include heavy chain-only dies In one embodiment, transgenic animals which lack a functional Ig light chain locus, and comprising an artificial heavy chain locus, are immunized with antigen to produce heavy chain-only antibodies that specifically bind to antigen.

In one embodiment, the described are monoclonal antibody producing cells derived from such animals, as well as nucleic acids derived therefrom. Also described are hybridomas derived therefrom. Also described are are fully human heavy only antibodies, as well as encoding c acids, derived therefrom.

Teachings on heavy chain-only antibodies are found in the art. For example, see PCT publications WO02085944, WO02085945, WO2006008548, and WO2007096779. See also US ,840,526; US 5,874,541; US 6,005,079; US 6,765,087; US 5,800,988; EP 1589107; WO 9734103; and US 6,015,695. ceutical Compositions In a further embodiment of the present description, purified monoclonal or polyclonal antibodies are d with an appropriate pharmaceutical carrier suitable for administration to patients, to provide pharmaceutical compositions.

Patients treated with the pharmaceutical compositions of the description are preferably mammals, more preferably humans, though veterinary uses are also contemplated.

Pharmaceutically able carriers which can be ed in the present pharmaceutical compositions can be any and all solvents, sion media, ic agents and the like. Except r as any conventional media, agent, t or r is detrimental to the recipient or to the therapeutic effectiveness of the antibodies contained therein, its use in the pharmaceutical compositions of the present description is appropriate.

The carrier can be liquid, semi-solid, e.g. pastes, or solid carriers. Examples of carriers include oils, water, saline solutions, l, sugar, gel, lipids, liposomes, resins, porous matrices, binders, fillers, coatings, preservatives and the like, or ations thereof.

Methods of Treatment In a further ment of the present description, methods are described for treating a disease in a vertebrate, preferably a mammal, ably a primate, with human subjects being an especially preferred embodiment, by administering a purified antibody composition of the description desirable for treating such disease.

The antibody compositions can be used to bind and neutralize or modulate an antigenic entity in human body tissues that causes or contributes to disease or that elicits red or abnormal immune responses. An "antigenic entity" is herein defined to encompass any soluble or cell surface bound molecules including proteins, as well as cells or ious disease-causing organisms or agents that are at least capable of binding to an antibody and preferably are also capable of stimulating an immune response.

Administration of an antibody composition against an infectious agent as a monotherapy or in combination with chemotherapy results in elimination of infectious particles.

A single administration of antibodies decreases the number of infectious particles generally 10 to 100 fold, more commonly more than 1000-fold. Similarly, antibody therapy in patients with a malignant disease employed as a monotherapy or in combination with chemotherapy reduces the number of malignant cells generally 10 to 100 fold, or more than 1000-fold. Therapy may be ed over an extended amount of time to assure the complete elimination of infectious particles, malignant cells, etc. In some instances, y with antibody preparations will be continued for extended periods of time in the absence of detectable amounts of infectious particles or undesirable cells.

Similarly, the use of antibody y for the modulation of immune responses may consist of single or multiple administrations of therapeutic antibodies. y may be continued for extended periods of time in the absence of any disease symptoms.

The subject ent may be employed in conjunction with chemotherapy at dosages sufficient to inhibit infectious disease or malignancies. In autoimmune disease ts or transplant ents, antibody therapy may be employed in conjunction with immunosuppressive therapy at dosages sufficient to inhibit immune reactions.

EXAMPLES In mice transgenic for human immunoglobulin (Ig) loci, suboptimal efficacy in delivery of fully human antibodies has been attributed to ect interaction between the constant regions of human membrane IgH chains and the mouse cellular signaling machinery. To obviate this problem, we here describe a humanized rat strain (OmniRatTM) carrying a ic human/rat IgH locus [comprising 22 human VHs, all human D and JH segments in natural uration but linked to the rat CH locus] together with fully human light-chain loci [12 V?s linked to J?-C? and 16 V?s linked to J?-C?]. The endogenous rat Ig loci were silenced by er zinc finger nucleases. Following immunization, OmniRats perform as efficiently as normal rats in yielding high ty serum IgG. Monoclonal dies, comprising fully human variable regions with sub-nanomolar antigen affinity and carrying extensive somatic mutations, are readily obtainable – similarly to the yield of conventional antibodies from normal rats.

MATERIALS AND METHODS Construction of modified human Ig loci on YACs and BACs a) IgH loci The human IgH V genes were covered by 2 BACs: BAC6-VH3-11 containing the authentic region spanning from VH4-39 to VH3-23 followed by VH3-11 (modified from a commercially available BAC clone 3054M17 CITB) and BAC3 containing the authentic region spanning from VH3-11 to VH6-1 6 RPCI-11). A BAC termed Annabel was constructed by joining rat CH region genes immediately downstream of the human VH6Ds-JHs region (Figure 1). All BAC clones containing part of the human or rat IgH locus were purchased from ogen.

Both BAC6-VH3-11 and Annabel were initially constructed in S. cerevisiae as circular YACs (cYACs) and further d and maintained in E. coli as BACs. Construction s can be found at www.ratltd.net.

Unlike YACs, BAC plasmid preps yield large quantities of the desired DNA. To convert a linear YAC into a cYAC or to le DNA fragments with overlapping ends into a single cYAC in S. cerevisiae, which can also be maintained as a BAC in E. coli, two selfreplicating S. siae/E. coli shuttle vectors, pBelo-CEN-URA, and CEN-HYG were constructed. Briefly, S. cerevisiae CEN4 was cut out as an AvrII fragment from pYAC-RC39 and ligated to SpeI – linearised pAP59940. The resulting d contains CEN4 cloned in between S. cerevisiae URA3 and a hygromycin-resistance expression cassette (HygR). From this plasmid, an ApaLI–BamHI fragment containing URA3 followed by CEN4 or a PmlI–SphI fragment containing CEN4 followed by HygR was cut out, and ligated to ApaLI and BamHI or HpaI and SphI doubly digested pBACBelo11 (New England Biolabs) to yield pBelo-CEN-URA and pBelo-CEN-HYG.

To construct H3-11, initially two fragments, a 115 kb NotI-PmeI and a 110 kb RsrII-SgrAI, were cut out from the BAC clone 3054M17 CITB. The 3’ end of the former fragment overlaps 22 kb with the 5’ end of the latter. The NotI-PmeI fragment was ligated to a amHI YAC arm containing S. cerevisiae CEN4 as well as TRP1/ARS1 from pYAC-RC, and the RsrII-SgrAI fragment was ligated to a BamHI YAC arm containing S. cerevisiae URA3, also from pYAC-RC. Subsequently, the ligation mixture was transformed into S. cerevisiae AB1380 cells via spheroplast transformation41, and URA+TRP+ yeast clones were selected. Clones, termed YAC6, containing the linear region from human VH4-39 to VH3-23 were confirmed by Southern blot analysis. YAC6 was further extended by addition of a 10.6 kb fragment 3’ of VH3-23, and conversion to a cYAC. The 10.6 kb extension contains the human VH3-11 and also occurs at the 5’ end of BAC3. We constructed pBeloHYG-YAC6+BAC3(5’) for the modification of YAC6. Briefly, 3 fragments with overlapping ends were prepared by PCR: 1) a ‘stuff’ fragment ning S. cerevisiae TRP1-ARS1 flanked by HpaI sites with 5’ tail matching the sequence upstream of VH4-39 and 3’ tail matching downstream of VH3-23 in YAC6 (using long oligoes 561 and 562, and pYAC-RC as template), 2) the 10.6 kb extension fragment with a 5’ tail ng the sequence ream of VH3-23 as described above and a unique AscI site at its 3’ end (using long oligoes 570 and 412, and human genomic DNA as te), and 3) pBelo-CEN-HYG vector with the CEN4 joined downstream with a homology tail matching the 3’ end of the 10.6 extension fragment and the HygR joined am with a tail matching the sequence upstream of VH4-39 as described above (using long oligoes 414 and 566, and pBelo-CEN-HYG as template). uently, the 3 PCR nts were assembled into a small cYAC conferring HYGR and TRP+ in S. cerevisiae via homologous recombination associated with spheroplast transformation, and this cYAC was further converted into the BAC pBeloHYG-YAC6+BAC3(5’). Finally, the HpaI-digested pBeloHYG-YAC6+BAC3(5’) was used to transform yeast cells carrying YAC6, and through homologous recombination cYAC BAC6-VH3-11 conferring only HYGR was generated. Via transformation, see below, this cYAC was introduced as a BAC in E. coli. The human VH genes in BAC6-VH3-11 were cut out as a ~ 182 kb AsiSI ring naturally in the HygR) – AscI fragment, and the VH genes in BAC3 were cut out as a ~173 kb NotI- fragment (Figure 1 top).

] For the assembly of the C region with the VH overlap, the human VH6Ds-JHs region had to be joined with the rat genomic sequence immediately downstream of the last JH followed by rat Cs to yield a cYAC/BAC. To achieve this, 5 overlapping restriction as well as PCR fragments were prepared; a 6.1 kb fragment 5’ of human VH6-1 (using s 383 and 384, and human c DNA as template), an ~78 kb PvuI-PacI fragment containing the human VH6Ds-JHs region cut out from BAC1 (RP11645E6), a 8.7 kb fragment joining the human JH6 with the rat genomic sequence immediately downstream of the last JH and containing part of rat µ coding sequence (using oligos 488 and 346, and rat genomic DNA as template), an ~ 52 kb NotI-PmeI fragment containing the authentic rat µ, d and ?2c region cut out from BAC M5 (CH230-408M5) and the pBelo-CEN-URA vector with the URA3 joined downstream with a homology tail matching the 3’ end of the rat ?2c region and the CEN4 joined upstream with a tail matching the 5’ region of human VH6-1 as bed (using long oligoes 385 and 550, and pBelo-CEN-URA as template). Correct assembly via gous recombination in S. cerevisiae was analysed by PCR and purified cYAC from the correct clones was converted into a BAC in E. coli.

For the ly of Annabel parts of the above AC ning humanVH6- 1-Ds-JHs followed by the authentic rat µ, d and ?2c region, as well as PCR fragments were used.

Five overlapping fragments contained the 6.1 kb fragment at the 5’ end of human VH6-1 as described above, an ~83 kb SpeI fragment comprising human VH6Ds-JHs immediately followed by the rat genomic sequence downstream of the last JH and containing part of rat Cµ, a .2 kb fragment joining the 3’ end of rat µ with the 5’ end of rat ?1 (using oligos 490 and 534, and rat genomic DNA as te), an ~118 kb NotI-SgrAI nt containing the authentic rat ?1, ?2b, e, a and 3’E IgH enhancer region cut out from BAC I8 (CH230-162I08), and the pBelo- CEN-URA vector with the URA3 joined downstream with a gy tail matching the 3’ end of rat 3’E and the CEN4 joined upstream with a tail matching the 5’ end of human VH6-1 as described above. There is a 10.3 kb p between the human VH6-1 regions in both the BAC3 and Annabel. The human VH6-1 -Ds - JHs followed by the rat CH region together with the S. cerevisiae URA3 in Annabel can be cut out as a single ~183 kb NotI-fragment (see Figure 1 top).

BAC6-VH3-11, BAC3 and Annabel were checked extensively by restriction analysis and partial sequencing for their authenticity. b) IgL loci The human Ig? locus on a ~410 kb YAC was obtained by recombination assembly of a V? YAC with 3 C? containing cosmids25. Rearrangement and expression was verified in transgenic mice derived from ES cells containing one copy of a te human Ig? YAC38.

This Ig? YAC was shortened by the generation of a circular YAC removing ~100kb of the region 5’ of V?3-27. The vector pYAC-RC was ed with ClaI and BspEI to remove URA3 and ligated with a ClaI/NgoMIV fragment from pAP 599 containing HYG. PCR of the region containing the yeast centromere and hygromycin marker gene from the new vector RCHYG ) was carried out with primers with 5’ ends gous to a region 5’ of V?3-27 (primer 276) and within the ADE2 marker gene in the YAC arm (primer 275). The PCR fragment (3.8 kb) was integrated into the Ig? YAC using a high efficiency lithium acetate transformation method42 and selection on hygromycin containing YPD plates. DNA was prepared from the clones (Epicentre MasterPure Yeast DNA purification kit) and analysed for the correct junctions by PCR using the following oligos: 243 + 278 and Hyg end R + 238. Plugs were made43 and yeast chromosomes removed by PFGE (0.8% agarose (PFC) (Biorad) gel [6V/cm, pulse times of 60s for 10hr and 10s for 10hr, 8°C) leaving the circular yeast artificial chromosome caught in the agarose 4. The blocks were d and digested with NruI. Briefly, blocks were preincubated with restriction enzyme buffer in excess at a 1X final concentration for 1 hr on ice.

Excess buffer was removed leaving just enough to cover the plugs, restriction enzyme was added to a final concentration of 100U/ml and the tube incubated at 37°C for . The linearized YAC was ran out of the blocks by PFGE, cut out from the gel as a strip and purified as described below.

For the human Ig? locus 3 BACs were chosen (RP11-344F17, RP11-1134E24 and 56D9, Invitrogen), which covered a region over 300 kb from 5’ V?1-17 to 3’ KDE45. In digests and sequence es three pping fragments were identified: from V?1-17 to V?3- 7 (150 kb NotI with ~14 kb overlap), from V?3-7 to 3’ of C? (158 kb NotI with ~40 kb overlap) and from C? to 3’ of the KDE (55 kb PacI with 40 kb overlap). Overlapping regions may generally favour joint integration when ected into oocytes24.

Gel analyses and DNA purification Purified YAC and BAC DNA was analysed by restriction digest and separation on conventional 0.7% agarose gels46. Larger fragments, 50-200 kb, were separated by PFGE (Biorad Chef MapperTM) at 80C, using 0.8% PFC Agaraose in 0.5% TBE, at 2-20 sec switch time for 16 h, 6V/cm, 10mA. Purification allowed a direct comparison of the resulting fragments with the predicted size obtained from the sequence analysis. tions were analysed by PCR and sequencing.

Linear YACs, circular YACs and BAC fragments after digests, were ed by electro-elution using ElutrapTM (Schleicher and Schuell)47 from strips cut from 0.8% agarose gels run tionally or from pulsed-field-gel electrophoresis (PFGE). The DNA concentration was usually several ng/µl in a volume of ~100µl. For fragments up to ~200 kb the DNA was precipitated and re-dissolved in micro-injection buffer (10 mM Tris-HCl pH 7.5, 100 mM EDTA pH 8 and 100 mM NaCl but without Spermine/Spermidine) to the desired concentration.

The purification of circular YACs from yeast was carried out using Nucleobond AX silica-based anion-exchange resin (Macherey-Nagel, y). Briefly, spheroplasts were made using zymolyase or lyticase and pelleted20. The cells then underwent alkaline lysis, binding to AX100 column and elution as described in the Nucleobond method for a low-copy plasmid.

Contaminating yeast chromosomal DNA was hydolyzed using Plamid –Safe™ ATP-Dependent DNase (Epicentre Biotechnologies) followed by a final cleanup step using SureClean (Bioline).

An aliquot of DH10 electrocompetent cells rogen) was then transformed with the circular YAC to obtain BAC colonies. For microinjection, the insert DNA 00 kb), was separated from BAC vector DNA(~10 kb) using a filtration step with sepharose 4B-CL 48.

Derivation of rats and breeding Purified DNA encoding recombinant immunoglobulin loci was resuspended in microinjection buffer with 10 mM Spermine and 10 mM Spemidine. The DNA was injected into fertilized oocytes at various trations from 0.5 to 3 ng/µl.

Plasmid DNA or mRNA ng ZFNs specific for rat immunoglobulin genes were injected into fertilized s at various concentrations from 0.5 to 10 ng/ul.

Microinjections were performed at Caliper Life Sciences facility. Outbred SD/Hsd (WT) strain animals were housed in standard microisolator cages under ed animal care protocols in animal facility that is accredited by the Association for the Assessment and Accreditation for Laboratory Animal Care (AAALAC). The rats were maintained on a 14-10 h light/dark cycle with ad libitum access to food and water. Four to five week old SD/Hsd female rats were ed with 20-25 IU PMSG (Sigma-Aldrich) followed 48 hours later with 20-25 IU hCG (Sigma-Aldrich) before ng to outbred SD/Hsd males. Fertilized 1-cell stage embryos were collected for subsequent microinjection. lated embryos were transferred to pseudopregnant SD/Hsd female rats to be carried to parturition.

Multi-feature human Ig rats (human IgH, Ig? and Ig? in combination with rat J KO, ? KO and ? KO) and WT, as control, were ed at 10–18 weeks of age. The animals were bred at Charles River under specific pathogen-free conditions.

PCR and RT-PCR Transgenic rats were identified by PCR from tail or ear clip DNA using a Genomic DNA Mini Kid (Bioline). For IgH PCRs < 1kb GoTaq Green Master mix was used (Promega) under the following ions: 94°C 2 mins, 32 x (94°C 30 secs, 54-670C (see supplemental Table 1 for primers and specific annealing temperatures) 30 secs, 72°C 1 min), 72°C 2 mins. For IgH PCRs >1kb KOD polymerase (Novagen) was used under the following conditions: 95°C 2 mins, 32 x (95°C 20 secs, C ementary Table 1) 20 secs, 70°C 90 secs), 70°C 2 mins. For Ig? and Ig? PCR, all <1kb, the above condition were used except extension at 72oC for 50 secs.

RNA was extracted from Blood using the RiboPure Blood Kit (Ambion) and RNA extraction from spleen, bone marrow or lymph nodes used RNASpin mini kit. (GE Healthcare). cDNA was made using Oligo dT and Promega Reverse Transcriptase at 42°C for 1 hour.

GAPDH PCR reactions (oligos 429-430) determined the concentration.

RT-PCRs were set up using VH leader primers with rat µCH2 or rat ?CH2 primers (supplementary Table 1). ication with GoTaq Green Master mix were 94°C 2 mins, 34 x (94°C 30 secs, 55-65oC 30 secs, 72°C 50-60 secs), 72°C 2 mins. PCR products of the expected size were either purified by gel or QuickClean (Bioline) and sequenced directly or cloned into pGemT (Promega).

Protein purification IgM was purified on anti-IgM affinity matrix (BAC B.V., Netherlands, CaptureSelect #2890.05) as described in the protocol. Similarly, human Ig? and Ig? was purified on anti-L chain affinity matrix (CaptureSelect anti-Ig? #0833 and g? # 0849) according to the protocol.

For rat IgG cation29 protein A and protein G e was used (Innova, Cambridge, UK, #851-0024 and #895-0024). Serum was incubated with the resin and binding facilitated at 0.1 M sodium phosphate pH 7 for protein G and pH 8 for protein A under gentle mixing. Poly-prep columns (Bio-Rad) were packed with the mixture and washed extensively with PBS pH7.4. Elution buffer was 0.1 M Sodium Citrate pH 2.5 and neutralization buffer was 1 M Tris-HCl pH 9 ophoresis was performed on 4-15% SDS-PAGE and sie brilliant blue was used for staining. MW standards were HyperPage Prestained Protein Marker (#BIO-33066, Bioline).

Flow cytometry analysis and FISH Cell suspensions were washed and adjusted to 5x105 cells/100 µl in PBS-1% BSA- 0.1% Azide. Different B-cell subsets were fied using mouse anti-rat IgM abelled mAb (MARM 4, Jackson Immunoresearch Laboratories) in combination with anti-B cell CD45R (rat PE-conjugated mAb (His 24, BD biosciences) or anti-IgD-PE-conjugated mAb (MARD-3, Abd Serotec). A FACS CantoII flow cytometer and FlowJo software (Becton Dickinson, Pont de Claix, France) was used for the analysis.

Fluorescence in situ hybridisation was carried out on fixed blood lymphocytes using purified IgH and IgL C-region BACs as described.49 Immunization, cell fusion and affinity measurement Immunizations were performed with 125 µg PG in CFA, 150 µg hGHR in CFA, 200 µg Tau/KLH in CFA, 150 µg HEL in CFA, 150 µg OVA in CFA at the base of the tail and medial iliac lymph node cells were fused with mouse P3X63Ag8.653 myeloma cells 22 days later as described50. For le immunizations protein, 125 µg PG or HEL, or 100 µg hGHR or CD14 in GERBU adjuvant (www.Gerbu.com), was administered intraperitoneally as follows: day 0, day 14, day 28 and day 41 without adjuvant, ed by spleen cell fusion with P3x63Ag8.653 cells 4 days later.49 Binding kinetics were analyzed by surface n resonance using a Biacore 2000 with the antigens directly immobilized as described23.

Supplementary Table 1 PCR* and RT-PCR** conditions to detect human IgH and IgL integration and expression IgH Primers Annealing Temp (Tm-5) Fragment size Hyg (5’ BAC6) Hyg 3’ F - 459 54°C ~400bp V4-34 (BAC6) 205-206 65°C ~1kb V4-28 (BAC6) 203-204 65°C ~1kb V3-11 (overlap BAC6- 448-461 60°C ~500bp BAC3) V1-8 (BAC3) 371-372 60°C ~300bp V4-4 (BAC3) 6 60°C ~750bp V6-1 (BAC3- 359-360 65°C ~350bp Annabel) JH (Annabel) 368-369 62°C ~250bp µ-?1 (Annabel) 583-535 62°C ~3kb Ura (3’ Annabel) 241-253 56°C ~3kb Ig? Primers Annealing Temp (Tm-5) Fragment size KDE 313-314 66°C ~600bp cKappa 307-308 64°C ~600bp V4-1 333-334 60°C ~300bp V1-5 329-330 64°C ~400bp V1-6 331-332 60°C ~300bp V3-7 0 66°C ~700bp V3-15 311-312 66°C ~500bp Ig? Primers Annealing Temp (Tm-5) nt size V3-27 215-216 67°C ~400bp V3-19 213-214 67°C ~700bp V2-14 211-212 67°C ~400bp V middle 9 65°C ~500bp JLambda 162-163 67°C ~800bp cLambda 170-171 67°C ~500bp Enhancer 172-173 67°C ~400bp *For DNA extraction from ear and tail clips the Genomic DNA Mini Kit (Bioline) was used.

For PCRs 1kb or less in size GoTaq Green Master mix (Promega) was used under the following conditions: 94°C 2 mins, 32 x (94°C 30 secs, Tm-5 (below) 30 secs, 72°C 1 min [50 sec for Ig?/?]), 72°C 2 mins. Annealing temperatures were set at the lowest primer Tm– 50C (www.sigmagenosys.com/calc/DNACalc.asp). For PCRs >1kb KOD polymerase (Novagen) was used under the following ions: 95°C 2 mins, 32 x (95°C 20 secs, Tm-5 20 secs, 70°C 90 secs), 70°C 2mins.

IgH Primer ing Temp (Tm-5) Fragment size VH1 Leader 390 65°C VH2 Leader 391 65°C VH3 Leader 392 65°C VH4 Leader 393 60°C VH6 Leader 394 65°C VH4-39 Leader 761 55°C Rat µCH2 345 ~1kb Rat ?CH2 682 ~800bp Ig Primer Annealing Temp (Tm-5) Fragment size HuVK1 Leader 400/474 63°C HuVK3 Leader 401/475 63°C HuVK4 Leader 476 63°C HuVK5 Leader 477 63°C Hu ? C region 402 ~600bp Ig Primer Annealing Temp (Tm-5) Fragment size HuVL2 Leader 388/478 58°C HuVL3 Leader 398/479/480/482/483/481/484 58°C HuVL4 Leader 485 58°C Hu ??C region 387 ~600bp **RNA was extracted from Blood using the RiboPure Blood Kit (Ambion). RNA extracted from spleen, bone marrow or lymph nodes used the RNASpin mini kit (GE Healthcare). cDNA was made using Oligo dT and Promega Reverse Transcriptase at 42°C 1 hour. PCRs using the GoTaq Green Master mix were set up as s: 94°C 2 mins, 34 x (94°C 30 secs, Tm-5 30 secs, 72°C 1 min [50 sec for Ig?/?]), 72°C 2 mins.

Primers Number Oligonucleotide sequence 5'-3' 162 GGGGCCAAGGCCCCGAGAGATCTCAGG 163 CACTGGGTTCAGGGTTCTTTCCACC 168 GTGGTACAGAAGTTAGAGGGGATGTTGTTCC 169 ACAAGCCCTTCTAAGAACACCTGG 170 AGCACAATGCTGAGGATGTTGCTCC 171 ACTGACCCTGATCCTGACCCTACTGC 172 AAACACCCCTCTTCTCCCACCAGC 173 CGCTCATGGTGAACCAGTGCTCTG 203 GCTATTTAAGACCCACTCCCTGGCA 204 AAAACCTGCAGCAAGGATGTGAGG 205 GCTCCTTCAGCACATTTCCTACCTGGA 206 ATGGCAAAATGAGTCATGCAGG 211 CTCTGCTGCTCCTCACCCTCCTCACTCAGG 212 GAGAGTGCTGCTGCTTGTATATGAGCTGCA 213 TGGCTCACTCTCCTCACTCTTTGCATAGGTT 214 TACCACTGCTGTCCCGGGAGTTAC 215 ATCCCTCTCCTGCTCCCCCTCCTCATTCTCTG 216 TGATGGTCAAGGTGACTGTGGTCCCTGAGCTG 238 AACAAGTGCGTGGAGCAG 241 GTACTGTTGACATTGCGAAGAGC 243 TGGTTGACATGCTGGCTAGTC 253 TGTCTGGCTGGAATACACTC 275 AAATGAGCTTCAAATTGAGAAGTGACGCAAGCATCAATGGTATAATGTCC Number Oligonucleotide sequence 5'-3' AGAGTTGTGAGGCCTTGGGGACTGTGTGCCGAACATGCTC 276 CCAGCACTGTTCAATCACAGTATGATGAGCCTAATGGGAATCCCACTAGG CTAGTCTAGTCACCACATTAAAGCACGTGGCCTCTTATCG 278 TGACCATTGCTTCCAAGTCC 307 GAGGAAAGAGAGAAACCACAGGTGC 308 CACCCAAGGGCAGAACTTTGTTACT 309 TGTCCAGGTATGTTGAAGAATGTCCTCC 310 TGGACTCTGTTCAACTGAGGCACCAG 311 GGCCTTCATGCTGTGTGCAGACTA 312 GCACTGATTCAAGAAGTGAGT 313 TTCAGGCAGGCTCTTACCAGGACTCA 314 TGCTCTGACCTCTGAGGACCTGTCTGTA 329 GACTGTGATCCCTAGAA 330 TATGCCAACTGAACAGC 331 CGTAGCAGTCCCCATCTGTAATC 332 ATGTCAGAGGAGCAGGAGAGAGA 333 CACGCCTCACATCCAATATGTTA 334 ATACCCTCCTGACATCTGGTGAA 345 GCTTTCAGTGATGGTCAGTGTGCTTATGAC 346 TGGAAGACCAGGAGATATTCAGGGTGTC 359 TTGCTTAACTCCACACCTGCTCCTG 360 TGCTTGGAACTGGATCAGGCAGTC 368 CACCCTGGTCACCGTCTCC 369 AGACAGTGACCAGGGTGCCAC 371 TGAGGAACGGATCCTGGTTCAGTC 372 ATCTCCTCAGCCCAGCACAGC 383 CCTCCCATGATTCCAACACTG 384 CTCACCGTCCACCACTGCTG 385 CTGTGCCACAAACATGCAAAGATAAGTTCCATGTGACAAGTCTGAACTCA GTGTTGGAATCATGGGAGGCGGCCGCGTTATCTATGCTGTCTCACCATAG 387 TGCTCAGGCGTCAGGCTCAG 388 TGCTCAGGCGTCAGGCTCAG 390 ATGGACTGGACCTGGAGGATCC 391 TCCACGCTCCTGCTGCTGAC 392 ATGGAGTTTGGGCTGAGCTGG 393 TGAAACACCTGTGGTTCTTCC 394 TCATCTTCCTGCCCGTGCTGG 396 ACTCTTGAGGGACG 398 ATGTGGCCACAGGCTAGCTC 400 ATGAGGGTCCCCGCTCAG 401 ATGGAAGCCCCAGCTCAGC 402 CCTGGGAGTTACCCGATTGG 412 GGCGCGCCAAGCATCATGTCCTACCTGGCTG 414 CAAAGTACGTGGCACCTCCCTCGTCTTTCTTCCTCCTGCTCCAGCCAGGTA GGACATGATGCTTGGCGCGCCGTTATCTATGCTGTCTCACCATAG Number Oligonucleotide sequence 5'-3' 429 CAGTGCCAGCCTCGTCTCAT 430 AGGGGCCATCCACAGTCTTC 448 TGTGTGTTCTTGGGATAC 459 GTGTAATGCTTTGGACGGTGTGTTAGTCTC 461 GCATAGCGGCGCGCCAAGCATCATGTCCTACCTGGCTG 474 GACATGAGAGTCCTCGCTCAGC 475 AAGCCCCAGCGCAGCTTC 476 ATGGTGTTGCAGACCCAGGTC 477 GTCCCAGGTTCACCTCCTCAG 478 TCCTCASYCTCCTCACTCAGG 479 CGTCCTTGCTTACTGCACAG 480 AGCCTCCTTGCTCACTTTACAG 481 CCTCCTCAYTYTCTGCACAG 482 GCTCACTCTCCTCACTCTTTGC 483 CCTCCTCTCTCACTGCACAG 484 GCCACACTCCTGCTCCCACT 485 ATGGCCTGGGTCTCCTTCTAC 488 ATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTC ACCGTCTCCTCAGGAAGAATGGCCTCTCCAGGTC 490 CTGTCGTTGAGATGAACCCCAATGTGAG 534 GGAACTGATGTGATCTCAGTCACACAGCTAATGCAAAGGTCAGCAGGCT GTTTACTGCCTGGAGGTTCATCGCCCAATTCCAAAGTCAC 535 CTAGTCTGCATGGGTCTCCGCAAAC 550 CTGGTATAATCATAAGTCTCCACTTAATAGTTCTGTAGACAGAATCTTCAT TTAGACTTACAGACCGCGGCCGCACCGCAGGGTAATAACTG 561 GCAACCCTTCTTGCCACTCATGTCCCAGCTCTCACCATGTGACATAGCCTG TTAACAATTCGGTCGAAAAAAGAAAAGGAGAG 562 AATGTTCTTAGTATATATAAACAAGCTACTCCCAATTCATAGTCAACTAA GTTAACATTCCACATGTTAAAATAGTGAAGGAG 566 TTAACAGGCTATGTCACATGGTGAGAGCTGGGACATGAGTGGCAAGAAG GGTTGCCAGACTCCCCCTTTACCTCTATATCGTGTTC 570 CTTAGTTGACTATGAATTGGGAGTAGCTTGTTTATATATACTAAGAACATT TGTCAGAAGCTCTTTCTTGTTTATTCCCAGTTTGC 583 CATGTCCGTATGTTGCATCTGC 682 GGGAAGATGAAGACAGATG 761 TGGAGTGGATTGGGAGT RESULTS The human IgH and IgL loci uction of the human Ig loci employed established technologies to le large DNA segments using YACs and BACs16, 19, 24-26. As multiple BAC modifications in E. coli frequently deleted repetitive regions such as switch ces and enhancers, a method was developed to assemble sequences with pping ends in S. cerevisiae as circular YAC (cYAC) and, subsequently, converting such a cYAC into a BAC. Advantages of YACs include their large size, the ease of homologous alterations in the yeast host and the sequence stability, while BACs propagated in E. coli offer the ages of easy preparation and large yield.

Additionally, detailed restriction mapping and sequencing analysis can be better achieved in BACs than in YACs.

Sequence is and digests identified gene clusters of interest and ensured locus integrity and functionality to secure DNA rearrangement and switching over a wide region. The layout of the human IgH (human VH, D and JH segments followed by rat C genes), Ig? and Ig? loci are depicted in Fig. 1a-c. As shown usly, overlapping regions may generally favor joint integration when co-injected into oocytes24. Thereby, insertion of H3-11, a 182 kb AsiSI-AscI fragment, with BAC3, a 173 kb NotI fragment, and N12M5I8 (Hu-Rat Annabel), a 193 kb NotI fragment, led to the reconstitution of a fully functional transgenic IgH loci in the rat genome. Similarly, the human Ig? locus was integrated by homologous overlaps.

The human Ig? locus was isolated intact as a ~300 kb YAC and also fully ed into a rat chromosome. The integration success was identified by ript is which showed V(D)J-C recombinations from the most 5’ to the most 3’ end of the locus injected. Multiple copies were identified by qPCR (not shown) and it is likely that head to tail integrations occurred. In all cases, transgenic animals with -site integrations were generated by breeding.

Breeding to homozygosity The derivation of transgenic rats by DNA njection into oocytes, their breeding and immunization is comparable to the mouse. However, ZFN technology to obtain gene knockouts has only been reported recently11, 13. Silencing of the rat IgH locus by JH deletion using ZFN KO technology has been described12 and a manuscript describing silencing of the rat IgL loci, targeting of C? and deletion of J-C? genes, is in preparation. We derived multiple founders with integrated human Ig loci and silenced endogenous Ig production; all analyzed by PCR and FISH with complete trans-locus integration selected and interbred (Table 2). Several founder rats d low translocus copy numbers; with the rat C-gene BAC in OmniRat likely to be fully integrated in 5 copies as determined by qPCR of Cµ and Ca products (not shown). Identification by FISH of single position insertion in many lines confirmed that spreading or le integration of BAC mixtures were rare; an advantage for breeding to homozygosity, which was achieved.

Table 2: Generated rat lines: transgenic integration, knock-out and gene usage human human ZFN human VH rat CH FISH Igk Igl KO BAC6- BAC3 (Annabel) BACs Igl YAC rat rat line VH3-11 JH KO Ig? KO Ig? KO 173 kb 193 kb 300 kb 300 kb some 182 kb HC14 v v v 5q22 homozygous OmniRat v v v v v v v v LC#79 v 17 LC#6.2 v 6q23 #117 v 6q32 #23 v 4 #35 v 11 Rats ng the individual human transloci - IgH, Ig? and Ig? - were crossbred successfully to homozygosity with Ig locus KO rats. This produced a highly efficient new multifeature line (OmniRats™) with human VH-D-JH regions of over 400 kb containing 22 functional VHs and a rat C region of ~116 kb. DNA rearrangement, expression levels, class-switching and hypermutation was very similar between the different founders and comparable to wt rats. This is probably the result of the associated rat constant region accommodating several Cs and with the 3’E (enhancer control) region in authentic configuration.

B-cell development in the knock-out background To assess whether the uced human Ig loci were capable of reconstituting normal B-cell development flow cytometric analyses were performed. ular differentiation stages were analyzed in spleen and bone marrow cytes (Fig. 2), which previously showed a lack of B-cell development in JKO/JKO rats12, and no corresponding IgL expression in ?KO/?KO as well as in ?KO/?KO animals (data not . Most striking was the complete recovery of B- cell development in ts compared to wt animals, with similar numbers of B220(CD45R)+ cytes in bone marrow and spleen. IgM expression in a large proportion of CD45R+ B- cells marked a fully reconstituted immune system. Size and shape tion of spleen cells was indistinguishable between OmniRats and wt animals and thus successfully restored in the transgenic rats expressing human idiotypes with rat C region. Moreover, the small sIgG+ lymphocyte population was present in ts (Fig. 2 right).

The is of other t lymphocyte tissues showed that they were indistinguishable from wt controls and, for example, T-cell subsets were fully retained (data not shown), which further supports the notion that optimal immune function has been completely restored.

Diverse human H- and L-chain transcripts Extensive transcriptional analysis was carried out using blood lymphocytes or spleen cells from transgenic rats with functional endogenous Ig loci. RT-PCR from ic human VH group d to Cµ or C? reverse primers, showed human VHDJH usage. For L-chain analysis group specific human V? or V? forward primers were used with C? or C? reverse primers. The results (Table 3) showed the use of all integrated human VH genes regarded as functional27 in combination with diverse use of D segments and all JH segments.

EHHHHHHHHHHHHEHHH- .¢§¢¢g¢g¢?=ng 1,. § 9 $0 9 a: HHHIHHIHHHHHEHHEEEH ==—Egg—=5—_____===__===_EE— 4% a:< 52 _.

Anna a: Auga“Ewan—Em.Egg—Ea a:oSE The analysis of class-switch and hypermutation (Fig. 3) in the JKO/JKO background showed that these essential and highly ble mechanisms are fully operative in OmniRats.

Amplification of IgG switch products from PBLs revealed an extensive rate of mutation (>2 aa changes) in the majority of cells, ~80%, and in near equal s of ?1 and ?2b H-chains. A small percentage of trans-switch sequences, ?2a and 2c, were also identified (Fig. 3), which supports the observation that the ocus is similarly active, but providing human (VH-D-JH)s, as the endogenous IgH locus28. The number of d human Ig? and Ig? L-chain sequences is ~30% and thus considerably lower than IgG H-chains. The reason is the general amplification of L-chain from all producing cells rather than from IgG+ or differentiated plasma cells.

Ig levels in serum To gain unambiguous information about antibody production we compared quality and quantity of serum Ig from OmniRats and normal wt animals. Purification of IgM and IgG separated on GE under reducing conditions (Fig. 4) showed the ed size - ~75 kDa for µ, ~55 kDa for ? H-chains, and ~25 kDa for L-chains – which appeared indistinguishable between OmniRats and wt animals. The Ig yield from serum was determined to be n 100- 300 µg/ml for IgM and 1-3 mg/ml for IgG for both, several OmniRats and wt animals. However, as rat IgG purification on protein A or G is seen as suboptimal29, rat Ig levels may be under represented. Taken into consideration that these young (~3 months old) rats were housed in pathogen-free ties and had not been zed, this compares well with the IgM levels of 0.5-1 mg/ml and IgG levels of several mgs/ml reported for rats kept in open facilities30, 31.

Interestingly, we were able to visualize class-specific mobility of rat IgG isotypes on SDS-PAGE as trated for monoclonals29. In IgG separations (Fig. 4b) a distinct lower ?H-chain band is e in wt but not OmniRat Ig. This band has been attributed to ?2a H-chains, which are not present in the OmniRat (HC14) translocus. As the IgG levels are similar between OmniRats and wt animals we assume class-switching is rly efficient. The reason that the lack of C?2a in OmniRats is not limiting may be that several copies of the transgenic locus favorably increase the level of switch products. Purification of human Ig? and Ig? by capturing with anti-L-chain was also successful (Fig. 4c and d) and predicted H- and L-chain bands were of the expected size. Confirmation of the IgM/G titers was also ed by ELISA, which determined wt and OmniRat isotype distribution and identified comparable amounts of IgG1 and IgG2b (not shown).

A direct comparison of human Ig L-chain titers in solid phase titrations (Fig. 4e and f) revealed 5-10 fold lower levels in OmniRats than in human serum. However, this was ed as human l serum from mature adults can sometimes contain over 10-times higher Ig levels than in children up to their teens32, which would be similar to the human Ig? and Ig? titers in young rats. Interestingly, wt rats produce very little endogenous Ig? while transgenic rats can efficiently express both types of human L-chain, Ig? and Ig?.

Fully human antigen-specific IgG Several cell fusions were carried out, using either a rapid one-immunization scheme and ting lymph nodes or, alternatively, using r immunizations and spleen cells (Table 2). For example, a considerable number of stable hybridomas were obtained after one zation with human progranulin (PG) and a fusion 22 days later. Here cell growth was observed in ~3,520 and ~1,600 wells in SD control and t hybridoma clones, respectively. Anti-progranulin specific IgG, characterized by biosensor measurements, was produced by 148 OmniRat clones. Limiting dilution, to exclude mixed wells, and repeat affinity measurements revealed that OmniRat clones retain their antigen specificity. A comparison of association and dissociation rates of dies from SD and OmniRat clones showed similar affinities between 0.3 and 74 nM (Table 4 and data not . Single immunizations with human growth hormone receptor (hGHR), TAU receptor coupled to keyhole limpet hemocyanin (TAU/KLH), hen egg lysozyme (HEL) or ovalbumin (OVA), followed by lymph node fusions also produced many high affinity human dies often at r numbers compared to wt.

Furthermore, conventional booster immunizations with human PG, hGHR, human CD14 and HEL resulted in high affinities (pM range) of IgG with human idiotypes. OmniRats always showed the expected 4- to 5-log titer increase of antigen-specific serum IgG, similar to and as pronounced as wt rats (Table 4a). Although the results could vary from animal to animal, comparable numbers of hybridomas producing antigen-specific antibodies with similarly high ties were obtained from wt animals (SD and other strains) and OmniRats. A y of individual IgG producing lymph node and spleen cell fusion clones, showing their diverse human VH-D-JH, human V?-J? or V?-J?? characteristics and affinities are presented in Table 4b. The immunization and fusion results showed that affinities well below 1 nM (determined by biosensor analysis) were frequently obtained from OmniRats immunized with PG, CD14, Tau, HEL and OVA antigens. In summary, antigen-specific hybridomas from OmniRats could be as easily generated as from wt s yielding numerous mAbs with sub-nanomolar affinity even after a single immunization.

Table 4a Diverse antigen-specific rat IgG hybridomas with fully human idiotypesa Animal Antigen Cells* fusions titer hybrids IgGs** Kd*** SD PG LN 1 38400 3520 38 0 nM OmniRat PG LN 1 12800 1600 148 0.7-2.4 nM SD PG SP 1 51200 8000 29 ND OmniRat PG SP 1 51200 36000 24 ND OmniRat hGHR LN 3 4800 704-1024 18, 3, 2 ND SD hGHR SP 1 204800 53760 230 <0.07-0.4 nM OmniRat hGHR SP 1 76800 53760 7 0.16-2.4 nM OmniRat CD14 SP 2 102400 2800-3500 54, 14 <0.1-0.2 nM TAU/K SD LN 1 20000 1728 99# 0.6-2.4 nM TAU/K t LN 1 4800 1880 118# 0.5-3.2 nM SD HEL LN 1 12800 1564 26 0.02-0.1 nM OmniRat HEL LN 3 25600 288-640 0, 2, 7 0.6-1.5 nM SD HEL SP 1 6400 30720 0 ND SD OVA LN 1 9600 1488 10 1.1-4.8 nM 0, 30, OmniRat OVA LN 4 8000 512-2240 5 nM 0, 1 *cell s were 3-9 x 107 per fusion ** antigen specificity confirmed by biosensor analysis *** range of 5 highest affinities # 8 mAbs were specific for Tau-peptide Table 4b a OmniRats (HC14/Hu? and/or OJKO/KKOKKO) and control SD rats were immunized with human progranulin (PG), human growth hormone receptor , human CD14, Tau-peptide (TAU-KLH), hen egg lysozyme (HEL), min (OVA) or ß-galactosidase (ß-gal). *Lymph nodes (LN) or spleen cells (SP) were fused after single or le administration of antigen, respectively.

DISCUSSION A combination of human and rat genes to assemble a novel IgH locus has resulted in highly ent near normal expression of antibodies with human idiotypes. Moreover, integration of the human Ig? and Ig?? loci revealed that chimeric Ig with fully human specificity is readily produced and that association of rat C-regions with human L-chains is not detrimental.

Advantages of using part of the rat IgH locus are that species-specific C regions and enhancer control elements are kept in their natural configuration, with essentially only the diverse human VH D JH region being transplanted. Furthermore, expression of antibodies with rat Fc-regions allow normal B-cell receptor assembly and l activation of the downstream signaling pathway essential for the initiation of highly efficient immune responses. In particular, the quality of an immune response to antigen challenge relies on combined actions of many receptor associated signaling and modifier components (see: www.biocarta.com/pathfiles/h_bcrpathway.asp).

The approach of using YACs and BACs, and interchanging n the two, has the advantage of both, speed and the ability to check integrity when making constructs of large regions by overlapping homology. Several founder rats carried low ocus copy numbers; with the rat C-gene BAC in OmniRat likely to be fully integrated in 5 copies as determined by qPCR of Cµ and Ca products (not shown). Identification by FISH of single position insertion in many lines (see Table 1d) confirmed that spreading or multiple integration of BAC mixtures were rare; an advantage for breeding to homozygosity, which was achieved. Little was known whether extensive overlapping s would integrate, such as to maintain the full functionality, essential for DNA ngement. Previously, overlapping integration has been reported but for much smaller regions (<100 kb)24, 33 and our s suggest that desired integration by homology or in tandem is a frequent event. This eases the transgenic technology substantially as no laborious integration of large YACs into stem cells and subsequent animal derivation therefrom has to be performed18, 19. In addition, ZFN technology, also performed via DNA ion11, 12, produced Ig KO strains easily and may well be the future technology of choice for gene disruptions and replacement. ed endogenous Ig gene sion in OmniRats, containing human-rat IgH and human IgL loci, has the advantage that no interfering or undesired rat Ig could give rise to mixed products. stingly, immunization and hybridoma tion in OmniRats still producing wt Ig revealed that many products were fully human, human-rat IgH and human IgL, despite incomplete Ig KOs. Here, despite the extensive number of wt V genes, it was remarkable that the introduced human genes amplified readily and thus showed to be efficient expression competitors. This is in line with the observation of generally good sion levels of all our integrated transgenes, which favorably compete with the endogenous loci. Previously in mice expressing a human antibody repertoire, Ig KOs were essential as little expression of human products was found when wt Ig is released8, 18.

It is possible that the tion of fully human Ig loci even in Ig KO mice is suboptimal as strain specific ting ces are required for high-level expression. In the mouse an enhancer region downstream of Ca plays a vital role in class-switch recombination34 and it is likely that elements in that region may facilitate hypermutation23. This may be the reason why immune responses and tion of diverse hybridomas at high frequency may be difficult in mice carrying even a large fully human locus35, 36. As the chimeric human-rat IgH locus facilitates near wt differentiation and sion levels in OmniRats, it can be concluded that the endogenous rat C region and indeed the ~30 kb enhancer sequence 3’ of Ca are providing optimal locus control to express and mature human VH genes. Another region, Cd with its 3’ control motif cluster26, has been d from the chimeric C-region BAC since silencing or a lack of IgD did not appear to reduce immune function37 and refs n. Normally, mature IgM+IgD+ s down-regulate IgD upon n contact, which tes class-switch recombination37. Thus, switching may be increased without IgD control, which is supported by our finding that IgG transcripts and serum levels are significantly lower when the Cd region is retained in transgenic constructs (data not shown).

The production of specific IgG in OmniRats is ularly encouraging as we found that in various immunizations mAbs with diversity in sequence and epitope, comparable to what was produced in wt controls, could be isolated via spleen and lymph node fusion. V-gene, D and J diversity was as expected and nearly all segments were found to be used productively as predicted27. This was in stark contrast to mice ng fully human transloci where clonal expansion from a few sor B-cells produced little diversity23. Since the number of transplanted V-genes is only about half of what is used in humans we anticipated to find restricted immune responses and limited diversity when comparing OmniRats with wt s.

However, this was not the case and a comparison of CDR3 diversity in over 1000 clones nces can be provided) revealed the same extensive junctional differences in OmniRats as in wt animals. The few identical gene-segment combinations were further diversified by N- sequence additions or deletion at the VH to D and/or D to JH junctions and also by hypermutation. Thus, it is clear that the rat C region sequence is highly efficient in controlling DNA rearrangement and expression of human VHDJH. Extensive diversity was also seen for the introduced human Ig? and Ig? loci, similar to what has previously been shown in mice22, 23, 38.

Hence, substantially reduced efficiency in the production of human antibodies from mice7 has been overcome in OmniRats, which ify rearranged H-chains reliably and extensively by class-switch and hypermutation to yield high affinity antibodies in bulk rather than occasionally.

The yield of transgenic IgG and the level of hypermutation, impressively utilized in antigenspecific mAbs, showed that clonal diversification and production level are similar between OmniRats and wt animals. Routine generation of high affinity specificities in the subnanomolar range was even accomplished by ent single immunizations and again compares favorably with wt animals; results that have not been shown in transgenic mice producing human antibody oires from entirely human loci18.

In summary, to ze human antibody production an IgH locus that uses human genes for dy specificity but rodent genes for control of differentiation and high expression should be regarded essential. L-chain ility is a bonus as it permits highly efficient human IgH/IgL assembly even when wt Ig is present. For therapeutic applications chimeric H-chains can be easily converted into fully human Abs by C-gene replacement without compromising the specificity. [0153A] In this ication where reference has been made to patent specifications, other external documents, or other sources of ation, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

All s and patent publications referred to herein are hereby incorporated by reference. n modifications and improvements will occur to those skilled in the art upon a reading of the foregoing description. It should be understood that all such modifications and improvements have been deleted herein for the sake of conciseness and readability but are properly within the scope of the following claims. [0155A] Certain statements that appear below are broader than what appears in the statements of the invention above. These statements are provided in the interests of providing the reader with a better understanding of the invention and its practice. The reader is directed to the accompanying claim set which defines the scope of the invention.

REFERENCES 1. Chan, A.C. & , P.J. Therapeutic antibodies for autoimmunity and inflammation. Nature s. Immunology 10, 301-316 . 2. Enever, C., Batuwangala, T., Plummer, C. & Sepp, A. Next generation immunotherapeutics--honing the magic bullet. Current opinion in biotechnology 20, 405-411 (2009). 3. Brüggemann, M., Smith, J.A., Osborn, M.J. & Zou, X. Part I: Selecting and shaping the antibody molecule, Selection Strategies III: Transgenic mice, in Handbook of Therapeutic Antibodies. Ed. Dübel, S. Wiley-VHC, 69-93 (2007). 4. Green, L.L. Antibody engineering via genetic engineering of the mouse: XenoMouse strains are a vehicle for the facile generation of eutic human monoclonal antibodies. Journal of immunological s 231, 11-23 (1999). 5. Ishida, I. et al. Production of human monoclonal and polyclonal antibodies in hromo animals. Cloning and stem cells 4, 91-102 (2002). 6. Kuroiwa, Y. et al. Cloned transchromosomic calves producing human immunoglobulin. Nature biotechnology 20, 4 (2002). 7. Lonberg, N. Human antibodies from transgenic animals. Nature biotechnology 23, 1117-1125 (2005). 8. Bruggemann, M. et al. A oire of monoclonal antibodies with human heavy chains from transgenic mice. Proceedings of the National Academy of Sciences of the United States of America 86, 6709-6713 (1989). 9. Kitamura, D., Roes, J., Kuhn, R. & Rajewsky, K. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature 350, 6 (1991). 10. Davies, N.P. & Bruggemann, M. Extension of yeast artificial chromosomes by cosmid multimers. Nucleic acids research 21, 767-768 (1993). 11. Geurts, A.M. et al. Knockout rats via embryo microinjection of zinc-finger nucleases. Science 325, 433 (2009). 12. Menoret, S. et al. Characterization of immunoglobulin heavy chain knockout rats.

European journal of immunology 40, 2932-2941 (2010). 13. owska, T. et al. Efficient globulin gene tion and targeted ement in rabbit using zinc finger nucleases. PloS one 6, e21045 (2011). 14. Xian, J. et al. Comparison of the performance of a plasmid-based human Ig? minilocus and YAC-based human Ig? transloci for the production of a human dy repertoire in transgenic mice. . Transgenics, 333-343 (1998). 15. Anand, R. Yeast artificial chromosomes (YACs) and the analysis of complex genomes. . Trends hnol 10, 35-40 (1992). 16. Davies, N.P., ll, I.R. & Bruggemann, M. Targeted alterations in yeast artificial chromosomes for inter-species gene transfer. Nucleic acids research 20, 2693-2698 (1992). 17. Zou, X., Xian, J., Davies, N.P., Popov, A.V. & Bruggemann, M. Dominant expression of a 1.3 Mb human Ig kappa locus replacing mouse light chain production. FASEB journal : al publication of the Federation of American Societies for Experimental Biology , 1227-1232 (1996). 18. Mendez, M.J. et al. Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice. Nature genetics 15, 146-156 (1997). 19. Davies, N.P. et al. Creation of mice expressing human antibody light chains by introduction of a yeast artificial chromosome containing the core region of the human immunoglobulin kappa locus. Biotechnology (N Y) 11, 911-914 (1993). 20. Davies, N.P., Popov, A.V., Zou, X. & Brüggemann, M. Human antibody repertoires in transgenic mice: Manipulation and er of YACs. . IRL Oxford, 59-76 (1996). 21. Lonberg, N. et al. Antigen-specific human antibodies from mice sing four distinct genetic modifications. Nature 368, 856-859 (1994). 22. Nicholson, I.C. et al. Antibody repertoires of four- and five-feature translocus mice carrying human immunoglobulin heavy chain and kappa and lambda light chain yeast artificial chromosomes. J Immunol 163, 6898-6906 (1999). 23. a, S. et al. Human monoclonal dies to HIV-1 gp140 from mice g YAC-based human immunoglobulin transloci. Protein engineering, design & selection : PEDS 24, 9 (2011). 24. Wagner, S.D., Gross, G., Cook, G.P., Davies, S.L. & Neuberger, M.S. Antibody expression from the core region of the human IgH locus reconstructed in enic mice using bacteriophage P1 clones. Genomics 35, 405-414 (1996). 25. Popov, A.V., Butzler, C., Frippiat, J.P., Lefranc, M.P. & Bruggemann, M. ly and extension of yeast artificial chromosomes to build up a large locus. Gene 177, 195-201 (1996). 26. Mundt, C.A. et al. Novel control motif cluster in the IgH delta-gamma 3 interval ts B cell-specific enhancer function in early development. J Immunol 166, 3315-3323 (2001). 27. Lefranc, M.-P. & Lefranc, G. The immunoglobulin factsbook. FactsBook Series, Academic Press, GB, 45-68 (2001). 28. Reynaud, S. et al. Interallelic class switch recombination contributes significantly to class switching in mouse B cells. J Immunol 174, 6176-6183 (2005). 29. Bruggemann, M., Teale, C., Clark, M., Bindon, C. & Waldmann, H. A d set of rat/mouse chimeric antibodies. Identification and ical properties of rat H chain constant regions mu, gamma 1, gamma 2a, gamma 2b, gamma 2c, epsilon, and alpha. J Immunol 142, 3145-3150 (1989). 30. Bazin, H., s, A. & Querinjean, P. Three classes and four (sub)classes of rat immunoglobulins: IgM, IgA, IgE and IgG1, IgG2a, IgG2b, IgG2c. an journal of immunology 4, 44-48 (1974). 31. McGhee, J.R., Michalek, S.M. & Ghanta, V.K. Rat immunoglobulins in serum and secretions: purification of rat IgM, IgA and IgG and their quantitation in serum, colostrum, milk and . Immunochemistry 12, 817-823 (1975). 32. Shansab, M., ton, J.M. & Selsing, E. Translocation of an antibody transgene requires AID and occurs by interchromosomal switching to all switch regions except the mu switch region. European journal of immunology 41, 464 (2011). 33. Bruggemann, M. et al. Human dy production in transgenic mice: expression from 100 kb of the human IgH locus. European journal of immunology 21, 1323-1326 (1991). 34. Vincent-Fabert, C. et al. Genomic deletion of the whole IgH 3' regulatory region (hs3a, hs1,2, hs3b, and hs4) dramatically affects class switch recombination and Ig secretion to all isotypes. Blood 116, 1895-1898 (2010). 35. Davis, C.G., Gallo, M.L. & an, J.R. Transgenic mice as a source of fully human antibodies for the treatment of . Cancer metastasis reviews 18, 421-425 (1999). 36. Lonberg, N. Fully human dies from transgenic mouse and phage display platforms. Current opinion in immunology 20, 450-459 . 37. Chen, K.C., A. New Insights into the Enigma of Immunoglobulin D. Immunol Rev 237, 160-179 (2010). 38. Popov, A.V., Zou, X., Xian, J., son, I.C. & Bruggemann, M. A human immunoglobulin lambda locus is similarly well expressed in mice and humans. The Journal of experimental medicine 189, 1611-1620 (1999). 39. Marchuk, D. & Collins, F.S. pYAC-RC, a yeast artificial chromosome vector for cloning DNA cut with infrequently cutting restriction endonucleases. Nucleic acids research 16, 7743 (1988). 40. Kaur, R., Ma, B. & k, B.P. A family of glycosylphosphatidylinositollinked aspartyl ses is required for virulence of Candida glabrata. Proceedings of the National Academy of Sciences of the United States of America 104, 7628-7633 (2007). 41. Nelson, D.L. & Brownstein, B.H. YAC libraries: A user’s guide. . Freeman and Company, NY (1994). 42. Gietz, D. & Woods, R.A. Transformation of yeast by the lithium acetate singlestranded carrier DNA/PEG method. Methods in Microbiology 26, 53-66 (1998). 43. Peterson, K.R. Preparation of intact yeast artificial chromosome DNA for transgenesis of mice. Nature protocols 2, 3009-3015 (2007). 44. Beverly, S.M. Characterization of the ‘unusual’ ty of large ar DNAs in pulsed field-gradient electrophoresis Nucleic acids research 16, 925-939 (1988). 45. Kawasaki, K. et al. Evolutionary dynamics of the human immunoglobulin kappa locus and the germline repertoire of the Vkappa genes. European journal of immunology 31, 1017-1028 (2001). 46. Sambrook, J. & Russell, D.W. Molecular Cloning. A laboratory . . Cold Spring Harbor Laboratory Press, NY (2001). 47. Gu, H., , D. & Inselburg, J. Recovery of DNA from e gels using a modified Elutrap. Journal of biochemical and biophysical s 24, 45-50 (1992). 48. Yang, X.W., Model, P. & Heintz, N. Homologous recombination based modification in Escherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome. Nature biotechnology 15, 859-865 (1997). 49. Meisner, L.M., and J. Johnson Protocols for cytogenetic studies of human embryonic stem cells. . Methods 45, 133-141 (2008). 50. Kishiro, Y., Kagawa, M., Naito, I. & Sado, Y. A novel method of preparing ratmonoclonal antibody-producing hybridomas by using rat medial iliac lymph node cells. Cell structure and on 20, 151-156 (1995).

Claims (13)

1. A transgenic rat, the rat comprising in its germline a heavy chain immunoglobulin locus comprising human unrearranged heavy chain variable region gene segments linked to DNA encoding a rat heavy chain nt region and a rat 3' enhancer comprising the sequence set forth as SEQID NO:1, wherein the heavy chain immunoglobulin locus does not comprise a human immunoglobulin constant region gene.

2. A rat of claim 1, wherein the human heavy chain variable region gene segments are contained on a DNA fragment that is about 50 to 500 kb or larger, or wherein the human heavy chain variable region gene segments are contained on a DNA fragment that is up to 2 mega bases.

3. A rat of claim 1 or claim 2 comprising a enic uct containing an cial heavy chain locus capable of undergoing gene rearrangement thereby producing a diversified repertoire of heavy chains having human idiotypes.

4. A rat of claim 3, wherein following rearrangement the rodent expresses a functional antigenbinding molecule d by the human gene segments.

5. A rat of any one of the claims 1 to 4, wherein the rat produces an antibody that comprises a human variable region and a rat nt region.

6. A rat of any one of claims 1 to 5, wherein the rat heavy chain constant region lacks CH1.

7. A method of producing an antibody having a human variable region and a rat constant region comprising exposing a enic rat to an antigen, the rat comprising in its germline a heavy chain immunoglobulin locus comprising human unrearranged heavy chain variable region gene segments linked to DNA encoding a rat heavy chain constant region and a rat 3’ enhancer comprising the sequence set forth as SEQ ID NO: 1, wherein the heavy chain immunoglobulin locus does not comprise a human immunoglobulin gene, wherein the exposure to the antigen is such that the enic rat produces an antibody to the n, the antibody having a human heavy chain variable region and a rat heavy chain constant region.

8. A method of claim 7, wherein the human heavy chain variable region gene segments are contained on a DNA fragment that is about 50 to 500 kb or larger, or wherein the human heavy chain le region gene segments are contained on a DNA fragment that is up to 2 mega bases.

9. A method of claims 7 or claim 8, wherein the rat heavy chain constant region lacks CH1.

10. A method of any one of the claims 7 to 9, further comprising the step of making a hybridoma from the transgenic rat, the hybridoma comprising DNA encoding the antibody.

11. A method of claim 10, wherein the oma is made from the spleen of the transgenic rat.

12. A transgenic rat according to any one of claims 1-6, substantially as herein described with reference to any example thereof and with reference to the accompanying figures.

13. A method of producing an antibody according to any one of claims 7-11, substantially as herein described with reference to any example thereof and with reference to the accompanying figures.