NZ733805B2 - Combined treatment with a tlr7 agonist and an hbv capsid assembly inhibitor - Google Patents

Abstract

The present invention is directed to compositions and methods for treating hepatitis B virus infection. In particular, the present invention is directed to a combination therapy comprising administration of a TLR7 agonist and an HBV capsid assembly inhibitor for use in the treatment of chronic hepatitis B patient. itis B patient.

Description

ed Treatment with a TLR7 agonist and an HBV capsid assembly inhibitor The present invention is generally directed to itions for treating hepatitis B virus ion. Methods for treating hepatitis B virus infection are described herein. In particular, the present invention is ed to a combination therapy comprising administration of a TLR7 agonist and an HBV capsid assembly inhibitor for use in the treatment of chronic tis B patient.

FIELD OF THE INVENTION Chronic infection of Hepatitis B virus (HBV) is a serious public health problem worldwide, with more than 240 million people chronically infected worldwide. HBV belongs to the aviridae family of viruses. Following entry into cyte, its viral genome is delivered into nucleus where a covalently closed circular DNA (cccDNA) is formed through DNA repair of partially double-stranded viral genomecccDNA serves as the template for transcription of viral RNAs. Viral pre-genomic RNA interacts with other two viral components, capsid n and polymerase to form capsid particles where viral DNA ation occurs.

HBV has an icosahedral core comprising of 240 copies of the capsid (or core) protein. The inant biological function of capsid protein is to act as a structural protein to encapsidate pre-genomic RNA and form immature capsid particles in the cytoplasm. This step is prerequisite for viral DNA replication. When a near full-length relaxed circular DNA is formed through reverse-transcription of viral pregenomic RNA, an immature capsid becomes a mature .

Most copies of the encapsidated genome efficiently associate with cellular lipids and viral envelope proteins (S, M, and L) for virion assembly and secretion. However, non-infectious particles are also produced that greatly outnumber the infectious virions. These empty, enveloped particles are referred to as al particles (SVPs). The S, M, and L envelope proteins are sed from a single ORF (open reading frame) that contains three different start codons. All three proteins share a 226aa sequence, the S-domain, at their C-termini. S-domain contains the HBsAg epitope (Lambert, C. & R. Prange. Virol J, 2007, 4, 45).

Many observations showed that several HBV viral proteins could counteract the initial host cellular response by interfering with the viral ition signaling system and subsequently the interferon (IFN) antiviral activity. Among these, the excessive secretion of HBV empty al particles may participate to the maintenance of the immunological tolerant state observed in cally ed patients (CHB). The persistent exposure to HBsAg and other viral antigens can lead to HBV-specific T-cell on or to progressive functional impairment (Kondo et al.

Journal of Immunology 1993, 150, 671; Kondo et al. Journal of l Virology 2004, 74, 3; ro et al. Gastroenterology, 2010, 138, 682-93;). Moreover HBsAg has been reported to suppress the function of immune cells such as monocytes, dendritic cells (DCs) and natural killer (NK) cells by direct interaction (Op den Brouw et al. Immunology, 2009b, 126, 280-9; Woltman et al. PLoS One, 2011, 6, e15324; Shi et al. J Viral Hepat. 2012, 19, e26-33; Kondo et al. ISRN Gasteroenterology, 2013, Article ID 935295).

HBsAg quantification is a biomarker for prognosis and treatment response in chronic hepatitis B. HBsAg loss and nversion is the goal for clinical cure, but is rarely observed in chronically infected patients. t therapy such as Nucleos(t)ide analogues that inhibit HBV DNA synthesis does not directly affect HBsAg level. Nucleos(t)ide analogs, even with prolonged therapy, have demonstrated very low rates of HBsAg clearance comparable to those ed naturally (Janssen et al. Lancet, 2005, 365, 123-9; Marcellin et al. N. Engl. J. Med., 2004, 351, 1206-17; Buster et al. logy, 2007, 46, 388-94).

Toll-like receptors (TLRs) detect a wide range of conserved pathogen-associated molecular patterns ). They play an important role of sensing invading pathogens and subsequent initiation of innate immune responses. There are 10 known members of the TLR family in human, which are type I transmembrane proteins featuring an extracellular leucine-rich domain and a cytoplasmic tail that contains a conserved Toll/ interleukin (IL)-1 receptor (TIR) domain.

Within this , TLR3, TLR7, TLR8, and TLR9 are located within endosomes. TLR7 can be activated by binding to a specific small molecule ligand (i.e., TLR7 agonist) or its native ligand (i.e., single-stranded RNA, ssRNA). Following binding of ssRNA to TLR7, the receptor in its dimerized form is believed to undergo a structural change leading to the subsequent recruitment of adapter proteins at its cytoplasmic domain, including the myeloid differentiation primary response gene 88 ). Following the initiation of the receptor signalling cascade via the MyD88 pathway, cytoplasmic transcription factors such as interferon regulatory factor 7 (IRF-7) and nuclear factor kappa B (NF-κB) are activated. These transcription factors then translocate to the nucleus and initiate the transcription of various genes, e.g., IFN-α and other antiviral cytokine genes. TLR7 is predominately expressed on plasmacytoid cells, and also on B-cells.

Altered responsiveness of immune cells might contribute to the reduced innate immune ses during chronic viral infections. Agonist-induced activation of TLR7 might therefore represent a novel approach for the treatment of chronic viral infections. (D. J Connolly and L. AJ O’Neill, Current Opinion in Pharmacology 2012, 12:510–518, P. A. Roethle et al, J. Med. Chem. 2013, 56, 7324−7333).

Treatment with an oral TLR7 agonist represents a ing solution to provide greater efficacy with better tolerability. Pegylated IFN-α (PEG-IFN-α) is currently used to treat chronic HBV and is an alternative to potentially life-long ent with antiviral nucleos(t)ide analogues. In a subset of chronic HBV patients, PEG-IFN-α y can induce sustained immunologic l of the virus following a finite duration of therapy. However, the percentage of HBV patients that e seroconversion with interferon therapy is low (up to 27% for HBeAg-positive ts) and the treatment is typically poorly tolerated. rmore, functional cure (defined as HBsAg loss and seroconversion) is also very infrequent with both PEG-IFN-α and s(t)ide treatment. Given these limitations, there is an urgent need for improved therapeutic options to treat and induce a functional cure for chronic HBV. Treatment with an oral, small-molecule TLR7 agonist is a promising approach that has the ial to provide greater efficacy and tolerability (T. Asselah et al, Clin Liver Dis 2007, 11, 839–849).

HBV capsid protein plays essential roles in HBV replication.

Heteroaryldihydropyrimidines or HAP, including compounds named Bay 41-4109, Bay 38-7690 and Bay 39-5493, were discovered in a tissue culture-based ing (Deres K. et al. Science 2003, 893). These HAP s act as synthetic allosteric activators and are able to induce aberrant capsid formation that leads to degradation of the core protein. HAP analogs also reorganized core protein from preassembled capsids into noncapsid polymers, presumably by interaction of HAP with dimers freed during capsid ‘breathing’, the transitory breaking of individual intersubunit bonds. Bay 41-4109 was administered to HBV ed transgenic mouse or zed mouse models and demonstrated in vivo efficacy with HBV DNA reduction (Deres K. et al. Science 2003, 893; Brezillon N. et al. PLoS ONE 2011, e25096). It was also shown that bis-ANS, a small molecule that acts as a molecular ‘wedge’ and interferes with normal protein geometry and capsid formation (Zlotnick A. et al. J. Virol. 2002, 4848-4854).

Now, the standard of clinic cure of HBV infection is the loss and/or seroconversion of HBsAg. Even though N-α and nucleos(t)ide are available to HBV patients, the majority (around or more than 90%) of treated patients fail to e this goal, which is mainly due to fact that the current therapies cannot elicit the appearance of lizing antibodies against HBsAg (anti-HBs), a sign of resolution of HBV infection, in most chronically infected patients.

Hence, there is certainly a medical need for treatments with improved s rate of inducing HBsAg loss and/or seroconversion and promoting the production of anti-HBs. It is an object of the invention to go some way s meeting this need, and/or to at least provide the public with a useful choice.

SUMMARY OF THE INVENTION The t invention relates to a pharmaceutical ition comprising a TLR7 agonist and an HBV capsid assembly inhibitor, in a pharmaceutically acceptable carrier. The “TLR7 t” herein is a compound of formula (I), (II) or any one of the compounds disclosed in patent WO2006/066080, particularly the “TLR7 agonist” herein is [(1S)[(2S,4R,5R)(5- aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] acetate; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate; 5-amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5- d]pyrimidinone; 5-amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5- d]pyrimidinone or 5-amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin- 2,7-dione, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof. The HBV capsid assembly inhibitor herein is a compound of formula (III) or any one of the compounds disclosed in patent WO2014/037480, and WO2015/132276, particularly the HBV capsid assembly inhibitor herein is S)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 3-[(8aS)[[(4S)ethoxycarbonyl (3-fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; ,3S,5S) [[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidin yl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; 2-[(1S,3R,5R)[[(4R)(2- chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]- 6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; or (S)[(R)(2-Chlorofluorophenyl )methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholine carboxylic acid; or pharmaceutically acceptable salt, enantiomer or reomer thereof.

In a first aspect, the ion provides a pharmaceutical composition sing a TLR7 agonist and an HBV capsid assembly inhibitor, in a pharmaceutically acceptable carrier, wherein the TLR7 agonist is selected from [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- ydrofuranyl]propyl] acetate having the structure -amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione having the structure ; and wherein the HBV capsid assembly inhibitor is selected from 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- opyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

In a second aspect, the invention provides a kit sing a container comprising a TLR7 agonist and an HBV capsid ly inhibitor, wherein the TLR7 agonist is selected from [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- tetrahydrofuranyl]propyl] acetate having the structure ; or -amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione having the structure or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; and wherein the HBV capsid assembly inhibitor is selected from 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure ; or 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

In a third aspect, the invention provides use of a combination of a TLR7 agonist and a HBV capsid ly tor, selected from the group ting of: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)- 5-ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 1-[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro- 2-methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo ]pyrazinyl]-2,2-dimethyl-propanoic acid; 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and S)[[(4R)(2-chlorofluoro-phenyl)- -ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo ]pyrazinyl]-2,2-dimethyl-propanoic acid; 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and S)[[(4S)ethoxycarbonyl(3- fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo- ,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof, in the manufacture of one or more ment for the treatment or prophylaxis of hepatitis B virus infection.

In the description in this specification nce may be made to subject matter which is not within the scope of the appended claims. That subject matter should be readily identifiable by a person skilled in the art and may assist in putting into practice the invention as defined in the appended claims.

BRIEF DESCRIPTION OF THE FIGURES Figure 1: HBV DNA and HBsAg levels from mice sera in AAV-HBV mouse model.

Results were shown in Figure. 1 for mice with sustained level of HBV DNA and HBsAg treated with vehicle (shown as diamond), Compound 1 alone at 100mg/kg (shown as circle), Compound 2 alone at 12mg/kg (shown as triangle), or combination of Compound 1 and Compound 2 (shown as square). Relative reduction of HBV DNA and HBsAg post treatment was calculated by normalizing to their levels in the vehicle group as a base line. Synergistic antiviral effect in reducing HBsAg was observed in mice treated with the combination therapy, and more importantly, reduction in HBV DNA and HBsAg was sustained during a 2-week off-treatment period post the combination therapy. LLQ: lower limit of quantification.

Figure 2: X-ray crystal structure of Compound 2A-2a.

Figure 3: X-ray crystal structure of Compound 3J.

Figure 4: HBV DNA and HBsAg in the AAV-HBV infected mice treated with vehicle, Compound 1 (100mg/kg), Compound 4 (20mg/kg), or the combination of nd 1 plus Compound 4. The treatment started after the mice were infected with AAV-HBV for 4 weeks.

They were given the treatment for 6 weeks, and were monitored for another 6-week atment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were ted as mean ± SEM.

LLQ: lower limit of quantification.

Figure 5: HBV DNA and HBsAg in the AAV-HBV infected mice treated with e, Compound 3 (30mg/kg), Compound 4 (20mg/kg), or the combination of Compound 3 plus Compound 4. The treatment d after the mice were infected with AAV-HBV for 4 weeks.

They were given the treatment for 6 weeks, and were monitored for another 6-week offtreatment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were presented as mean ± SEM.

LLQ: lower limit of quantification.

Figure 6: HBV DNA and HBsAg in the AAV-HBV infected mice treated with vehicle, Compound 1 /kg), Compound 5 (12mg/kg), or the combination of nd 1 plus Compound 5. The treatment started after the mice were infected with AAV-HBV for 4 weeks.

They were given the treatment for 6 weeks, and were monitored for r 6-week offtreatment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were presented as mean ± SEM.

LLQ: lower limit of quantification.

Figure 7: The level of anti-HBs antibody ody against HBsAg ) in the serum of each mouse taking the single or combination treatment as described in Figures 4, 5, and 6. The serum samples were collected on day 24 post the removal of treatment and anti-HBs was measured by anti-HBs CLIA. LLQ: lower limit of quantification.

Figure 8: HBV DNA and HBsAg in the AAV-HBV infected mice treated with vehicle, Compound 8 (300mg/kg), Compound 4 (20mg/kg), or the combination of nd 8 plus Compound 4. The treatment started after the mice were infected with AAV-HBV for at least 38 days. They were given the treatment for 6 weeks, and were monitored for another 6-week off- treatment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were presented as mean ± SEM.

LLQ: lower limit of quantification.

Figure 9: HBV DNA and HBsAg in the AAV-HBV infected mice treated with e, Compound 8 (300mg/kg), Compound 10 (20mg/kg), or the combination of Compound 8 plus Compound 10. The treatment started after the mice were infected with AAV-HBV for at least 38 days. They were given the treatment for 6 weeks, and were monitored for another 6-week offtreatment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were presented as mean ± SEM.

LLQ: lower limit of quantification.

Figure 10: HBV DNA and HBsAg in the AAV-HBV ed mice treated with e, Compound 1 (100mg/kg), nd 10 (20mg/kg), or the combination of Compound 1 plus Compound 10. The treatment started after the mice were infected with V for at least 38 days. They were given the ent for 6 weeks, and were monitored for another 6-week offtreatment period. HBV DNA and HBsAg in mouse serum were measured on the indicated time points by RT-qPCR and HBsAg CLIA, respectively. The results were presented as mean ± SEM.

LLQ: lower limit of quantification.

Figure 11: The level of anti-HBs antibody (antibody against HBsAg ) in the serum of each mouse taking the single or combination treatment as described in Figures 8, 9, and 10. The serum samples were collected on day 31 post the removal of ent and anti-HBs was measured by Bs CLIA. LLQ: lower limit of quantification.

DETAILED DESCRIPTION OF THE ION Unless defined ise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

As used herein, the term “C1-6alkyl” refers to a monovalent linear or branched ted hydrocarbon group of 1 to 6 carbon atoms. In particular embodiments, C1-6alkyl has 1 to 6 carbon atoms, and in more particular embodiments 1 to 4 carbon atoms. Examples of C1-6alkyl include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, sec-butyl or tert-butyl.

As used herein, the term “halo” or “halogen” are used interchangeably herein and refer to fluoro, chloro, bromo, or iodo.

As used herein, the term lkoxy” refers to a group of C1-6alkyl-O-, wherein the “C1- 6alkyl” is as defined above; for example methoxy, ethoxy, propoxy, iso-propoxy, n-butoxy, iso- butoxy, 2-butoxy, tert-butoxy and the like. Particular lkoxy” groups are methoxy and ethoxy and more particularly methoxy.

As used herein, the term ycloalkyl” refers to a saturated carbon ring containing from 3 to 7 carbon atoms, particularly from 3 to 6 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, eptyl and the like. Particular “C3-7cycloalkyl” groups are cyclopropyl, cyclopentyl and cyclohexyl.

As used herein, the term “C2-6alkenyl” refers to an unsaturated, linear or branched chain alkenyl group containing 2 to 6, ularly 2 to 4 carbon atoms, for example vinyl, propenyl, allyl, butenyl and the like. Particular “C2-6alkenyl” group is allyl.

As used herein, the term “C2-6alkynyl” refers to an unsaturated, linear or ed chain alkynyl group ning 2 to 6, particularly 2 to 4 carbon atoms, for example l, 1- propynyl, propargyl, butynyl and the like. ular “C2-6alkynyl” groups are ethynyl, 1- propynyl and propargyl.

As used herein, the term “heterocyclic” ring or “heterocyclyl” refers to a saturated or partly unsaturated monocyclic or bicyclic ring containing from 3 to 10 ring atoms which can comprise one, two or three atoms selected from nitrogen, oxygen and/or sulfur. Examples of monocyclic heterocyclyl rings containing in particular from 3 to 7 ring atoms include, but not limited to, aziridinyl, azetidinyl, oxetanyl, dinyl, piperazinyl, azepinyl, diazepanyl, pyrrolidinyl, morpholinyl, dihydrofuryl, tetrahydrofuryl, tetrahydropyranyl, tetrahydrothiopyranyl and thiomorpholinyl. Bicyclic heterocyclyl can be bicyclic fused ri ng or bicyclic bridged ring.

Examples for bicyclic heterocyclyl are bicyclo[3.2.1]octy l, quinuclidinyl, 8-oxaaza- o[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl, 3-oxaaza-bicyclo[3.3.1]nonyl, 3-thiaaza- bicyclo[3.3.1]nonyl, or difluoroazabicyclo[3.2.1]octyl. Monocyclic and bicyclic heterocyclyl can be further substituted by halogen, C1-6 alkyl, cyano, carboxy, carboxyC1-6alkyl.

The term “heterocyclic amino” refers to an amino group with the en atom on the heterocyclic ring, wherein “heterocyclic” ring is as defined above.

As used herein, the term “diastereomer” refers to a stereoisomer with two or more centers of chirality and whose les are not mirror images of one another. Diastereomers have ent physical properties, e.g. melting points, g points, spectral ties, activities and reactivities.

As used herein, the term “enantiomers” refers to two stereoisomers of a compound which are non-superimposable mirror images of one another.

As used herein, the term aceutically acceptable salts” refers to salts which are not ically or otherwise undesirable. Pharmaceutically acceptable salts include both acid and base addition salts.

As used herein, the term “prodrug” refers to a form or derivative of a compound which is lized in vivo, e.g., by ical fluids or enzymes by a subject after administration, into a pharmacologically active form of the compound in order to produce the desired pharmacological effect. Prodrugs are described e.g. in the Organic Chemistry of Drug Design and Drug Action by Richard B. Silverman, Academic Press, San Diego, 2004, Chapter 8 Prodrugs and Drug Delivery Systems, pp. 497-558.

The term “pharmaceutically acceptable acid addition salt” refers to those pharmaceutically acceptable salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and c acids selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic, and sulfonic classes of organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic acid, malic acid, maleic acid, maloneic acid, succinic acid, fumaric acid, tartaric acid, citric acid, aspartic acid, ascorbic acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid, mandelic acid, embonic acid, phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, enesulfonic acid, and clic acid.

The term “pharmaceutically acceptable base addition salt” refers to those pharmaceutically able salts formed with an organic or inorganic base. Examples of acceptable inorganic bases include sodium, ium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Salts derived from pharmaceutically acceptable organic nontoxic bases includes salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine, arginine, histidine, ne, procaine, amine, choline, betaine, ethylenediamine, amine, methylglucamine, theobromine, purines, piperizine, dine, N-ethylpiperidine, and polyamine resins.

Compounds of the general formula (I) which contain one or several chiral centers can either be present as racemates, diastereomeric es, or optically active single isomers. The racemates can be separated according to known methods into the enantiomers. Particularly, diastereomeric salts which can be separated by crystallization are formed from the racemic mixtures by reaction with an lly active acid such as e.g. D- or L-tartaric acid, mandelic acid, malic acid, lactic acid or camphorsulfonic acid.

As used herein, “combo” refers to ation.

As used herein, “RT-PCR” refers to Reverse transcription rase chain reaction.

As used , “CLIA” refers to chemiluminescence immunoassay.

As used herein, “AAV” refers to adeno-associated virus.

As used , “AAV-HBV” refers to a recombinant virus that carries 1.3 copies of the HBV genome packaged in AAV capsids. A chronicle HBV infection mouse model can be established by injecting mice with AAV-HBV through tail vein injection. In this mouse model, active HBV replication results in persist HBV viral markers (e.g., HBV DNA, HBsAg, HBeAg, etc.).

As used herein, “HBsAg” refers to hepatitis B surface antigen.

As used herein, “HBeAg” refers to hepatitis B e antigen.

As used herein, “anti-HBs” refers to antibodies against HBsAg.

As used herein, “HBV specific primers” refers to a pair of -stranded nucleic acid that serves as ng and ending points for specific amplification of HBV DNA regions.

As used herein, “TLR7” refers to the Toll-like receptor 7 of any species of origin (e.g., human, murine, woodchuck etc.).

As used herein, “TLR7 agonist” refers to a compound that acts as an agonist of TLR7.

Unless otherwise indicated, a TLR7 agonist can include the compound in any pharmaceutically acceptable form, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like. The TLR agonism for a particular compound may be determined in any suitable manner. For example, assays for detecting TLR agonism of test compounds are bed, for example, in U.S. Provisional Patent Application Ser. No. 60/432,650, filed Dec. 11, 2002, and recombinant cell lines suitable for use in such assays are described, for example, in U.S. Provisional Patent Application Ser. No. 60/432,651, filed Dec. 11, 2002.

The term ising” as used in this specification and claims means “consisting at least in part of”. When interpreting statements in this specification and claims which include the term ising”, other features besides the features prefaced by this term in each statement can also be present. Related terms such as “comprise” and ises” are to be interpreted in similar manner.

The present invention relates to a pharmaceutical ition comprising a TLR7 agonist and an HBV capsid assembly tor, in a pharmaceutically acceptable r.

In one embodiment of present invention and/or described herein, a “TLR7 agonist” is a compound of formula (I): (I), wherein R1 is hydroxy, C1-6alkyl, haloC1-6alkyl, C1-6alkylcarbonyl-O-, C1-6alkyl-S-, azido, cyano, C2-6alkenyl, C1-6alkylsulfonyl-NH-, (C1-6alkyl)2N-, C1-6alkylcarbonyl-NH- or heterocyclic amino; R2 is hydrogen, C1-6alkyl, koxyC1-6alkyl, C3-7cycloalkyl, C2-6alkynyl, C2-6alkenyl, benzyl and thiophenyl; R3 is hydrogen or C1-6alkylcarbonyl; or pharmaceutically acceptable salt, enantiomer or reomer thereof; In another embodiment of present invention and/or described herein, a “TLR7 agonist” is a compound of formula (II): (II), wherein R4 and R5 are independently selected from hydrogen, C2-6alkenyl and C1-6alkyl; R6 and R7 are independently selected from hydrogen, C1-6alkyl, C3-7cycloalkyl, C3- 7cycloalkylC2-6alkynyl, kenyl, C2-6alkynyl and phenyl; R8 is hydrogen or C1-6alkylcarbonyl; or pharmaceutically able salt, enantiomer or diastereomer thereof.

More particularly, the TLR7 agonist according to present invention and/or described herein s to [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidin- 3-yl)-1,3-oxathiolanyl]-cyclopropyl-methyl] acetate; 5-amino(3’-deoxy-β-D- ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(2’-O-acetyl-3’-deoxy-β-D- ranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(3’-deoxy-β-D-ribofuranosyl)- 3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione; or [(2R,3R,5S)[(1S)acetoxypropyl](5- amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate ;or pharmaceutically able salt, enantiomer or diastereomer thereof. In another embodiment, a “TLR7 agonist” also relates to anyone of the compounds disclosed in patent WO2006/066080.

After administration, compounds of formula (I) or a (II) or compounds in patent WO2006/066080 are metabolized into their active forms which are useful TLR7 agonists.

As used herein, “hepatitis B virus” or “HBV” refers to a member of the Hepadnaviridae family having a small double-stranded DNA genome of approximately 3,200 base pairs and a tropism for liver cells. “HBV” includes hepatitis B virus that infects any of a variety of mammalian (e.g., human, non-human primate, etc.) and avian (duck, etc.) hosts. “HBV” includes any known HBV genotype, e.g., serotype A, B, C, D, E, F, and G; any HBV pe or HBV subtype; any HBV isolate; HBV ts, e.g., HBeAg-negative variants, drug-resistant HBV variants (e.g., lamivudine-resistant variants; adefovir-resistant mutants; vir-resistant mutants; entecavir-resistant mutants; etc.); and the like.

As used herein, “HBV capsid ly inhibitor” refers to a compound that inhibits and/or disrupt and/or accelerates and/or s and/or delays and or reduces and/or modifies normal HBV capsid assembly (e.g., during maturation) and/or normal capsid disassembly (e.g., during infectivity) and/or perturbs capsid stability, thereby inducing aberrant capsid morphology and function.

In one embodiment of present invention and/or described herein, the HBV capsid assembly inhibitor is a compound of formula (III): (III), wherein R9 is C1-6alkyl; R10 is phenyl, which is once or twice or three times substituted by n or C1-6alkyl; R11 is hydrogen or C1-6alkyl; R12 is monocyclic, bicyclic fused or bicyclic d heterocyclyl; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

More particularly the HBV capsid assembly tor according to present invention and/or described herein relates to 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonyl thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5- a]pyrazinyl]-2,2-dimethyl-propanoic acid; 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 2-[(1R,3S,5S)[[(4R)(2-chloro fluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6- roazabicyclo[3.2.1]octanyl]acetic acid; 2-[(1S,3R,5R)[[(4R)(2-chlorofluorophenyl )methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid (disclosed in patent ); or (S)[(R) (2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydro-pyrimidin ylmethyl]-morpholinecarboxylic acid; or pharmaceutically able salt, omer or reomer thereof. In another embodiment, an “HBV capsid assembly inhibitor” more particularly is anyone of the compounds disclosed in patent WO2015/132276, and WO2014/037480.

In one embodiment of t invention and/or described herein, the pharmaceutical composition ses a TLR7 agonist and an HBV capsid assembly inhibitor, wherein TLR7 agonist and HBV capsid assembly inhibitor are independently selected from Table 1: (Compound 2 and 4 were disclosed in patent WO2015/132276; Compound 5 and 6 were disclosed in patent WO2014/184328; Compound 7, 8 and 9 were disclosed in patent WO2006/066080; Compound 10 was disclosed in patent WO2014/037480).

Table 1. List of TLR7 agonist and HBV capsid Entry Class Compound Name Structure [(1S)[(2S,4R,5R)(5-amino- 2-oxo-thiazolo[4,5-d]pyrimidin- TLR7 Compound 1 3-yl)hydroxyagonist tetrahydrofuranyl]propyl] acetate 3-[(8aS)[[(4R)(2-chloro fluoro-phenyl) ethoxycarbonylthiazolyl- HBV capsid 1,4-dihydropyrimidin Compound 2 inhibitor yl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5- zinyl]-2,2-dimethylpropanoic acid [(S)-[(2S,5R)(5-aminooxo- TLR7 thiazolo[4,5-d]pyrimidinyl)- Compound 3 agonist 1,3-oxathiolanyl]- cyclopropyl-methyl] acetate 3-[(8aS)[[(4S) carbonyl(3-fluoro methyl-phenyl)thiazolyl- HBV capsid 1,4-dihydropyrimidin Compound 4 inhibitor yl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5- zinyl]-2,2-dimethylpropanoic acid 2-[(1R,3S,5S)[[(4R)(2- chlorofluoro-phenyl) methoxycarbonylthiazolyl- HBV capsid Compound 5 1,4-dihydropyrimidin inhibitor yl]methyl]-6,6-difluoro azabicyclo[3.2.1]octan yl]acetic acid 2-[(1S,3R,5R)[[(4R)(2- chlorofluoro-phenyl) methoxycarbonylthiazolyl- HBV capsid nd 6 1,4-dihydropyrimidin inhibitor yl]methyl]-6,6-difluoro azabicyclo[3.2.1]octan yl]acetic acid -amino(3’-deoxy-β-DTLR7 Compound 7 ranosyl)-3H-thiazolo[4,5- d]pyrimidinone -amino(2’-O-acetyl-3’- TLR7 Compound 8 deoxy-β-D-ribofuranosyl)-3H- agonist thiazolo[4,5-d]pyrimidinone -amino(3’-deoxy-β-DTLR7 ribofuranosyl)-3H,6HCompound agonist thiazolo[4,5-d]pyrimidin-2,7- dione (S)[(R)(2-Chlorofluoro- O Cl phenyl)methoxycarbonyl HBV capsid Compound 10 thiazolyl-3,6-dihydro- O N inhibitor pyrimidinylmethyl]- S O N morpholinecarboxylic acid H N N [(2R,3R,5S)[(1S) acetoxypropyl](5-amino-2,7- TLR7 Compound 11 dioxo-6H-thiazolo[4,5- agonist d]pyrimidin yl)tetrahydrofuranyl] acetate More particularly, the present invention and/or sure relates to a ceutical composition comprising a TLR7 agonist and an HBV capsid assembly inhibitor which is selected from any one of the following combinations: Compound 1 and Compound 2; Compound 1 and Compound 4; Compound 1 and Compound 5; Compound 1 and Compound 6; Compound 1 and Compound 10; Compound 3 and Compound 2; Compound 3 and Compound 4; Compound 3 and Compound 5; Compound 3 and Compound 6; nd 3 and Compound 10; Compound 7 and Compound 2; Compound 7 and Compound 4; Compound 7 and Compound 5; Compound 7 and nd 6; Compound 7 and Compound 10; Compound 8 and Compound 2; Compound 8 and Compound 4; Compound 8 and Compound 5; Compound 8 and Compound 6; Compound 8 and Compound 10; nd 9 and Compound 2; Compound 9 and Compound 4; nd 9 and Compound 5; Compound 9 and Compound 6; Compound 9 and Compound 10; Compound 11 and nd 2; Compound 11 and Compound 4; Compound 11 and nd 5; Compound 11 and Compound 6; and Compound 11 and Compound 10.

The Compound 1 to 11 of the above said combination can be replaced by its corresponding pharmaceutically acceptable salt, enantiomer or diastereomer.

The Compound 1 of the above said combination can be replaced by its corresponding mono, double or triple prodrugs, such as: , , , , , , and their pharmaceutically acceptable salt, enantiomer or diastereomer.

In one embodiment of present invention and/or described herein, the pharmaceutical composition consists of a TLR7 agonist and an HBV capsid assembly tor, in a pharmaceutically acceptable r. More ularly, the ition consists of: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- tetrahydrofuranyl]propyl] acetate and 2-[(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] e and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethylphenyl )thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and 2-[(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl) ycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- tetrahydrofuranyl]propyl] acetate and (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; (2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonyl thiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and (S) [(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydro-pyrimidin ylmethyl]-morpholinecarboxylic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydropyrimidinylmethyl ]-morpholinecarboxylic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydropyrimidinylmethyl ]-morpholinecarboxylic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 3-[(8aS)- 7-[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4-dihydropyrimidin yl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 3-[(8aS)- 7-[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidin yl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 5-amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 2- [(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 2- [(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and S)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; 5-amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and S)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 2-[(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione and 3- [(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; -amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione and 3- [(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- opyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; 5-amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione and 2- [(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; or -amino(3’-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione and 2- [(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; in a pharmaceutically able carrier.

In another embodiment of present ion and/or described herein, the pharmaceutical composition consists of a TLR7 agonist and an HBV capsid assembly inhibitor, in a pharmaceutically acceptable carrier, most particularly, the composition consists of: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethylphenyl )thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- o[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 1-[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- tetrahydrofuranyl]propyl] acetate and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] e and (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydropyrimidinylmethyl ]-morpholinecarboxylic acid; [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidin- 3-yl)tetrahydrofuranyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidin- 3-yl)tetrahydrofuranyl] e and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl- )thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidin- 3-yl)tetrahydrofuranyl] acetate and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidin- 3-yl)tetrahydrofuranyl] acetate and 2-[(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; or [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidin- etrahydrofuranyl] e and (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; in a pharmaceutically acceptable carrier.

In another embodiment of present invention, other TLR7 agonists or HBV capsid assembly tors can also be used in the pharmaceutical composition including small molecules or large molecules. es of other TLR7 agonists include, but not limited to, mod, Resiquimod, PF-4878691, SM-276001, ANA975, ANA773 and GS9620. Examples of other HBV capsid assembly inhibitors include, but not limited to, Bay 41-4109, Bay 38-7690, Bay 39-5493, GLS4, AT-61 and .

In another embodiment of t invention, the pharmaceutical composition can additionally comprise one or more other antiviral agents, which include, but not limited to, lamivudine, adefovir, tenofovir, telbivudine and entecavir.

Typical dosages of a TLR7 agonist and/or an HBV capsid assembly inhibitor can be in the ranges recommended by the manufacturer, and where indicated by in vitro ses in an animal models, can be reduced by up to about one order of magnitude concentration or amount.

Thus, the actual dosage will depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based on the in vitro responsiveness of the appropriate animal models.

Described herein is a method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that a TLR7 agonist and an HBV capsid assembly inhibitor are used in the medicament.

Described herein is the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, terized in that the TLR7 agonist and the HBV capsid assembly tor are co-administered in the same formulation or different formulation.

For purposes of the present invention, minister” refers to any administration of the TLR7 agonist and the HBV capsid assembly inhibitor as the two active , either tely or together, where the two active agents are administered as part of an appropriate dose regimen designed to obtain the benefit of the combination therapy. Thus, the two active agents can be administered either as part of the same pharmaceutical composition or in separate pharmaceutical compositions. Also, the two active agents can be administered either at the same time, or sequentially.

The TLR7 agonist and the HBV capsid assembly inhibitor can be administered with various pharmaceutically acceptable inert rs in the form of tablets, capsules, lozengens, troches, hard s, powders, sprays, creams, , itories, s, gels, pastes, lotions, ointments, elixirs, syrups, and the like. Administration of such dosage forms can be carried out in single or multiple doses. Carries include solid diluents of fillers, sterile aqueous media and various non-toxic organic solvents. Administration of such dosage forms can be carried out through, but not limited to, oral stration, parenteral administration, veterinary administration.

Described herein is the method for manufacturing a medicament for treatment or prophylaxis of tis B virus infection, characterized in that the TLR7 agonist and the HBV capsid assembly inhibitor are intended for administration to a subject by the same route or different routes.

Described herein is the method for manufacturing a medicament for treatment or laxis of hepatitis B virus infection, characterized in that the TLR7 agonist and the HBV capsid assembly inhibitor are intended for administration to a subject by parenteral or oral administration.

Described herein is the method for manufacturing a medicament for treatment or laxis of hepatitis B virus infection, characterized in that the administration of TLR7 agonist and the HBV capsid assembly inhibitor to a subject is simultaneous or sequential. In any of the methods described herein, the administration of agents simultaneously can be performed by separately or sequentially administering agents at the same time, or together as a fixed combination. Also, in any of the methods described , the administration of agents separately or sequentially can be in any order.

Described herein is the method for manufacturing a ment for treatment or prophylaxis of hepatitis B virus infection, characterized in that TLR7 agonist thereof is a compound of formula (I) or formula (II), or pharmaceutically acceptable salt, enantiomer or diastereomer thereof. Particularly, the TLR7 t is [(1S)[(2S,4R,5R)(5-aminooxothiazolo [4,5-d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] acetate; [(S)-[(2S,5R) (5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]-cyclopropyl-methyl] acetate; -amino(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(2’-O- acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(3’-deoxy-β- D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione; or [(2R,3R,5S)[(1S) acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate ; or pharmaceutically acceptable salt, omer or diastereomer thereof.

Described herein is the method for manufacturing a ment for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBV capsid assembly inhibitor thereof is a compound of formula (III), or pharmaceutically acceptable salt, enantiomer or diastereomer f. Particularly, the HBV capsid assembly inhibitor is 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl- 1,4-dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; 2-[(1S,3R,5R)[[(4R)(2-chlorofluoro-phenyl)methoxycarbonylthiazolyl- 1,4-dihydropyrimidinyl]methyl]-6,6-difluoroazabicyclo[3.2.1]octanyl]acetic acid; or (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6- dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; or pharmaceutically able salt, enantiomer or diastereomer thereof. bed herein is the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the medicament additionally comprising one or more other antiviral agents, which include, but not limited to, lamivudine, adefovir, tenofovir, udine and entecavir.

Described herein is the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, wherein the TLR7 agonist and the HBV capsid assembly inhibitor used in the medicament are: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and S)[[(4S)ethoxycarbonyl(3-fluoromethylphenyl iazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 1-[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 2-[(1R,3S,5S)[[(4R)(2-chlorofluoro-phenyl) methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl l] e and (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; 5-amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; or -amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydropyrimidinylmethyl ]-morpholinecarboxylic acid;in a pharmaceutically acceptable carrier.

Another embodiment of present invention and/or described herein relates to a kit comprising a container comprising a TLR7 agonist and an HBV capsid ly inhibitor, said kit can further comprise a sterile diluent.

A further embodiment of present invention s to the said kit, wherein the kit can further comprise a package insert comprising printed instructions directing the use of a combined treatment of a TLR7 t and an HBV capsid ly inhibitor as a method for treatment or prophylaxis of hepatitis B virus infection.

Another embodiment of present invention and/or described herein relates to the said kit, wherein the TLR7 t is [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidin yl)hydroxy-tetrahydrofuranyl]propyl] acetate; [(S)-[(2S,5R)(5-aminooxothiazolo [4,5-d]pyrimidinyl)-1,3-oxathiolanyl]-cyclopropyl-methyl] acetate; 5-amino(3’- β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(2’-O-acetyl-3’- deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(3’-deoxy-β-D- ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione; or [(2R,3R,5S)[(1S) acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; and/or the HBV capsid assembly inhibitor is 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonyl thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5- a]pyrazinyl]-2,2-dimethyl-propanoic acid; 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 2-[(1R,3S,5S)[[(4R)(2-chloro fluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6- difluoroazabicyclo[3.2.1]octanyl]acetic acid; 2-[(1S,3R,5R)[[(4R)(2-chloro fluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6- difluoroazabicyclo[3.2.1]octanyl]acetic acid; or (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

Another embodiment of present invention and/or described herein relates to the said kit, wherein the TLR7 agonist and the HBV capsid assembly inhibitor used in the container are: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl) carbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- o[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate and S)[[(4S)ethoxycarbonyl(3-fluoromethylphenyl )thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and ,3S,5S)[[(4R)(2-chlorofluoro-phenyl) ycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; o(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; or 5-amino(2’-O-acetyl-3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone and (S)[(R)(2-Chlorofluoro-phenyl)methoxycarbonylthiazolyl-3,6-dihydropyrimidinylmethyl ]-morpholinecarboxylic acid;in a pharmaceutically able carrier.

Described herein is a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a t with an effective first amount of a TLR7 agonist, or pharmaceutically acceptable salt, enantiomer or reomer thereof; and a second amount of HBV capsid ly inhibitor, or pharmaceutically acceptable salt, enantiomer or reomer thereof; wherein the TLR7 agonist is [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5- d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] acetate; [(S)-[(2S,5R)(5-amino oxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]-cyclopropyl-methyl] acetate; 5-amino- 3-(3’-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(2’-O-acetyl-3’- deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidinone; 5-amino(3’-deoxy-β-D- ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidin-2,7-dione; or [(2R,3R,5S)[(1S) acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; and/or the HBV capsid assembly inhibitor is 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonyl thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5- a]pyrazinyl]-2,2-dimethyl-propanoic acid; 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H- imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 2-[(1R,3S,5S)[[(4R)(2-chloro fluoro-phenyl)methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6- roazabicyclo[3.2.1]octanyl]acetic acid; 2-[(1S,3R,5R)[[(4R)(2-chlorofluorophenyl )methoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]-6,6-difluoro azabicyclo[3.2.1]octanyl]acetic acid; or (S)[(R)(2-Chlorofluoro-phenyl) methoxycarbonylthiazolyl-3,6-dihydro-pyrimidinylmethyl]-morpholinecarboxylic acid; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

Described herein is use of pharmaceutical composition herein mentioned above as an antiviral medicament, in particular as the medicament for treatment or prophylaxis of tis B virus infection.

Another embodiment of present ion and/or described herein relates to the use of a TLR7 agonist and an HBV capsid assembly inhibitor for the manufacture of pharmaceutical composition herein mentioned above as an antiviral ment, in particular the medicament for treatment or prophylaxis of hepatitis B virus infection.

EXAMPLES The invention will be more fully understood by reference to the following es. They should not, r, be construed as limiting the scope of the invention.

Example 1 [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- tetrahydrofuranyl]propyl] acetate (Compound 1) Compound 1 was prepared through the following scheme: TsCl MeMgBr 1A 1B 1C obenzoic acid Ac O 1D 1F Ac O HOAc 1G 1H 1I Preparation of [(2R)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- ]dioxolyl]hydroxy-ethyl] 4-methylbenzenesulfonate To a solution of (1R)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]ethane-1,2-diol (compound 1A, 100 g, 490 mmol) in dry pyridine (1000 mL) was added p-toluenesulfonyl chloride (139 g, 735 mmol) at 0oC. After being stirred at room temperature for 12 hours, the resulted solution was quenched by water (100 mL) and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:10 to 1:3 EtOAc in petroleum ether) to afford 130 g of [(2R)[(3aR,5S,6aR)-2,2- dimethyl-3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxolyl]hydroxy-ethyl] 4- methylbenzenesulfonate (compound 1B) as a slight yellow oil.

Compound 1B: 1H NMR (400 MHz, CDCl3) δ ppm: 7.82 (d, J = 8.00 Hz, 2H), 7.38 (d, J = 8.00 Hz, 2H), 5.78 (d, J = 3.76 Hz, 1H), 4.75 (t, J = 4.00 Hz, 1H), 4.20- 4.12 (m, 2H), 4.03- 3.97 (m, 2H), 2.48 (s, 3H), 2.39 (d, J = 3.51 Hz, 1H), 2.08-2.15 (m, 1 H), 1.75-1.80 (m, 1 H), 1.51 (s, 3 H), 1.33 (s, 3 H).

Preparation of (3aR,5S,6aR)-2,2-dimethyl[(2R)-oxiranyl]-3a,5,6,6atetrahydrofuro [2,3-d][1,3]dioxole To a solution of [(2R)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]hydroxy-ethyl] 4-methylbenzenesulfonate (compound 1B, 100 g, 280 mmol) in anhydrous THF (1500 mL) cooled at -70 oC was added potassium bis(trimethylsilyl)amide (340 mL, 340 mmol, 1 M in THF) under N2 atmosphere. After being stirred at -70 oC for 1 hour, the reaction mixture was poured into saturated NH4Cl on. The organic layer was separated and the aqueous phase was extracted with EtOAc. The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:3 EtOAc in petroleum ether) to afford 40.5 g of S,6aR)-2,2-dimethyl[(2R)-oxiranyl]-3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole (compound 1C) as a slight yellow oil.

Compound 1C: 1H NMR: (400 MHz, CDCl3) δ ppm: 5.87 (d, J = 3.76 Hz, 1H), 4.77 (t, J = 4.00, 1H), 4.20-4.28 (m, 1H), 3.14-3.20 (m, 1H), 2.83-2.88 (m, 1H), 2.63 (dd, J = 5.00, 2.80 Hz, 1H), 2.09 (dd, J = 12.00, 4.00 Hz, 1H), .79 (m, 1H), 1.52 (s, 3H), 1.34 (s, 3H).

Preparation of -[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propanol To a suspension of CuI (19.3 g, 107 mmol) in dry THF (2000 mL) under N2 atmosphere was added methyl ium bromide (3 M in l ether, 537 mL, 1.61 mol) at -70 oC. After being stirred at the same temperature for 1 hour, a solution of S,6aR)-2,2-dimethyl [(2R)-oxiranyl]-3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole (compound 1C, 100 g, 537 mmol, dissolved in anhydrous THF 200 mL) was added to reaction mixture dropwise. After being d at -70 oC for additional 2 hours, the reaction e was poured into saturated NH4Cl solution. The organic layer was separated and the aqueous phase was extracted with EtOAc twice. The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:3 EtOAc in petroleum ether) to afford 82 g of (1R)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6atetrahydrofuro [2,3-d][1,3]dioxolyl]propanol (compound 1D) as a slight yellow solid.

Compound 1D: 1H NMR (400 MHz, CDCl3) δ ppm: 5.83 (d, J = 3.76 Hz, 1H), 4.81 - 4.73 (m, 1H), 4.26-4.19 (m, 1H), 3.91-3.82 (m, 1H), 2.08-2.02 (m, 1H), 1.93 - 1.89 (m, 1H), 1.54 (s, 3H), 1.49-1.39 (m, 2H), 1.34 (s, 3H), 1.02 (t, J = 7.53 Hz, 3H).

Preparation of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propyl] 4-nitrobenzoate To a stirred solution of (1R)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propanol (compound 1D, 50 g, 245 mmol), triphenylphosphine (195 g, 743 mmol), 4-nitrobenzoic acid (124 g, 743 mmol) in THF (1200 mL) was added diethyl azodicarboxylate (130 g, 743 mmol) dropwise at 0 oC under N2. After being stirred at 18 oC for hours, the mixture was quenched by addition of saturated NaHCO3 on and extracted with EtOAc. The organic layers were combined, dried over Na2SO4 and concentrated in vacuo.

The residue was purified by column chromatography on silica gel ng with 1:3 EtOAc in petroleum ether) to afford 61 g of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6atetrahydrofuro [2,3-d][1,3]dioxolyl]propyl] obenzoate (compound 1E) as a slight yellow solid.

Compound 1E: 1H NMR (400 MHz, CDCl3) δ ppm: 8.34- 8.22 (m, 4 H), 5.85 (d, J = 3.76 Hz, 1H), 5.23- 5.17 (m, 1H), 4.76 (t, J = 4.27 Hz, 1H), 4.48- 4.39 (m, 1H), 2.12 (dd, J = 13.30, 4.52 Hz, 1H), 1.88- 1.78 (m, 2H), 1.71- 1.62 (m, 1H), 1.55 (s, 3 H), 1.34 (s, 3 H), 1.01 (t, J = 7.40 Hz, 3 H).

Preparation of (1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propanol To a solution of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propyl] 4-nitrobenzoate (compound 1E, 100 g, 285 mmol) in methanol (1200 mL) was added K2CO3 (78.7 g, 570 mmol). After being stirred at room temperature for 10 minutes, the resulted mixture was filtered. The filtrate was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:8 EtOAc in petroleum ether) to afford 54.7 g of (1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propanol und 1F) as a slight yellow solid.

Compound 1F: 1H NMR (400 MHz, CDCl3) δ ppm: 5.81 (d, J = 3.64 Hz, 1H), 4.75 (t, J = 4.20 Hz, 1H), 4.18- 4.11 (m, 1H), 3.49-3.40 (m, 1H), 2.07-2.00 (m, 2H), 1.84-1.75 (m, 1H), 1.59- 1.47 (m, 5H), 1.32 (s, 3H), 1.01 (t, J = 7.40 Hz, 3H).

Preparation of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propyl] acetate To a d solution of (1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- d][1,3]dioxolyl]propanol (compound 1F,13.5 g, 67 mmol), TEA (81 g, 804 mmol), DMAP (1.6 g, 13 mmol) in anhydrous DCM (150 mL) was added acetic anhydride (62 g, 603 mmol).

After being stirred at 22 oC for 10 hours, the reaction was quenched by the ted NaHCO3 solution. The organic layer was separated and the s phase was extracted with EtOAc. The combined organic layers were dried over Na2SO4, and concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:8 EtOAc in petroleum ether) to afford 13 g of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxol yl]propyl] acetate (compound 1G) as a colourless oil.

Compound 1G: 1H NMR (400 MHz, CDCl3) δ ppm: 5.83 (d, J = 3.76 Hz, 1H), 4.92 (dt, J = 7.97, 5.18 Hz, 1H), 4.74 (t, J = 4.00 Hz, 1H), 4.35- 4.27 (m, 1H), 2.12 (s, 3H), 2.08 - 1.99 (m, 1H), 1.74- 1.56 (m, 3H), 1.53 (s, 3H), 1.34 (s, 3H), 0.95 (t, J = 7.40 Hz, 3H).

Preparation of [(3R,5S)acetoxy[(1S)acetoxypropyl]tetrahydrofuranyl] acetate 1H To a solution of [(1S)[(3aR,5S,6aR)-2,2-dimethyl-3a,5,6,6a-tetrahydrofuro[2,3- ]dioxolyl]propyl] acetate (compound 1G, 4.8 g, 20 mmol), acetic acid (12.2 g, 200 mmol) and acetic anhydride (10.2 g, 100 mmol) in anhydrous DCM (100 mL) was added concentrated H2SO4 (0.5 mL) at 0 oC. After being stirred at 22 oC for 3 hours, the reaction was quenched by addition of saturated NaHCO3 solution. The organic layer was separated and the s phase was extracted with EtOAc. The combined c layers were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by column on silica gel (eluting with 1:8 EtOAc in petroleum ether) to afford 2.3 g of [(3R,5S)acetoxy[(1S) acetoxypropyl]tetrahydrofuranyl] acetate (compound 1H) as a colourless oil.

Compound 1H: 1H NMR (400 MHz, CDCl3) δ ppm: 6.12 (s, 1H), 5.19 (d, J = 4.52 Hz, 1H), 4.83- 4.91 (m, 1H), 4.34- 4.44 (m, 1H), 2.09- 2.19 (m, 9H), 1.51- 1.74 (m, 4H), 0.94 (t, J = 7.40 Hz, 3H). ation of [(2R,3R,5S)[(1S)acetoxypropyl](5-aminooxo-thiazolo[4,5- d]pyrimidinyl)tetrahydrofuranyl] acetate To a suspension of 5-amino-3H-thiazolo[4,5-d]pyrimidinone (3.5 g, 20.8 mmol) in xylene (160 mL) was added BSA (21.2 g, 104 mmol). The reaction mixture was stirred at 70 oC for 1 hour under argon to form a clear solution. After some of xylene and excrescent BSA were evaporated, [(3R,5S)acetoxy[(1S)acetoxypropyl]tetrahydrofuranyl] e (compound 1H, 3.0 g, 10.4 mmol) and TMSOTf (2.6 g, 11.6 mmol) were added in sequence at 0 oC. After being heated with stirring at 65 oC for 2 hours, the reaction was quenched with water (30 mL), extracted with EA (30 mL) three times. The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The residue was purified by column on silica gel (eluting with 1:10 to 1:1 EtOAc in petroleum ether) to give 2.0 g of [(2R,3R,5S)[(1S) acetoxypropyl](5-aminooxo-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate (compound 1I) as a white solid.

Compound 1I: 1H NMR (400 MHz, CDCl3) δ ppm: 8.15 (s, 1 H), 6.04 (d, J = 1.51 Hz, 1 H), 5.80 (d, J = 7.03 Hz, 1 H), 5.27 (br. s., 2 H), 4.98- 5.04 (m, 1 H), 4.32- 4.39 (m, 1 H), 2.63 - 2.77 (m, 1 H), 2.13 (s, 3 H), 2.09 (s, 3 H), 2.00 - 2.07 (m, 1 H), 1.61- 1.75 (m, 2 H), 0.94 (t, J = 7.40 Hz, 3 H).

Preparation of [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl) hydroxy-tetrahydrofuranyl]propyl] acetate [(2R,3R,5S)[(1S)acetoxypropyl](5-aminooxo-thiazolo[4,5-d]pyrimidin yl)tetrahydrofuranyl] acetate (compound 1I, 3.2 g, 8.0 mmol) and K2CO3 (2.2 g, 16.0 mmol) were suspended in anhydrous ethanol (85 mL) at room ature. Methanol (85 mL) was added dropwise under N2 atmosphere. After the on, the mixture was stirred at room temperature for 10 minutes (monitored by TLC). After the reaction, the mixture was poured into te NH4Cl, extracted with EA (150 mL) four times. The combined organic layers were dried over Na2SO4 concentrated in vacuo. The residue was purified by column on silica gel (eluting with 1:100 to 1:70 MeOH in DCM) to give the crude product, which was further purified by flash column (eluting with acetonitrile and water) to give 1.64 g of 1-[(2S,4R,5R)(5- aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] acetate (Compound 1) as a white power.

Compound 1: 1H NMR (400 MHz, Methanol-d4) δ ppm: 8.19 (s, 1 H), 6.02- 6.05 (m, 1 H), 4.94- 5.00 (m, 2 H), 4.33- 4.40 (m, 1 H), 2.58- 2.68 (m, 1 H), 2.03 (s, 3 H), 1.86- 1.96 (m, 1 H), 1.56 - 1.77 (m, 2 H), 0.93 (t, J = 7.40 Hz, 3 H). MS obsd. (ESI-) [(M+H)+]: 355.0.

Example 2 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]- 2,2-dimethyl-propanoic acid Compound 2 was prepared through following scheme: .TFA DIPEA 2A 2B 2 To a stirred solution of ethyl (4R)(bromomethyl)(2-chlorofluoro-phenyl) thiazolyl-1,4-dihydropyrimidinecarboxylate (compound 2A, 0.073 g, 0.16 mmol) and 3- [(8aS)oxo-1,5,6,7,8,8a-hexahydroimidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid (compound 2B, crude, 0.25 mmol) in 1,2-dichloroethane (5 mL) was added dropwise DIPEA (0.078 mL, 0.45 mmol). The reaction mixture was stirred at room temperature until the disappearance of compound 2A. The mixture was then diluted with EtOAc (50 mL) and washed successively with saturated aqueous NH4Cl solution and brine. The organic layer was separated and dried over Na2SO4. The solvent was d in vacuo and the crude t was purified by prep-HPLC to give 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazol- 2-yl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazin yl]-2,2-dimethyl-propanoic acid (Compound 2) as a light yellow solid (12 mg). 1H NMR (400 MHz, Methanol-d4) ppm 7.92 - 8.02 (m, 1H), 7.70 - 7.80 (m, 1H), 7.21 - 7.36 (m, 2H), 7.10 - 7.21 (m, 1H), 6.19 - 6.28 (m, 1H), 3.99 - 4.14 (m, 3H), 3.81 - 3.96 (m, 3H), 3.47 - 3.56 (m, 1H), 3.38 - 3.44 (m, 1H), 3.27 - 3.32 (m, 1H), 3.15 - 3.25 (m, 1H), 3.07 - 3.14 (m, 1H), 2.79 - 2.96 (m, 2H), 2.30 - 2.41 (m, 1H), 2.13 - 2.23 (m, 1H), 1.20 (d, J = 2.76 Hz, 6H), 1.13 (m, 3H). MS: calc’d 619 (M+H)+, measured 619 (M+H)+.

Preparation of ethyl (4R)(bromomethyl)(2-chlorofluoro-phenyl)thiazolyl-1,4- dihydropyrimidinecarboxylate (compound 2A): 1. NaOMe, MeOH 2. NH4Cl KOAc HCl .

CF3CH2OH 2A-1 2A-2 2A-2a 2A-2b CCl4 2A-2a 2A Preparation of thiazolecarboxamidine hydrochloride und 2A-1): To a stirred solution of thiazolecarbonitrile (1.5 g, 14 mmol) in 5 mL of dry MeOH was added dropwise a solution of sodium methoxide (0.74 g, 14 mmol) in 10 mL of dry methanol. The reaction mixture was stirred at room temperature until the disappearance of starting material. Then ammonium chloride (1.5 g, 28 mmol) was added in one portion and the reaction mixture was stirred overnight. The undissolved material was removed by tion and the filtrate was concentrated to afford lecarboxamidine hydrochloride (compound 2A-1, 2.1 g) as a grey solid which was used directly in the next step without further purification. MS: calc’d 128 (M+H)+, measured 128 (M+H)+.

Preparation of ethyl hlorofluoro-phenyl)methylthiazolyl-1,4- dihydropyrimidinecarboxylate (compound 2A-2): To a stirred solution of thiazolecarboxamidine hloride (1.3 g, 10 mmol), ethyl cetate (1.3 g, 10 mmol) and 2-chlorofluorobenzaldehyde (1.6 g, 10 mmol) in trifluoroethanol (30 mL) was added potassium acetate (2.0 g, 20 mmol). The reaction mixture was refluxed for 16 hours. After it was cooled to room temperature, the reaction e was concentrated and the residue was dissolved in ethyl acetate and then washed with brine. The organic layer was dried over Na2SO4. The solvent was removed in vacuo and the residue was purified by silica gel column chromatography (ethyl acetate/petroleum ether: from 1/4 to 1/2) to afford ethyl 4-(2-chlorofluoro-phenyl)methylthiazolyl-1,4-dihydropyrimidine carboxylate (compound 2A-2, 2.8 g) as a yellow solid. MS: calc’d (M+H)+ 380, measured (M+H)+ 380.

Preparation of ethyl (4R)(2-chlorofluoro-phenyl)methylthiazolyl-1,4- opyrimidinecarboxylate (compound 2A-2a): A chiral separation of racemic compound 2A-2 eluting with a mixed t of 85% supercritical CO2 / 15% EtOH at 100 mL/min rate on SFC (SFC-Multigram; IC: 5 × 250 mm, 5μ) gave two enantiomers of ethyl (4R)(2-chlorofluoro-phenyl)methylthiazolyl-1,4- dihydropyrimidinecarboxylate (compound 2A-2a, faster eluting) and ethyl (4S)(2-chloro- 3-fluoro-phenyl)methylthiazolyl-1,4-dihydropyrimidinecarboxylate (compound 2A- 2b, slower eluting). The absolute configuration of d (-)-enantiomer compound 2A-2a ([α]D20 -46.6 (c 0.28, MeOH)) was determined by X-ray diffraction study (Figure 2).

Preparation of ethyl (4R)(bromomethyl)(2-chlorofluoro-phenyl)thiazolyl-1,4- dihydropyrimidinecarboxylate (compound 2A): To a stirred solution of ethyl -(2-chlorofluoro-phenyl)methylthiazolyl- 1,4-dihydropyrimidinecarboxylate und 2A-2a, 0.37 g, 1.0 mmol) in CCl4 (5 mL) was added NBS (0.20 g, 1.1 mmol) in portions. After the reaction mixture was stirred at room temperature for 1 hour, the solvent was removed in vacuo and the residue was ed by silica gel column chromatography to give ethyl -(bromomethyl)(2-chlorofluoro-phenyl) thiazolyl-1,4-dihydropyrimidinecarboxylate (compound 2A, 0.35 g) as a yellow solid. MS: calc’d 459 (M+H)+, measured 459 (M+H)+.

Preparation of 3-[(8aS)oxo-1,5,6,7,8,8a-hexahydroimidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid (compound 2B): .HCl CbzCl Swern [O] NaBH(OAc)3 2B-1 2B-2 2B-3 .TFA Pd-C, H2 1. LiOH, H2O Triphosgene 2. TFA, CH2Cl2 2B-4 2B-5 2B Preparation of O1-benzyl O4-tert-butyl (2S)(hydroxymethyl)piperazine-1,4- dicarboxylate (compound 2B-1): To a stirred solution of tert-butyl (3S)(hydroxymethyl)piperazinecarboxylate (CAS number: 3147417, m; for its synthesis, please refer to: Gao H., Renslo A. R. J. Org.

Chem. 2007, 72, 8591-8592) (6 g, 27.8 mmol) in saturated NaHCO3 (45 mL) and EtOAc (45 mL) was added benzyl chloroformate (7.1 g, 41.7 mmol) dropwise at 0oC. Then the reaction mixture was stirred at room temperature for 15 hours. The reaction mixture was diluted with EtOAc (60 mL). The organic layer was separated and the aqueous layer was extracted with EtOAc (35 mL).

The combined organic layers were dried over Na2SO4. The t was removed in vacuo to give the crude product, which was purified by silica gel column chromatography (Petroleum ether : EtOAc = 10:1 to 1:1) to give O1-benzyl O4-tert-butyl (2S)(hydroxymethyl)piperazine-1,4- dicarboxylate (compound 2B-1, 6.7 g). MS: calc’d 351 (M+H)+, measured 351 (M+H)+.

Preparation of O1-benzyl O4-tert-butyl (2S)formylpiperazine-1,4-dicarboxylate (compound 2B-2): To a stirred solution of oxalyl chloride (3.64 g, 28.6 mmol) in anhydrous dichloromethane (80 mL) at -78 oC was added se dimethyl sulfoxide (4.47 g, 57.3 mmol).

After 10 minutes, a solution of O1-benzyl O4-tert-butyl (2S)(hydroxymethyl)piperazine-1,4- dicarboxylate (compound 2B-1, 6.7 g, 19.1 mmol) in dichloromethane (20 mL) was added se. After the mixture was d for 30 minutes at -78 oC, N,N-diisopropylethylamine (14.78 g, 114.6 mmol) was added and the reaction e was stirred for 30 minutes. After the reaction mixture was slowly warmed to 0 oC over 30 minutes, it was d with dichloromethane (80 mL), washed with 5% aqueous citric acid (10 mL), brine and then dried over Na2SO4. After filtration, the e was concentrated in vacuo to get the crude product O1- benzyl O4-tert-butyl (2S)formylpiperazine-1,4-dicarboxylate (compound 2B-2, 7.0 g). MS: calc’d 349 (M+H)+, measured 349 (M+H)+.

Preparation of O1-benzyl t-butyl (2R)[[(3-ethoxy-2,2-dimethyloxopropyl )amino]methyl]piperazine-1,4-dicarboxylate (compound 2B-3): To a stirred solution of ethyl 3-amino-2,2-dimethyl-propanoate hydrochloride salt (3.4 g, 18.6 mmol) in anhydrous DCM (100 mL) was added DIPEA (2.6 g, 27.3 mmol) at room temperature. Then O1-benzyl O4-tert-butyl (2S)formylpiperazine-1,4-dicarboxylate (compound 2B-2, crude, 7.0 g, 20 mmol) was added, followed by NaBH(OAc)3 (6.3 g, 29.8 mmol) and AcOH (1.5 mL) at 0 oC. The reaction mixture was d for 16 hours at room temperature. Water (100 mL) was added and the mixture was extracted with DCM (100 mL).

The organic layer was dried and concentrated in vacuo to give crude product of O1-benzyl O4- tert-butyl (2R)[[(3-ethoxy-2,2-dimethyloxo-propyl)amino]methyl]piperazine-1,4- dicarboxylate und 2B-3, 7.3 g). MS: calc’d 478 (M+H)+, measured 478 (M+H)+.

Preparation of tert-butyl (3R)[[(3-ethoxy-2,2-dimethyloxopropyl )amino]methyl]piperazinecarboxylate (compound 2B-4): To a solution of O1-benzyl O4-tert-butyl (2R)[[(3-ethoxy-2,2-dimethyloxopropyl )amino]methyl]piperazine-1,4-dicarboxylate und 2B-3, crude, 3.3 g, 6.9 mmol) in EtOH (100 mL) was added 10% palladium on carbon (1 g). Then the mixture was stirred at 50 oC for 3 hours under hydrogen atmosphere (50 Psi). The reaction mixture was filtered and the filtrate was concentrated in vacuo to get the tert-butyl (3R)[[(3-ethoxy-2,2-dimethyloxopropyl )amino]methyl]piperazinecarboxylate (compound 2B-4, 1.8 g). MS: calc’d 344 (M+H)+, measured 344 (M+H)+.

Preparation of tert-butyl (8aR)(3-ethoxy-2,2-dimethyloxo-propyl)oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinecarboxylate und 2B-5): To a solution of tert-butyl (3R)[[(3-ethoxy-2,2-dimethyloxopropyl ]methyl]piperazinecarboxylate (compound 2B-4, 1.8 g, 5.2 mmol) in anhydrous dichloromethane (60 mL) was added N,N-diisopropylethylamine (3.4 g, 26.2 mmol) at 0 oC.

Then triphosgene (783 mg, 2.6 mmol) was added at 0 oC and the mixture was stirred at 10-15 oC for 16 hours. Water (50 mL) was added and the mixture was extracted with dichloromethane (60 mL). The organic layer was dried over Na2SO4 and the solvent was removed in vacuo to give the crude product. The crude product was purified by silica gel column tography (Petroleum ether: EtOAc = 5:1 to 1:1) to give tert-butyl (8aR)(3-ethoxy-2,2-dimethyloxo-propyl) oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinecarboxylate (compound 2B-5, 1.3 g). MS: calc’d 370 (M+H)+, ed 370 (M+H)+.

Preparation of 3-[(8aS)oxo-1,5,6,7,8,8a-hexahydroimidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid und 2B): To a stirred solution of tert-butyl 2-(3-ethoxy-2,2-dimethyloxo-propyl)oxo- ,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinecarboxylate und 2B-5, 94 mg, 0.25 mmol) in THF (3 mL) was added a solution of LiOH∙H2O (84 mg, 2.0 mmol) in H2O (1 mL) at room temperature. After the reaction mixture was stirred at room temperature overnight, it was acidified to PH 3~4 with 1N HCl at 0 oC. The mixture was then trated in vacuo and azeotropically dried with toluene to give the crude acid which was dissolved in dichloromethane (2 mL) and treated with trifluoroacetic acid (2 mL) at room temperature. After the reaction mixture was stirred at room temperature for 1 hour, the solvent was removed in vacuo to give 3- [(8aS)oxo-1,5,6,7,8,8a-hexahydroimidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid (compound 2B) which was used directly. MS: calc’d 242 (M+H)+, measured 242 (M+H)+.

[(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanyl]- cyclopropyl-methyl] acetate (Compound 3) 3 Compound 3 was prepared through following scheme: Ac O 2 L-(-)-menthol 3A 3B 3C trans MMTrCl 3E 3F Ac O NaBH 3G 3H 3I 3 3J Preparation of 5-hydroxy-1,3-oxathiolanecarboxylic acid To a stirred solution of 1,4-dithiane-2,5-diol (compound 3A, 150 g, 0.98 mol) in methyl tert-butyl ether (500 mL) and cyclohexane (150 mL) was added glyoxylic acid (180 g, 1.96 mol).

The resulting reaction mixture was stirred at 80 oC under Dean-Stark conditions for 16 hours.

The resulting solution was concentrated in vacuo. The residue was purified by column chromatography on silica gel (eluting with 1:7 ethyl acetate in petroleum ether to 100% ethyl acetate) to afford 220 g of the crude 5-hydroxy-1,3-oxathiolanecarboxylic acid (compound 3B), which was used directly in the next step without further cation.

Preparation of transacetoxy-1,3-oxathiolanecarboxylic acid 3C trans To a solution of 5-hydroxy-1,3-oxathiolanecarboxylic acid (compound 3B, 220 g, 1.5 mol) in HOAc (1.5 L) was added concentrated sulfuric acid (1 mL) and acetic anhydride (50 g, 0.5 mol). After being stirred at room ature for 16 hours, the resulting on mixture was diluted with water and extracted with EtOAc. The c phase was combined and concentrated in vacuo. The e was ed by column chromatography on silica gel (eluting with 1:10 to 1:7 ethyl acetate in petroleum ether) to afford crude product, which was recrystallized from toluene to give 10 g of transacetoxy-1,3-oxathiolanecarboxylic acid (compound 3C trans).

(For the synthesis, please also refer to: J. Org. Chem. 1995, 60, 2621-2623.) Compound 3C trans: 1H NMR (400 MHz, 6) δ ppm: 13.26 (br, 1 H), 6.66 (d, J = 4.0 Hz, 1 H), 5.66 (s, 1 H), 3.30 - 3.37 (m, 1 H), 3.19 - 3.25 (m, 1 H), 2.04 (s, 3 H).

Preparation of [(1R,2S,5R)isopropylmethyl-cyclohexyl] (2S,5S)acetoxy-1,3- oxathiolanecarboxylate A solution of dicyclohexylcarbodiimide (12 g, 57 mmol) in DCM (50 mL) was added to a round bottom flask containing a solution of transacetoxy-1,3-oxathiolanecarboxylic acid (compound 3C trans, 10 g, 52 mmol), L-(-)-menthol (8.9 g, 57 mmol) and DMAP (0.6 g, 5.2 mmol) in DCM (100 mL) at 0 oC. After the reaction mixture was stirred at room ature for 16 hours, methanol (2 mL) and glacial acetic acid (2 mL) were added. The reaction mixture was stirred for another 10 minutes and then diluted with hexane (250 mL), filtrated through celite and the filtrate was concentrated to yield crude product. (J. Org. Chem. 1995, 60, 2621- 2623). The crude product was re-dissolved in hexane (250 mL), ed and the filtrate was concentrated in vacuo. The residue was purified by ritical fluid chromatography (SFC) to give 3.2 g of [(1R,2S,5R)isopropylmethyl-cyclohexyl] (2S,5S)acetoxy-1,3-oxathiolane- 2-carboxylate (compound 3D) with a diastereoisomeric excess of 85% as a colorless oil. The diastereoisomeric excess value of compound 3D was obtained by HPLC (Agilent 1260 HPLC) analysis using a chiral column (CHIRALPAK IA-3 ODH (4.6 mm × 250 mm, 5 μm)). The mobile phase of the chiral analysis was 20:80 acetonitrile in MeOH.

Compound 3D: 1H NMR (400 MHz, CDCl3) δ ppm: 6.81 (d, J = 4.0 Hz, 1 H), 5.63 (s, 1 H), 4.76 (dt, J = 10.9, 4.5 Hz, 1 H), 3.44 (dd, J = 11.7, 4.1 Hz, 1 H), 3.17 (d, J = 11.8 Hz, 1 H), 2.11 (s, 3 H), 2.00 (d, J = 12.0 Hz, 1 H), 1.85 (dt, J = 6.9, 2.5 Hz, 1 H), 1.69 (d, J = 11.0 Hz, 2 H), 1.55 - 1.26 (m, 3 H), 1.11 - 1.00 (m, 2 H), 0.91 (dd, J = 6.8, 9.8 Hz, 6 H), 0.76 (d, J = 7.0 Hz, 3 H).

Preparation of [(1R,2S,5R)isopropylmethyl-cyclohexyl] (2S,5R)(5-aminooxothiazolo [4,5-d]pyrimidinyl)-1,3-oxathiolanecarboxylate 3E A sion of 5-amino-3H-thiazolo[4,5-d]pyrimidinone (6.0 g, 36 mmol) and BSA (24.0 g, 118 mmol) in DCE (250 mL) was heated at 85 oC for 1 hour. The on mixture was cooled to 0 oC, to the above mixture was added a on of [(1R,2S,5R)isopropylmethylcyclohexyl ] (2S,5S)acetoxy-1,3-oxathiolanecarboxylate (compound 3D, 9.0 g, 27 mmol) in DCE (10 mL), followed by TMSI (14 g, 70 mmol) dropwise. The reaction mixture was stirred at 60 oC for 5 hours, quenched by aqueous NaHCO3 solution, and then extracted with EtOAc. The organic layer was washed with brine, dried over anhydrous Na2SO4 and concentrated to give the crude product as an oil, which was purified by column chromatography on silica gel (eluting with 1:100 to 1:50 methanol in dichloromethane) to give 7.7 g of a mixture of two isomers, which was further purified and separated by preparative HPLC to give the d 2.8 g of beta isomer [(1R,2S,5R)isopropylmethyl-cyclohexyl] (2S,5R)(5-aminooxo-thiazolo[4,5- d]pyrimidinyl)-1,3-oxathiolanecarboxylate (compound 3E) as a white solid. The configuration of compound 3E was determined by NOESY.

Compound 3E: 1H NMR (400 MHz, CDCl3) δ ppm: 8.17 (s, 1 H), 6.44 (m, 1 H), 5.51 (s, 1 H), 5.12 (bs, 2 H), 4.78 (m, 1 H), 4.47 (m, 1 H), 3.16 (m, 1 H), 2.00 (m, 1 H), 1.79 (m, 1 H), 1.62 (m, 2 H), 1.38 (m, 2 H), 0.98 (m, 2 H), 0.9 - 0.72 (m, 10 H). MS obsd. (ESI+) [(M+H)+]: 439.

Preparation of (2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-N-methoxy-N- methyl-1,3-oxathiolanecarboxamide A solution of [(1R,2S,5R)isopropylmethyl-cyclohexyl] (2S,5R)(5-aminooxo- thiazolo[4,5-d]pyrimidinyl)-1,3-oxathiolanecarboxylate (compound 3E, 3.0 g, 7.5 mmol) in 80% TFA aqueous (20 mL) was stirred at 50 oC for 16 hours, and then concentrated to give the crude acid as a white solid, which was re-dissolved in THF (40 mL). To the above mixture was added N-methoxymethylamine hydrochloride (2.1 g, 22 mmol), DIPEA (14.5 g, 112 mmol) and HATU (8.36 g, 22 mol) at room temperature. After being d at room temperature for 16 hours, the reaction mixture was d with DCM, washed by water and brine, dried over anhydrous Na2SO4, and concentrated to give the crude t which was purified by flash tography on silica gel (eluting with 1:100 to 1:50 methanol in dichloromethane) to give 2.1 g of (2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-N-methoxy-N-methyl-1,3- oxathiolanecarboxamide (compound 3F) as a white solid.

Compound 3F: 1H NMR (400 MHz, CDCl3) δ ppm: 8.16 (s, 1 H), 6.42 (m, 1 H), 5.83 (s, 1 H), 5.14 (bs, 2 H), 4.46 (t, J = 9.6 Hz, 1 H), 3.72 (s, 3 H), 3.23 (s, 3 H), 3.15 (m ,1 H). MS obsd.

(ESI+) [(M+H)+]: 344.

Preparation of (2S,5R)-N-methoxy[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino] iazolo[4,5-d]pyrimidinyl]-N-methyl-1,3-oxathiolanecarboxamide To a solution of )(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-N-methoxy-N- methyl-1,3-oxathiolanecarboxamide (compound 3F, 2.1 g, 6.1 mmol) in DCM (30 mL) was added collidine (1.45 g, 12 mmol), AgNO3 (2.04 g, 12 mmol) and MMTrCl (3.8 g, 12 mmol) at room temperature. After being stirred at room temperature for 16 hours, the reaction mixture was diluted with DCM, filtered to remove the solid. The filtrate was washed with water and brine, dried over ous Na2SO4 and concentrated to give the crude product, which was purified by flash tography on silica gel (eluting with 1:100 to 2:1 ethyl acetate in petroleum ether) to give 3.6 g of (2S,5R)-N-methoxy[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino]oxothiazolo [4,5-d]pyrimidinyl]-N-methyl-1,3-oxathiolanecarboxamide (compound 3G) as a yellow solid. (ESI+) [(M+H)+]: 616.

Preparation of 3-[(2S,5R)[cyclopropyl(hydroxy)methyl]-1,3-oxathiolanyl][[(4- methoxyphenyl)-diphenyl-methyl]amino]thiazolo[4,5-d]pyrimidinone To a solution of (2S,5R)-N-methoxy[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino] oxo-thiazolo[4,5-d]pyrimidinyl]-N-methyl-1,3-oxathiolanecarboxamide (compound 3G, 3 g, 5 mmol) in THF (40 mL) was added Grignard reagent, cyclopropylmagnesium bromide (0.5 M, 25 mL) at 0 oC. The reaction mixture was stirred at 0 oC for 30 min. The reaction was quenched with saturated NH4Cl solution and extracted with EtOAc. The organic layer was dried and concentrated to give the crude product, which was re-dissolved in MeOH (50 mL). To the above mixture was added NaBH4 (2.0 g, 540 mmol) at 0 oC. The reaction mixture was d at room temperature for 30 min. The reaction was ed with saturated NH4Cl solution and extracted with DCM. The organic layer was dried over anhydrous Na2SO4 and concentrated to give the crude product, which was purified by flash chromatography on silica gel ng with 1:100 to 1:1 ethyl acetate in petroleum ether) to give 1.8 g of 3-[(2S,5R) [cyclopropyl(hydroxy)methyl]-1,3-oxathiolanyl][[(4-methoxyphenyl)-diphenylmethyl ]amino]thiazolo[4,5-d]pyrimidinone (compound 3H) as a yellow solid. (ESI+) [(M+H)+]: 599.

Preparation of [cyclopropyl-[(2S,5R)[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino] oxo-thiazolo[4,5-d]pyrimidinyl]-1,3-oxathiolanyl]methyl] acetate To a solution of 3-[(2S,5R)[cyclopropyl(hydroxy)methyl]-1,3-oxathiolanyl][[(4- methoxy phenyl)-diphenyl-methyl]amino]thiazolo[4,5-d]pyrimidinone (compound 3H, 1.2 g, 2 mmol) in DCM (10 mL) was added TEA (800 mg, 8 mmol), DMAP (30 mg, 0.2 mmol) and Ac2O (400 mg, 4 mmol) at 0 oC. The reaction mixture was stirred at room temperature for 48 hours. After the reaction was completed, the reaction was quenched by water, extracted with DCM. The organic layer was dried and concentrated to give 1.3 g of the crude product propyl-[(2S,5R)[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino]oxo-thiazolo[4,5- d]pyrimidinyl]-1,3-oxathiolanyl]methyl] acetate (compound 3I) as a white solid, which was used directly in the next step without further purification. (ESI+) +]: 641.

Preparation of [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3- oxathiolanyl]-cyclopropyl-methyl] acetate A solution of [cyclopropyl-[(2S,5R)[5-[[(4-methoxyphenyl)-diphenyl-methyl]amino] oxo-thiazolo[4,5-d]pyrimidinyl]-1,3-oxathiolanyl]methyl] acetate und 3I, 1.3 g, 2 mmol) in 90% HCOOH aqueous solution (25 mL) was d at room temperature for 1 hour.

The reaction mixture was concentrated and the residue was r purified and separated by preparative HPLC to give 114 mg of [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidin- 3-yl)-1,3-oxathiolanyl]-cyclopropyl-methyl] acetate (compound 3) as a white solid.

Compound 3: 1H NMR (400 MHz, Methanol-d4) δ ppm: 8.20 (s, 1 H), 6.34 (m, 1 H), 5.34 (d, J = 6.4 Hz, 1 H), 4.54 (t, J = 6.0 Hz, 1 H), 4.18 (t, J = 8.4 Hz, 1 H), 3.31 (t, J = 6.0 Hz, 1 H), 2.02 (s, 3 H), 1.13 (m ,1 H), 0.65 - 0.42 (m, 4 H). MS obsd. (ESI+) [(M+Na)+]: 391.

Preparation of 5-amino[(2S,5R)[(S)-cyclopropyl(hydroxy)methyl]-1,3-oxathiolan yl]thiazolo[4,5-d]pyrimidinone To a solution of [(S)-[(2S,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)-1,3- oxathiolanyl]-cyclopropyl-methyl] acetate (compound 3, 500 mg, 1.36 mmol) in methanol (5 mL) was added K2CO3 (94 mg, 0.68 mmol). After being stirred at room temperature for 4 hours, the reaction was quenched with HOAc to pH 7 and then concentrated in vacuo. The residue was diluted with EtOAc and filtered. The filtrate was concentrated in vacuo. The e was purified and separated by preparative HPLC to give 45 mg of 5-amino[(2S,5R)[(S)- cyclopropyl(hydroxy)methyl]-1,3-oxathiolanyl]thiazolo[4,5-d]pyrimidinone und 3J) as a white powder.

Compound 3J: The absolute structure was determined by 1H NMR and single crystal X- ray structural analysis as shown in Figure 3. 1H NMR (400 MHz, Methanol-d4) δ ppm: 8.25 (s, 1 H), 6.39 (dd, J = 9.16, 5.65 Hz, 1 H), 5.24 (d, J = 5.27 Hz, 1 H), 4.06 (dd, J = 10.29, 9.29 Hz, 1 H), 3.13 - 3.30 (m, 2 H), 0.37 - 1.04 (m, 5 H). MS obsd. (ESI+) [(M+H)+]: 327.0.

Example 4 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]- 2,2-dimethyl-propanoic acid (Compound 4) 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]- methyl-propanoic acid (Compound 4) nd 4 was prepared through following scheme: .TFA DIPEA 4A 2B 4 The title compound was prepared in y to Compound 2 by using ethyl (4S) (bromomethyl)(3-fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidine carboxylate (compound 4A) instead of ethyl (4R)(bromomethyl)(2-chlorofluorophenyl )thiazolyl-1,4-dihydropyrimidinecarboxylate (compound 2A). Compound 4 was obtained as a light yellow solid (132 mg). 1H NMR (400 MHz, Methanol-d4) δ ppm 7.95 (d, J = 3.3 Hz, 1H), 7.75 (d, J = 3.3 Hz, 1H), 7.08-7.23 (m, 2H), 6.95 (t, J = 8.8 Hz, 1H), 5.99 (s, 1H), 4.02-4.17 (m, 3H), .00 (m, 3H), 3.36-3.57 (m, 2H), 3.26-3.33 (m, 1H), 3.17-3.25 (m, 1H), 3.11 (dd, J = 9.3, 4.0 Hz, 1H), 2.78-2.99 (m, 2H), 2.53 (d, J = 2.0 Hz, 3H), 2.39 (dd, J = 11.2, 8.2 Hz, 1H), 2.14-2.26 (m, 1H), 1.21 (d, J = 2.8 Hz, 6H), 1.15 ppm (t, J = 7.2 Hz, 3H). MS: calc’d 599 (M+H)+, measured 599 (M+H)+.

Preparation of ethyl (4S)(bromomethyl)(3-fluoromethyl-phenyl)thiazol- ,4-dihydropyrimidinecarboxylate (compound 4A): Compound 4A was prepared in analogy to compound 2A by using 2-methyl fluorobenzaldehyde instead of 2-chlorofluorobenzaldehyde. The optical on of compound 4A: [α]D20 -21.0 (c 0.10, MeOH).

Example 5 -amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione (compound 11) Compound 11 Compound 11 was prepared according to the following Scheme. 1H 11A 11 Preparation of [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5- d]pyrimidinyl)tetrahydrofuranyl] acetate To a suspension of 5-amino-3,6-dihydrothiazolo[4,5-d]pyrimidine-2,7-dione (5.37 g, 29.1 mmol) and [(3R,5S)acetoxy[(1S)acetoxypropyl]tetrahydrofuranyl] acetate (compound 1H, 2.8 g, 9.7 mmol) in itrile (140 mL) was added BSA (21.4 mL, 87.3 mmol). The reaction mixture was stirred at 65 oC for 1.5 hour under argon to form a clear solution. Then to the solution was added TMSOTf (9.8 g, 43.7 mmol) and the e was stirred at 65 oC for another 3 hours. The reaction was concentrated in vacuum. The residue was dissolved in EtOAc (200 mL) and extracted with saturated NaHCO3 solution (50 mL). A precipitate was out of the organic layer. The resulting mixture was filtered and the filtrate was washed with brine (50 mL), dried over Na2SO4 and concentrated in vacuum to give 2.3 g of the crude product [(2R,3R,5S) 1-acetoxypropyl](5-amino-2,7-dioxo-6H-thiazolo[4,5-d]pyrimidinyl)tetrahydrofuran- 3-yl] acetate (compound 11A) as a yellow solid. MS obsd. (ESI-) [(M+H)+]: 413.1.

Preparation of 5-amino[(2R,3R,5S)hydroxy[(1S) hydroxypropyl]tetrahydrofuranyl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione To a solution of [(2R,3R,5S)[(1S)acetoxypropyl](5-amino-2,7-dioxo-6H- lo[4,5-d]pyrimidinyl)tetrahydrofuranyl] acetate (compound 11A, 2.3 g, 5.58 mmol) in methanol (100 mL) was added sodium methoxide (1.5 g, 27.9 mmol) After the on, the mixture was stirred at room temperature for 1.5 hours (monitored by TLC). After the reaction was ted, the reaction was quenched with saturated aqueous NH4Cl (50 mL). The resulting mixture was concentrated in vacum to remove most of MeOH. The residue was extracted with EtOAc (100 mL) ten times. The combined c layer was washed with brine (100 ml), dried over Na2SO4 and concentrated in vacuum. The residue was purified by silica gel column eluted with OH=20/1 to 10/1 to give 360 mg of 5-amino[(2R,3R,5S)hydroxy[(1S) hydroxypropyl]tetrahydrofuranyl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione (Compound 11) as a white solid and 550 mg of crude product.. nd 11: 1H NMR (400 MHz, DMSO-d6) δ 11.22 (br s, 1H), 6.95 (br s, 2H), 5.72 (d, J=2.26 Hz, 1H), 5.42 (d, J=4.52 Hz, 1H), 4.73 (m, 1H), 4.53 (d, J=6.02 Hz, 1H), 3.96 (m, 1H), 3.25-3.32 (m, 1H), 2.25-2.48 (m, 1H), 1.66-1.74 (m, 1H), 1.35-1.46 (m, 1H), 1.19-1.31 (m, 1H), 0.88 (t, J=7.28 Hz, 3H) Example 6 HEK293-Blue-hTLR-7 cells assay: A stable HEK293-Blue-hTLR-7 cell line was purchased from InvivoGen : hkb-htlr7, San Diego, California, USA). These cells were designed for studying the stimulation of human TLR7 by monitoring the activation of NF-κB. A SEAP ted embryonic ne phosphatase) reporter gene was placed under the control of the IFN-βminimal promoter fused to five NF-κB and APbinding sites. The SEAP was induced by activating NF-κB and AP-1 via stimulating HEK-Blue hTLR7 cells with TLR7 ligands. Therefore the reporter expression was regulated by the NF-κB promoter upon stimulation of human TLR7 for 20 hours. The cell culture supernatant SEAP reporter ty was determined using QUANTI-Blue™ kit (Cat.#: rep-qb1, Invivogen, San Diego, Ca, USA) at a wavelength of 640 nm, a detection medium that turns purple or blue in the presence of alkaline phosphatase.

HEK293-Blue-hTLR7 cells were incubated at a density of 250,000~450,000 cells/mL in a volume of 180 µL in a l plate in Dulbecco's Modified Eagle's medium (DMEM) containing 4.5 g/L glucose, 50 U/mL penicillin, 50 mg/mL streptomycin, 100 mg/mL Normocin, 2 mM L-glutamine, 10% (v/v) heat-inactivated fetal bovine serum for 24 h. Then the HEK293- Blue-hTLR-7 cells were incubated with addition of 20 μL test compound in a serial dilution in the presence of final DMSO at 1% and perform tion under 37 ºC in a CO2 incubator for 20 hours. Then 20 µL of the atant from each well was incubated with 180 µL Quanti-blue substrate solution at 37°C for 2 hours and the absorbance was read at 620~655 nm using a spectrophotometer. The signalling pathway that TLR7 activation leads to downstream NF-κB tion has been widely accepted, and therefore similar reporter assay was also widely used for evaluating TLR7 agonist (Tsuneyasu Kaisho and Takashi Tanaka, Trends in Immunology, Volume 29, Issue 7, July 2008, Pages 329.sci; Hiroaki Hemmi et al, Nature Immunology 3, 196 - 200 (2002).

The TLR7 agonism activity in HEK293- hTLR-7 assay of compound 11 was 72µM.

Example 6 A combination of TLR7 t (Compound 1) and HBV capsid assembly inhibitor (Compound 2) potently reduced HBV DNA and HBsAg in AAV-HBV mouse model Animal model 4-week old male C57BL/6 mice, specific pathogen free, were purchased from Shanghai tory Animal Center of Chinese Academy of Sciences (SLAC) and housed in an animal care facility in dually ventilated cages under controlled temperature and light conditions following the Institutional Animal Care ines. AAV/HBV virus was purchased from Beijing FivePlus Molecular Medicine Institute (Beijing, China). This recombinant virus carries 1.3 copies of the HBV genome, which was packaged in AAV serotype 8 (AAV8) capsids.

C57BL/6 mice were injected with 200µL of recombinant virus, diluted in saline buffer, through tail vein ion. The mice were bled at days 7 and 14 post injection to r HBV surface antigen ), HBV e antigen (HBeAg), HBs dy (HBsAb) and HBV genomic DNA in serum, and then were randomly grouped ing to these HBV biomarkers.

Measurement of HBV biomarkers Serum HBsAg and HBeAg was measured using CLIA kits (Autobio Diagnostics Co., Ltd , Zhengzhou, China) according to the manufacturer’s instructions. The lower limit of detection for HBsAg and HBeAg was 0.1ng/mL and U/mL (national clinical unit/mL) respectively.

Serum dilution of 100-fold (for HBsAg) or 500-fold (for HBeAg) was used to obtain values within the linear range of the standard curve. Serum HBV DNA was extracted using a MagNA Pure 96 DNA and Viral NA Small Volume Kit (Roche) following the manufacturer’s instructions. The DNA samples were analyzed by real-time quantitative PCR (qPCR) using a HBV-specific primer and probe set for specific amplification and detection of a 128bp HBV genome region from the nucleotide 2969 to 3096. The ces of the primers and probe are shown as follows: Forward primer: AAGAAAAACCCCGCCTGTAA; Reverse primer: CCTGTTCTGACTACTGCCTCTCC; HBV-Probe: 5'TARMA-CCTGATGTGATGTTCTCCATGTTCAGC-BHQ2-3'.

Anti-HBs in the serum was measured on day 24 after the treatment ended using Anti-HBs CLIA kits (Autobio Diagnostics Co., Ltd , Zhengzhou, China) following the manufacturer’s instructions. The serum samples were 3-fold diluted and 50 μL of the diluted samples were used for the assay.

Experiment design and results 10mg/mL of Compound 1 and mL of Compound 2 was ated as an inclusion complex with 2% Klucel LF, 0.1% rbate 80, and 0.1% Parabens in water. All the mice were orally dosed for a total of 6 weeks followed by a 2-week off-treatment period. In one single-treatment control study, the five mice of the group Compound 1 were treated with Compound 1 at 100mg/kg every other day (QOD). The vehicle group was treated with an equivalent volume of oral-QD vehicle placebo (2% Klucel LF, 0.1% Polysorbate 80, and 0.1% Parabens in water). In the combination therapy study, the five mice of the group Compound 2 were administered at 12mg/kg orally once daily (QD). The group Combo received 100mg/kg of nd 1 QOD plus 12mg/kg Compound 2 QD. The vehicle group was treated with an equivalent volume of oral-QD vehicle placebo (2% Klucel LF, 0.1% Polysorbate 80, and 0.1% Parabens in water).

A mouse model with high level expression of both HBV DNA and HBsAg was generated by injecting C57BL/6 mice with a recombinant adeno-associated virus (AAV) ng a replicable HBV genome (AAV-HBV). At 3 weeks post infection, persistent HBV viral markers such as HBV genomic DNA, HBsAg, and HBeAg were detected in the sera of the infected mice.

With the long-lasting HBV viremia and a fully ent immune , the AAV-HBV model was used to investigate the individual and combined effect of Compound 1, a prodrug of a TLR7 agonist, the active form of which, after sion, induces potent innate immune responses, and Compound 2, a small molecule which inhibits HBV capsid assembly. As shown in Figure 1, after a 6-week ent, Compound 1 induced more than 2-log reduction in HBV DNA and more than 1-log reduction in HBsAg. Compound 2 alone reduced HBV DNA by more than 3-log and to the level below the LLQ (lower limit of quantification), and moderately reduced the HBsAg level. The combination of the Compound 1 and Compound 2 ed in a nable reduction in both HBV DNA and HBsAg to the level below the LLQ even at the end of a 2-week off-treatment period. The results provide evidence for the synergistic antiviral effect of the novel y with the combination treatment of a TLR7 agonist and a HBV capsid assembly inhibitor.

Example 7 A combination of TLR7 agonist (Compound 1 and 3) and HBV capsid assembly inhibitor (Compound 4 and 5) potently reduced HBV DNA and HBsAg in AAV-HBV mouse model In another independent study, more combinations of a TLR7 agonist plus a Capsid inhibitor and corresponding single compound treatments were tested (summarized in Table 2) using the same AAV-HBV mouse model and method of measurement of HBV biomarkers described in Example 5.

Table 2. Combination study design in AAV-HBV mouse model for Compound 1, 3, 4 and 5 Treatment Group # Mice# Compound Dose (mg/kg) Drug delivery 1 8 vehicle 0 PO, QOD, 42D 2 8 Compound 1 100 3 8 Compound 4 20 PO, QD, 42D 4 8 Compound 3 30 PO, QOD, 42D 8 Compound 5 12 PO, QD, 42D Compound 1 100 PO, QOD, 42D 6 8 Compound 4 20 PO, QD, 42D nd 3 30 PO, QOD, 42D 7 8 nd 4 20 PO, QD, 42D Compound 1 100 PO, QOD, 42D 8 8 Compound 5 12 PO, QD, 42D In this study, eight mice were recruited in each group, and animals ed the first dose on day 28 post AAV-HBV infection. The tested combinations included Compound 1 plus Compound 4, Compound 3 plus Compound 4, and Compound 1 plus Compound 5. All compounds were formulated as an inclusion complex with 2% Klucel LF, 0.1% rbate 80, and 0.1% Parabens in water, and an equivalent volume of placebo containing 2% Klucel LF, 0.1% rbate 80, and 0.1% Parabens was used in the vehicle group. Specifically, for the combination of Compound 1 plus Compound 4, 10mg/mL of Compound 1 and 2mg/mL of nd 4 was ated. The group Compound 1 was orally dosed at 100mg/kg QOD, while the group Compound 4 were orally dosed at 20mg/kg QD. The corresponding Combo group received 100mg/kg of Compound 1 QOD plus 20mg/kg nd 4 QD. For the combination of Compound 3 plus Compound 4, 3mg/mL of Compound 3 and 2mg/mL of Compound 4 was formulated. The group Compound 3 were orally dosed at 30mg/kg QOD, while the group Compound 4 were orally dosed at 20mg/kg QD. The corresponding Combo group received 30mg/kg of Compound 3 QOD plus 20mg/kg Compound 4 QD. For the combination of nd 1 plus Compound 5, 10mg/mL of Compound 1 and 1.2mg/mL of Compound 5 was formulated. The group Compound 1 were orally dosed at 100mg/kg QOD, while the group Compound 5 were orally dosed at 12mg/kg QD. The corresponding Combo group received 100mg/kg of Compound 1 QOD plus 12mg/kg nd 5 QD. After the first dose, mice were submandibularly bled (75 μL blood/mouse) twice per week for serum collection until the end of the studies. The collected blood were left at 37°C for at least 30 minutes to coagulate and then centrifuged at 13,200 × g, 4°C for 3 minutes to obtain mouse serum. These serum samples were subjected to analysis of HBV biomarkers.

As shown in Figure 4, single treatment of Compound 4 at 20mg/kg inhibited HBV DNA and reduced HBsAg by 2-log at the end of 6-week treatment. The combination of Compound 1 (TLR7 agonist) plus Compound 4 (HBV capsid inhibitor) clearly demonstrated a superior antiviral effect ally in controlling the HBsAg. In all animals taking the ation therapy, their HBsAg d to the level close to or below the LLQ within 4 weeks of the treatment, and a more than 3.5-log HBsAg ion at the end of the treatment could last for at least 6 weeks during the off-treatment period. During the off-treatment period, 6 out of 8 mice were found to have developed detectable levels of anti-HBs, as shown in Figure 7.

As shown in Figure 5, another TLR7 agonist Compound 3 also reduced both HBV DNA and HBsAg. The combination of Compound 3 plus the capsid inhibitor Compound 4 exhibited further reduction in HBV DNA (>4 log) and in HBsAg (2.7-log). As shown in Figure 7, 3 out of 8 mice taking Compound 3 plus Compound 4 ped detectable levels of anti-HBs during the 6-week off-treatment period.

As shown in Figure 6, Compound 5 is another capsid inhibitor which reduced both HBV DNA and HBsAg. The ation of Compound 5 plus the TLR7 agonist Compound 1 further suppressed HBsAg below the LLQ within 4 weeks post ent, and the viral reduction was ned throughout the study even after the treatment was removed for 6 weeks.

As shown in Figure 7, 4 out of 8 mice taking Compound 1 plus nd 5 developed detectable levels of anti-HBs during the 6-week off-treatment period.

Example 8 A combination of TLR7 agonist (Compound 1 and 8) and HBV capsid assembly inhibitor (Compound 4 and 10) potently reduced HBV DNA and HBsAg in V mouse model In another independent study, more combinations of a TLR7 agonist plus a Capsid inhibitor and ponding single nd treatments were tested (as summarized in Table 3) using the same AAV-HBV mouse model and methods of measurement of HBV kers described in Example 5.

Table 3. Combination study design in AAV-HBV mouse model for Compound 1, 4, 8 and 10 Treatment and regimen Group # Mice# Compound Dose (mg/kg) Drug delivery 1 7 vehicle 0 2 7 Compound 1 100 PO, QOD, 42D, 3 7 Compound 8 300 4 7 Compound 4 20 PO, QD, 42D 7 Compound 10 20 Compound 1 100 PO, QOD, 42D 6 7 Compound 10 20 PO, QD, 42D Compound 8 300 PO, QOD, 42D 7 7 Compound 4 20 PO, QD, 42D Compound 8 300 PO, QOD, 42D 8 7 Compound 10 20 PO, QD, 42D In this ic study, seven mice were recruited in each group and animals received the first dose at least 38 days post AAV-HBV ion. The tested combinations included Compound 8 plus Compound 4, nd 8 plus Compound 10, and Compound 1 plus Compound 10. All compounds were formulated as an inclusion complex with 2% Klucel LF, 0.1% Polysorbate 80, and 0.1% Parabens in water, and an equivalent volume of placebo containing 2% Klucel LF, 0.1% Polysorbate 80, and 0.1% Parabens was used in the vehicle group. Specifically, for the combination of Compound 8 plus Compound 4, 30mg/mL of Compound 8 and 2mg/mL of Compound 4 were formulated. The group Compound 8 were orally dosed at 300mg/kg QOD, while the group nd 4 were orally dosed at 20mg/kg QD. And then the ponding Combo group received 30mg/kg of Compound 8 QOD plus 20mg/kg Compound 4 QD. For the combination of Compound 8 plus Compound 10, 30mg/mL of Compound 8 and 2mg/mL of Compound 10 were formulated. The group Compound 8 were orally dosed at 300mg/kg QOD, while the group Compound 10 were orally dosed at 20mg/kg QD. And then the corresponding Combo group received 300mg/kg of Compound 8 QOD plus 20mg/kg Compound 10 QD. For the ation of Compound 1 plus Compound 10, 10mg/mL of Compound 1 and 2mg/mL of nd 10 were formulated.

The group Compound 1 was orally dosed at 100mg/kg QOD, while the group Compound 10 were orally dosed at 20mg/kg QD. And then the corresponding Combo group received 100mg/kg of nd 1 QOD plus 20mg/kg Compound 10 QD. After the first dose, mice were submandibularly bled (75 μL blood/mouse) twice per week for serum collection until the end of the studies. The collected blood were left at 37°C for at least 30 minutes to coagulate and then centrifuged at 13,200 × g, 4°C for 3 minutes to obtain mouse serum. These serum samples were subjected to analysis of HBV biomarkers.

The results in Figure 8 showed that TLR7 agonist Compound 8 alone reduced HBV DNA and HBsAg by about 2-log and 1.5-log respectively at the end of the treatment, while the combination of Compound 8 plus capsid inhibitor Compound 4 r d HBsAg to the level below the LLQ. During the 6-week eatment period, the combination group demonstrated sustainable HBsAg reduction, l HBV DNA rebound, and high levels of anti-HBs which was not seen in vehicle and single treatment , as shown in Figure 11.

Such benefits of the combination treatment were also consistently ed in the combination groups of Compound 8 plus Compound 10, and Compound 1 plus Compound 10, as shown in Figures 9, 10, and 11.

In summary, the results above have proven for the first time that the combination of a TLR7 t plus an HBV Capsid inhibitor is an effective therapy to greatly reduce or even eliminate HBV DNA and HBsAg. After the combination therapy, the viral suppression has been shown to last for as long as 6 weeks without treatment. In most chronically HBV-infected patients, the current available therapies can rarely achieve HBsAg seroconversion due to the fact that most of these therapies are unable to elicit anti-HBs (antibody against HBsAg). In our combination studies, it is striking to find that anti-HBs has become detectable during the 6-week off-treatment period, and this was most t in the mice taking the combination therapies as shown in Figure 7 and 11. Therefore, the combination therapy of a TLR7 agonist plus an HBV Capsid inhibitor offers another key benefit to promote the development of anti-HBs. As sustained HBsAg loss and/or anti-HBs seroconversion is an ideal treatment nt for chronic hepatitis B, our combination treatment represents a novel way to achieve clinical cure of chronic HBV infection.

In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the ion. Unless ically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.

Claims (5)

Claims

1. A pharmaceutical composition comprising a TLR7 agonist and an HBV capsid assembly tor, in a pharmaceutically acceptable carrier, wherein the TLR7 agonist is selected from 5 [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate having the structure 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- 10 thiazolo[4,5-d]pyrimidine-2,7-dione having the structure and wherein the HBV capsid assembly inhibitor is ed from 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- 15 dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure 5 ; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof. 2. The pharmaceutical composition according to claim 1, wherein the composition consists of 10 [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] e having the structure 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- 15 yl-propanoic acid having the structure in a pharmaceutically acceptable carrier. 3. The pharmaceutical composition according to claim 1, n the composition consists of 5 [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] e having the structure 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- 10 dimethyl-propanoic acid having the structure in a pharmaceutically acceptable carrier. 4. The pharmaceutical composition according to claim 1, wherein the composition consists of 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione having the structure 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- 5 opyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure in a pharmaceutically acceptable r. 5. The pharmaceutical composition according to claim 1, wherein the composition 10 consists of 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione having the structure 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- 15 dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure in a pharmaceutically acceptable carrier. 6. The pharmaceutical ition according to any one of claims 1 to 5, wherein the composition additionally comprises one or more other antiviral agents. 5 7. The pharmaceutical composition according to claim 6, wherein said other antiviral agents are selected from lamivudine, ir, tenofovir, telbivudine and entecavir. 8. A kit comprising a container comprising a TLR7 agonist and an HBV capsid assembly inhibitor, wherein the TLR7 t is selected from [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- 10 tetrahydrofuranyl]propyl] acetate having the structure ; or 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione having the structure or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; and n the HBV capsid assembly inhibitor is selected from 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- 5 dimethyl-propanoic acid having the structure ; or 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure 10 ; or pharmaceutically acceptable salt, enantiomer or diastereomer thereof. 9. The kit according to claim 8, wherein the TLR7 t and the HBV capsid ly inhibitor used in the container are: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- 15 tetrahydrofuranyl]propyl] acetate and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)- 5-ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoro- 5 2-methyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)- 5-ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8a- 10 tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and 3-[(8aS)[[(4S)ethoxycarbonyl(3- fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo- 15 5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; in a pharmaceutically able carrier. 10. The kit according to claim 9, further comprising a sterile diluent. 11. The kit according to any one of claims 8 to 10, further comprising a package insert comprising printed instructions directing the use of a combined treatment of a TLR7 agonist and 20 an HBV capsid assembly inhibitor as a method for treatment or laxis of tis B virus infection. 12. Use of a combination of a TLR7 agonist and a HBV capsid assembly tor, selected from the group consisting of: [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy- 25 tetrahydrofuranyl]propyl] acetate and S)[[(4R)(2-chlorofluoro-phenyl)- 5-ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; [(1S)[(2S,4R,5R)(5-aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxytetrahydrofuranyl ]propyl] acetate and S)[[(4S)ethoxycarbonyl(3-fluoro- yl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 5 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)- 5-ethoxycarbonylthiazolyl-1,4-dihydropyrimidinyl]methyl]oxo-5,6,8,8atetrahydro-1H-imidazo [1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; 10 5-amino[(2R,3R,5S)hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H- thiazolo[4,5-d]pyrimidine-2,7-dione and S)[[(4S)ethoxycarbonyl(3- fluoromethyl-phenyl)thiazolyl-1,4-dihydropyrimidinyl]methyl]oxo- 5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2-dimethyl-propanoic acid; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof, 15 in the manufacture of one or more medicament for the treatment or prophylaxis of hepatitis B virus infection. 13. Use according to claim 12, wherein the combination is [(1S)[(2S,4R,5R)(5- aminooxo-thiazolo[4,5-d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] acetate having the structure and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid having the structure or a ceutically acceptable salt, enantiomer or diastereomer thereof. 14. Use according to claim 12, wherein the combination is [(1S)[(2S,4R,5R)(5-

2-oxo-thiazolo[4,5-d]pyrimidinyl)hydroxy-tetrahydrofuranyl]propyl] 5 acetate having the structure and

3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,

4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,

5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; 10 ; or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. 15. Use according to claim 12, wherein the combination is 5-amino[(2R,3R,5S) hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione having the structure 5 and 3-[(8aS)[[(4R)(2-chlorofluoro-phenyl)ethoxycarbonylthiazolyl-1,4- dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- dimethyl-propanoic acid; or a pharmaceutically acceptable salt, omer or diastereomer thereof. 10 16. Use according to claim 12, wherein the combination is 5-amino[(2R,3R,5S) hydroxy[(1S)hydroxypropyl]tetrahydrofuranyl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione having the structure and 3-[(8aS)[[(4S)ethoxycarbonyl(3-fluoromethyl-phenyl)thiazolyl-1,4- 15 dihydropyrimidinyl]methyl]oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazinyl]-2,2- yl-propanoic acid having the structure or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. 17. Use according to any one of claims 12 to 16, wherein the TLR7 agonist and the HBV capsid assembly inhibitor are formulated for co-administration in the same formulation or 5 different formulations. 18. Use according to any one of claims 12 to 17, n the TLR7 agonist and the HBV capsid assembly inhibitor are formulated for administration to a subject by the same route or different . 19. Use ing to any one of claims 12 to 18, wherein the TLR7 agonist and the HBV 10 capsid assembly inhibitor are formulated for administration to a subject by parenteral or oral administration. 20. Use according to any one of claims 12 to 19, wherein the TLR7 agonist and the HBV capsid assembly tor are formulated for simultaneous or sequential administration. 21. A pharmaceutical composition according to any one of claims 1 to 7, substantially as 15 herein described with nce to any example thereof. 22. A kit according to any one of claims 8 to 11, substantially as herein bed with reference to any example thereof. 23. Use according to any one of claims 12 to 20, substantially as herein described with reference to any example thereof. W0