CN111635866B - Method for inhibiting cell aggregation of pichia kudriavzevii strain, construction and application - Google Patents

Abstract

The invention discloses a method, construction and application for inhibiting cell aggregation of a pichia kudriavzevii strain, which can remarkably promote the growth of the pichia kudriavzevii strain under an extreme acid condition by adding arginine, relieve the cell aggregation, facilitate the transfer of oxygen and nutrient substances and improve the production performance of the strain during low-pH fermentation. The invention also constructs the pichia kudriana for inhibiting cell aggregation, which is a recombinant bacterium for over-expressing the ARGJ, the intracellular arginine content is improved by 26.3 percent, the biomass is obviously improved under the condition of pH2.0, the cell aggregation effect is obviously relieved, and the transfer of nutrient substances and oxygen is facilitated.

Description

Method for inhibiting cell aggregation of pichia kudriavzevii strain, construction and application

Technical Field

The invention relates to the technical field of yeast, and particularly relates to a method for inhibiting cell aggregation of pichia kudriavzevii strains, construction and application.

Background

When organic acid is produced by a fermentation method, along with accumulation of products, the organic acid enters microbial cells in a simple diffusion mode and is dissociated into acid radical ions and protons with charges, so that the intracellular pH (pHi) is reduced, the conformation of protein and the intracellular enzymatic reaction are influenced, active transmembrane transport using the protons as the driving force is also interfered, the absorption of nutrient substances by the microbial cells is influenced, and the fermentation performance is sharply reduced. The development of the low pH fermentation technology depending on an acid tolerant host can remarkably reduce or even abandon the use of a neutralizer, simplify the production process, reduce the risk of contamination, and save energy and material consumption, thereby realizing the construction of resource-saving and environment-friendly biological manufacturing. Pichia pastoris (Pichia kudriavzevii) is a common non-traditional yeast in food and plays an important role in the formation of flavor substances of external traditional fermented food in white spirit, pickles, cheese and the like. It has multiple tolerance to high temperature, osmotic pressure, ethanol, especially organic acid and low pH, and is considered as a potential new biotechnology host. In recent years, genetically engineered pichia kudriana has been reported in low pH fermentation of organic acids such as succinic acid, lactic acid, xylonic acid, and 3-hydroxypropionic acid and ethanol. However, Pichia kudriavzevii grows in a pseudo hyphal form under acidic conditions at pH less than 2.5 and aggregates with each other (as shown in FIG. 1), which is disadvantageous in the transfer of oxygen and nutrients and seriously affects the productivity of the strain in low pH fermentation.

Disclosure of Invention

The invention aims to provide a method, construction and application for inhibiting cell aggregation of pichia kudriavzevii strains. The invention can inhibit the cell aggregation of the pichia kudriavzevii strain and improve the fermentation performance.

In order to solve the technical problems, the technical scheme provided by the invention is as follows: a method for inhibiting the cell aggregation of a Pichia kudriavzevii strain is disclosed, wherein arginine is added to promote the growth of the Pichia kudriavzevii strain under the condition of low pH and relieve the cell aggregation.

The method for inhibiting the cell aggregation of the pichia kudriavzevii strain comprises the following components in mass concentration: glucose 20g/L, peptone 20g/L and yeast extract 10g/L, adjusting YPD medium pH to 2.5 or less with HCl or NaOH, autoclaving, and adding 5mmol/L arginine to the medium.

A Pichia pastoris for inhibiting cell aggregation, wherein a Pichia pastoris strain is a Pichia kudriavzevii N-X and over-expression ARG J gene construction recombinant strain; pichia kudriavzevii N-X is deposited in the China Center for Type Culture Collection (CCTCC); address: eight-path Lojia mountain in Wuchang district, Wuhan city, Hubei province, with the preservation number: CCTCC M2017759.

The application of the pichia kudriavzevii inhibiting cell aggregation in low-pH fermentation is provided.

The construction method of pichia kudriana for inhibiting cell aggregation comprises the following steps:

a. amplifying by using primers Pdc1F, Pdc1R and pichia pastoris N-X genomic DNA as templates to obtain a fragment containing a PDC1 gene promoter, a reading frame and a terminator, and connecting the fragment into a pMD19T vector; the primer Pdc1F is CGCGGATCCGCGTTTAAGTGGTGGTTGTA, and the primer Pdc1R is CGG GGTACCTGGT GAGA TTGATGGATTGT;

b. reverse amplification is carried out by using primers 0-F and 0-R; the primers 0-F are ACAGATAAGTACCTAGGGAGATT, and the primers 0-R are TGACATCT GAATGTAAAATGAAC;

c. primers 1-F and 1-R and a plasmid pGAPZB are used as templates for amplification to obtain bleomycin resistance gene BLE and a CYC1 terminator; the primers 1-F are acacagcaaaacacaaaaatATG GCCAAGTTGACCAGTGC; the primers 1-R are tatcgaaatctagcccGCAAATTAAAGCCTTCGA GC;

d. amplifying by using primers 2-F and 2-R and genome DNA as a template to obtain a pGAP promoter; the primer 2-F is tcgaaggctttaatttgcGGGCTAGATTTCGATATGGAT; the primers 2-R are gtagatt gcggaggacatTTTTTGTAATTGTGTTTGTTTGTGT;

e. amplifying by using primers 3-F and 3-R to obtain a target gene ARGJ; the primer 3-F is caaacacaattacaaaaaATGTTAAGACATGTTGCA; the primer 3-R is cattttacattcagatgtcaTCACGACCTGTAGTCTCCA;

f. using a Clon express Multi S One Step Cloning Kit to perform One-Step connection on the fragments to construct and obtain a recombinant integration expression vector pARGJ; and finally, transforming the recombinant plasmid subjected to BamH I enzyme digestion into an N-X strain by using a lithium acetate method, and screening positive transformants on a YPD plate containing 180 mu g/ml Zeocin to obtain the recombinant strain for over-expressing the ARG J.

Compared with the prior art, the invention can obviously promote the growth of the pichia kudriana under the extreme acid condition by adding the arginine, relieve the cell aggregation, facilitate the transfer of oxygen and nutrient substances and improve the production performance of the strain during low pH fermentation. The invention also constructs the pichia kudriana for inhibiting cell aggregation, which is a recombinant strain for over-expressing the ARGJ, the intracellular arginine content of the recombinant strain is improved by 26.3 percent, the biomass is obviously improved under the condition of pH2.0, the cell aggregation effect is obviously relieved, and the transfer of nutrient substances and oxygen is facilitated.

Drawings

FIG. 1 is a schematic representation of Pichia pastoris growth and inter-aggregation in pseudohyphal form under acidic conditions at pH less than 2.5;

FIG. 2 is a schematic diagram showing the cell spreading effect of Pichia kudriavzevii with arginine addition;

FIG. 3 is a schematic diagram showing the spreading effect of the Pichia pastoris strain suppressor constructed according to the present invention.

Detailed Description

The invention is further illustrated by the following figures and examples, which are not to be construed as limiting the invention.

Example 1: a method for inhibiting cell aggregation of Pichia pastoris strain comprises preparing 200mM arginine mother liquor, filtering, and sterilizing; the pichia kudriavzevii growth YPD culture medium comprises the following components in mass concentration: 20g/L of glucose, 20g/L of peptone and 10g/L of yeast extract; further, pH of YPD medium was adjusted by HCl or NaOH, and 5mmol/L arginine was added after autoclaving, and arginine was exogenously added to YPD medium under different pH conditions, as shown in FIG. 2. The results show that the addition of 5mmol/L arginine can significantly promote the growth of Pichia pastoris at low pH pressure. Meanwhile, pHi is remarkably improved in the presence of arginine, which shows that arginine has a positive effect on protecting Pichia pastoris against low pH pressure stress, and the cell aggregation effect is remarkably reduced when arginine is added.

Example 2: a constructing method of recombinant Pichia pastoris for inhibiting cell aggregation, which is to obtain a recombinant strain for over-expressing ARG J genes in Pichia pastoris strain N-X; wherein, the Pichia kudriavzevii N-X is preserved in China Center for Type Culture Collection (CCTCC); address: eight-path Lojia mountain in Wuchang district, Wuhan city, Hubei province, with the preservation number: CCTCC M2017759, gene accession number MT499446 of the ARG J gene; the method specifically comprises the following steps:

a. amplifying by using primers Pdc1F, Pdc1R and pichia pastoris N-X genomic DNA as templates to obtain a fragment containing a PDC1 gene promoter, a reading frame and a terminator, and connecting the fragment into a pMD19T vector; the primer Pdc1F is CGCGGATCCGCGTTTAAGTGGTGGTTGTA, and the primer Pdc1R is CGG GGTACCTGGT GAGA TTGATGGATTGT;

b. reverse amplification is carried out by using primers 0-F and 0-R; the primers 0-F are ACAGATAAGTACCTAGGGAGATT, and the primers 0-R are TGACATCT GAATGTAAAATGAAC;

c. primers 1-F and 1-R and a plasmid pGAPZB are used as templates for amplification to obtain bleomycin resistance gene BLE and a CYC1 terminator; the primers 1-F are acacagcaaaacacaaaaatATG GCCAAGTTGACCAGTGC; the primers 1-R are tatcgaaatctagcccGCAAATTAAAGCCTTCGA GC;

d. amplifying by using primers 2-F and 2-R and genome DNA as a template to obtain a pGAP promoter; the primer 2-F is tcgaaggctttaatttgcGGGCTAGATTTCGATATGGAT; the primers 2-R are gtagatt gcggaggacatTTTTTGTAATTGTGTTTGTTTGTGT;

e. amplifying by using primers 3-F and 3-R to obtain a target gene ARGJ; the primer 3-F is caaacacaattacaaaaaATGTTAAGACATGTTGCA; the primer 3-R is cattttacattcagatgtcaTCACGACCTGTAGTCTCCA;

f. using a Clon express Multi S One Step Cloning Kit to perform One-Step connection on the fragments to construct and obtain a recombinant integration expression vector pARGJ; and finally, transforming the recombinant plasmid subjected to BamH I enzyme digestion into an N-X strain by using a lithium acetate method, and screening positive transformants on a YPD plate containing 180 mu g/ml Zeocin to obtain the recombinant strain for over-expressing the ARG J, wherein the intracellular arginine content is improved by 26.3%.

The ARG J gene sequence:

ATGTTAAGACATGTTGCAAAGAGATCATTTGGATCGCTAGGAATCCCACAAAATAAGCTAAAGTATATTCCTAAAGGAGGATTCTACCCTAAGGGTTTCAAAGTAGGATCAGTAGCTTCCCATGTGAAGAAAACAGGAGCACCCGATCTAGCTTTAATTCATTCAGCCAAACCATGCACAGCTGCAGGTGTCTTTACGACTAACAAGTTCAAAGCAGCACctgttattgttgataaGGAAAACTTAACGCTCAAGAAAAACGAAGACTTCCATTCGATTATAATTAATTCAGGCTGTGCCAATGCTGTCACTGGAAACGGTGGGTTGTCGGATGCAAAGGACATCATAAACTACGTTGATAAAGCATTGCATGGAACAACATACCCTGTATCTAAAACACTGACAATGTCAACGGGTGTCATTGGACAGAGACTACAAGTGGATAAGATCAAGTCAGGTATTGACAACATAGTGACGGAAATTGACTCACAGCATGAAGACTGGCTCAAATGTGCCAAGGGAATAATGACAACCGACACGTTTCCTAAATTAATATCTagaaatttcaagattAATGGAATTGAGTACAATATTGCGGGTCTGGTCAAAGGTGCCGGTATGATTTGTCCCAACATGGCGACTCTGTTGGGTCTGATTATCACAGATGCCCCAATAGAGTCAATCACCTTACAGAATTTGCTTAGTAAGTCTGTTGataaatctttcaattgTATATCGGTGGATGGTGATATGTCTACCAACGATACCATTTTGTCATTATCAAATGGTCAATCTGGTGGAGAATTGATCACCGAGCAGTCTGGAGAGGTTTACGAggtttttgaaaagaacTTCAAAGAGATTGCCATTGAATTGGCAAAACTAGTTGTGAGAGACGGAGAAGGTGCTACCAAATTCATCACAATCAAGGTGAAGAATGCCAAAAACGATGAAGAGGCGAAACAAGCGGCAAACTCTGTCTCTAACTCTGCATTGGTCAAGACTGCCATGTTTGGTAAAGACGCCAATTGGGGTAGAATTTTATGTGCAATTGGATATTCTGAAATCGATGTTGAGCCTACGAAAACCAACGTTTCCTTCGTTCCAAGTGATGGAAGTGCAGAACTGAAGTTGTTAGTCAATGGAGAGCCGCAACTAGTTGACGAAAATAGAGCAAGTGAAATCCTCGAGCACGAAGACCTTGAAATTGCCATCGATCTTGGTCTCGAAGGAAAAGGTGAGTGCACCTTCTGGACATGTGACTTGACTCACGACTACGTGACTATTAATGGAGACTACAGGTCGTGA。

as shown in FIG. 3, the Pichia pastoris constructed by the method of the invention can obviously relieve the cell aggregation effect of the recombinant bacteria under a microscope, and is beneficial to the transfer of nutrients and oxygen.

In conclusion, the invention utilizes arginine to obviously promote the growth of pichia kudriana under extreme acid conditions, relieve cell aggregation, facilitate the transfer of oxygen and nutrient substances and improve the production performance of the strain during low pH fermentation.

Sequence listing

<110> university of Wenzhou

<120> method, construction and application for inhibiting cell aggregation of pichia kudriavzevii strains

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 1

cgcggatccg cgtttaagtg gtggttgta 29

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 2

cggggtacct ggtgagattg atggattgt 29

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 3

acagataagt acctagggag att 23

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 4

tgacatctga atgtaaaatg aac 23

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 5

acacagcaaa acacaaaaat atggccaagt tgaccagtgc 40

<210> 6

<211> 36

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 6

tatcgaaatc tagcccgcaa attaaagcct tcgagc 36

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 7

tcgaaggctt taatttgcgg gctagatttc gatatggat 39

<210> 8

<211> 43

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 8

gtagattgcg gaggacattt tttgtaattg tgtttgtttg tgt 43

<210> 9

<211> 36

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 9

caaacacaat tacaaaaaat gttaagacat gttgca 36

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 10

cattttacat tcagatgtca tcacgacctg tagtctcca 39

<210> 11

<211> 1308

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 11

atgttaagac atgttgcaaa gagatcattt ggatcgctag gaatcccaca aaataagcta 60

aagtatattc ctaaaggagg attctaccct aagggtttca aagtaggatc agtagcttcc 120

catgtgaaga aaacaggagc acccgatcta gctttaattc attcagccaa accatgcaca 180

gctgcaggtg tctttacgac taacaagttc aaagcagcac ctgttattgt tgataaggaa 240

aacttaacgc tcaagaaaaa cgaagacttc cattcgatta taattaattc aggctgtgcc 300

aatgctgtca ctggaaacgg tgggttgtcg gatgcaaagg acatcataaa ctacgttgat 360

aaagcattgc atggaacaac ataccctgta tctaaaacac tgacaatgtc aacgggtgtc 420

attggacaga gactacaagt ggataagatc aagtcaggta ttgacaacat agtgacggaa 480

attgactcac agcatgaaga ctggctcaaa tgtgccaagg gaataatgac aaccgacacg 540

tttcctaaat taatatctag aaatttcaag attaatggaa ttgagtacaa tattgcgggt 600

ctggtcaaag gtgccggtat gatttgtccc aacatggcga ctctgttggg tctgattatc 660

acagatgccc caatagagtc aatcacctta cagaatttgc ttagtaagtc tgttgataaa 720

tctttcaatt gtatatcggt ggatggtgat atgtctacca acgataccat tttgtcatta 780

tcaaatggtc aatctggtgg agaattgatc accgagcagt ctggagaggt ttacgaggtt 840

tttgaaaaga acttcaaaga gattgccatt gaattggcaa aactagttgt gagagacgga 900

gaaggtgcta ccaaattcat cacaatcaag gtgaagaatg ccaaaaacga tgaagaggcg 960

aaacaagcgg caaactctgt ctctaactct gcattggtca agactgccat gtttggtaaa 1020

gacgccaatt ggggtagaat tttatgtgca attggatatt ctgaaatcga tgttgagcct 1080

acgaaaacca acgtttcctt cgttccaagt gatggaagtg cagaactgaa gttgttagtc 1140

aatggagagc cgcaactagt tgacgaaaat agagcaagtg aaatcctcga gcacgaagac 1200

cttgaaattg ccatcgatct tggtctcgaa ggaaaaggtg agtgcacctt ctggacatgt 1260

gacttgactc acgactacgt gactattaat ggagactaca ggtcgtga 1308

Claims (3)

1. A pichia kudriavzevii that inhibits cell aggregation, characterized by: the Pichia pastoris strain is a recombinant strain constructed by overexpression of an ARG J gene in Pichia kudriavzevii N-X; pichia kudriavzevii N-X is deposited in the China Center for Type Culture Collection (CCTCC); address: eight-path Lojia mountain in Wuchang district, Wuhan city, Hubei province, with the preservation number: CCTCC M2017759.

2. Use of pichia kudriavzevii inhibiting cell aggregation according to claim 1 in fermentation at pH below 2.5.

3. The method for constructing pichia kudriavzevii that inhibits cell aggregation according to claim 1, wherein: the method comprises the following steps:

a. amplifying by using primers Pdc1F, Pdc1R and pichia pastoris N-X genomic DNA as templates to obtain a fragment containing a PDC1 gene promoter, a reading frame and a terminator, and connecting the fragment into a pMD19T vector; the primer Pdc1F is CGCGGATCCGCGTTTAAGTGGTGGTTGTA, and the primer Pdc1R is CGG GGTACCTGGT GAGA TTGATGGATTGT;

b. reverse amplification is carried out by using primers 0-F and 0-R; the primers 0-F are ACAGATAAGTACCTAGGGAGATT, and the primers 0-R are TGACATCT GAATGTAAAATGAAC;

c. primers 1-F and 1-R and a plasmid pGAPZB are used as templates for amplification to obtain bleomycin resistance gene BLE and a CYC1 terminator; the primers 1-F are acacagcaaaacacaaaaatATG GCCAAGTTGACCAGTGC; the primers 1-R are tatcgaaatctagcccGCAAATTAAAGCCTTCGA GC;

d. amplifying by using primers 2-F and 2-R and genome DNA as a template to obtain a pGAP promoter; the primer 2-F is tcgaaggctttaatttgcGGGCTAGATTTCGATATGGAT; the primers 2-R are gtagatt gcggaggacatTTTTTGTAATTGTGTTTGTTTGTGT;

e. amplifying by using primers 3-F and 3-R to obtain a target gene ARGJ; the primer 3-F is caaacacaattacaaaaaATGTTAAGACATGTTGCA; the primer 3-R is cattttacattcagatgtcaTCACGACCTGTAGTCTCCA;

f. using a Clon express Multi S One Step Cloning Kit to perform One-Step connection on the fragments to construct and obtain a recombinant integration expression vector pARGJ; and finally, converting the recombinant plasmid subjected to BamH I enzyme digestion into an N-X strain by using a lithium acetate method, and screening positive transformants on a YPD plate containing 180 mug/ml Zeocin to obtain the recombinant strain for over-expressing the ARG J.

Images