NZ753744A

NZ753744A - Method for obtaining low ethanol-producing yeast strains, yeast strains obtained therefrom and their use

Info

Publication number: NZ753744A
Application number: NZ753744A
Authority: NZ
Inventors: Valentin Tilloy; Anne Ortiz-Julien; Jessica Noble; Sylvie Dequin
Original assignee: Danstar Ferment Ag; Institut National De Rech Pour L’Agriculture L’Alimentation Et L’Environnement
Priority date: 2014-01-31
Filing date: 2015-01-30
Publication date: 2022-07-29

Abstract

The present disclosure concerns a process for obtaining a variant yeast strain capable of producing less ethanol in an alcoholic fermentation process than its corresponding ancestral strain. The variant yeast strain is obtained by culturing the ancestral strain in the presence of increasing concentrations of a salt capable of causing an hyperosmotic stress to the ancestral yeast strain. The present disclosure also concerns variant yeast strain obtained from this process (for example the variant yeast strain deposited at Institut Pasteur, on January 9, 2014, under accession number CNCM I-4832, the variant yeast strain deposited at Institut Pasteur, on October 18, 2012 under accession number CNCM I-4684, the variant yeast strain deposited at Institut Pasteur, on October 18, 2012 under accession number CNCM I-4685 and/or the variant yeast strain deposited at Institut Pasteur on January 28, 2015 under accession number CNCM I-4952) as well as processes using the variant yeast strain (wine fermentation for example).

Description

METHOD FOR OBTAINING LOW ETHANOL-PRODUCING YEAST STRAINS, YEAST STRAINS OBTAINED THEREFROM AND THEIR USE CROSS-REFERENCE TO RELATED APPLICATIONS AND DOCUMENTS This ation claims priority from EP patent application serial number 14290019.0 filed on January 31, 2014. This application also includes a sequence listing led ncelisting" and having 4 kb). This application further includes the following biological deposits (all made at Institut Pasteur) under accession number Collection Nationale des Cultures des Microorganismes (CNCM) I-4832 (deposited on January 9, 2014), CNCM I-4684 (deposited on October 18, 2012), CNCM I-4685 (deposited on October 18, 2012) and CNCM I-4952 (deposited on January 28, 2015).

The content of the priority application, the ical deposits and the ce listing is herewith incorporated in its entirety.

The present application is a divisional of New Zealand patent application , which is the national phase entry of PCT international application (published as TECHNOLOGICAL FIELD The present disclosure relates to a process for obtaining non-genetically-modified variant yeast strains which have the y of producing less ethanol than their corresponding ancestral/parental strains as well as variant yeast strains ed or d from this process. The present disclosure also relates the use of such variant yeast strain during an alcoholic fermentation process, such as the production of wine.

BACKGROUND Over the past twenty years, the alcohol content of wine has increased considerably, by about 2% (v/v), as a result of the high sugar content of the grapes currently used. This is mainly due to developments in winemaking practices, with the harvest of very mature grapes being favored to adapt to consumer demand for rich and ripe fruit flavor in wine. This trend poses major problems for the wine industry. The market is currently oriented towards beverages with moderate l contents, in line with public prevention policies, consumer health issues and preferences. In addition, as some ies impose taxes on the alcohol content, this trend raises economic issues. High levels of alcohol can alter the sensorial quality of wines, by increasing the perception of hotness and, to a lesser extent, by decreasing the perception of sweetness, acidity and aroma. Also, high ethanol levels generated during fermentation may inhibit yeast activity and can lead to sluggish or stuck fermentations.

Consequently, reducing the ethanol content of wine has been a major focus of wine research, at various steps of the wine-making process. Several viticulture strategies are being developed to se sugar accumulation on grapes. These ches include the selection of adequate grape varieties that accumulate less sugar and the modification of culture techniques to reduce the berry sugar lation, such as irrigation, canopy management or limitation of photosynthesis. Physical techniques for de-alcoholisation, for example reverse s, nano-filtration or distillation have also been developed and are available in the short-term. However, de-alcoholisation treatments are expensive to implement, and may have detrimental effects on the organoleptic quality of the wine.

An attractive and inexpensive option would be to use yeasts that e less alcohol from the same amount of sugar. Indeed, there have been many efforts to develop engineered wine yeast strains with reduced ethanol yield. One of the most efficient approaches was to divert metabolism towards increased production of glycerol and thus away from ethanol. In Saccharomyces cerevisiae, glycerol plays major roles in redox homeostasis and in osmotic stress resistance: it is the main compatible solute in yeast. Glycerol is usually found in wines at concentrations in the range 5 to 9 g/L and contributes positively to the quality of wine by ing body and sweetness. It may also confer viscosity at very high concentrations (above 25 g/L), as in Botrytis wines. Rerouting carbon towards glycerol led to a substantial decrease in ethanol production and accumulation of various compounds, including acetate and acetoin, both rable for wine ial quality. Rational engineering of key reactions at the acetaldehyde branch point allowed the accumulation of these undesirable compounds to be limited. This ed in low alcohol strains being obtained in which the carbon flux was redirected towards glycerol and 2,3-butanediol, a polyol with no sensorial impact in wines.

These engineered wine yeasts have the potential to reduce the alcohol t of wine by 1 to 3% (v/v). r, the poor consumer acceptance of DNA recombinant technology in food is a major barrier to their commercialization. Consequently, there is a great interest to use alternative, non-genetically modified organism (GMO) approaches to e the properties of wine yeast strains.

It would be highly desirable to be provided with non-genetically ed variants yeast strains capable of producing less ethanol than their ponding ancestral yeast strains, or to at least provide the public with a useful choice. Preferably, the alcoholic tation of these variant yeast strain does not lead to the production of rable organoleptic properties in the fermented product.

In this ication where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of ation, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

BRIEF Y The present disclosure provides a process for obtaining a variant yeast strain capable of producing, when compared to an ancestral yeast strain, more ol, less acetate and less l during an alcoholic fermentation process. The process relies on the use of a salt capable of causing an smotic stress to the ancestral yeast strain as well as culturing the yeast strain in a high concentration of a carbon source until exhaustion of the carbon source. Surprisingly, the variant yeast strain obtained produce more glycerol and less ethanol than the ancestral yeast strain from which they are d, even in the absence of the salt. In an embodiment, the variant yeast strain is not more ant to the hyperosmotic stress than its corresponding ral yeast strain, but displays increased viability and a gain of fitness in carbon starvation conditions when compared to its ancestral yeast strain. In some embodiments, the variant yeast strain (when compared to the ancestral yeast strain) produces the same amount or less of acetate and/or acetoin during an alcoholic fermentation.

According to a first aspect, the present sure provides a process for obtaining a variant yeast strain capable of producing, when compared to an ancestral yeast strain, more glycerol, less acetate and less ethanol in an alcoholic fermentation process on a grape must. Broadly, the process ses a) culturing the ancestral yeast strain in a first culture medium comprising a salt capable of causing an hyperosmotic stress to the ancestral yeast strain, wherein the ancestral yeast strain is ed in increasing salt concentrations and under conditions to achieve glucose depletion in the first culture medium so as to obtain a first ed yeast strain; and b) culturing the first cultured yeast strain in a second culture medium comprising the salt, wherein the first ed yeast strain is cultured at a fixed salt concentration and under conditions to e glucose depletion in the second culture medium so as to obtain the variant yeast strain. The salt used in the process has a countercation which is different than a sodium cation. In the process, the concentration of the salt in the second e medium is higher than the tration of the salt in the first culture medium. In an embodiment, the concentration of the salt in the first culture medium is between about 1.25 M and less than about 1.9 M or about 2.4 M. In another embodiment, the concentration of the salt in the second culture medium is at least about 2.4 M. In an embodiment, the process further comprises, at step a), increasing the salt concentration weekly or monthly. In still another embodiment, the first culture medium comprises glucose and the process r comprises, at step a), culturing the ancestral yeast strain in the first culture medium while decreasing glucose concentrations. In such embodiment, the concentration of glucose can be decreased weekly or monthly. Further, still in such embodiment, the concentration of glucose in the first culture medium can be between about 14.0% and about 8.0% (w/v) or between about 14.0% and about 9.6% (w/v) with respect to the total volume of the first culture medium. In another embodiment, the second e medium comprises glucose and the process further ses, at step b), culturing the first cultured yeast at a fixed glucose concentration. In such embodiment, the fixed glucose concentration of the second culture medium is preferably 8.0% (w/v) with respect to the total volume of the second culture medium. In an embodiment, the process can further comprise mating haploid spores of the t yeast strain to obtain a t hybrid strain. In still another embodiment, the salt has a potassium , such as, for example, KCl. In yet another embodiment, the ancestral and/or variant yeast strain is from a Saccharomyces species and preferably from a genus ed from the group consisting of Saccharomyces arboricolus, Saccharomyces nus, Saccharomyces s , Saccharomyces cerevisiae, Saccharomyces kudriadzevii, Saccharomyces mikatae, Saccharomyces paradoxus, Saccharomyces pastorianus, romyces carsbergensis, Saccharomyces uvarum and inter-species s.

In a particular aspect, the present invention provides a process for obtaining a variant yeast strain capable of producing, when ed to an ancestral yeast strain, more glycerol, less acetate and less ethanol during an alcoholic fermentation process on a grape must, said process comprising: a) culturing the ancestral yeast strain in a first culture medium comprising a salt capable of causing an hyperosmotic stress to the ancestral yeast strain, wherein the ral yeast strain is cultured in increasing salt concentrations and under conditions to achieve glucose depletion in the first culture medium so as to obtain a first cultured yeast strain; and b) culturing the first cultured yeast strain in a second e medium comprising the salt, wherein the first cultured yeast strain is cultured at a fixed salt concentration and under conditions to achieve glucose depletion in the second culture medium so as to obtain the variant yeast strain; wherein • the salt has a counter-cation which is different than a sodium cation; and [FOLLOWED BY PAGE 4a] - 4a - • the concentration of the salt in the second culture medium is higher than the concentration of the salt in the first culture medium.

According to a second aspect, the present disclosure provides a variant yeast strain capable of producing, when compared to an ral yeast strain, more glycerol and less ethanol in an alcoholic fermentation process. In an embodiment, the variant yeast is obtained by the process described herein. In an ment, the variant yeast strain obtained can be used for making a fermented product, such as wine (e.g., red wine) or beer. In an embodiment, the variant yeast strain is at least one of the one deposited at Institut Pasteur, on January 9, 2014, under accession number Collection ale des Cultures des Microorganismes (CNCM) I-4832, the one deposited at Institut Pasteur, on r 18, 2012 under accession number Collection Nationale des es des Microorganismes (CNCM) I-4684 and the one ted at Institut Pasteur, on October 18, 2012 under accession number Collection Nationale des es des rganismes (CNCM) I-4685, on January 28, 2015 under accession number Collection Nationale des Cultures des Microorganismes (CNCM) I-4952 as well as any combination thereof.

According to a third aspect, the present disclosure provides a s for making a fermented t. Broadly, the process comprises contacting the variant yeast strain described herein with a fermentable source of nutrients. In an embodiment, the fermented product is wine (e.g., red wine) and the fermentable source of nutrients is a grape must. In another embodiment, the fermented product is beer and the fermentable source of nutrient is starch (e.g., d from cereals such as barley for example).

Unless the context y requires otherwise, throughout the description and the claims, the words ‘comprise’, ‘comprising’ and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say in the sense of "including but not limited to".

In the description in this specification reference may be made to subject matter which is not within the scope of the appended claims. That subject matter should be readily identifiable by a person skilled in the art and may assist in putting into practice the invention as defined in the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS Having thus generally described the nature of the ion, reference will now be made to the accompanying drawings, showing by way of illustration, a preferred embodiment thereof, [FOLLOWED BY PAGE 4b] - 4b - and in which: Figure 1 shows glycerol concentration (bars providing the minimal and maximal concentration) and ethanol yield (black lozenges with the error bars providing minimal and maximal yields) (A, B), and glycerol concentration (bars) and residual e after 15 (white les with the error bars providing maximal and minimal concentrations) and 30 (black triangles with the error bars providing maximal and minimal concentrations) days of [FOLLOWED BY PAGE 5] W0 20152114115 fermentation (C, D) for the ancestral strain (EC1118), evolved tions (dark grey, label starting with "PK") and isolates (evolved s) (light grey, label ng with "K") from the independent lineages a (A, C) and b (B, D). Fermentations were carried out in 300 mL M8210, 260 g/L glucose, at 28°C in triplicate. The number in the different labels refers to the number of generations that the populations and strains were submitted to adaptive evolution.

Figure 2 shows the selective advantage of the evolved strains. Viability of EC1118 (0, black line), K300.2(a) (A, dark grey line) and K300.1(b) (o, light gray line) during culture in YPD + 8% glucose and 2.4 M KCl at 28°C. Results are shown as the number (x107) of living cells/mL in function of time (hours). Sugar exhaustion is observed after 100 hours. Each point includes the measured value as well as the standard deviation.

Figure 3 illustrates the fermentation performances (A) and cell population (B) of the ancestral strain EC1118 (a, black line) and the evolved strains K300.2(a) (A, dark grey line) and K300.1(b) (0, light grey line) on M8210 medium, 260 g/L glucose, at 28°C. Results in panel A are provided as dCOg/dt (g/l/H) in function of time (hours). Results in panel B are provided as the number of cells /mL in function of time (hours) and include the standard deviation.

Figure 4 shows by-product yields for strains EC1118 and (b). lites were measured after 30 days of fermentation in 300 mL of M8210, 260 g/L glucose at 16°C, 20°C, 24°C, 28°C, 32°C and 34°C. Results are shown for ethanol (A, ed as g/g of consumed glucose in function of time and of strain used), glycerol (B, provided as 9/9 of consumed glucose in function of time and strain used) and succinate (C, provided as 9/9 of consumed glucose in function of time and strain used). Each points includes the measured valued as well as the standard deviation.

Figure 5 illustrates the kinetics of wine fermentation on Grenache for EC1118 (black line) and K300.1(b) (dark grey line). 72 mg/L nitrogen (15 g/hL of DAP and 30 gth of Fermaid®E) were added at the time point indicated by an arrow. Results are shown as dCOzldt(g/L/H) in function of time (hours). Each points includes the measured valued as well as the standard Figure 6 illustrates the kinetics of wine fermentation trial N2 on synthetic must containing 235 g/L sugars for the ancestral strain (EC1118) and an H2 generation hybrid. Results are shown as dCOz/dt(g/L/H) in on of time ).

Figure 7 illustrates the kinetics of wine tation trial N3 on synthetic must containing 260 g/L sugars for the ancestral strain (EC1118) and an H2 generation hybrid. Results are shown as dCOzldt(g/L/H) in function of time (hours).

W0 20151114115 2015/051995 - 6 _ Figure 8 illustrates the cs of wine tation trial N4 on a Syrah variety grape must for the ancestral strain (EC1118) and an H2 generation hybrid (120—A5). Results are shown as dCOzldt(g/L/H) in function of time (hours). Arrows indicated when oxygen was added to the fermentation.

DETAILED DESCRIPTION An attractive and inexpensive option to obtain wine having a lower alcohol content would be to use yeasts that e less alcohol from the same amount of sugar. indeed, there have been many efforts to develop engineered wine yeast strains with reduced ethanol yield. One of the most efficient approaches was to divert lism towards increased production of glycerol and thus away from ethanol. In Saccharomyces cerevisiae, glycerol plays major roles in redox homeostasis and in osmotic stress resistance: it is the main compatible solute in yeast. Glycerol is usually found in wines at concentrations in the range 5 to 9 g/L and contributes positively to the quality of wine by providing body and sweetness. It may also confer viscosity at very high concentrations (above 25 g/L), as in Botrytis wines. Usually, rerouting carbon towards ol led to a substantial decrease in ethanol production and accumulation of various compounds, including acetate and acetoin, both undesirable for wine ial quality. al genetic ering of key reactions at the acetaldehyde branch point allowed the accumulation of these undesirable compounds to be limited. This resulted in low alcohol strains being obtained in which the carbon flux was redirected towards glycerol and 2,3—butanediol, a polyol with no sensorial impact in wines. These engineered wine yeasts have the ial to reduce the alcohol content of wine by 1 to 3% (v/v). However, the poor consumer acceptance of DNA recombinant technology in food is a major barrier to their commercialization. Consequently, there is a great interest to use alternative, non—GMO approaches to e the ties of wine yeast strains.

Process for obtaining low ethanol-producing variant yeast strains Adaptive tory evolution (ALE) experiments, based on long term adaptation of yeast under environmental or metabolic constraints, has been used to improve yeast strains for biotechnological applications, including wine-making. Experimental evolutions using sodium chloride to generate osmotic stress have been used to study evolutionary processes, and in more applied work, to increase the tolerance of baking strains to freezing. NaCl—resistant evolved industrial strains were obtained, but the production of ol and ethanol by the evolved strains was not affected.

The present disclosure provides a process for obtaining a variant yeast . In the context of the present disclosure, a "variant yeast strain" is a natural (e.g., not cally modified _ 7 _ using recombinant DNA/RNA technology) yeast strain mutant which has been selected from an "ancestral" yeast strain using ALE (based on the salt described herein) to redirect carbon flux towards glycerol and, ultimately, reduce the production of ethanol during alcoholic fermentation. The ancestral yeast strain and the t yeast strain are non-genetically modified organisms, e.g., their genomic content has not been altered by the introduction of exogenous nucleic acid molecules or the removal of endogenous nucleic acid molecules using genetic engineering techniques. in some embodiments, the alcoholic th by volume (% vlv) of a fermented product (e.g., wine) obtained with the t yeast strain is reduced when compared to the lic strength by volume of a fermented product (e.g., 1O wine) obtained with thee ancestral yeast strain, by between about 0.40% and 2.00% or by at least 0.40%, 0.45%, 0.50%, 0.60%, 0.70%, 0.80%, 0.90%, 1.00%, 1.10%, 1.20%, 1.30%, 1.40%, 1.50%, 1.60%, 1.70%, 1.80%, 1.90% or 2.00%. In alternative or complimentary embodiments, the ratio of the glycerol content of a fermented product (e.g., wine) obtained with the variant yeast strain to the glycerol content of a fermented t (e.g., wine) ed with the ancestral yeast strain, is n 1.25 and 2.40 or at least 1.25 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.70, 1.75, 1.80, 1.85, 1.90, 1.95, 2.00, 2.10, 2.15, 2.20, 2.25, 2.30, 2.35 or 2.40. in the context of the t disclosure, during an lic tation process, the "variant" yeast strain does not produce an amount of acetate, acetaldehyde and acetoin which can alter the leptic properties of the fermented product. In an embodiment, the content of acetate, acetaldehyde or acetoin in the fermented product obtained by using the variant yeast strain is either equal to or less than the corresponding content of e, acetaldehyde or acetoin in the ted product obtained by using the ancestral yeast strain. in embodiments, the content of acetate, acetaldehyde or acetoin in the fermented product obtained by using the variant yeast strain is augmented when compared to the corresponding fermented product obtained using the ancestral yeast strain, this increase is equal to or less than 70%. In still some embodiments, the variant yeast strain can produce a greater amount of one or more compounds (such as 2,3-butanediol), when compared to the ancestral yeast strain, which does not impact the organoleptic properties of the fermented product. In some embodiments, the variant yeast strains are not more resistant to an hypersomotic shock caused by the salt than the ancestral yeast strain, but the variant yeast s display better viability and a gain of fitness (when compared to the ral yeast strain) under conditions of hyperosmotic stress and carbon starvation. in order to obtain the variant yeast strain, an ancestral yeast strain is submitted to ALE and is cultured in increasing salt trations. The salt used during ALE is capable of causing an _ 8 - hyperosmotic stress to the ancestral yeast . in the t of the t disclosure, the term hyperosmotic stress (also referred to as an hyperosmotic shock) is an increase in the solute (e.g., ionic) tration around a yeast cell causing a rapid change in the movement of water across its cell membrane. In such conditions, an inhibition of the transport of substrates and ors into the cell can occur thus causing a shock. The salt in ALE can either be a single type of salt or a combination of salts capable of causing an hyperosmotic shock. The salt or the combination of salts used in the ALE described herein must be capable of providing a specific osmoiaiity to the culture medium t inducing toxicity towards the al strain. For example, in the context of the present disclosure, the cation of the salt (or combination of salts) used in ALE lacks toxicity with respect to the ancestral yeast strain when used at a concentration for providing an initial osmolality of at least 1 500 mmol/kg, at least 1 600 g, at least 1 700 mmol/kg, at least 1 800 mmol/kg, at least 1 900 g, at least 2 000 mmol/kg, at least 2 100 mmol/kg or at least 2 200 mmol/kg.

The salt used in the processes described herein has a countercation which is different than sodium. For example, the salt can have a potassium countercation. Such salts include, but are not limited to KCI. Such salts exclude NaCl whose cation has been shown to cause toxicity to the ancestral yeast strain. Such salts also exclude sulfites, such as sodium sulfite (NaZSO3), which generate sodium cations and provide yeasts strains only modestly capable of decreasing the alcohol by volume content of fermented products.

In a first step, the process for obtaining the variant yeast strain includes culturing yeast s in increasing salt concentrations. The ral yeast strain is used to inoculate (at a predetermined amount) a culture medium containing the salt at a specific concentration. The ancestral yeast strain is then cultured under conditions so as to achieve carbon or glucose depletion (e.g. also referred to as carbon starvation). Then, a pre-determined amount of the ed yeasts is used to inoculate a fresh medium containing either the same salt concentration or a higher salt concentration. This cycle is repeated until the cultured yeasts reach a relatively stable phenotype with respect to glycerol and ethanol production in alcoholic tation. in some embodiments, this cycle is repeated for at least (about) 200, 250, 300, 250, 400, 450, 500, 550, 600, 650, 700 or 750 yeast generations. During the 3O process, the osmoiaiity of the medium used to culture the yeasts is progressively increased from about 1 5000 to about 5 000 mmol/kg. For example, in an embodiment, the osmoiaiity during the initial phase of the process can be (about) at least 1 500 mmol/kg, at least 1 600 mmol/kg, at least 1 700 mmol/kg, at least 1 800 mmol/kg, at least 1 840 mmol/kg, at least 1 900 mmol/kg, at least 2 000 mmol/kg, at least 2 100 mmol/kg, at least 2 105 mmol/kg or at least 2 200 mmol/kg. Alternatively or in ation, the osmoiaiity during the final phase of the ﬁrst step of the process can be ) at most 4 800 g, at most 4 740 mmol/kg, at _ 9 - most 4700 g, at most 4600 mmoI/kg, at most 4500 mmoI/kg, at most 4400 mmoI/kg, at most 4 300 mmoI/kg, at most 4 200 mmoI/kg, at most 4 100 mmoI/kg, at most 4 000 g, at most 3 900 mmol/kg, at most 3 800 mmoI/kg, at most 3 730 mmoI/kg, at most 3 700 mmoI/kg, at most 3 600 mmoI/kg or at most 3 500 mmoI/kg. In an embodiment, the osmolaIity during the first step of the process is increased from (about) 1 500 g to (about) 4 800 mmoI/kg, 4740 mmoI/kg, 4700 mmoI/kg, 4600 mmol/kg, 4500 mmoI/kg, 4400 mmoI/kg, 4300 mmoI/kg, 4200 mmoI/kg, 4100 mmoI/kg, 4000 mmoI/kg, 3 900 mmol/kg, 3 800 mmoI/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 mmoI/kg or 3 500 mmoI/kg.

In another embodiment, the osmoIality during the process is increased from (about) 1 600 1O mmoI/kg to (about) 4 800 g, 4 740 mmoI/kg, 4 700 mmoI/kg, 4 600 g, 4 500 mmoI/kg, 4 400 mmol/kg, 4 300 mmoI/kg, 4 200 mmoI/kg, 4 100 mmol/kg, 4 000 mmoI/kg, 3 900 mmoI/kg, 3 800 mmol/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In yet another embodiment, the osmoIality during the first step of the process is increased from (about) 1 700 g to (about) 4 800 mmoI/kg, 4 740 mmol/kg, 4700 mmoI/kg, 4 600 g, 4 500 mmoI/kg, 4 400 mmoI/kg, 4 300 mmoI/kg, 4 200 mmoI/kg, 4100 g, 4000 mmol/kg, 3 900 mmoI/kg, 3 800 mmol/kg, 3 730 mmoI/kg, 3 700 mmol/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In still a further embodiment, the lity during the first step of the process is increased from (about) 1 800 g to (about) 4 800 mmol/kg, 4 740 mmoI/kg, 4 700 mmoI/kg, 4 600 mmoI/kg, 4 500 mmoI/kg, 4 400 mmoI/kg, 4300 mmol/kg, 4200 mmol/kg, 4100 mmoI/kg, 4000 mmoI/kg, 3 900 mmoI/kg, 3 800 mmol/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In another embodiment, the osmoIality during the first step of the process is increased from (about) 1 840 mmoI/kg to (about) 4 800 mmoI/kg, 4 740 mmoI/kg, 4 700 mmoI/kg, 4 600 mmoI/kg, 4500 mmol/kg, 4400 g, 4300 mmoI/kg, 4200 mmol/kg, 4100 mmol/kg, 4000 mmol/kg, 3 900 mmoI/kg, 3 800 mmoI/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In still a further embodiment, the osmolaIity during the first step of the process is increased from (about) 1 900 mmoI/kg to (about) 4 800 g, 4 740 mmoI/kg, 4700 mmoI/kg, 4600 mmoI/kg, 4500 mmoI/kg, 4400 mmoI/kg, 4300 mmol/kg, 4200 mmoI/kg, 4 100 g, 4 000 mmoI/kg, 3 900 mmol/kg, 3 800 mmoI/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In another embodiment, the osmolaIity during the first step of the process is increased from (about) 2 000 mmoI/kg to ) 4 800 mmol/kg, 4 740 mmol/kg, 4 700 mmoI/kg, 4 600 mmol/kg, 4 500 mmoI/kg, 4 400 mmoI/kg, 4 300 mmoI/kg, 4200 mmoI/kg, 4100 mmoI/kg, 4000 mmoI/kg, 3 900 mmoI/kg, 3 800 mmol/kg, 3 730 g, 3 700 mmoI/kg, 3 600 g or 3 500 mmoI/kg. In yet r embodiment, the lity during the first step of the process Is increased from (about) 2 100 mmol/kg to (about) 4 800 mmoI/kg, 4 740 mmoI/kg, 4700 mmoI/kg, 4 600 mmol/kg, 4500 mmoI/kg, 4400 mmol/kg, 4300 mmoI/kg, 4200 mmoI/kg, 4100 g, 4000 mmoI/kg, 3 900 mmoI/kg, 3 800 g, 3 730 mmol/kg, 3 700 mmollkg, 3 600 g or 3 500 mmoI/kg. In still a further embodiment, the osmolality during the first step of the process is increased from (about) 2 105 g to (about) 4 800 mmoI/kg, 4 740 mmol/kg, 4700 mmolikg, 4600 mmol/kg, 4500 mmoI/kg, 4400 mmol/kg, 4300 mmol/kg, 4200 mmoI/kg, 4 100 mmoI/kg, 4 000 mmol/kg, 3 900 g, 3 800 mmoI/kg, 3 730 mmoI/kg, 3 700 mmoI/kg, 3 600 g or 3500 mmol/kg. In another ment, the ' osmolality during the first step of the process is increased from (about) 2 200 mmol/kg to ) 4 800 mmoI/kg, 4 740 mmoI/kg, 4 700 mmol/kg, 4 600 g, 4 500 g, 4 400 mmol/kg, 4 300 mmol/kg, 4200 mmol/kg, 4100 mmoI/kg, 4000 mmoI/kg, 3 900 mmol/kg, 3 800 mmoI/kg, 3 730 mmoI/kg, 3 700 mmol/kg, 3 600 mmoI/kg or 3 500 mmoI/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1500 mmoI/kg, 1600 mmoI/kg, 1700 mmoI/kg, 1800 mmoI/kg, 1840 mmol/kg, 1900 mmol/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2 105 mmoI/kg or 2 200 mmollkg to (about) 4 800 mmoI/kg. In still another embodiment, the osmolality during the first step of the process is sed from (about) 1500 g, 1600 mmol/kg, 1700 mmoI/kg, 1800 mmoI/kg, 1 840 mmol/kg, 1 900 mmol/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2105 mmoI/kg or 2 200 mmoI/kg to (about) 4 740 mmoI/kg. In still another embodiment, the osmolality during the first 'step of the process is increased from (about) 1 500 mmoI/kg, 1 600 g, 1 700 mmoI/kg, 1800 mmol/kg, 1840 mmol/kg, 1900 mmoI/kg, 2 000 mmol/kg, 2 100 mmol/kg, 2105 mmoI/kg or 2 200 mmol/kg to (about) 4700 mmoI/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1 500 mmoI/kg, 1 600 g, 1 700 mmol/kg, 1 800 g, 1 840 mmoI/kg, 1 900 mmol/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2105 mmoI/kg or 2 200 mmol/kg to (about) 4 600 mmoI/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1500 mmol/kg, 1600 mmol/kg, 1700 mmol/kg, 1800 mmol/kg, 1840 mmol/kg, 1900 mmoI/kg, 2 000 mmol/kg, 2 100 mmoI/kg, 2 105 mmol/kg or 2 200 mmoI/kg to (about) 4 500 mmoI/kg. In still another ment, the osmolality during the first step of the process is increased from (about) 1500 mmol/kg, 1600 mmol/kg, 1700 mmol/kg, 1800 mmoI/kg, 3O 1 840 mmoI/kg, 1 900 mmoI/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2 105 g or 2 200 mmoI/kg to (about) 4 400 mmol/kg. In still another embodiment, the osmolality during the first step of the process is sed from (about) 1 500 mmol/kg, 1 600 mmoI/kg, 1 700 mmoI/kg, 1 800 mmol/kg, 1840 mmoI/kg, 1900 mmoI/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2105 mmoI/kg or 2 200 mmol/kg to (about) 4300 mmol/kg. In still another ment, the osmolality during the first step of the process is increased from (about) 1 500 mmol/kg, 1 600 mmoI/kg, 1 700 mmol/kg, 1 800 mmoI/kg, 1 840 mmoI/kg, 1 900 mmoI/kg, 2 000 mmol/kg, 2 _ 11 _ 100 mmol/kg, 2105 mmol/kg or 2 200 mmol/kg to (about) 4 200 mmol/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1500 mmol/kg, 1600 g, 1700 mmol/kg, 1800 mmol/kg, 1840 mmol/kg, 1900 mmol/kg, 2 000 mmoI/kg, 2 100 mmol/kg, 2 105 mmol/kg or 2 200 g to (about) 4 100 mmol/kg. In still another ment, the osmolality during the first step of the process is increased from (about) 1500 g, 1600 mmol/kg, 1700 mmoI/kg, 1800 mmol/kg, 1 840 mmol/kg, 1 900 mmol/kg, 2 OOO mmol/kg, 2 100 g, 2105 mmol/kg or 2 200 g to (about) 4 000 mmol/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1 500 mmol/kg, 1 600 g, 1 700 mmol/kg, 1O 1800 mmol/kg, 1840 mmol/kg, 1900 mmol/kg, 2 000 g, 2 100 mmol/kg, 2105 mmol/kg or 2 200 mmol/kg to (about) 3 900 mmol/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1 500 g, 1 600 mmoI/kg, 1 700 mmol/kg, 1 800 mmol/kg, 1 840 mmol/kg, 1 900 mmol/kg, 2 000 mmol/kg, 2 100 mmol/kg, 2105 mmoI/kg or 2 200 mmol/kg to (about) 3 800 mmol/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1500 g, 1600 mmol/kg, 1700 mmoI/kg, 1800 mmol/kg, 1840 mmol/kg, 1900 mmoI/kg, 2 000 mmol/kg, 2 100 mmol/kg, 2 105 mmol/kg or 2 200 mmol/kg to (about) 3 730 mmol/kg. In still another embodiment, the osmolality during the first step of the process is sed from (about) 1500 mmol/kg, 1600 mmol/kg, 1700 mmoI/kg, 1800 mmol/kg, 1 840 mmol/kg, 1 900 mmoI/kg, 2 000 mmol/kg, 2 100 mmol/kg, 2105 g or 2 200 mmoI/kg to (about) 3 700 mmol/kg. In still another ment, the osmolality during the first step of the process is increased from (about) 1 500 mmoI/kg, 1 600 mmol/kg, 1 700 mmol/kg, 1800 mmol/kg, 1840 mmol/kg, 1900 mmol/kg, 2 000 mmol/kg, 2 100 mmol/kg, 2105 mmol/kg or 2 200 mmol/kg to (about) 3 600 mmol/kg. In still another embodiment, the osmolality during the first step of the process is increased from (about) 1 500 mmol/kg, 1 600 mmol/kg, 1 700 mmol/kg, 1 800 mmol/kg, 1 840 mmol/kg, 1 900 mmol/kg, 2 000 g, 2 100 mmol/kg, 2 105 g or 2 200 mmol/kg to (about) 3 500 mmol/kg. y, the process comprises at least two phases. In a first phase, the yeasts are cultured at a relatively low salt concentration which is increased during culture. In a second phase, the yeasts are cultured at a higher and fixed salt concentration. During the process, the initial carbon source tration in the culture medium (e.g., prior to culture) is high (at least 8% (w/v) with respect to total volume of the culture medium) in the culture medium so as to maintain the fermentative performances of the cultured yeast in the presence of, initially, a relatively high tration of carbon. in the context of the present disclosure, in both phases, the yeasts are cultured until the carbon source is depleted (e.g., until a state of carbon tion is reached) from the culture medium prior to proceeding to a further inoculation into afresh medium.

During the first phase of the process, the yeasts are cultured in a first culture medium ning the salt and the carbon . In the context of the present disclosure, the ‘first culture medium" refers to a culture medium that is used during the first phase of the process.

The first culture medium can be any type of medium suitable for the growth of . Even though the first culture medium can be a solid , the first culture medium is preferably a liquid medium. Yeast-adapted medium include, but are not limited to, the Yeast Peptone Dextrose (YPD) medium or a defined/synthetic SD medium based a yeast nitrogen base medium. ally, the first e medium can be supplemented with bacto—yeast extract and bactopeptone.

Initially, the concentration of the salt in the first culture medium is selected to increase the osmolality of the first culture medium (e.g., to reach at least at least 1 500 mmol/kg, at least 1 600 mmol/kg, at least 1 700 mmol/kg, at least 1 800 mmol/kg, at least 1 840 mmol/kg, at least 1 900 mmol/kg, at least 2 000 mmol/kg, at least 2 100 mmol/kg, at least 2 105 mmol/kg or at least 2 200 mmol/kg) and cause a ion in growth (when compared to a yeast in the same medium without the salt) of the ancestral strain (which has not previously been cultured in the presence of such high salt concentration). This reduction in growth can be, for example, at least about 1.5, 2.0, 3.0, 4.0 fold or even more, when compared to the ancestral yeast strain cultured in similar conditions but in the e of the salt. This salt concentration can correspond to 1.25 M when KCl is used as the salt to supplement a YPD medium and it provides an osmolality of about 2 105 mmol/kg. Thereafter, the yeasts are cultured in increasing salt concentrations. During the first phase, the salt concentration can be between about 1.25 M to less than about 2.4 M or at least about 1.25 M, 1.30 M, 1.40 M, 1.50 M, 1.60 M, 1.70 M, 1.80 M, 1.90 M, 2.0 M, 2.1 M, 2.2 M or 2.3 M. In an embodiment, the salt concentration in the first culture medium can serially be increased from about 1.25 M to about 1.30 M, from about 1.30 M to about 1.40 M, from about 1.40 M to about 1.50 M, from about 1.50 M to about 1.60 M, from about 1.60 M to about 1.70 M, from about 1.70 M to about 1.80 M, from about 1.80 M to about 1.90 M, from about 1.9 M to about 2.0 M, from about 2.0 M to about 2.1 M, from about 2.1 M to about 2.2 M, from about 2.2 M to about 2.3 M and from about 2.3 M to about 2.4 M. This serial increase can be made at pre-determined intervals, for example at weekly intervals or at monthly intervals. in some embodiments, the first phase can comprise two sub—phases: a first sub—phase in which the salt tration is increased weekly (for example by increasing the salt concentration from about 1.25 M to _ 13 _ about 1.9 M) and a second ase in which the salt concentration is increased y (for example by increasing the salt tration from about 1.9 M to about 2.4 M).

The first culture medium also comprises an available carbon source, such as glucose. The initial concentration of the carbon source in the first culture medium is selected to allow the maintenance of good fermentative performances of the yeasts. For example, prior to the culture with the yeasts, the concentration of the carbon source in the first culture medium is at least 8%(w/v), between about 8% and about 14% (w/v) or between about 9.6% (WM and about 14%(w/v) with respect to the total volume of the culture medium. During the first phase, the initial carbon source concentration can be at least about 8.0%, 8.4%, 8.8%, 9.2%, 9.6%, 10.0%, 10.4%, 10.8%, 11.2%, 11.6%, 12.0%, 12.4%, 12.8%, 13.2%, 13.6% or 14%, preferably at least about 9.6%, 10.0%, 10.4%, 10.8%, 11.2%, 11.6%, 12.0%, 12.4%, 12.8%, 13.2%, 13.6% or 14.0% (w/v with respect to the total volume of the culture medium). in an embodiment, the carbon source concentration in the first e medium can serially be decreased from about 14.0% to about 13.6%, from about 13.6% to about 13.2%, from about 13.2% to about 12.8%, from about 12.8% to about 12.4%, from about 12.4% to about 12.0%, from about 12.0% to about 11.6%, from about 11.6% to about 11.2%, from about 11.2% to about 10.8%, from about 10.8% to about 10.4%, from about 10.4% to about 10.0%, from about 10.0% to about 9.6%, from about 9.6% to about 9.2%, from about 9.2% to about 8.8%, from about 8.8% to about 8.4% and from about 8.4% to about 8.0%. This serial decrease can be made at pre-determined intervals, for example at weekly intervals or at y als.

In some embodiments, the first phase can comprise two sub—phases: a first sub-phase in which the carbon source tration is decreased weekly (for example by sing the carbon concentration from about 14% to about 9.6%) and a second sub-phase in which the carbon source concentration is increased y (for example by decreasing the carbon source concentration from about 9.6% to about 8.0%).

At the initial step of the first phase, the ancestral yeast strain can be first inoculated at a pre— determined concentration (e.g., an ODBOO of 1.0 for example) in the first culture medium. The ancestral strain is cultured under conditions so as to allow yeast growth (e.g., 28°C under agitation). The yeasts are cultured in the first e medium until the carbon source (usually 3O glucose) has been metaboiized (e.g., depleted). The time to reach carbon depletion will depend on the type of culture medium used, the amount of yeasts used to inoculate the culture medium, the incubation conditions as well as the initial amount of the carbon source.

However, after about 4 to 7 generations (e.g., about a week), the carbon source in a YPD medium supplemented with 8% (w/w) glucose and inoculated at an ODsoo of 1.0 with cultured yeasts is considered depleted. In another example, after about 8 to 14 generations (e.g., about two weeks), the carbon source in a YPD medium supplemented with 14% (w/w) glucose and inoculated at an ODsoo of 1.0 with cultured yeasts is considered depleted.

During the first phase, once the carbon source has been depleted from the e medium, the cultured yeasts can be maintained in a carbon starvation phase or can be inoculated into a fresh medium containing a higher salt tration and a further source of available carbon. During the first phase, the increase in salt concentration between two culture media can be, for example, 0.05 M (initially) and 0.1 M wards). In some embodiments, a more or less important increase in salt concentration can be made to achieve similar results. The first phase is maintained for at least about 175 days, at least about 25 weeks or at least 1O about 100 generations. In an embodiment, the first phase is maintained until the growth rate of the cultured yeasts increases by at least about 5%, 6%, 7%, 8%, 9% or 10% when compared to the growth rate of the cultured yeasts at the initiation of the first phase (when a reduction in growth rate is observed because of the presence of the salt).

When the salt concentration is sed in the first culture , a corresponding glucose concentration can be decreased in the first culture medium. For example, in an embodiment, when the salt concentration is increased by 0.1 M in the first e medium, the glucose concentration can be decreased (prior to the culture) by 0.4% (w/v) with respect to the total volume of the first culture medium. In still another ment, when the salt concentration is increased by about 0.05 M in the first culture medium, the glucose concentration (prior to the culture) is decreased by about 0.2% (w/v) with respect to the total volume of the first culture medium.

Once the first phase of the process has been completed, in a second phase, the yeasts are cultured in a second culture medium containing the salt and the carbon source. In the context of the present disclosure, the "second e medium" refers to a culture medium that is used during the second phase of the process. The second e medium can be any type of medium suitable for the growth of yeasts. Even though the second culture medium can be a solid medium, the second e medium is preferably a liquid medium. Yeast-adapted medium include, but are not limited to, the Yeast Peptone Dextrose (YPD) medium or a defined/synthetic SD medium based a yeast nitrogen base medium. Optionally, the second e medium can be supplemented with bacto—yeast extract and bactopeptone.

During the second phase, the second culture medium has a salt concentration that is the same or higher than the first culture medium at the end of the first phase. However, during the second phase, the salt concentration remains the same and does not increase. In an embodiment, the salt concentration of the second culture medium can be about 2.4 M. In some embodiment, the second culture medium has an osmolality of at most about 4 800 _ 15 _ g, at most about 4 740 mmol/kg, at most about 4 700 g, at most about 4 600 g, at most about 4 500 mmol/kg, at most about 4 400 mmol/kg, at most about 4 300 g, at most about 4 200 mmol/kg, at most about 4 100 mmol/kg, at most about 4 000 mmol/kg, at most about 3 900 mmol/kg, at most about 3 800 mmol/kg, at most about 3 730 mmol/kg, at most about 3 700 mmol/kg, at most about 3 600 mmol/kg or at most about 3 500 mmol/kg. g.

As indicated above, the second culture medium also comprises a carbon source, such as glucose. The initial concentration of the carbon source in the second e medium is selected to allow the maintenance of good fermentative performances of the yeasts. in an ment, the initial concentration of the carbon source in the second culture medium is equal to or lower than the initial concentration of the carbon source in the first culture medium at the end of the first phase of the process. Further, the initial glucose concentration (prior to culture) in the second culture medium remains the same during the second phase.

In an embodiment, prior to the culture with the yeasts, the concentration of glucose in the second culture medium is between about 8% and about 14% (w/v), preferably between about 8% and about 10% (WM and even more preferably about 8% (w/v with respect to the total volume of the second culture medium). in an embodiment, the salt concentration of the second culture medium is about 2.4 M. When KCl is used at such concentration to supplement a YPD medium, this ponds to an osmolality of about 3 730 mmol/kg.

During the second phase, the first cultured yeast strain (e.g., a yeast strain that has been submitted and completed the first phase of the process) is first inoculated at a pre— determined tration (e.g. an ODSOO of 1.0) in the second culture medium containing the salt as well as the carbon source. The yeast strain is cultured under conditions so as to allow yeast growth (e.g., 28°C under agitation). The yeasts are cultured in the second culture medium until the carbon source (usually glucose) has been metabolized (e.g., ed). The time to reach carbon ion will depend on the type of culture medium used, the amount of yeasts used to inoculate the culture medium, the incubation conditions as well as the initial amount of the carbon source. However, after about 4 to 7 generations (e.g., about a week), the carbon source in a YPD medium supplemented with about 8% (w/w) glucose and inoculated at an ODeoo of 1.0 with cultured yeasts is considered depleted.

During the second phase, once the carbon source has been depleted from the culture medium, the cultured yeasts are either maintained in a glucose starvation state or inoculated into a fresh medium containing the same salt concentration and the same carbon source concentration than the previous . During the second phase, the salt concentration can be about 2.4 M and the glucose concentration can be about 8.0% (w/w). In W0 20151114115 ‘ _ 15 _ embodiments, the second phase is maintained for at least about 553 days, at least about 79 weeks and/or at least about 200 generations. In an embodiment, the second phase lasts until the cultured yeast strain exhibit a stable phenotype with respect to glycerol and ethanol production in the absence of the salt stress.

The first and second culture medium can have the same base medium and differ only with respect to the salt, the salt concentration, the carbon source and/or the carbon source concentration. Alternatively, the first and second can have different base medium.

At the end of the second phase of the s, it is expected that the cultured yeast strains (now ed to as variant yeasts strains) have the y of producing more glycerol during an alcoholic fermentation than the ral yeast strain. For example, in some embodiments, the ratio of the glycerol content of a ted product (e.g., wine) obtained with variant yeast strains to the glycerol content of a fermented product (e.g., wine) obtained with the ral yeast strain, is between 1.25 and 2.40 or at least about 1.25, 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.70, 1.75, 1.80, 1.85, 1.90, 1.95, 2.00, 2.10, 2.15, 2.20, 2.25, 2.30, 2.35 or 2.40. it is also expected that the variant yeast strains have the ability of producing less ethanol during an alcoholic fermentation than the ancestral yeast strain. For example, in some embodiments, the alcoholic strength by volume (% v/v) of a fermented product (e.g., wine) obtained with the variant yeast strain is reduced, when compared to the alcoholic strength by volume of a fermented product (e.g., wine) obtained with thee ancestral yeast strain, by at least 0.40% or between about 0.40% and 2.00% or by at least about 0.40%, 0.45%, 0.50%, 0.60%, 0.70%, 0.80%, 0.90%, 1.00%, 1.10%, 1.20%, 1.30%, 1.40%, 1.50%, 1.60%, 1.70%, 1.80%, 1.90% or 2.00%. In some embodiments, the variant yeast strain can produce a greater amount of one or more compounds (such as 2,3-butanediol), when compared to the ancestral yeast strain, which does not impact the organoleptic properties of the fermented product.

The variant yeasts strains can optionally be further submitted to conventional breeding (which es genetic engineering manipulations) to r increase their ability to e glycerol, se their ability to produce ethanol during an alcoholic fermentation and/or produce inter—species hybrid having a similar phenotype. Conventional breeding conducted with yeasts of the same s (e.g., species breeding) or with yeasts of different species (e.g., inter-species breeding). Such breeding techniques are known to those skilled in the art and usually include (i) the production of haploid yeast spores from a selected variant yeast strain, (ii) the selection of haploid strains having the desired phenotype (e.g., an increased capacity in producing glycerol and/or a decreased ty of producing l during an alcoholic fermentation for example) and (iii) the mating of the selected haploid W0 20152114115 - 17 _ strains to obtain stable hybrid (e.g., diploid) strain and the ion of a hybrid strain having the desired phenotype (e.g., an increased capacity in producing glycerol, a decreased capacity of producing ethanol during an alcoholic fermentation and/or an inter-species hybrid having the desired (stable) phenotype). This optional breeding step can be used to obtain ‘lSt generation hybrids (e.g., y referred to as H1), 2"d generation hybrids (e.g., usually referred to as H2) and even 3" generation hybrids (e.g., usually referred to as H3). As indicated above, the ng step can include the generation of intra—species and inter- species hybrids).

Prior to or after the breeding, the variant yeast strain can optionally be ted to a further 1O step for determining their ability to conduct cellular respiration. t yeast strains capable of cellular respiration are considered to be useful for wine-making applications.

The process bed herein can be apply to yeasts and is especially useful for the generation of variant yeast strains destined to be used in alcoholic fermentations. Exemplary yeasts includes, but are not limited to romyces sp. (for example, from the genus romyces arborico/us, Saccharomyces eubayanus, Saccharomyces bayanus, Saccharomyces cerevisiae, romyces kudriadzevii, Saccharomyces mikatae, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces carsbergensisand Saccharomyces uvarum.), Brettanomyces sp. (Teleomorph Dekkera sp.), Candida (Teleomorphs for different species from several genera including Pichia sp., Metschnikowia sp., Issatchenkia sp., Torulaspora sp. and Kluyveromyces sp.), K/oeckera sp. (Teleomorph Hanseniaspora sp.), romycodes sp., Schizosaccharomyces sp. and/or Zygosaccharomyces sp as well as inter-species hydrids derived from any one of these yeast species.

Variant yeast strains and their use in alcoholic fermentation The present sure also concerns the variant yeast strain ed by the process bed herein. As described herein, the "variant yeast strain", during an alcoholic fermentation, produces more glycerol and less ethanol than its corresponding ancestral yeast strain and is obtained by the process described herein. As such, the fermented products obtained using the variant yeast strain has less ethanol than the fermented products obtained using the ancestral yeast strain. For example, the alcoholic strength by volume (% v/v) of a fermented product (e.g., wine) obtained with the variant yeast strain can be d, when compared to the alcoholic strength by volume of a fermented product (e.g., wine) ed with thee ancestral yeast strain, by between about 0.40% and about 2.00% or by at least about 0.40%, 0.45%, 0.50%, 0.60%, 0.70%, 0.80%, 0.90%, 1.00%, 1.10%, 1.20%, 1.30%, 1.40%, 1.50%, 1.60%, 1.70%, 1.80%, 1.90% or 2.00%. Further, the fermented _ 18 _ products obtained using the variant yeast strain has more glycerol than the fermented ts obtained using the ancestral yeast strain. For example, the ratio of the glycerol content of a fermented product (e.g., wine) obtained with the variant yeast strain to the glycerol content of a fermented product (e.g., wine) obtained with the ancestral yeast strain, is between about 1.25 and about 2.40 or at least about 1.25 1.30, 1.35, 1.40, 1.45, 1.50, 1.55, 1.60, 1.70, 1.75, 1.80, 185,190, 1.95, 2.00, 2.10, 2.15, 2.20, 2.25, 2.30, 2.35 or 2.40. in some embodiment, the nt" yeast , during an alcoholic fermentation, does not produce an amount of acetate, acetaldehyde and acetoin (when compared to the "ancestral yeast strain") which can alter the organoleptic properties of the fermented product. For example, the content of acetate, acetaldehyde or acetoin in the fermented product obtained by using the variant yeast strain can be either equal to or less than the corresponding content of acetate, acetaldehyde or acetoin in the fermented product obtained by using the ancestral yeast . Alternatively, the content of acetate, acetaldehyde or n in the ted product obtained by using the variant yeast strain can be augmented when compared to the corresponding ted product obtained using the ral yeast strain. in still some embodiments, the variant yeast strain can produce a greater amount of one or more compounds (such as 2,3-butanediol), when compared to the ancestral yeast strain, which does not impact the organoleptic properties of the ted product. In some embodiments, the variant yeast strains are not more resistant to an hyperosmotic shock caused by the salt than the ancestral yeast strain, but the variant yeast strains display better viability and a gain of fitness (when compared to the ancestral yeast ) under conditions of hyperosmotic stress and carbon starvation.

One of the exemplary t yeast strain of the present disclosure has been ted at ut Pasteur, on January 9, 2014, under accession number CNCM l-4832. Another exemplary variant yeast strain of the present disclosure has been deposited at lnstitut Pasteur, on October 18, 2012 under accession number CNCM l~4684. A further exemplary variant yeast strain of the present disclosure has been deposited at lnstitut Pasteur, on October 18, 2012 under accession number CNCM l-4685. in yet r exemplary variant yeast strain of the present disclosure has been deposited at lnstitut Pasteur, on January 28, 2015 under accession number CNCM l—4952.

The present disclosure also concerns the use of the variant yeast strain during an alcoholic fermentation process in which it is warranted to limit the alcohol content of the final fermented product. in the process for making a fermented product having an alcoholic content, the variant yeast strain is placed in contact with a fermentable source of nutrients and the tation is conducted in conditions allowing the completion of the alcoholic W0 20151114115 _ 1g _ fermentation. The t yeast strains are especially useful in processes for making wines (e.g., red, white, rose, sparkling or fortified wine). In such embodiment, the variant yeast strain is placed into contact with a the fermentation is conducted in grape must and conditions allowing the completion of the alcoholic fermentation. Optionally, the variant yeast strain can be provided in a dried formulation and submitted to a rehydration step prior to the fermentation. In r embodiment, the variant yeast strain can be provided in a liquid formulation and submitted to a dilution step and/or a thawing step prior to fermentation. In an embodiment, only the variant yeast strain is used to complete the alcoholic fermentation.

Alternatively, the variant yeast strain can be admixed with other yeast strain to ferment. In tation is some embodiments, when the fermented product is a white wine, the conducted at a temperature below about 25°C, usually at about between about 20°C and about 24°C. In other embodiments, when the fermented product is a red wine, the tation is conducted at a temperature equal to or higher than about 25°C, for example, at a temperature between about 25°C and about 30°C, and in some embodiments, at a temperature between about 25°C and about 28°C (e.g., 28°C for example). In some variant yeast strains described herein, a metabolic shift towards the production of glycerol has been observed when the yeasts are ted at a temperature higher than about 24°C. In such variant yeasts strain, the maximal reduction in ethanol production was observed at about 28°C. As such, some of the variant yeasts strains described herein are especially suited for ing a lower alcohol t in red wines. The resulting wines can optionally be filtered and bottled, as it is currently done in the art.

The variant yeast strains can be used to ferment the must of different grape species (alone or in combination), such as Vitis vinifera, as well as hybrid grape species ing one of more of V. labrusca, V. aestivalis, V. ruprestris, V. rotundifo/ia and V. riparia. The t yeast strains can be used to ferment the must of different grape ies (alone or in combination) used to make red, white, rose, ing or fortified wine. Grape varieties used to make red wines include, but are not limited to, Aghiorghitiko, Aglianico, Aleatico, Alicante Bouschet, Aramon, Baga, Barbera, Blaufrankisch, Cabernet Franc, Cabernet Sauvignon, lo, Carignan, Carmenere, Cinsaut, Dolcetto, Dornfelder, EIinng, Freisa, Gaglioppo, Gamay, he/Garnacha, Grignolino, Malbec, Mavrud, Melnik, Merlot, Mondeuse (Refosco), ulciano, Nebbiolo, Negroamaro, Nero d'Avola, Nielluccio, Periquita, Petit and Gros g, Petit Verdot, Petite Sirah, tino, vese, Saperavi, Saint Laurent, Syrah/Shiraz, Tannat, Tempranillo, Teroldego, Tinta Barroca, Tinto Cao, Touriga Francesa, Xinomavro and/or Zinfandel. Grape varieties used to make white wines include, but are not limited to, Airen, Albana, Albarino (Alvarinho), Aligote, Arneis, Bacchus, Bombino, Chardonnay, Chasselas, Chenin Blanc, Clairette, Ehrenfelser, Elbling, Ezerjo, Fernao Pires, WO 14115 _ 20 _ Furmint, Garganega, Gewiirztraminer, Grechetto, Greco, , Grtiner Veltliner, Harslevelu, Huxelrebe, lnzolia, Iona, Jacquere, Kerner, Listen, Macabeo, Malvasia, ne, Melon de Bourgogne, Optima, Palomino, Parelleda, Pedro Ximenez, Picpoul, Pinot Blanc, Pinot Gris/Grigio, Reichensteiner, Riesling, Rkatsiteli, Robola, Roditis, Sauvignon Blanc, Savagnin, Scheurebe, Semillon, Silvaner, Tocai Friulano, Torrontes, Trebbiano, Ugni-Blanc, Verdejo, Verdelho, Verdicchio, Vermentino, Vernaccia di San Gimignano, Viognier, Welschriesling and/or Xarel—lo.

Some of the advantages of using the variant yeast strain in processes for making a fermented product (such as wine) include, but are not limited to, the nce of using genetically-modified yeast strains, the avoidance of using mechanical de-alcoholisation procedures (e.g., reverse osmosis, nano—filtration or distillation) and/or the applicability to various grape varieties, irrelevant to the initial sugar content. As such, the process for obtaining a fermented product having alcohol (such as a wine) can exclude the use of genetically—modified yeast strain and/or the use of mechanical de-alchololisation procedures.

The variant yeast strains are especially useful in processes for making wines (e.g., red, white, rose, ing or fortified wine). in such embodiment, the variant yeast strain is placed into contact with a wine must and the fermentation is conducted in conditions ng the completion of the alcoholic fermentation. Optionally, the variant yeast strain can be submitted to a rehydration step prior to the fermentation. in an embodiment, only the t yeast strain is used to complete the alcoholic fermentation. Alternatively, the variant yeast strain can be admixed with other yeast strain to t. In some embodiments, when the fermented product is a white wine, the fermentation is conducted at a temperature below about 25°C, usually at about between about 20°C and about 24°C. in other embodiments, when the fermented t is a red wine, the fermentation is conducted at a temperature equal to or higher than about 25°C, for example, at a temperature between about 25°C and about 30°C, and in some ments, at a temperature between about 25°C and about 28°C (e.g., 28°C for example). in some variant yeast strains bed herein, a metabolic shift s the tion of glycerol has been observed when the yeasts are incubated at a temperature higher than about 24°C. in such variant yeasts strain, the maximal ion in ethanol production was observed at about 28°C. As such, some of the variant yeasts strains described herein are especially suited for providing a lower alcohol content in red wines. The resulting wines can optionally be filtered and bottled, as it is currently done in the art.

The variant yeast strains can also be used to ferment the cereal-derived starch (e.g. malted cereal) in brewed application for making beer.

W0 2015l114115 The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope.

EXAMPLE I — KCI-BASED VE LABORATORY ION Yeast strain and growth conditions. The wine yeast strain S. cerevisiae Lalvin EC1118® was used as the ancestral strain. Prior to ALE, strains were propagated in rich YPD medium (1% bacto yeast extract (DB), 2% bactopeptone (DB), 2% glucose; Legallais) or in synthetic SD medium (0.67% Difco yeast nitrogen base without amino acids (DB), 2% glucose) and maintained on YPD plates (2% agar) at 4°C or stored at ~80°C in 20% glycerol.

KCI resistance assay. E01118 was grown in 60 mL YPD with KCI in concentrations varying from 0.5 to 3M, at 28°C, under agitation. Optical density at 600 nm was measured each 6 hours until 240 hours and growth was compared for the different conditions.

Adaptive laboratory evolution (ALE). Adaptive evolution was based on a long-term serial transfer procedure using KCl as stress inducer. The strain EC1118 was cultured overnight at 28°C in 5 mL of YPD, and the resulting cell suspension was used to inoculate capped tubes (13 mL), each containing 5 mL medium with 1% bacto yeast extract, 2% bactopeptone, 14% glucose and 1.25M KCI (Sigma-Aldrich). Duplicate evolution experiments and also a control without stress were performed. The cultures were incubated at 28°C under agitation at 225 rpm. After 7 days, ponding to about 5 generations, the optical y of the culture at 600 nm (ODsoo) was measured and an t was used to inoculate a fresh medium such that the ODsoo was 1. Such serial transfers were ed for 450 generations. Every 50 generations, 1 mL samples of the ng population were taken and stored at —80°C in 20% glycerol for subsequent analysis.

After 7 days of culture, the cultures were ated in a YPD medium containing 13.6% glucose and 1.30 M KCI. Then, each week, the tures were inoculated in a medium in which the KCI concentration was increased by a further 0.1 M and the glucose concentration was decreased by a further 0.4%. This phase lasted between d7 and dig. Afterwards every 4 weeks, the KCl concentration was increased by 0.1 M and the e was decreased by 0.4 %. This phases lasted between d4g and (1728.

Wine fermentation (Laboratory scale). Batch fermentation experiments were carried out in synthetic medium (MS), which mimics a standard grape juice. MS medium was prepared as bed by Bely et a/. with the following modiﬁcations: 260 g/L e, 210 mg/L available nitrogen, 7.5 mg/L ergosterol, 0.21 g/L Tween® and 2.5 mg/L oleic acid (M8210 medium).

Fermentations in grape must were carried out in the same conditions, using Chardonnay- Coursan 2011 previously flash pasteurized. The fermentations were performed in 330 mL W0 20151114115 _ 22 _ fermenters containing 300 mL medium, inoculated with 0.5 x 106 cells per mL and incubated at 28°C with continuous stirring (350 rpm). To study the metabolic flexibility of the evolved and ancestral strains, different temperatures were used (16, 20, 24, 32 and 34°C).

Fermentation cs was red by calculation of the amount of C02 released determined by weighing the fermenters manually. All fermentation experiments were performed in triplicate. Extracellular metabolites and volatile compounds were assayed at the end of the fermentation.

Wine fermentation (Pilot scale). Pilot-scale fermentations were performed in 1 hL cylindrical stainless—steel tanks with Grenache y grape must. This grape must contains 269 g/L 1O sugars and 186 mg/L nitrogen and was flash pasteurized and stored at 2°C before fermentation. Grenache must was inoculated at 25 g/hL with EC1118 and K300.1(b) active dry yeasts (Lallemand, Toulouse, France). C02 production was determined using a Brooks 5810 TR series gas flowmeter (Brooks instrument, PA, USA), as described by Aguera and rolles. Fermentations were carried out under isothermal conditions at 28°C. Dissolved oxygen was added during fermentation to limit the risk of stuck fermentation. A transfer of 4 mg/L, 7 mglL and 10 mg/L oxygen was performed when the C02 released reached 7.2 g/L, 13.5 g/L and 45 g/L respectively. Nitrogen (72 mg/L) was added under the form of 15 g/hL DAP and 30 g/hL FermaidE at 45g/L of 002 released.

Viability of d strains. Ancestral and evolved cells were grown in 50 mL of YPGIuKCl (1% bacto yeast extract, 2% bactopeptone, 8% glucose and 2.4 M KCl) ated at 0.1 ODeoo/mL from an overnight preculture in YPD. The size of the cell population, extracellular metabolites and viability were followed for 7 days. The assays were performed in triplicate. ity was determined using a flow cytometer (Accuri, BD Biosciences) to count 20 000 cells diluted and washed in 300 pL 1x PBS (137 mmol/L NaCl -Aldrich), 2.7 mmol/L KCl, 100 mmol/L NagHPO4 (Sigma), 2 mmol/L KH2P04 ), pH 7.5) with 3 uL of propidium iodide ochem) previously diluted to 0.1 mg/mL in sterile water.

Analytical methods. Cell densities were determined by measuring the OD600 with a Secomam UVlLine 9400 or by using a Coulter ZBI cell counter linked to a C56 Channelyzer fitted with a probe with a 100 mm aperture (Beckman Coulter). Dry weight was determined gravimetrically by filtering 10 mL of sample (pore size 0.45 pm, Millipore) and drying the sample for 24 h at 100°C. Extracellular glucose, glycerol, ethanol, pyruvate, succinate and acetate concentrations were determined by high-pressure liquid chromatography (HPLC), using an HPX-87H ion exclusion column (Bio-Rad). Volatile compounds (acetoin and 2,3—butanediol) were assayed by gas chromatography (GC). Acetoin and diol were extracted into chloroform according to the uer—Hener protocol with the ing modifications: 1 mL W0 20151114115 _ 23 _ of l (Sigma) as an internal standard (1 :1000 v/v) in 10% ethanol (VWR) was added to 1 mL of sample. The c phase was dried and 1 uL was injected into a 30m megabore column (DBWAX, JandW Scientific) on a GC apparatus HP 6890. The acetaldehyde concentrations were determined enzymatically according to the Lundquist method. For pilot- scale experiments, glucose and fructose concentrations were determined enzymatically. The ethanol concentration was determined by measuring density, the volatile acidity by the henol blue method, the 802 concentration by iodometry and total acidity by ion.

The osmolality was measured using a Vapro 5520 device (Wescor) with a sample volume of uL.

Adaptive evolution under hyperosmotic KCI—medium and isolation of high—glycerol—producing evolved strains. To evolve strain E01118, batch es in YPD 8% glucose with a gradual increase of osmotic stress were performed. KCl stress was chosen because it generates osmotic and salt stress but unlike NaCl does not cause cation toxicity. A high sugar concentration (8%) was used to maintain good fermentative performances of the evolved strain in rich sugar medium. in preliminary experiments, the effect of various KCl concentrations was tested on EC1118 growth and it was found that the addition of 1.25 M KCI on YPD 8% glucose reduced the growth of EC1118 four times (data not . The adaptive laboratory ion (ALE) experiments were d in YPD 8% glucose containing 1.25 M KCI. The osmolality of this medium is 2 105 mmollkg, compared to 480 mmollkg for YPD 8% glucose. The concentrations of KCI were progressively sed up to 2.4 M, corresponding to an osmolality of 3730 mmollkg and maintained at that level thereafter.

Duplicate ALE experiments were performed for each condition and one control ALE experiment, t osmotic stress, was done.

Samples collected after 100, 200, 800 and 400 generations were ﬁrst analysed to monitor the dynamics of each evolution experiment. Yeast cells were plated on YPD and the populations obtained were characterized during fermentation of the synthetic must M8210 at 28°C. The glycerol concentration in the growth medium was measured at the end of the fermentation as a first indicator of the success or failure of the adaptation. Adaptation on KCl medium generated evolved populations with increased glycerol production during wine fermentation (Figure 1) whereas no increase of glycerol was ed in the control experiment (evolution of E01118 t ). A similar increase in glycerol production was observed in the two parallel KCI ments (a) and (b). in fermentations with both (a) and (b) lineages, the concentration of glycerol produced by fermentation reached 12 g/L for evolved populations at 200 generations; the value for the ral EC1118 was 8.5 g/L. The KCI—ALE experiment little variation in was pursued for 450 generations (total duration of almost 2 years), but only glycerol tion was observed after 200 generations (data not shown).

First characterization of the d strains during wine fermentation. After several generations, due to the natural accumulation of mutations, a non-homogeneous population of yeasts should be present in samples obtained from ALE experiments. Yeast populations sampled after different times of the KCl—ALE ment were subcultured 0n YPD. These subclones, hereafter called evolved strains, were characterized during wine fermentation on M8210 medium e 1). All the evolved s obtained after 200 generations produced more glycerol than the ancestral strain; glycerol production remained stable after 200 1O generations. Consistent with the re—routlng of carbons and NADH oxidation resulting from increased glycerol tion, all evolved s showed a reduced l yield. The ethanol yield was between 0.440 and 0.450 for the evolved strains and 0.464 for the reference ancestral strain (Figure 1 A and B). The evolved mutants showed reduced sugar consumption e 1 C and D). Thus, there was a correlation between high glycerol yield, reduced l yield and diminution of fermentative properties. A detailed study of six KCl— evolved strains from tions isolated after 200, 250 and 300 generations, including three from lineage (a): K200.1(a), K250.1(a), K300.2(a) and three from e (b): K200.1(b), K250.3(b), K300.1(b) was undertaken. Yeast strain K300.1(b) (also named Lowa3 herein) was registered under CNCM I—4684 as a biological deposit in the Collection National de Cultures de Microorganismes (CNCM) of the lnstitut Pasteur on October 18, 2012. Yeast strain K250.3(b) (also named Lowa2 herein) was registered under CNCM l-4685 as a biological deposit in the Collection National de Cultures de Microorganismes (CNCM) of the lnstitut Pasteur on October 18, 2012.

High—giycerol—producing strains e better in conditions of osmotic stress and carbon restriction. The resistance of the evolved strains to hyperosmotic stress was assessed by growth on KCl, NaCl or sorbitol SD plates. ln these ions, no significant differences in growth were observed between E01118 and the evolved s (Figure 2): under the ions of the ALE experiment (YPD 80 g/L glucose, 2.4 M KCI), the specific growth rate and maximal cell number reached by the evolved s were similar to those of the ancestral strain. Therefore, yeast cells that evolved in these conditions did not display growth adaptation to osmotic stress. it was then examined whether other components of fitness, such as viability, had been improved during the evolution experiment. Cell viability was monitored during culture involving a 7-day transfer cycle in the conditions of the evolution experiment (YPD 80 g/L glucose, 2.4 M KCl). After complete glucose exhaustion (about 4 days), the evolved mutants survived better than the ancestral strain. After 7 days _ 25 _ (corresponding to the time of transfer to fresh medium during the evolution experiment), almost all E01118 cells had died, whereas the number of viable cells of the d mutants was considerably higher (Figure 2). The ity of the evolved mutants at 7 days correlated with glycerol production at the same time—point (data not shown). Therefore, the main adaptation to the selective re put on yeast cells during the adaptive evolution experiment appeared to be improved survival in conditions of salt stress and carbon restriction. terization of the seiected KCI-evo/ved strains during wine fermentation. The characteristics of the six ed KCI-evolved strains and the ancestral strain were studied 1O in detail during wine fermentation in anaerobic batch cultures on MS medium. All the strains were able to te the fermentation, although the duration of the fermentation differed between the evolved s (Tabie 1). Two evolved s, K200.1(b) and K300.1(b), consumed all the sugar in less than two weeks, like the ancestral strain, whereas one month or more was required for the four other evolved strains (sugar was completely exhausted only after 40 days by K250.1(a) and K300.2(a)).

The fermentation rate of two evolved strains having distinct fermentation capacity, K300.2(a) and K300.1(b), is shown in Figure 3A. The evolved strains ted an overall decrease of fermentation performance in comparison to the ancestral strain, which is consistent with the reduced sugar consumption observed before, but were nevertheless able to complete the fermentation. Final cell population was the same between ancestral and these two evolved strains despite that K300.2(a) showed a slower growth than (b) (Figure BB).

The concentration of the most abundant by—products was determined after 30 days of fermentation (Table 1). Carbon and redox balances were close to 100% for all strains. All evolved strains produced glycerol at trations 48 to 67% higher than that produced by E01118, and the ethanol content in the synthetic wines was 0.45 to 0.80% (v/v) lower. The evolved strains also ed greater amounts of succinate, 2,3-butanediol and acetaldehyde than the ancestral strain. Succinate production by K200.1(a) and K300.2(a) was 22% and 88.9% higher, than that by E01118; the production of acetaldehyde by K200.1(a) and K300.2(a) was 45.5% to 181.8% higher, respectively, and that of 2,3- butanediol by 93% to 255.6% higher. The tration of these compounds was also increased in strains overexpressing GPD1 coding for the glycerol 3-P dehydrogenase, in which the carbon flux is redirected s glycerol formation at the expense of ethanol (Michnick et al., Remize et al., Cambon et al.). By contrast, unlike previously described engineered strains, no significant changes in the production of acetate and acetoin by the d s was observed.

WO 2015114115 Although similar phenotypes were observed for the two replicates, lineage (b) was characterized by slightly greater glycerol production and better fermentative performances.

K300.1(b) was the most promising evolved strain obtained in terms of fermentation capacity and production of glycerol, succinate, 2,3—butanediol and ethanol.

Metabolic properties of the evolved strain K3001 (b) at various temperatures on tic and l grape musts. Wine can be produced in a large range of fermentation temperatures, usually from 16°C (for white wines) to 28°C and more (for red wines). The metabolic properties of the ancestral strain and the evolved strain (b) were compared over a wide range of temperatures (16, 20, 24, 28, 32 and 34°C) in M8210 medium 1O containing 260 g/L sugars. For temperatures between 16 and 28°C, both strains consumed all or most of the sugar, while for the two highest temperatures, a residual sugar tration of 43 and 53 g/L for EC1118 and 47 and 59 g/L for K300.1(b) was observed at 32 and 34°C respectively.

The yields of by—products were determined after 30 days of fermentation (Figure 4). At all atures, K300.1(b) was y differentiated from EC1118 on the basis of high glycerol, high succinate and low ethanol yields. The yields of glycerol and succinate increased with increasing temperature, s the ethanol yield decreased. The differences between atures were larger for K300.1(b) than for EC1118, in particular for the three highest temperatures. The ethanol content was reduced by 0.14% (v/v), 0.18% (v/v) and 0.24% (v/v) at 16°C, 20°C and 24°C and by 0.61% (v/v), 0.80% (v/v), 0.87% (v/v) at 28°C, 32°C and 34°C tively with the evolved strain compared to . Therefore, a metabolic shift was observed between 24°C and 28°C. To e whether a similar behavior can be observed on natural must, fermentation was carried out in Chardonnay- Coursan, under similar conditions, at 24°C and 28°C. Under these conditions, the ethanol level was reduced by 0.12% (v/v) at 24°C and 0.42% (Viv) at 28°C, conﬁrming the results obtained in synthetic must. These results highlight a more flexible metabolism in the evolved strain regarding ature, with the reduction of ethanol yield maximized at a temperature of 28 °C and above.

WO 2013114115 98:8me 3:88. mdﬁmdmm VHO: v.0.ﬂo.v wdwoé: m.o.ITN.:\ VOHNé Nodﬂmﬁo TOHOé mod CC oodﬂocé mdﬂwdm odﬂu©m mcﬁbm 3%.:me m. m.

EmeN 5 820$ NHN: 0.33 :3: Noam? 2"? 5.38.0 N33 U: wdwﬁom rﬂxwm e wSFOM 3:85. OHN: moi: 33¢: 093.2 2mm: 5.38.0 to"? Sodﬂmodmoodﬁmmqo rdﬁodmm U: :20"de @6va wdﬁmdm INN] couﬁcmctﬁ 3:".ch Qmﬂm. rﬁmo.‘ SHE :3: 33$ tour EN 2 8.32.0 0.91;. 506$de U: SMOHwoe r NNHONm Wmﬂmkm mmeLmE @3me QVHNomN m. bcm VHO: we": 33: 23.3 2:3 5.38.0 0.03.0 Noodﬁmmod U: d QNHNNm FNHmNm n$0922 .OowN 325% v. m. 39me EN: $35 :3: 2mm? tom: 8.38.0 33.0 50.0350 Uc modﬁooe wdﬂmdm ~69.me x82 .mmOQEm coemo doomm 3:8 v.0HmdmN 03.: to": 330$ :33 0.03.0 2:33 N630 5035.0 U: Nodﬂmvd QOHonAﬁov wdﬂwﬁm 69:03me A0892 Ago :0 wuczanoo @8029 $009 moccﬂwn .r cozﬂcmctﬂ amocﬁmn was Ems. UmEEswcoo ~00 $985 6:26 .983 928$ @523 938m ouémuﬁmom ngom _o_b®cmSQ-m"N congmo xoumm or or ON .3836 moodwovvd Sodwvmod deﬁwmdv : 3.33.: 35% m.3m.o 033 .3836 D6 8:9039 moodﬂvvd Sodavmod mmdﬂod: mmdwmﬁi 3.3%.: m. m. £29: m5 393 3: :09th Ucm moodﬂnvio od 3.033.: 8.0353 3.3%.: 95 30:85-3 :33 330.0 9.03933 lel owodﬂomvd Noodﬁomod mwdﬁmod: vmdﬂumér 3.3%.: conﬁcogﬂ 0.333 33% :ozﬂcmrEﬂ B mvd Sodﬂmod :.oﬂ.m. 96 : NWQHvQE :33: @353 033 coemo 8:90:32 EmEmocm>cw voodﬁomvd od modﬁmm. mtoamwi‘ 8.33.: 9: : 333 33 5938 $058 0:9 03$ .omﬁcmema comwmwcmctm: Noodﬂvmvd ooodwmmod BdHSN modﬁmmbr 538.: 9: 9: E :33 :33 mﬁcmmmamg 85359 cmmmmaxm 33:. $3 E 965 w>mu @ov 29 $9 SVV m: on onm>\_o_oo>_m> 223$; .6: 5% 5% av .893 $.33 333 8:38 mocﬂmn 98:38 859% 3938:: 6:26 10m; _9mo>_m> £9.26 mmoogm 3%: 6.639 339mm: 59ng xowmm Ho: 50m 36:55 .mzcﬂoa vawmmE 8528.2 a n ".8 . : 3 3 2‘ m_\ ON _ 29 _ Pilot-scale ment of the evolved strain K3001 (b). To validate the results obtained at laboratory scale, the behavior and the metabolic ties of K300.1(b) and EC1118 were compared during pilot scale fermentation, using a Grenache grape must, at 28°C (Table 2).

Table 2. Characteristics of wines obtained by tation of Grenache must with EC1118 and K300.1(b) at pilot scale (1 hL). ASV was ined by distillation and electronic densitometry.

EC1118 (b) residual sugars (g/L) 0.2 0.5 1O volatil acidity (g/L) 0.50 0.36 total acidity (g/L) 4.10 4.40 ASV % v/v) 16.26 15.80 pH 3.60 3.57 free 802 (g/L) 0.07 0.07 total 802(g/L) 0.035 0.039 dehyde (g/L) 0.021 0.030 malate (g/L) 1.35 1.38 succinate (g/L) 1.04 1.43 acetate (g/L) 0.47 0.31 glycerol (g/L) 10.8 14.2 To be as close as possible to industrial conditions, the strains K300.1(b) and EC1118 were used in the form of active dry yeast and inoculated after a standard rehydration procedure.

To avoid stuck fermentation, oxygen and nitrogen were added during fermentation (Figure 5).

The evolved strain had a fermentation rate slightly lower than EC1118, but was able to complete the fermentation, despite the high sugar concentration (270 g/L). The evolved strain ed more glycerol (14.2 g/L versus 10.8 g/L) and succinate than EC1118, and less ethanol, ing in a reduction of 0.46% (v/v) of the ethanol content. These results are in agreement with those obtained at laboratory scale. The production of acetic acid and volatile acidity by the evolved strain was clearly lower than for EC1118. The production of acetic acid for both strains was much lower than on synthetic must, which is in agreement with previous observations. In summary, the results obtained in grape must at pilot-scale confirm the metabolic reprogramming of the evolved strain, and the analysis of the wine obtained did not reveal e side effects.

W0 2015Ill4115 - 30 _ in this study, adaptive laboratory evolution (ALE) was used to develop low-alcohol wine yeasts by redirecting the metabolism of strain EC1118 towards glycerol. Yeast cultures were serially transferred in hyperosmotic ions during 450 tions using KCI as osmo- and tress salt. The stress imposed was severe, from osmolalities of 2 105 to 3 730 mmol/kg. These levels of stress are above those generally used in laboratory ions to study responses to osmotic stress (20 g/L glucose, 1.2 M NaCl, corresponding to an osmolality of 2 070 mmol/kg). The KCI stress generated strains in which the carbon flux was re—directed towards glycerol. in another experiment, sorbitol was used as an osmotic salt (from 1.5 to 2.4 g/L corresponding to 1 480 to 2 105 mmol/kg), but these conditions failed to 1O generate strains with increased glycerol production (data not shown). This clear difference in effect may be a consequence of the different natures of the stress salt (salt versus osmotic ), and/or the higher level of stress in the KCl-ALE experiment than the sorbitol—ALE experiment. The evolved strains obtained from the KCl—ALE experiment were not more resistant than the ancestral strain to osmotic or salt stress, but showed a gain of fitness due to a better viability under conditions of salt stress and carbon tion, the conditions in which cells were transferred to a fresh medium. No increase in glycerol production was observed in the ALE control experiment with EC1118 without KCl stress (data not shown). ore, it is likely that the redirection of carbon fluxes towards glycerol was driven by the combination of high KCI concentration and carbon starvation stresses.

The link between al and glycerol is intriguing. Usually, cells die after the culture enters the stationary phase, when one or all of the nutrients are missing. However, if the only nutrient missing is the carbon source, cells e longer. Without wishing to be bound to theory, it is stipulated that, under carbon limitation, nutrient sensing depends on Sch9, Tor, and Ras proteins that are activated and converge on the protein kinase Rim15; Rim15 regulates the ription factors Msn4/Msn2 and Gist, ed in cellular protection and longevity, also called chronological life span (CLS). Recent work indicates that glycerol production is required for CLS regulation), and various distinct mechanisms have been suggested. Unlike glucose and ethanol, glycerol does not inhibit the transactivation of Msn2/Msn4 and Gist, which play ant roles in general stress resistance and longevity. r, glycerol production may affect aging through the modulation of the intracellular redox balance, because its production contributes to the maintenance of the NADVNADH ratio. Overexpression of the malate-aspartate NADH e was also demonstrated to extend the CLS. Also, high osmolarity has been ated to extend the life span by ting Hog1, leading to an increase in the biosynthesis of glycerol from glycolytic intermediates. Links between aging and redox metabolism during wine fermentation have also been highlighted.

W0 20151114115 _ 31 _ The detailed characterization of the olved mutants during wine fermentation revealed that the evolved strains had one substantial changes to their central carbon metabolism: carbons in these strains are mainly re-routed towards glycerol, succinate and 2,3—butanediol at the expense of ethanol. The absence of stress resistance phenotype and the ed fitness under carbon restricted and stress conditions suggest that the primary target of evolution is not the HOG pathway. The origin of the observed phenotype might rely on indirect mutations disturbing the redox balance, causing a redirection of carbon flux. Other factors such as a lower e uptake rate might also play a role in the phenotype. Indeed, the net flux h the TCA cycle increased significantly with sing glucose uptake, 1O which is reminiscent of the increased ate production and lower fermentation rate in the evolved strains. On the other hand, it was previously shown that glycerol tion is less dependent on rate of glucose uptake and more influenced by environmental conditions.

Other studies using genome—wide approaches may be required to elucidate the underlying mechanisms.

As observed previously in engineered strains overexpressing GPD1 (Michnick et al., Remize et al., Cambon et at), increased glycerol production is associated with a reduction of ethanol synthesis due to lower carbon availability and NADH shortage, and this is accompanied by bations at the acetaldehyde and pyruvate nodes. For e, strains overexpressing GPD7, and producing large amounts of glycerol but low l , accumulate succinate and 2,3—butanediol but also undesirable compounds including acetaldehyde, acetate and acetoin (Remize et al., Cambon et al.). The evolved strain described herein did not accumulate high levels of these compounds, possibly due, for example, to the smaller increase in ol production than in the engineered strains, and/or to a different metabolic strategy. In yeast, n is reduced to 2,3—butanediol by the 2,3~butanediol dehydrogenase. it was previously showed that the balance between acetoin and 2,3—butanediol in the engineered s can be ced by the amounts of glycerol produced. In strains producing high glycerol levels, acetoin accumulated because of the limited capacity of the 2,3 butanediol dehydrogenase and the decreased availability of NADH, as this cofactor is mainlyre-oxidized through glycerol synthesis. In a previous study (Michnick at at), it was found that strains overproducing glycerol at moderate levels (such as W18GPD1 or W6GPD1), comparable to the evolved mutants characterized herein, did not accumulate acetoin. As the evolved strains, these strains also accumulated dehyde at low levels, which can be explained by a limitation of the alcohol dehydrogenase. These levels remain in the range of usual trations in wines and are unlikely to cause a sensory problem. In contrast, the reduced accumulation of acetate by the evolved mutants is surprising because there was acetate accumulation in all cases, independent of the level of glycerol WO 2015114115 _ 32 _ accumulated by the GPD1 s (Blomberg et al.). This suggests that the modifications of the metabolic network in the evolved mutants differ from those in the genetically engineered strains. Without wishing to be bound to theory, another major difference involves the compromised tation performances of the evolved strains, ting that the mutations responsible for the re—routing of metabolism in these strains also negatively affect the glycolytic rate. This finding contrasts with the improved fermentation performances of GPD1 strains during the stationary phase of wine fermentation.

It is thus hypothesized that adaptive evolution resulted in the utilization of routes different to those operating in rationally engineered strains. The present disclosure provides the first description of a non-GMO gy allowing a substantial increase in glycerol production and decrease in the l yield of a commercial wine yeast strain. A much higher diversion of carbon was obtained when compare to previous attempts to divert carbons towards the pentose phosphate pathway or towards glycerol by adaptive ion using sulfites (Kutyna et at). Consequently, the reduction in the ethanol content in of wine produced with our strains was at least 0.5% (v/v) from 260 g/L sugars. Despite the lower fermentation performances of the evolved strains, evolved isolates with only ly affected fermentation kinetics were selected. A first assessment of the potential value of the d strain K300.1(b) for winemaking revealed similar characteristics in synthetic and natural grape musts, except that acetate production was reduced in wines obtained from grape musts.

Interestingly, d strain K300.1(b) has a higher lic flexibility than the ral strain with respect to temperature, with metabolic differences between the two strains being st at temperatures higher than 24°C. This suggests that the evolved strain might be particularly useful for the production of red wines, which are usually produced in a ature range of 25—30°C and are most affected by excessive alcohol levels.

The present exemple demonstrates that the adaptive ion strategy used herein is a valuable alternative to rational engineering for the generation of non—GMO, low-ethanol producing yeast. Although the diversion of carbon flux ed is not as high as that achieved by genetic engineering, a reduction of the alcohol content of wine by 0.5 to 1% (v/v) offers interesting perspectives. A preliminary wine tasting by a panel of seven wine s did not revealed any defect of the wines ed at pilot scale, confirming the good overall attributes of the evolved strains reported in this study.

EXAMPLE II — SECOND GENERATION OF LOW-ETHANOL PRODUCING YEASTS OBTAINED BY BREEDING The S. cerevisiae strain K300.1(b) ned and characterized in Example I and renamed Lowa3 in e II) was cultured (2 days at 28°C)«in a presporulation GNA medium _ 33 _ (BactoYeast extract 1 %, BactoPeptone 2 %, glucose 20 %, agar 2 %). The Lowa3 strain was then transferred in a sporulation spoMA medium (BactoYeastExtract 0,1 %, glucose 0,05 %, potassium e 1 %, adenine 0,002 %) and cultured between 3 to 15 days at room temperaure (about 20°C) to e asci. The asci obtained were isolated and incubated with the digestive juice of the snail Helix Pomatia (1/6 dilution) for 20 to 60 min at 28°C. The asci were dissected with a dissection microscope (Singer MSM300) to isolate the spores. With this method, about 700 spores were isolated.

Since the S. cerevisiae strain EC1118 and the Lowa3 strain are heterozygotes for the H0 gene, it is ed that half of the progeny will be haploid, whereas the other half of the 1O progeny will be diploid. As such, a PCR selection was undertaken to select the haploid progeny (e.g., HO"') of the Lowa3 strain. The PCR was performed on a part of a colony the diluted in 50 uL of sterile water and heated for 10 min at 95°C to liberate the DNA. Five (5) uL of the aqueous DNA mixture was admixed to 10x Taq buffer (with (NH4)2SO4; 2,5 uL), 25 mM MgC12 (2,5 uL), 10 mM dNTPs (0,5 uL), the MAT-F primer (1 uL), the MATa~R or MATalpha~R primer (1 uL), Taq polymerase (Fermentas, 0.25 uL) and water to obtain a final volume of 25 pL. The following oligonucleotides were used to distinguish between the MATa and ha genes : Mat F (5’- AGTCACATCAAGATCGTTTATGG ~3’) (SEQ ID NO : 1), Mat a-R (5’- ACTCCACTTCAAGTAAGAGTTTG -3‘, generating a 504 bp amplicon of the MATa gene) (SEQ ID NO : 2) and Mat alpha—R (5’- AATATGGGACTACTTCG -3’, generating a 404 bp amplicon of the MATalpha gene) (SEQ ID NO: 3). The PCR was conducted during 30 cycles using a denaturation temperature of 94°C (for 1 min), an hybridization temperature of 55°C (for 1 min) and an elongation temperature of 72°C (for 1 min).

Using the PCR selection, 156 d spores of the Lowa3 strain were obtained. The phenotype of the haploid spores was further characterized during wine fermentation. Several wine fermentations were conducted in 330 mL fermenters containing 300 mL synthetic must , 260 g/L glucose) under agitation. After 15 and 30 days of fermentation at 28°C, a sample of the supernatant was obtained to determine the glycerol concentration. The different haploid strains were classified in function of their glycerol tion (which is inversely proportional to their ethanol production). The best strain of the MATa mating type, named 5074, produced 20,9 g/L glycerol. The best strain of the MATalpha mating type, named 5049, produced 16,2 g/L glycerol. Strains 5074 and 5049 were selected for further breeding.

Both strains were cultured to be in their growth phase and were ted in a YPD medium (BactoYeast extract 1 %, BactoPeptone 2 %, glucose 2 %, agar 2 %). A first hybrid was WO 2013114115 _ 34 _ obtained, named VT1 (H1 generation ). The dipioid nature of the VT1 hybrid was confirmed by the absence of breeding when it was placed in contact with a strain of the MATa mating type and with a strain of the MATaIpha mating type.

Spores of the hybrid strain VT1 were ted with the medium GNA and spoMA as described above. A stable haploid spore of the hybrid VT1 strain, named MP120-A4 was selected based on its MATaIpha mating type. The strain MP120—A4 was bred with the strain 5074 to obtain the strain MP112-A5 (H2 generation hybrid). Strain MP112-A5 (also referred as H2) was registered under CNCM [-4832 as a ical deposit in the Collection National de Cultures de Microorganismes (CNCM) of the lnstitut r on y 9, 2014. 1O The various strains obtained were further terized using a laboratory scale or pilot scale wine fermentation, as described in Example I, and following the kinetics of each fermentations.

Fermentation trial N1. A synthetic must was used and has an initial concentration in sugar of 235 g/L (117,5 g/L of glucose and 117,5 g/L of fructose). The initial concentration in available nitrogen in this tic must was 300 mg/L. Ail the fermentations were conducted in isotherm conditions at 28°C, in 1,1 L~containing fermenters.

As shown on Figure 6, 112-A5 (H2) was compared with E01118 to ferment the same must with a 14% v/v potential alcohol. As previously described, the fermentation kinetic profiles are very different on the exponential phase with a better fermentation rate of EC1118. The evolved yeast strain (112—A5) had a iong stationary phase and completed the tation much later than EC1118. However, the fermentation went to s, meaning there is no residual sugars. This is confirmed by the analysis in Table 4. The use of 112—A5 allowed to ferment with a significant lower final ethanol level. Another difference is observed on the final acetate content which is significantly iower with 112—A5. Further differences n the fermentations obtained using the EC1118 or the 112—A5 strains are presented at Table 4.

Table 4. Analysis of various constituents of the fermented wine obtained at fermentation triai N1 using the EC1118 or the 112~A5 strains. The glycerol content was not determined.

Sugar/Ethanol e Residual yield content (gIL) sugars (gIL) EC1118 16,67 W0 2015f114115 Fermentation trial N2. A synthetic must was used and has an initial concentration in sugar of 260 g/L (130 g/L of glucose and 130 g/L of fructose). The initial concentration in available nitrogen in this synthetic must was 300 mg/L. All the fermentations were conducted in isotherm conditions at 28°C, in 1,1 L-containing fermenters.

As shown on Figure 7, 112-A5 (H2) was ed with E01118 to ferment the same must with a 15.6 % v/v potential alcohol. As previously described, the fermentation kinetic profiles are very different on the exponential phase with a better fermentation rate of E01118. The evolved yeast strain 5) had a long stationary phase and completed the fermentation much later than E01118. r, the fermentation went to dryness, meaning there is no 1O residual sugars. This is med by the is in Table 5. The use of 112—A5 allowed to ferment with a significant lower final ethanol level. Another difference is observed on the final acetate content which is significantly lower with 112—A5. Further differences between the fermentations using the E01118 or the 112-A5 strains are presented at Table 5.

Table 5. Analysis of various tuents of the fermented wine obtained in fermentation trial N2 using the EC1118 or the 112-A5 strains. The glycerol content was not determined.

Sugar/Ethanol Acetate Residual ASV (% vlv) yield_ content (glL) sugars (glL) E01118 16,7 15,56 0,68 ) 0,4 H2 17,6 14,75 1 0,51 ‘ 1,0 Fermentation triai' N3. A Syrah variety grape must was used in this pilot scale fermentation trial. The must was flash pasteurized and stored at 2°C prior to fermentation. Prior to fermentation, the Syrah must had the following characteristics: 255 g/L of total sugars, 3,50 g/L H2804 of total acidity, pH = 3,63, 138 mg/L of available nitrogen and a turbidity of 77 NTU. Prior to fermentation, and as indicated in Example I, the yeasts were rehydrated.

Further, during fermentation, the must was supplemented with oxygen and nitrogen (as indicated in Example I). All the fermentations were ted in isotherm conditions at 28°C, in 1 hL-containing fermenters. Afterwards, the wines were bottled.

Figure 8 shows the fermentative kinetics of EC1118, K300.1(b) ) and 112—A5 (H2) in real , in enological conditions. The es are different but the performances on the total fermentation duration quite similar, showing a delay of only 20 h for the fermentation with 112—A5. This confirms that 112—A5 is suitable to ferment high sugar grapes till s, without stuck or sluggish fermentations. This is confirmed by the analysis of the classical enological parameters reported in table 6A and 68.The final ethanol level shows a decrease of more than 1% for the wine ted with 112-A5, with a higher glycerol production and a very low acetate production (not ed). Further differences between the fermentations using the EC1118 or the 112—A5 strains are presented at Tables 6.

Table 6A. Kinetics parameters of the wine fermentation using the EC1118 or the 112-A5 strains in tation trial N3.

Time of Latency period Vmax (glLlh) al fermentation (h) after addition sugars (g/L) trial. (h) 8 11 I 2,13 0,3 130 I I j 112-A5 1 1,47 0,4 150 Tables 68. Analysis of various constituents of the fermented wine obtained in fermentation trial N3 using the E01118, the K300.1(b) or the 112-A5 (H2) strains. Measurements were done in triplicates.

EC1118 K300.1(b) H2 Main compounds (gIL) ed sugar 254.6:O.1 0.0 254.7:O.2 ethanol 118.4:1.2 09 107.8:0.8 ol 108:0.4 14.1:O.4 17.9:0.8 succinate 1.3:01 1.8:01 15:01 pyruvate 0.13:001 016:001 015:0.01 acetate 05:01 01:00 nd dehyde 0016:0008 0021:0001 0020:0006 acetoin nd nd 0024:0005 2,3-butanediol 1.11:018 1.98:0.38 3.93:0.30 YEtOH 0465:0005 0446:0003 0423:0003 Yglycerol 0042:0002 0055:0000 0070:0003 Yglycerol/YEtOH (%) 9.09:0.34 1237:005 16.57:084 ethanol (%(v/v)) 1501:015 14.40:011 13.67:.010 glucose (9) for 1%(v/v) ethanol 16.99:007 17.71:0O7 18.66:0.08 nd: not detected (< 10 mg/mL) While the invention has been described in connection with specific embodiments thereof, it will be understood that the scope of the claims should not be limited by the preferred _ 37 _ embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.

REFERENCES Aguera E, Sablayrolles JM. Pilot scale vinifications (100L). ill Controlled tation. Wine lnternet Tech. J. 8.

Bely M, Sablayrolles JM, Barre P. 1990. Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentation in oenological conditions. J. t. Bioeng. 70:246—252.

Blomberg A, Adler L. 1992. Physiology of osmotolerance in fungi. Adv. Microb. Physiol. 1O 33:145—212.

Cambon B, Monteil V, Remize F, Camarasa C, Dequin S. 2006. Effects of GPD1 overexpression in Saccharomyces cerevisiae commercial wine yeast strains lacking ALD6 genes. Appl. Environ. Microbiol. 72:4688—4694.

Hagenauer—Hener U, Henn D, Fettmar F, Mosandl A, Schmitt A. 1990. 2,3 Butanediol- Direkte Bestimmung der Stereoisomeren im Wein. Dtsch Leb. Rundsch 273—276.

Kutyna DR, Varela C, Stanley GA, Borneman AR, Henschke PA, Chambers PJ. 2012.

Adaptive ion of romyces cerevisiae to te strains with enhanced glycerol tion. Appl. Microbiol. Biotechnol. 5—1184.

Lundquist F. Acetaldehyd: Bestimmung mit Aldehyd—dehydrogenase. Methods of enzymatic analysis. Methods Enzym. Anal.

Michnick S, Roustan JL, Remize F, Barre P, Dequin S. 1997. Modulation of ol and ethanol yields during alcoholic fermentation in Saccharomyces cerevisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3—phosphate dehydrogenase. Yeast ster Engl. 13:783—793.

Remize F, Roustan JL, Sablayrolles JM, Barre P, Dequin D. 1999. Glycerol overproduction by engineered saccharomyces cerevisiae wine yeast strains leads to substantial changes in By—product ion and to a stimulation of fermentation rate in stationary phase. Appl.

Environ. Microbiol. 65:143—149.

Claims

WHAT IS CLAIMED IS:

1. A process for obtaining a variant yeast strain capable of producing, when compared to an ancestral yeast strain, more glycerol, less e and less ethanol during an alcoholic fermentation process on a grape must, said s comprising: a) culturing the ancestral yeast strain in a first culture medium comprising a salt capable of g an hyperosmotic stress to the ancestral yeast strain, n the ancestral yeast strain is cultured in increasing salt concentrations and under ions to achieve glucose depletion in the first culture medium so as to obtain a first cultured yeast strain; and b) culturing the first cultured yeast strain in a second e medium comprising the salt, wherein the first cultured yeast strain is cultured at a fixed salt concentration and under conditions to achieve glucose depletion in the second e medium so as to obtain the variant yeast strain; wherein • the salt has a counter-cation which is different than a sodium cation; and • the concentration of the salt in the second culture medium is higher than the concentration of the salt in the first culture medium.

2. The process of claim 1, wherein the concentration of the salt in the first culture medium is between about 1.25 M and less than about 2.4 M and/or in the second culture medium is at least about 2.4 M.

3. The process of claim 1 or 2, further sing, at step a), increasing the salt concentration weekly or monthly.

4. The process of any one of claims 1 to 3, wherein the first culture medium ses glucose and the process further comprises, at step a), culturing the ancestral yeast strain in the first culture medium in decreasing glucose concentrations.

5. The process of claim 4, wherein the concentration of glucose is decreased weekly or monthly and wherein the concentration of glucose in the first culture medium is between about 14.0% and about 8.0% (w/v).

6. The process of any one of claims 1 to 5, wherein the second culture medium comprises glucose and the process further comprises, at step b), ing the first cultured yeast at a fixed glucose concentration.

7. The process of claim 6, wherein the fixed glucose concentration of the second culture medium is 8.0% (w/v).

8. The process of any one of claims 1 to 7, further comprising mating d spores of the variant yeast strain to obtain a variant hybrid strain.

9. The process of any one of claims 1 to 8, n the salt has a potassium countercation.

10. The process of claim 9, wherein the salt is KCl.

11. The process of any one of claims 1 to 10, n the variant yeast strain is from a Saccharomyces species.

12. The process of claim 11, n the variant yeast strain is from a genus selected from the group consisting of Saccharomyces arboricolus, Saccharomyces eubayanus, romyces bayanus, Saccharomyces cerevisiae, Saccharomyces kudriadzevii , Saccharomyces mikatae, Saccharomyces xus, Saccharomyces pastorianus , Saccharomyces carsbergensis, Saccharomyces uvarum and interspecies hybrids.

13. A variant yeast strain ted at Institut Pasteur, on January 9, 2014, under accession number Collection Nationale des Cultures des Microorganismes (CNCM) I-4832.

14. A variant yeast strain deposited at Institut Pasteur, on October 18, 2012 under accession number tion Nationale des Cultures des Microorganismes (CNCM) I-4684.

15. A variant yeast strain deposited at Institut Pasteur, on October 18, 2012 under accession number Collection Nationale des Cultures des Microorganismes (CNCM) I-4685.

16. A variant yeast strain deposited at Institut Pasteur, on January 28, 2015 under ion number Collection Nationale des Cultures des Microorganismes (CNCM) I-4952.

17. A process for making a fermented product, said process comprising contacting the variant yeast strain of any one of claims 13 to 16 with a grape must.

18. The process of claim 17, wherein the fermented produce is wine.

19. The process of claim 18, wherein the wine is red wine.

20. The process of claim 1, substantially as herein described with reference to any one of the Examples and/or s thereof. WO 2015114115 16 051 £910 3%; 0'47 8 9 8 ' I045 53 <1) U 6 .;. 2 5:; 1 IEII 0,43 >— L9 4 :3: 2 31 3 I IIIEIIIII 041 0 I039 C)" o' o 3 E $- 11 IIII 0,476g f ZIIIIIIIIIII IEIIIIII II IIIIO,45§ I 0,43 >- III0,41 WO 2015f114115 33V 11 .985 20006420 88:6 Escamm AVE S91111 642086 1 00000 0 a. 006420 88:3 €85 2.2: 420 I. .2 EsEmmm mHAHUm AVAnA3A33AAAAAAAAAAAAAAAAAm AA V A VVAVVV mAV VV AV3 VV AV AV W259VVV VV WV 0mg; OOHXQ omﬁxm oomxm Adomx moomg ommgm ﬁommx Nommx Mommx Vommx nommx wommxW85805 A83 35 25 Vommé:9.vademgV25V835V25:VNAVAVE£23 W0 201521141 15 mL —e—- EC1118 +K300.2(a) —O—— K300.l(b) living x107 Number --— EC1118 (g/L/h) —- (a) —- K300.1(b) dCOZ/dt cells/mL of 107 Number —e— EC1118 +K300.2(a) -o— K300.1(b) WO 14115 9.8 uoom 9% uowm uomm uovm a a a m a a U02 uoom UOVN uowm uomm uowm 39:83 D m a a a a > 2:3 EVE 2:8 $th u 2 -C -—EC1118