NZ711245A

NZ711245A - New Polypeptides having a Binding Affinity for the Neonatal Fc Receptor

Info

Publication number: NZ711245A
Application number: NZ711245A
Authority: NZ
Inventors: Lars Abrahmsén; Malin Lindborg; Elin Gunneriusson; Caroline Ekblad; John Löfblom; Torbjörn Gräslund; Johan Seijsing
Original assignee: Affibody Ab
Priority date: 2013-03-15
Filing date: 2014-03-17
Publication date: 2020-11-27
Also published as: JP2020022487A; ZA201506407B

Abstract

The present disclosure relates to a class of engineered polypeptides having a binding affinity for the neonatal Fc receptor (in the following referred to as FcRn), and provides an FcRn binding polypeptide comprising the sequence E X2 X3 X4 A X6 X7 EIRWLPNL X16 X17 X18 QR X21 AFI X25 X26 L X28 X29. The present disclosure also relates to the use of such an FcRn binding polypeptide as an agent for modifying pharmacokinetic and pharmacodynamic properties and as a therapeutic agent.

Description

NEW POLYPEPTIDES HAVING A BINDING AFFINITY FOR THE NEONATAL FC RECEPTOR Technical field of the ion The present disclosure relates to a class of engineered polypeptides having a binding affinity for the neonatal Fc receptor (in the following ed to as FcRn). The present disclosure also relates to the use of such an FcRn binding ptide as an agent for modifying cokinetic and pharmacodynamic ties of a biomolecule, eg. a pharmaceutical, and as a therapeutic agent. 1O ound The neonatal Fc receptor (FcRn) is a heterodimeric protein consisting of a transmembrane MHC class |-|ike heavy chain (FcRn o-chain) and the 62— microglobulin light chain, the latter also forming a part of MHC class I molecules (Simister and Mostov (1989) Nature 337:184—7; Burmeister etal. (1994) Nature 372:379—83).

FcRn is predominantly located in mes and is able to bind to serum albumin and immunoglobulin G (lgG) at pH 3 6.5 and release them at pH 2 7.0 (reviewed in Roopenian (2007) Nat Rev Immunol 7:715—25).

FcRn carries out several distinct tasks in mammals (reviewed in Roopenian, supra). FcRn is involved in ing of endocytosed lgG and serum albumin, thus avoiding their degradation in the lysosome, giving them longer half—life and higher availability in the blood than other serum proteins.

When lgG, serum albumin and other serum proteins are passively tosed by cells in contact with blood, the pH becomes gradually lower in the formed endosomes, which permits the g of lgG and serum albumin to FcRn. The receptor is then, together with its bound ligand, transported via recycling endosomes back to the plasma membrane. After returning to the plasma membrane, the pH increases to above 7, at which point the bound ligand is released.

FcRn is also recognized for its ability to transport [96 over barriers such as the placenta, the upper airway epithelium, the blood-brain barrier and the proximal small intestine. in mammals, the ties of FcRn are used to transcytose lgG from a mother to a fetus via the placenta, and to transcytose lgG from a mother’s milk to the blood stream of an infant in the proximal small intestine.

The expression pattern of FcRn differs between species. However, FcRn is widely expressed by cells in the blood brain barrier, upper airway epithelium, kidneys and vascular endothelia, and by antigen presenting cells as well as by other cells of hematopoietic origin in most species (reviewed in Roopenian (2007), supra).

Antibodies and peptides with affinity towards FcRn (Liu et al. (2007) J lmmunol 179:2999-3011, Mezo et al. (2008) Proc Natl Acad Sci U S A 105:2337—42) and B2—microglobulin n and Balthasar (2005) J Pharm Sci -29) have been developed with a view to inhibit the binding between endogenous lgG and FcRn. Another approach has been to mutate the Fc region of the lgG to get a higher affinity for FcRn (Petkova et al. (2006) lnt lmmunol 18:1759—69, Vaccaro etal. (2005) Nat Biotechnol 23:1283-8).

Fusion to the Fc domain or to albumin is a widely used strategy to increase the in vivo ife of ns. However, the large size of such fusion proteins adversly affects tissue penetration and reduces the specificity to the fusion partner (Valles ef al. (2011) J interferon Cytokine Res -184). On the other hand, mutations have been made in the Fc fragment of antibodies administered to non human primates to g half-life (Hinton et al. (2004) J Biol Chem 279:6213—6). However, this approach is only limited in use to therapeutic antibodies, and cannot be extrapolated to other therapeutic proteins unless the proteins in question are fused to Fc nts, which also results in large size molecules. A number of chemical and recombinant methods have been devised to improve protein half—life, such as PEGylation and genetic fusions of the protein to the Fc domain of lgG or albumin (reviewed in Schellenberger et al. (2009) Nat Biotechnol 21:1186-1190).

PEGylation of proteins has been ed to decrease their potency and 3O contribute to their immunoreactivity. ion proteins have also been used for oral and pulmonary delivery mediated by the FcRn (Low ef al., (2005) Human uction Jul;20(7):1805~ 13), however similar problems relating to tissue penetration and reduced specificity remain, due to the size of the fusion molecules.

Hence, there is large need in the field for the continued provision of z molecules with high ty for FcRn. in particular, small binding molecules are needed that, when present as a fusion partner, do not adversely affect the properties of the les they are fused to and do not contribute to immunoreactivity.

Summary of the invention It is an object of the present disclosure to provide new FcRn binding agents for use in modifying pharmacokinetic and/or pharmacodynamic properties of a biomolecule, e.g. a pharmaceutical.

It is also an object of the present disclosure to provide new FcRn binding agents for use as therapeutic agents in their own right, alone or as combination treatment.

It is an object of the present disclosure to provide a molecule allowing for efficient targeting of FcRn, while alleviating the mentioned and other drawbacks of current ies.

These and other objects which are evident to the skilled person from the present disclosure are met by different aspects of the invention as claimed in the appended claims and as generally sed .

Thus, in the first aspect of the disclosure, there is provided a neonatal Fc receptor (FcRn) binding polypeptide, comprising an FcRn binding motif, BM, which motif consists of the amino acid sequence EX2 X3 X4 AX6 X7 EIR WLPNLX16 X17 X18 QR X21 AF|X25 X26LX28 X29 wherein, ndently from each other, X2 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, G, H, l, K, L, M, N, Q, R, S, T, V, Wand X4 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; ' X6 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X7 is selected from A, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X16 is selected from N and T; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is ed from A, S, V and W; X25 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X26 is selected from K and S; X28 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X29 is selected from D and R.

The above tion of a class of sequence related, FcRn binding polypeptides is based on a statistical analysis of a number of random polypeptide variants of a parent scaffold, that were ed for their interaction with FcRn in several ent selection experiments. The identified FcRn binding motif, or “BM", ponds to the target binding region of the parent scaffold, which region constitutes two alpha helices within a three— helical bundle protein domain. In the parent scaffold, the varied amino acid residues of the two BM helices constitute a binding surface for interaction with the constant Fc part of antibodies, In the present sure, the random ion of binding surface residues and subsequent selection of variants have replaced the Fc interaction capacity with a capacity for interaction with FcRn.

In one embodiment of said FcRn g polypeptide, the BM consists of the amino acid sequence EX2 X3 X4 AXs X7 EIR WLPNLTX17 X18 QR X21 AFlX25 KLX28 D wherein, independently from each other, X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, Wand Y; X3 is selected from A, D, E, F, G, H, l, K, L, M, N, Q, R, S, T, V, W and X4 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X8 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X7 is selected from A, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X28 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y.

In another embodiment of the first aspect of the disclosure, said neonatal Fc or (FcRn) binding polypeptide comprises an FcRn binding motif, BM, which motif consists of the amino acid sequence EX2 X3 X4 AXs X7 EIR 16X17 X18 QR X21 AFIX25 X26LX28 X29 wherein, independently from each other, 1O X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, G, H, l, K, L, M, N, Q, R, S, T, V, Wand X4 is selected from A, D, E, F, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X6 is selected from A, E, F, G, H, l, K, Q, R, S and V; X7 is selected from A, F, H, K, N, Q, R, S and V; X16 is selected from N and T; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, E, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X26 is ed from K and S; X23 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X29 is selected from D and R.

In another ment of the first aspect, there is provided an FcRn binding polypeptide, wherein, independently from each other, X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, H, l, K, L, M, N, Q, R, S, T, V, W and Y; X4 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X5 is selected from A, E, F, G, H, l, K, Q, R and 8; X7 is selected from A, F, H, K, N, Q, R, S and V; X16 is selected from N and T; X17 is selected from F and Y; X18 is D; X21 is V; X25 is ed from D, E, H, I, K, L, N, Q, R, S, T, V, W and Y; X26 is ed from K and S; X28 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V and W and.

X29 is selected from D and R. in another embodiment of the first aspect, the BM consists of an amino acid sequence selected from i) EX2 X8 X4 AXe HEIR WLPNLTX17 X18 QR X21 AFlX25 KLX28 D n, independently from each other, X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y; X4 is selected from A, D, E, F, G, l, K, L, N, Q, R, S, T, V and Y; X8 is selected from A, G, K, R, S and V; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, G, H, K, L, N, R, V and W; X28 is selected from A, D, E, H, K, L, N, Q, R, S, T, W and Y; ii) an amino acid sequence which has at least 96 % identity to said sequence. in yet another embodiment of said aspect, the BM in sequence i) consists of an amino acid sequence selected from EX2 X3 X4 AXe HElR WLPNLTX17 X18 QR X21 AFlX25 KLX28 D wherein, independently from each other, X2 is selected from A, D, E, F, N, Q, R, S and W; X3 is selected from D, E, G, H, K, M, N, Q, S and T; X4 is selected from A, D, E, G, N, Q, R, S, T, V and Y; X6 is selected from A, G, S and V; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, G, H, K, L, N, R and V; and X28 is ed from A, E, H, L, N, Q, R, S, T, W and Y.

As the skilled person will realize, the function of any polypeptide, including the FcRn binding capacity of the polypeptide of the present disclosure, is dependent on the tertiary structure of the polypeptide. It is therefore possible to make minor changes to the sequence of amino acids in a polypeptide without affecting the function thereof. Thus, the disclosure encompasses ed variants of the FcRn binding polypeptide, which are such that the FcRn binding characteristics are retained.

Therefore, as described above, also encompassed by the present disclosure is a FcRn binding polypeptide comprising an amino acid sequence with 96 % or greater identity to a polypeptide as defined in i).

In some embodiments, such s may be made in all positions of the sequences of the FcRn binding polypeptide as disclosed herein. in other embodiments, such changes may be made only in the non-variable positions, also d as scaffold amino acid residues. In such cases, changes are not allowed in the variable positions, i.e. positions denoted with an “X” in sequence i). For example, it is possible that an amino acid e belonging to a certain functional ng of amino acid residues (e.g. hydrophobic, hydrophilic, polar etc) could be exchanged for another amino acid e from the same onal group.

The term "% identity”, as used hout the specification, may for example be calculated as s. The query sequence is aligned to the target sequence using the CLUSTAL W algorithm (Thompson et al. (1994) Nucleic Acids Research 22:4673—4680). A comparison is made over the window ponding to the shortest of the aligned sequences. The shortest of the aligned ces may in some instances be the target sequence. In other instances, the query sequence may constitute the shortest of the aligned sequences. The amino acid residues at each position are compared, and the percentage of positions in the query sequence that have identical correspondences in the target sequence is reported as % identity.

Below follows a list of embodiments which further specify amino acid residue Xn, wherein n is an integer which denotes the position of said residue within the polypeptide described herein. To clarify, in cases where the BM comprised in the polypeptide may consist of either a given amino acid sequence or an amino acid sequence with at least a given % ty to said given amino acid sequence, the Xn as used herein refers to an amino acid residue in said given amino acid sequence. For example, when applicable, Xn refers to an amino acid residue in ce i) above. in one embodiment, X2 is selected from A, D, E, F, l, L, N, Q, R, S, T, V, W and Y.

In one embodiment, X2 is selected from A, D, F, l, L, N, Q, R, S, T, V, W and Y.

In one ment, X2 is selected from A, D, F, l, L, N, Q, R, S, V and W.

In one embodiment, X2 is selected from A, l, L, N, Q, R, S, T, V, W and in one embodiment, X2 is selected from A, l, L, N, Q, S, T, V and W. in one embodiment, X2 is selected from A, l, L, N, Q, V and W.

In one embodiment, X2 is selected from A, l, L, Q, V and W.

In one embodiment, X2 is selected from A, l, L and Q.

In one embodiment, X2 is selected from I, L and Q.

In one embodiment, X2 is selected from l and Q.

In one embodiment, X2 is l. in one ment, X2 is Q. in one embodiment, X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y. in one embodiment, X3 is selected from A, D, E, H, K, L, M, N, Q, R, S, T, V and Y.

In one embodiment, X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S and T.

In one embodiment, X3 is selected from A, D, E, G, H, K, M, N, Q, S and T. in one embodiment, X3 is selected from A, D, E, G, H, M, N, Q, S and in one embodiment, X3 is selected from A, D, E, K, N, Q, S and T.

In one embodiment, X3 is selected from A, D, E, K, Q, and T.

In one embodiment, X3 is selected from A, D, E, Q and T.

In one embodiment, X3 is selected from D, E and T.

In one embodiment, X3 is selected from D and E.

In one embodiment, X3 is D.

In one ment, X3 is E.

In one embodiment, X4 is selected from A, D, E, F, G, I, K, L, N, Q, R, S, T, V and Y.

In one ment, X4 is selected from A, D, E, G, N, Q, R, S, T and V. ‘ In one embodiment, X4 is ed from A, D, E, F, I, K, L, N, Q, R, S, T and V.

In one embodiment, X4 is selected from A, D, E, I, K, N, Q, R, S and T.

In one embodiment, X4 is ed from A, D, E, I, K, Q, S and T.

In one embodiment, X4 is selected from A, D, I, K, Q and S.

In one embodiment, X4 is selected from A, D, E, K and S.

In one embodiment, X4 is selected from A, D, K and S.

In one embodiment, X4 is selected from A, D, E and K.

In one embodiment, X4 is selected from A, D and K.

In one embodiment, X4 is selected from A and D.

In one embodiment, X4 is ed from A and E.

In one embodiment, X4 is A.

In one embodiment, X4 is D.

In one embodiment, X4 is E.

In one embodiment, X5 is selected from A, G, K, Q, R, S and V.

In one embodiment, X6 is selected from A, G, K, R, S and V.

In one embodiment, X6 is selected from A, G, K, R and S.

In one embodiment, X6 is selected from A, G, K, S and V.

In one embodiment, X5 is selected from A, G, K and V.

In one embodiment, X6 is selected from A, G, K and S.

In one embodiment, X5 is selected from A, G and K.

In one embodiment, X6 is selected from A, G and V.

In one embodiment, X6 is selected from A and G.

In one embodiment, X6 is A.

In one embodiment, X5 is G.

In one embodiment, X7 is selected from A and H.

In one embodiment, X7 is H.

In one embodiment, X16 is T.

In one embodiment, X15 is N.

In one embodiment, X17 is selected from F and Y.

In one embodiment, X17 is F.

In one embodiment, X18 is selected from A, D and E.

In one embodiment, X18 is selected from A and D.

In one embodiment, X18 is D.

In one embodiment, X21 is selected from V and W.

In one embodiment, X21 is V.

In one embodiment, X25 is ed from D, E, G, H, K, L, N, Q, R, V and W.

In one embodiment, X25 is selected from D, G, H, K, L, N, R, V and W.

In one embodiment, X25 is selected from D, G, H, K, L, N, R and V.

In one embodiment, X25 is selected from H, L, R, V and W.

In one embodiment, X25 Is selected from H, R, V and W.

In one embodiment, X25 is selected from H, R and V.

In one embodiment, X25 is selected from H, L and R.

In one ment, X25 is ed from H and R.

In one embodiment, X25 is selected from H and V.

In one embodiment, X25 is H.

In one embodiment, X25 is K.

In one embodiment, X25 is S.

In one embodiment, X28 is selected from A, D, E, H, K, L, N, Q, R, S, T, W and Y.

In one embodiment, X28 is selected from A, D, E, K, L, N, Q, R, S, T, W and Y.

In one embodiment, X28 is selected from A, D, E, L, R, S, T, W and Y.

In one embodiment, X28 is selected from A, D, K, L, N, Q, R, S, T and In one embodiment, X28 is selected from A, D and R.

In one ment, X28 is selected from A and R.

In one embodiment, X28 is selected from D and R.

In one embodiment, X28 is A.

In one embodiment, X28 is R.

In one ment, X29 is D.

In one embodiment, X29 is R.

In one embodiment, X5X7 is selected from AH and GH.

In one embodiment, X6X7 is AH.

In one embodiment, X6X7 is GH.

In one embodiment, X17X18 is selected from FD and YD.

In one embodiment, X17X18 is FD.

In a more specific ment ng a sub-class of the FcRn binding polypeptide, the sequence ls at least three of the six conditions I— I. X5 is selected from A, G, K and S, such as in particular A; 1O II. X7 is H; III. X17 is selected from F and Y, such as in particular F; IV. X18 is D; V. X21 is selected from V and W, such as in particular V; VI. X25 is selected from H and R, such as in particular H.

In some examples of an FcRn binding polypeptide according to the first aspect, said sequence ls at least four of the six conditions l—Vl. More specifically, the sequence may fulfill at least five of the six conditions I—Vl, such as all of the six conditions l—VI.

As described in detail in the experimental section to follow, the selection of FcRn g polypeptide variants has led to the identification of a number of individual FcRn binding motif (BM) sequences. These sequences constitute individual embodiments according to this aspect. The sequences of individual FcRn binding motifs are presented in Figure 1 and as SEQ ID NO:1—353. Hence, in one embodiment of the FcRn binding polypeptide according to this aspect, the sequence is ed from the group consisting of SEQ ID NO:1—353. In one ment, the sequence is selected from the group consisting of SEQ ID NO:1—15, SEQ ID NO:17—14O and SEQ ID 3O NO:353. In one embodiment, the sequence is selected from the group consisting of SEQ ID NO:1-2 and SEQ ID NO:17—140. In one embodiment, the sequence is selected from the group ting of SEQ ID NO:1—2, SEQ ID NO:17—92, SEQ ID NO:94-103, SEQ ID NO:105—125 and SEQ ID NO:127— 140. In one embodiment, the sequence is selected from the group consisting of SEQ ID NO:1—8, SEQ ID NO:13 SEQ ID NO:19-20, SEQ ID NO:23, SEQ ID N0228, SEQ ID NO:41, SEQ ID NO:44, SEQ ID NO:65, SEQ ID NO:70, SEQ ID NO:73, SEQ ID NO:75—77 and SEQ ID NO:353. In another embodiment, the sequence is selected from the group consisting of SEQ ID N0:1, SEQ ID N0:23, SEQ ID N0228, SEQ ID N0z41, SEQ ID N0:44, SEQ ID N0265, SEQ ID NO:73 and SEQ ID NO:75—77. In yet another embodiment, the sequence is selected from SEQ ID N0:1, SEQ ID N0:23, SEQ ID N0z44, SEQ ID N0:65, SEQ ID NO:75 and SEQ ID NO:77. In one embodiment, the sequence Is selected from SEQ ID N021, SEQ ID N023 and SEQ ID NO:75. In one embodiment, the sequence is SEQ ID N021.

In some embodiments of the t disclosure, the BM as d 1O above “forms part of” a three—helix bundle protein domain. This is understood to mean that the sequence of the BM is “inserted” into or “grafted” onto the sequence of the al three—helix bundle domain, such that the BM replaces a similar structural motif in the al domain. For example, without wishing to be bound by theory, the BM is thought to constitute two of the three helices of a three—helix bundle, and can therefore replace such a two-helix motif within any three—helix bundle. As the d person will realize, the replacement of two helices of the three—helix bundle domain by the two BM helices has to be performed so as not to affect the basic structure of the polypeptide. That is, the overall folding of the Ca backbone of the polypeptide according to this embodiment of the invention is substantially the same as that of the three—helix bundle protein domain of which it forms a part, e.g. having the same elements of secondary structure in the same order etc.

Thus, a BM according to the disclosure “forms part” of a three—helix bundle domain if the polypeptide according to this embodiment of the aspect has the same fold as the al domain, ng that the basic structural properties are shared, those properties e.g. resulting in similar CD spectra. The skilled person is aware of other parameters that are relevant.

In particular embodiments, the FcRn binding motif (BM) thus forms part of a three—helix bundle protein domain. For example, the BM may essentially tute two alpha helices with an interconnecting loop, within said three- helix bundle protein domain. In particular embodiments, said three—helix bundle protein domain is selected from domains of ial receptor proteins.

Non-limiting examples of such domains are the five different three—helical domains of Protein A from Staphylococcus , such as domain B, and derivatives thereof. In some embodiments, the three—helical bundle protein domain is a variant of n Z, which is d from domain B of staphylococcal Protein A. in embodiments where the FcRn binding polypeptide of the invention forms part of a three-helix bundle protein domain, the FcRn binding polypeptide may comprise an amino acid sequence selected from: iii) K—[BM—DPSQS XaXbLLXc EAKKL XdXeXrQ; wherein [BM] is an FcRn g motif as defined herein, provided that X29 is D; ’10 Xa is selected from A and S; Xb is selected from N and E; Xc is selected from A, S and C; Xd is selected from E, N and S; Xe is selected from D, E and S; Xf is selected from A and S; iv) an amino acid sequence which has at least 93 % identity to a sequence d by iii). in embodiments where the FcRn binding polypeptide of the invention forms part of a three-helix bundle n domain, the FcRn binding polypeptide may comprise an amino acid sequence ed from: V) K-[BAﬂ—QPEQS XaXbLLXc EAKKL XdXeXfQ; wherein [BM] is an FcRn binding motif as defined herein, provided that X29 is R; Xa is selected from A and S; 3O Xb is selected from N and E; Xc is ed from A, S and C; Xd is selected from E, N and S; Xe is selected from D, E and S; Xr is selected from A and S; and vi) an amino acid sequence which has at least 93 % ty to a sequence d by v).

As discussed above, polypeptides comprising minor changes as compared to the above amino acid sequences which do not largely affect the tertiary structure and the on thereof are also within the scope of the present disclosure. Thus, in some embodiments, sequence iv) or sequence vi) has at least 95 %, for example at least 97 % identity to a sequence defined by iii) and v), respectively.

In one embodiment, Xa in sequence iii) or v) is A. In an alternative embodiment, Xa in sequence iii) or v) is S. in one ment, Xb in sequence iii) or v) is N. In an alternative embodiment, Xb in sequence iii) or v) is E.

In one embodiment, Xc in sequence ill) or v) is A. in an alternative embodiment, X0 in sequence iii) or v) is S. in yet r alternative embodiment, Xc in sequence ill) or v) is C. in one embodiment, Xd in sequence iii) or v) is E. in one embodiment, Xd in sequence iii) or v) is N.

In one embodiment, Xd in sequence ill) or v) is S. in one ment, Xe in sequence iii) or v) is D.

In one embodiment, Xe in sequence iii) or v) is E.

In one embodiment, Xe in sequence iii) or v) is S. in one embodiment, XdXe in sequence iii) or v) is ed from EE, ES, SE and SS. ln one embodiment, XdXe in sequence iii) or v) is ES. in one embodiment, XdXe in sequence iii) or v) is SE.

In one embodiment, Xf in sequence iii) or v) is A. in an alternative embodiment, Xf in sequence iii) or v) is S. 3O In one embodiment, in sequence iii) or v), Xa is A; Xb is N; Xc is A and Xf is A. in one embodiment, in sequence iii) or v), Xa is A; Xb is N; X0 is C and Xf is A.

In one embodiment, in sequence iii) or v), X3 is S; Xb is E; X0 is S and Xf is S.

In one embodiment, in sequence iii) or v), Xa is S; Xb is E; Xc is C and Xf is S.

In one embodiment, in sequence iii) or v), Xa is A; Xb is N; X0 is A; XdXe is ND and Xf is A.

In one embodiment, in sequence iii) or v), Xa is A; Xb is N; Xc is C; XdXe is ND and Xf is A.

In one embodiment, in sequence iii) or v), Xa is S; Xb is E; Xc is S; XdXe is ND and Xf is S.

In one embodiment, in Sequence iii) or v), Xa is S; Xb is E; Xc is C; XdXe is ND and Xf is S.

In one embodiment, in ce iii) or v), X3 is A; Xb is N; Xc is A; XdXe is SE and Xf is A.

In one ment, in sequence iii) or v), Xa is A; Xb is N; Xc is C; XdXe is SE and Xf is A.

In one embodiment, in sequence iii) or v), Xa is S; Xb is E; Xc is S; XdXe is SE and Xf is S.

In one embodiment, in sequence iii) or v), Xa is S; Xb is E; Xc is C; XdXe is SE and Xf is S.

In one embodiment, in sequence iii) or v), Xa is A; Xb is N; Xc is A; XdXe is ES and Xf is A.

In one embodiment, in sequence iii) or v), Xa is A; Xb is N; Xc is C; XdXe is ES and Xf is A.

In one ment, in sequence iii) or v), Xa is S; Xb is E; Xc is S; XdXe is ES and Xf is S.

In one embodiment, in sequence iii) or v), Xa is S; Xb is E; Xc is C; XdXe is ES and Xr is S.

In yet a further embodiment, sequence iii) in the definition of FcRn binding polypeptides above is selected from the group ting of SEQ ID NO:354—706. In one embodiment, sequence iii) is selected from the group consisting of SEQ ID NO:354—368, SEQ ID NO:370-493 and SEQ ID NO:706.

In one embodiment, sequence iii) is selected from the group consisting of SEQ ID NO:354—355 and SEQ ID NO:370—493. In one embodiment, sequence iii) is selected from the group consisting of SEQ ID N01354—355, SEQ ID NO:370—445, SEQ ID NO:447-456, SEQ ID NO:458—478 and SEQ ID N02480— 493. In one embodiment, sequence iii) is selected from the group consisting of SEQ ID NO:354-361, SEQ ID , SEQ ID NO:372—373, SEQ ID NO:376, SEQ ID NO:381, SEQ ID N02394, SEQ ID NO:397, SEQ ID NO:418, SEQ ID , SEQ ID NO:426, SEQ ID NO:428—43O and SEQ ID NO:706.

In another embodiment, sequence iii) is selected from the group consisting of SEQ ID NO:354, SEQ ID , SEQ ID NO:381, SEQ ID N02394, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:426 and SEQ ID NO:428-430. In yet another embodiment, sequence iii) is ed from SEQ ID NO:354, SEQ ID NO:376, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:428 and SEQ ID NO:430. In one embodiment, sequence iii) is selected from SEQ ID NO:354, SEQ ID NO:376 and SEQ ID . In one embodiment, sequence iii) is SEQ ID NO:354.

Also, in a further embodiment, there is provided an FcRn binding polypeptide as defined above, which comprises an amino acid sequence selected from: vii) YAK—[BM]-DPSQS SELLXC EAKKL NDSQA P; n [BM] is an FcRn g motif as defined above and Xc is selected from A, S and C; and viii) an amino acid sequence which has at least 94 % identity to a sequence defined by vii).

Alternatively, there is provided an FcRn binding polypeptide as defined above, which ses an amino acid sequence selected from: ix) FNK-[BM1—DPSQS ANLLXc EAKKL NDAQA P; wherein [BM] is an FcRn binding motif as d above and Xc is selected from A and C; and x) an amino acid sequence which has at least 94 % identity to a sequence defined by ix).

As discussed above, polypeptides sing minor changes as compared to the above amino acid sequences that do not largely affect the tertiary structure and the function thereof are also within the scope of the present disclosure. Thus, in some embodiments, the FcRn binding polypeptide as defined above may comprise a sequence which is at least 96 %, such as at least 98 % identical to a sequence defined by vii) or ix).

In some ments, the FcRn binding motif may form part of a polypeptide comprising an amino acid sequence selected from ADNNFNK-[BM]—DPSQSANLLSEAKKLNESQAPK; ADNKFNK-[BM]-DPSQSANLLAEAKKLNDAQAPK; ADNKFNK-[BW—DPSVSKEILAEAKKLNDAQAPK; ADAQQNNFNK-[BM]-DPSQSTNVLGEAKKLNESQAPK; AQHDE—[BM]—DPSQSANVLGEAQKLNDSQAPK; VDNKFNK—[BM]-DPSQSANLLAEAKKLNDAQAPK; AEAKYAK—[BM]—DPSESSELLSEAKKLNKSQAPK; VDAKYAK-[BM]—DPSQSSELLAEAKKLNDAQAPK; VDAKYAK-[BM]—DPSQSSELLAEAKKLNDSQAPK; AEAKYAK—[BM]—DPSQSSELLSEAKKLNDSQAPK; AEAKYAK—[BM1—DPSQSSELLSEAKKLSESQAPK AEAKYAK—[BM]-DPSQSSELLSEAKKLESSQAPK VDAKYAK—[BM1—DPSQSSELLSEAKKLNDSQAPK; VDAKYAK—[BM]-DPSQSSELLSEAKKLSESQAPK; VDAKYAK-[BM]-DPSQSSELLSEAKKLESSQAPK; VDAKYAK—[BM1-DPSQSSELLAEAKKLNKAQAPK; and AEAKYAK—[BM]-DPSQSSELLAEAKKLNKAQAPK; wherein [BM] is an FcRn binding motif as defined above. in one embodiment, the FcRn binding polypeptide comprises an amino acid sequence ed from: xi) AEAKYAK-[BMJ-DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined above; and xii) an amino acid sequence which has at least 94 % identity to the sequence defined in xi).

In one embodiment, sequence xi) is ed from the group consisting of SEQ lD 0—1062. in one ment, the FcRn binding polypeptide ses an amino acid sequence selected from: xiii) VDAKYAK—[BM]—DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined above; and xiv) an amino acid sequence which has at least 94 % identity to the sequence defined in xiii).

Sequence xiii) in such a polypeptide may for example be selected from the group consisting of SEQ ID NO:707—1059. in one embodiment, sequence xiii) is selected from the group ting of SEQ lD NO:707-721, SEQ lD N01723-846 and SEQ lD 9. In one embodiment, sequence xiii) is selected from the group consisting of SEQ ID N01707—7O8 and SEQ lD NO:723-846. in one embodiment, sequence xiii) is selected from the group consisting of SEQ ID NO:707—708, SEQ ID NO:723—798, SEQ ID NO:800— 809, SEQ ID NO:811-831 and SEQ ID —846. In one embodiment, sequence xiii) is selected from the group consisting of SEQ ID NO:707—714, SEQ ID NO:719, SEQ ID NO:725-726, SEQ ID NO:729, SEQ ID NO:734, SEQ ID NO:747, SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:776, SEQ ID NO:779, SEQ ID NO:781—783 and SEQ ID NO:1059. In r embodiment, sequence xiii) is selected from the group ting of SEQ ID NO:707, SEQ ID NO:729, SEQ ID NO:734, SEQ ID NO:747, SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:779 and SEQ ID NO:781—783. In yet r 1O embodiment, sequence xiii) is selected from SEQ ID NO:707, SEQ ID NO:729, SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:781 and SEQ ID NO:783. In one embodiment, sequence xiii) is selected from SEQ ID , SEQ ID NO:729 and SEQ ID NO:781. In one embodiment, sequence xiii) is SEQ ID NO:707.

Again, polypeptides comprising minor changes as compared to the above amino acid sequences which do not largely affect the tertiary structure and the function thereof are also within the scope of the t sure.

Thus, in some embodiments, the FcRn binding polypeptide as defined above may comprise a sequence which is at least 96 %, such as at least 98 % identical to a ce defined by xi) or xiii).

The terms “FcRn binding” and ”binding affinity for FcRn” as used in this specification refer to a property of a polypeptide which may be tested for example by the use of surface plasmon resonance (SPR) technology or ELISA.

For example as described in the examples below, FcRn binding affinity may be tested in an experiment in which FcRn, or a correctly folded fragment thereof, is immobilized on a sensor chip of the instrument, and the sample ning the ptide to be tested is passed over the chip. Alternatively, the polypeptide to be tested is lized on a sensor chip of the instrument, and a sample containing FcRn, or a correctly folded fragment thereof, is passed over the chip. The skilled person may then interpret the results obtained by such experiments to establish at least a qualitative measure of the binding affinity of the polypeptide for FcRn. If a quantitative measure is desired, for example to determine a KD value for the interaction, surface plasmon resonance methods may also be used. Binding values may for example be defined in a Biacore (GE Healthcare) or ProteOn XPR 36 (Bio— Rad) instrument. FcRn is suitably immobilized on a sensor chip of the instrument, and samples of the polypeptide whose affinity is to be determined are prepared by serial dilution and injected in random order. Ko values may then be calculated from the results using for example the 1:1 Langmuir binding model of the BlAevaluation 4.1 software, or other suitable software, provided by the instrument manufacturer.

Alternatively, as described in the es below, FcRn binding affinity may be tested in an experiment in which s of the polypeptide are 1O captured on antibody coated ELISA plates, and ylated FcRn is added followed by streptavidin conjugated HRP. TMB substrate is added and the ance at 450 nm is measured using a multi-well plate reader, such as Victor3 (Perkin . The skilled person may then interpret the results obtained by such experiments to establish at least a qualitative measure of the binding ty of the polypeptide for FcRn. If a quantitative measure is d, for example to determine the K0 value (the half maximal ive concentration) for the interaction, ELISA may also be used. The response of the polypeptides against a dilution series of ylated FcRn are measured using ELISA as described above. The skilled person may then interpret the results obtained by such experiments and KD values may be calculated from the results using for example ad Prism 5 and non—linear regression. in one embodiment, there is provided an FcRn binding polypeptide, which is capable of binding to FcRn at pH 6.0 such that the K0 value of the interaction is at most 1 x 10“6 M, such as at most 1 x 10‘7 M, such as at most 1 x10'8 M, such as at most 1 x10“9 M, such as at most 1 x10"10 M. An FcRn binding polypeptide according to this embodiment would bind, or remain bound, to FcRn in acidic pH conditions, such as pH 6.0, for example in a lysosome. if such a polypeptide were to enter an increasingly acidic intracellular environment, it would be recycled to the plasma membrane h its interaction with FcRn, and thus avoid degradation. in one embodiment, the KB value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is higher than the KB value of said interaction at pH 6.0. Thus, the FcRn binding polypeptide would bind to FcRn with higher affinity at pH 6.0 than at pH 7.4. in one embodiment, the KB value of said interaction at pH 7.4 is at least 2 times , such as at least 5 times higher, such as at least 10 times higher, such as at least 50 times higher, such as at least 100 times higher than the KB value of said interaction at pH 6.0.

In one embodiment, the KO value of the interaction between FcRn g ptide and FcRn at pH 7.4 is at least 1 x 10‘8 M, such as at least 1 x10'7 M, such as at least 1 x 10'6 M, such as at least 1 x 10‘5 M. In some embodiments, the only criterion for the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is that any FcRn g polypeptide which has bound to FcRn during more acidic conditions is released more rapidly from FcRn when the pH value increases. 1O in an alternative embodiment, there is provided an FcRn binding polypeptide, for which the KD of said interaction at pH 7.4 is the same as or lower than the KB of said interaction at pH 6.0. An FcRn binding polypeptide according to this embodiment would bind or remain bound to FcRn in acidic pH conditions (i.e. would have an off—rate at pH 6.0 which is sufficiently slow to avoid release), for example in the lysosome, as well as in neutral or slightly basic pH conditions, for example on the plasma membrane. In a more ic embodiment, the K0 value of said interaction at pH 7.4 is at least 2 times lower, such as at least 5 times lower, such as at least 10 times lower, such as at least 50 times lower, such as at least 100 times lower than the KD value of said interaction at pH 6.0. in another embodiment, there is provided an FcRn binding polypeptide, which is capable of binding to FcRn at pH 7.4 such that the KD value of the interaction is at most 1 x 10'6 M, such as at most 1 x 10‘7 M, such as at most 1 x10“8 M, such as at most 1 x 10~9 M, such as at most 1 x 10'10 M. An FcRn binding polypeptide according to this embodiment would bind or remain bound for an extended time to FcRn in neutral or ly basic pH conditions, such as pH 7.4, for example on the plasma membrane. The term “remain bound” should be tood to mean an interaction having a slow off—rate at given conditions. 3O in general, the skilled person knows that the KB value of an interaction is defined as the ratio between the off—rate (koff) and the on-rate (kon). Thus, a high KD value may be due to either a high koff, a low kon or both, and conversely, a low Kn value may be due to either a low koff, a high kon or both.

The skilled person will understand that various modifications and/or additions can be made to an FcRn binding ptide according to any aspect disclosed herein in order to tailor the polypeptide to a specific application without departing from the scope of the present sure.

For example, in one embodiment there is provided an FcRn binding polypeptide as described herein, which ptide has been extended by one or more amino acids at the C terminal and/or N terminal end. Such a polypeptide should be understood as a polypeptide having one or more additional amino acid residues at the very first and/or the very last position in the polypeptide chain. Thus, an FcRn binding polypeptide may comprise any le number of additional amino acid residues, for e at least one 1O additional amino acid residue. Each additional amino acid residue may individually or collectively be added in order to, for example, improve production, purification, stabilization in vivo or in vitro, ng, or detection of the ptide. Such additional amino acid residues may comprise one or more amino acid residues added for the purpose of chemical coupling. One example of this is the addition of a cysteine residue. Such additional amino acid residues may also provide a "tag” for purification or detection of the polypeptide, such as a His6 tag or a "myc" (c—myc) tag or a ”FLAG” tag for interaction with antibodies specific to the tag or immobilized metal ty chromatography (lMAC) in the case of the hexahistidine tag.

The further amino acids as discussed above may be coupled to the FcRn binding ptide by means of chemical conjugation (using known c chemistry methods) or by any other means, such as sion of the FcRn binding polypeptide as a fusion protein orjoined in any otherfashion, either directly or via a linker, for example an amino acid linker.

The further amino acids as discussed above may for example comprise one or more polypeptide domain(s). A further polypeptide domain may provide the FcRn binding polypeptide with another function, such as for example another binding function, or an enzymatic function, or a toxic function or a fluorescent signaling function, or combinations thereof.

A further polypeptide domain may moreover provide another FcRn binding moiety with the same FcRn binding on. Thus, in a further embodiment, there is provided an FcRn binding ptide in a multimeric form. Said er is understood to comprise at least two FcRn binding ptides as disclosed herein as monomer units, the amino acid sequences of which may be the same or different. Multimeric forms of the polypeptides may comprise a suitable number of domains, each having an FcRn binding motif, and each forming a monomer within the multimer. These domains may have the same amino acid sequence, but alternatively, they may have different amino acid sequences. In other words, the FcRn binding polypeptide of the invention may form homo— or heteromultimers, for example homo— or heterodimers. In one embodiment, there is provided an FcRn binding polypeptide, wherein said monomeric units are covalently coupled together. In another embodiment, said FcRn binding polypeptide monomer units are expressed as a fusion n. ln one embodiment, there is provided an FcRn binding polypeptide in dimeric form.

Additionally, ”heterogenic" fusion polypeptides or proteins, or conjugates, in which an FcRn binding polypeptide described , or multimer thereof, constitutes a first domain, or first moiety, and the second and further moieties have other functions than g FcRn, are also contemplated and fall within the ambit of the present disclosure. The second and further moiety/moieties of the fusion polypeptide or conjugate in such a protein suitably have a desired biological activity.

Thus, in a second aspect of the present disclosure, there is provided a fusion protein or a conjugate, comprising a first moiety ting of an FcRn binding polypeptide according to the first aspect, and a second moiety ting of a polypeptide having a desired biological ty. In another embodiment, said fusion protein or conjugate may additionally comprise further moieties, comprising d ical activities that can be either the same or ent from the biological activity of the second moiety.

Such heterogenic fusion polypeptides could also be used to create heteromultimeric complexes of higher order. One example is a heterodimeric complex of two fusion polypeptides, each comprising an FcRn binding polypeptide according to the present disclosure in fusion with another moiety.

Such a complex could for example form a heterodimer in vivo or in vitro and be held together by non—covalent and/or covalent interactions. A specific e of such a complex is a Fab fragment, in which both the light chain and heavy chain are produced in fusion with one FcRn binding polypeptide each, and which may include an inter-domain disulphide bond. Many biologically relevant, dimeric complexes known to the d person may be constructed using FcRn binding fusion proteins as monomer units.

In one embodiment of said fusion n or conjugate, the total size of the molecule is below the threshold for ent renal clearance upon administration to a mammalian subject.

In another embodiment of said fusion protein or conjugate, the total size of the molecule is above the threshold for ent renal clearance upon administration to a mammalian subject. in one ment, there is provided a fusion protein or conjugate, wherein the in vivo half—life of said fusion protein or conjugate is longer than the in vivo half—life of the polypeptide having the desired biological activity per Non—limiting examples of a desired biological activity comprise a 1O therapeutic activity, a g activity, and an enzymatic activity.

In one embodiment, said desired biological ty is a binding ty to a selected target.

One example of such a binding activity is a binding activity, which increases the in vivo half—life of a fusion protein or conjugate. This fusion n or conjugate may comprise at least one further . in one particular embodiment, said target is albumin, binding to which increases the in vivo half—life of said fusion protein or ate. In one embodiment, said albumin binding activity is provided by an albumin binding domain (ABD) of streptococcal protein G or a derivative thereof. For example, said fusion protein or conjugate, comprising at least one further moiety, may comprise [FcRn binding polypeptide moiety] — [albumin binding moiety] — [moiety with affinity for selected ]. It is to be understood that the three moieties in this example may be arranged in any order from the N— to the C—terminal of the polypeptide.

In one embodiment, when a complex n a target and the fusion protein or conjugate as described herein is formed (or maintained) at acidic pH, such as pH 6.0, the target is rescued from elimination by lysosomal degradation. Thus, target half—life is extended. Half-life extension implies that the elimination rate of a target is lower when interacting with said fusion protein or conjugate than the elimination rate of the target molecule in the absence of said fusion protein or conjugate. Furthermore, it is desirable in this ment that the binding of target by the fusion protein or conjugate should not interfere substantially with the on of the target.

On the other hand, when a complex between the target and the fusion protein or conjugate as described herein is not maintained or not formed at acidic pH, the target is directed to the subcellular lysosomes where it is degraded. in one embodiment, there is provided a fusion protein or conjugate, wherein the rate of elimination of a ed, undesirable target from the subject is increased. increased elimination of an undesirable target implies increased elimination rate of the target from the body of the multicellular organism, as compared to a “normal” elimination rate of the target molecule per se, i.e. t previous interaction with the fusion protein or conjugate. in another embodiment, binding of a selected undesirable target could inactivate the function of the target, y blocking its biological activity in situations where this is ble. Such biological activity may for example be activation or blocking of receptors or an enzymatic or otherwise toxic or undesirable activity. Such rable target may be an endogenous hormone, enzyme, cytokine, chemokine or a target having some other biological activity. By using an inactivating target binding, the biological activity is blocked until the target is delivered for degradation and released at a low pH value, and the target binding fusion protein is recycled to circulation.

This recycling of the target g fusion protein (via its FcRn binding ) enables it to “catalyze" the removal of more than one le of the selected undesirable target.

Undesirabie targets may for e be n proteins and compounds, or naturally expressed proteins that display elevated levels in plasma following a medical condition and where a therapeutic effect may be ed by elimination of said protein. The undesired target is not necessarily evenly distributed in the plasma but may be concentrated in certain regions, for example around a tumor or at sites of inflammation.

Non-limiting examples of targets are targets selected from the group ting of allergens, amyloids, antibodies, auto-antigens, blood clotting factors, hormones, tumor cells, drug molecules, cytokines, chemokines, proteases, ensitivity mediators, proinflammatory factors, toxins such as bacterial toxins and snake venoms; pollutants, metals and anti—oxidants.

Under certain conditions, such as in certain cancer diseases, it is desired to remove endogenous molecules, for e VEGF, PDGF, HGF and other growth stimulatory hormones. Such molecules could also be targeted by a binding function in said fusion n or conjugate.

Under other conditions, such as in certain immunological es, it may be desirable to remove endogenous molecules transiently, such as selected interieukines or TNF. Such molecules could also be targeted by a binding function in said fusion protein or conjugate.

In one embodiment, the second moiety having a desired biological activity is a therapeutically active polypeptide. Non—limiting examples of therapeutically active polypeptides are biomolecules, such as molecules ed from the group consisting of s, for example dase d and B, glucocerebrosidase, laronidase, arylsulphatase, sidase—o, asparaginase, Factor VII, Factor Vlll, Factor IX and Factor Xa; hormones and growth factors, for example growth hormone, transforming growth factor—82, erythropoietin, insulin, n-like growth factor—1, myostatin, bone—derived growth factor and glucagon—like peptide—1; chemokines, for example CCL17, CCL19, CCLZO, CCL21, CCL22, CCL27, XCL1 and CXCECL1; and cytokines, for example interleukin (lL)—2, lL—4, lL—7, lL—10, lL-12, lL-15, lL—18, lL—22, lL-27, interferon (lFN)—d, lFN—B, lFN—y, tumor necrosis factor, granulocyte-colony ating factor (G—CSF), macrophage—CSF, and granulocyte/macrophage—CSF.

As the skilled person understands, the FcRn binding polypeptide according to the first aspect may be useful in a fusion protein or as a conjugate r to any other moiety. Therefore, the above lists of therapeutically active polypeptides should not be construed as limiting in any way.

Other ilities for the on of fusion polypeptides or conjugates are also contemplated. Thus, an FcRn binding polypeptide according to the first aspect of the invention may be covalently coupled to a second or further moiety or es, which in addition to or instead of target binding exhibit other functions. One example is a fusion between one or more FcRn binding polypeptide(s) and an enzymatically active polypeptide serving as a reporter or effector moiety.

With regard to the description above of fusion proteins or conjugates 3O incorporating an FcRn binding polypeptide according to the disclosure, it is to be noted that the designation of first, second and further moieties is made for clarity reasons to distinguish between FcRn binding polypeptide or polypeptides according to the disclosure on the one hand, and moieties exhibiting other ons on the other hand. These designations are not intended to refer to the actual order of the different domains in the polypeptide chain of the fusion protein or conjugate. Thus, for example, said first moiety may t restriction appear at the inal end, in the middle, or at the C—terminal end of the fusion protein or conjugate. in one embodiment, there is provided an FcRn g polypeptide, fusion protein or conjugate, which binds to FcRn such that binding of lgG to FcRn is at least partially inhibited. This inhibition may be due to binding of the FcRn binding polypeptide, fusion protein or conjugate to the same, or an at least lly overlapping, region of FcRn as lgG. Alternatively, the FcRn binding polypeptide, fusion protein or ate may bind to a different region of FcRn than lgG but sterically hinder the binding of lgG to FcRn. Thus, the rate of elimination or clearance of lgG from the circulatory system would increase due to increased lysosomal degradation of lgG, because the FcRn mediated recycling of lgG would be wholly or partially unavailable due to the occupation of FcRn binding sites by the FcRn binding polypeptide according to the present disclosure. in other words, administration of FcRn binding polypeptide, fusion protein or conjugate or composition according to the t disclosure will act to increase the catabolism of circulating lgG antibodies. in one embodiment, the KB value of the interaction between the FcRn binding polypeptide, fusion protein or conjugate and FcRn is lower than the KB of the interaction between lgG and FcRn. This relationship may be true at both pH 6.0 and pH 7.4, or at pH 6.0 only.

The above aspects furthermore encompass polypeptides in which the FcRn g polypeptide according to the first aspect, or the FcRn binding ptide as comprised in a fusion protein or conjugate ing to the second aspect, further comprises a label, such as a label selected from the group consisting of fluorescent dyes and metals, chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radionuclides and particles. Such labels may for example be used for detection of the polypeptide. in other embodiments, the labeled FcRn binding polypeptide is present as a moiety in a fusion protein or conjugate also comprising a second moiety having a desired biological ty and/or comprising a binding function as described above. The label may in some instances be d only to the FcRn binding polypeptide, and in some instances both to the FcRn binding polypeptide and to the second moiety of the conjugate or fusion protein.

Furthermore, it is also possible that the label may be coupled to a second moiety only and not to the FcRn binding moiety. Hence, in yet another embodiment there is provided an FcRn binding polypeptide comprising a second moiety, wherein said label is coupled to the second moiety only.

When reference is made to a labeled polypeptide, this should be understood as a reference to all aspects of ptides as described herein, including fusion proteins and conjugates sing an FcRn g polypeptide and a second and ally further moieties. Thus, a labeled polypeptide may contain only the FcRn binding polypeptide and eg. a 1O therapeutic radionuclide, which may be chelated or covalently coupled to the FcRn binding polypeptide, or contain the FcRn binding polypeptide, a therapeutic radionuclide and a second moiety such as a small molecule having a desired biological activity, for example resulting in a therapeutic in embodiments where the FcRn g polypeptide, fusion protein or conjugate is radiolabeled, such a radiolabeled polypeptide may comprise a radionuclide. A majority of radionuclides have a metallic nature, are used in the ionic form, and are typically incapable of forming stable covalent bonds with ts presented in proteins and peptides. For this reason, ng of proteins and peptides with radioactive metals is performed with the use of chelators, i.e. multidentate ligands, which form non—covalent compounds, called chelates, with the metal ions. in an embodiment of the FcRn binding polypeptide, fusion protein or conjugate, the incorporation of a radionuclide is enabled through the provision of a chelating environment, h which the radionuclide may be coordinated, chelated or complexed to the ptide.

One example of a or is the polyaminopolycarboxylate type of chelator. Two classes of such polyaminopolycarboxylate chelators can be distinguished: macrocyclic and acyclic chelators. in one embodiment, the FcRn binding polypeptide, fusion protein or 3O conjugate comprises a chelating environment provided by a inopolycarboxylate chelator ated to the FcRn binding polypeptide via a thiol group of a cysteine residue or an epsilon amine group of a lysine e.

The most commonly used macrocyclic chelators for radioisotopes of indium, gallium, yttrium, bismuth, radioactinides and radiolanthanides are different derivatives of DOTA (1 ,4,7,10—tetraazacyclododecane—l ,4,7,10— tetraacetic acid). in one embodiment, a chelating environment of the FcRn g polypeptide, fusion protein or conjugate is ed by DOTA or a derivative thereof. More specifically, in one ment, the chelating polypeptides encompassed by the present disclosure are obtained by reacting the DOTA derivative 1,4,7,10-tetraazacyclododecane-1,4,7—tris— acetic acid—10—maleimidoethylacetamide (maleimidomonoamide—DOTA) with said polypeptide.

Additionally, l,4,7—triazacyclononane~1,4,7—triacetic acid (NOTA) and derivatives thereof may be used as cheiators. Hence, in one embodiment, there is provided an FcRn g ptide, fusion protein or conjugate, wherein the poiyaminopolycarboxylate chelator is 1,4,7—triazacyclononane— 1,4,7—triacetic acid or a derivative thereof.

The most commonly used acyclic poiyaminopolycarboxylate chelators are different derivatives of DTPA (diethylenetriamine—pentaacetic acid).

Hence, polypeptides having a ing environment provided by diethylenetriaminepentaacetic acid or derivatives thereof are also encompassed by the present disclosure. in a further embodiment, the FcRn binding polypeptide, produced recombinantly through expression of a polynucleotide or synthetically, is conjugated to one or more synthetic polymers, in order for e to increase its ynamic radius. Polyethylene glycol (PEG) is commonly used for this purpose, but other polymers have also been used in the art.

Such “PEGylation” may be used to increase the size of the FcRn binding polypeptide of any of the types described herein to a size above the old for effective renal excretion. in one ment, a synthetic polymer is conjugated to one or more chemically synthesized, monomeric FcRn binding polypeptides. Other functionalities may also be conjugated to the same synthetic polymer. if the FcRn binding polypeptide and other components are ally synthesized, none of the components will have to be made in a biological system if this is not desired.

In a preferred embodiment, one or more synthetically or biologically ctured FcRn binding polypeptides are conjugated to a synthetic polymer, to achieve a size exceeding the size associated with efficient renal nce and used for blocking binding of lgG to FcRn. A unique cysteine in each FcRn binding polypeptide may be used for site specific conjugation, for example a C—terminaily located cysteine introduced for this purpose. With a branched synthetic r, more than two FcRn binding moieties may be conjugated to the same polymer, to enhance the avidity and therefore the blocking potency.

In a third aspect of the present disclosure, there is ed a polynucleotide encoding an FcRn binding polypeptide or a fusion protein as described . Also encompassed by this disclosure is a method of producing a polypeptide or fusion protein as described above comprising expressing a polynucleotide; an expression vector comprising the polynucleotide; and a host cell comprising the expression vector.

Also encompassed is a method of ing a polypeptide, comprising culturing said host cell under conditions permissive of expression of said polypeptide from its expression vector, and isolating the polypeptide.

The FcRn binding polypeptide of the t disclosure may alternatively be produced by non—biological peptide synthesis using amino acids and/or amino acid derivatives having protected reactive side—chains, the non-biological e synthesis comprising — ise coupling of the amino acids and/or the amino acid derivatives to form a polypeptide according to the first aspect having protected reactive side-chains, — removal of the protecting groups from the reactive side-chains of the polypeptide, and — folding of the polypeptide in s solution.

In a fourth aspect of the disclosure, there is provided a composition comprising an FcRn binding polypeptide, fusion protein or conjugate as described herein and at least one pharmaceutically acceptable excipient or carrier. In one embodiment thereof, said ition further comprises at least one additional active agent, such as at least two additional active 3O agents, such as at least three additional active agents. Non-limiting examples of additional active agents that may prove useful in such a combination are immunosuppressing agents, anti—inflammatory agents, anti-microbial agents and enzymes.

In one embodiment of this aspect, said composition is d for administration by a route selected from the group consisting of oral administration, intranasal administration, pulmonar administration, l administration, rectal administration, intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection and intradermal injection.

As used herein, the term “systemic administration” refers to a route of administration such the substance of interest enters into the circulatory system so that the entire body is affected. The skilled person is aware that systemic administration can take place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally injection, infusion or implantation). in one embodiment, said composition is adapted for administration systemically or locally. In certain embodiments, systemic administration of said compound may be used. in another embodiment, said composition is adapted for administration by a local route. For example, local administration may be l in an nt, paste, foam or cream. In another embodiment, said composition is adapted for administration across an elial or epithelial layer. Here, the composition may be ytosed across said layer. in one embodiment, the rate of uptake of a composition comprising a fusion protein or conjugate as described herein is higher than the rate of uptake of polypeptides corresponding to second or further moieties per se. in one ment, the rate of uptake is at least 2 times higher, such as at least 5 times , such as at least 10 times higher, such as at least 25 times higher than the rate of uptake of the at second or further moieties per se.

It should be understood from the above disclosure that the FcRn binding polypeptide fusion protein or ate or the composition as bed herein may for example be useful as a therapeutic agent, and/or as a means for extending the in vivo half-life of a fusion partner, and/or as a means for increasing the rate of elimination of undesirable targets.

Hence, in a fifth aspect of the present disclosure, there is provided an FcRn binding ptide, fusion n, conjugate or composition as disclosed herein for use as a ment.

In a related, sixth, aspect of the present disclosure, there is provided a method of treatment of a subject in need thereof, comprising the step of administrating a therapeutically active amount of an FcRn binding polypeptide, fusion protein, conjugate or ition as disclosed herein. in one embodiment of any one of these two latter aspects, the medicament or method is intended for treatment in which the capacity of the FcRn binding polypeptide to at least partially block binding of lgG to FcRn is exploited, i.e. treatment in which increased catabolism of lgG antibodies is desired. In one embodiment, a ion in which such treatement may be indicated is an auto—immune condition. As non—limiting es of indicated conditions, mention is made of myasthenia gravis, Guillain—Barré me, autoimmune limbic encephalitis, pediatric autoimmune neuropsychiatric ers associated with streptococcal infection S), neuromyotonia (Isaac’s syndrome), morvan syndrome, multiple sclerosis, pemphigus is, foliaceus, bullous pemphigoid, epidermolysis bullosa acquisita, pemphigoid gestationis, mucous membrane goid, lichen sclerosus, antiphospholipid syndrome, erlapsing polychondritis, autoimmune anemia, idiopathic trombocytic purpura, autoimmune Grave’s disease, dilated cardiomyopathy, vasculitis, Goodpasture’s syndrome, idiopathic membranous nephropathy, toid arthritis and systemic lupus erythematosus. in another embodiment, there is provided an FcRn binding polypeptide, fusion protein, conjugate or composition as described herein for use in blocking or removal of an undesirable target from the circulation. In one ment, said undesirable target is selected from the group comprising allergens, amyloids, antibodies, auto—antigens, blood clotting factors, es, tumor cells, drug molecules, cytokines, chemokines, hypersensitivity mediators, pro-inflammatory factors, toxins such as bacterial toxins and snake venoms, pollutants, metals and xidants.

While the invention has been described with reference to s exemplary s and embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. ln addition, many modifications may be made to adapt a particular situation or molecule to the teachings of the invention without departing from the essential scope thereof. ore, it is intended that the invention not be limited to any particular embodiment contemplated, but that the invention will include all embodiments falling within the scope of the appended claims.

Brief description of the figures Figure 1 is a listing of the amino acid sequences of examples of FcRn binding motifs comprised in FcRn binding ptides of the invention (SEQ ID NO:1-353), examples of 49—mer FcRn binding ptides according to the sure (SEQ ID NO:354—706), es of 58-mer FcRn binding polypeptides according to the disclosure (SEQ ID NO:707—1062) as well as the amino acid sequences of the albumin binding polypeptide variant PP013 (SEQ ID NO:1063), Taq polymerase binding Z variant 203638 (SEQ ID NO:1064), human chRn (SEQ ID NO:1065), murine chRn (SEQ ID NO:1070), human BZ—microglobulin (SEQ ID N011066), murine 62— microglobulin (SEQ ID NO:1067), human chRn (SEQ ID NO:1068) when in human FcRn—eGFP and murine chRn (SEQ ID NO:1069) when in murine FcRn—eGFP.

Figures 2A-2E show the binding to human FcRn at pH 6.0 and dissociations at pH 6.0 and 7.4 for HISG-tagged Z variants and for lgG as described in Example 3. Overlays of sensorgrams obtained from a Biacore instrument representing ion at pH 6.0 followed by dissociation at pH 6.0 (solid line) and injection at pH 6.0 followed by dissociation at pH 7.4 (dashed line) are displayed for (A) ZO7918 (SEQ ID NO:707), (B) ZO7960 (SEQ ID NO:710), (C) Z10109 (SEQ ID NO:709), (D) 210193 (SEQ ID ) and (E) IgG.

Figure 3 shows dot plots from a flow cytometry analysis of binding of FcRn binding Z variant to human (upper panel) and mouse (lower panel) FcRn—eGFP HeLa cells, as described in Example 4. Due to heterogeneous expression of FcRn-eGFP by HeLa cells, cells were gated according to FcRn- eGFP sion level. Cells in gate H are considered to be FcRn-eGFP negative and cells in gate l are considered to be positive. tion with Alexa647 labeled Z variants resulted in a tion positive both for Alexa647 and eGFP, whereas incubation with buffer (buffer control) did not.

The figure shows that the three variants 207960 (SEQ ID NO:710), 207930 (SEQ ID NO:712) and 207918 (SEQ ID NO:707) bind to human FcRn and mouse FcRn. The y-axis shows Alexa647 intensity and the x—axis shows eGFP ty.

Figure 4 shows mean fluorescence intensity (MFI) values of Alexa647 d 207960 (SEQ ID NO:710), Z07930 (SEQ ID NO:712) and 207918 (SEQ ID NO:707), measured in the cell binding assay described in Example 4. Diagram (A) shows MFI from HeLa cells transduced with human FcRn~ eGFP and diagram (B) shows MFI from HeLa cells uced with mouse FcRn—eGFP.

Figure 5 shows dot plots from flow cytometry analysis of human or mouse IgG Alexa647 binding to human (upper panel) and mouse (lower panel) FcRn—eGFP HeLa cells, as described in Example 5. Due to heterogeneous expression of FcRn-eGFP by HeLa cells, cells were gated according to the abundance of FcRn—eGFP on the cell surface. Cells in gate M are considered to be FcRn-eGFP negative and cells in gate N are ered to be positive. Binding of 100 nM human or mouse lgG~Alexa647 to FcRn transduced HeLa cells are shown in the left panel (0 nM). The figure shows that lgG g was blocked by HiSrs—tagged Z07918 (SEQ lD NO:707) in a dose dependent manner (1, 10, 100 and 1000 nM). The y—axis shows Alexa647 intensity and the x—axis shows eGFP activity. 1O Figure 6 shows mean fluorescence intensity (MFl) values ing from FcRn g of lgG Alexa647 in the presence of ent concentrations of agged ZO7918 (SEQ lD NO:707) on (A) human FcRn— eGFP transduced HeLa cells and (B) mouse FcRn—eGFP transduced HeLa cells, as described in Example 5. The figure shows dose ent blocking of the lgG—FcRn binding by the Z variant.

Figures 7A—7C show kinetics of binding of three Z variants to human FcRn at pH 6.0, as described in Example 6, using a Biacore instrument.

Sensorgrams for a concentration series of (A) Z11948 (SEQ lD NO:1060), (B) Z11946 (SEQ lD NO:1061) and (C) Z11947 (SEQ ID 2), respectively, in fusion with the albumin binding polypeptide PP013 (SEQ ID NO:1063) and the control Z variant molecule 203638 (SEQ lD NO:1064; not specific for FcRn), are displayed. Curves from 640 nM (dashed line), 160 nM (dotted line) and 40 nM (solid grey line) were subjected to kinetic analysis using the Langmuir 1:1 binding model. Kinetic parameters and affinities were calculated from fitted curves (solid black lines) and are shown in Table 5.

Figure 8 shows the pharmacokinetic profiles for three FcRn binding Z variants fused to the albumin binding polypeptide PP013 obtained as described in Example 6. The Z variants Z11947 (SEQ lD NO: 1062, open squares), 211946 (SEQ lD NO:1061, open triangles) and 211948 (SEQ ID NO:1060, open diamonds) all yed prolonged half—life compared to the negative control PPO13—ZOB638 (open circles).

Figure 9 shows the blocking of human lgG to human FcRn by HiSs— 207918 (SEQ lD NO:707; black circles), lVlg (grey squares) and SClg (grey triangles), respectively, assayed as described in e 10.

Figure 10 shows that blocking of the lgG—FcRn interactions with FcRn specific Z variants in mice results in reduced levels of lgG. As further described in Example 11, mice were treated with five daily injections of Vehicle (+), the ABD fused Z variant ZO7918—PP013 (open square) and 211948 (SEQ ID NO:1060; closed circle). The concentration of endogenous lgG was measured by ELISA. The concentration of lgG in individual mice at 24, 72, 120 and 168 h were related to the level at 0 h and the results are therefore presented as tage of lgG at O h.

Summary 1O The following Examples disclose the pment of novel Z variant molecules targeting the neonatal Fc receptor (FcRn). The Z variants were obtained using phage display logy. The genes encoding FcRn binding polypeptides described herein were sequenced, and the corresponding amino acid sequences are listed in Figure 1, and denoted by the identifiers SEQ ID NO:707-1059. Also, the deduced binding motifs of these selected binding variants are listed in Figure 1 with sequence identifiers SEQ lD NO:1—353.

Example 1 Production of human chRn and human ﬁ2-microglobulin (82M) in this Example, the extracellular domain (ECD) of human chRn (SEQ ID NO:1065) in complex with human BZ—microglobulin (SEQ lD NO:1066) (complex denoted FcRn) and human BZ-microglobulin in non—complexed form (denoted 82M) were produced as soluble proteins. Human FcRn and 82M produced in this Example were used for phage selection, ELISA and Biacore assays in Examples 2 and 3.

Materials and methods Construction of plasmids ning the genes for human chRn and human ﬁZ—microglobulin to be used for co-expression: The genes ng human chRn (Genbank 800087342) and human BZ-microglobulin (82M) nk BCO32589.1) were obtained from OpenBiosystems. Using PCR overlap extension, a gene fragment encoding amino acids 24-290 of human chRn (chRnEco) (SEQ ID N021065) was ied to a construct ting of attBi—site/Kozak sequence followed by a gene encoding: an lg kappa chain leader ce, hFCRnECD, a GS—linker and a flag tag, followed by an attBZ site. A similar construct was made containing a gene fragment ng amino acids 21—119 of human 82M (SEQ ID NO:1066), except that a Hi35 tag replaced the flag tag. The constructs were inserted into the plasmid pDONOR221 (lnvitrogen, cat. no. 12536—017) by recombination using the Gateway system (lnvitrogen, cat. no. 11789020, Gateway® BP e® l| Enzyme mix), according to the manufacturer’s recommendations. After cation of correct sequences, the human ochRnEco construct was inserted into 2K7bsd (Suter etal. (2006) Stem Cells 24:615—623) using multi- site gateway cloning together with the er—containing plasmid pENTR— CMV (Tai et al. (2012) PLoS One 7(9):e46269), resulting in the vector 2K7bsd~ CRnECD. The human 82M gene construct was similarly inserted into 2K7neo (Suter et al., supra), giving the vector 2K7neo—CMV—hBZM.

Cell culture, preparation of recombinant lentiviral vectors and gene insertions into SKOV—3 cell line: The HEK293T and SKOV-3 cell lines were obtained from ATCC. Cells were grown at 37 °C in a humidified tor in the presence of 5 % 002. Complete medium for the HEK293T cell line was Dulbeccos ed eagle medium (DMEM) supplemented with 10 % fetal bovine serum (FBS), 1 % Antibiotic cotic Solution (AA) and 1 % MEM Non-essential Amino Acid Solution (NEAA). te medium for the SKOV— 3 cell line was McCoy’s 5A medium supplemented with 10 % FBS and 1 % The plasmids 2K7bsd—CMV—hFcRnEco and 2K7neo-CMV-hB2M were separately co—transfected together with VSV—G envelope and gag/pol packaging plasmid into HEK293T cells using calcium chloride transfection (Zufferey et al. (1997) Nat Biotechnol 15(9):871-5; Jakobsson etal. (2006) J Neurosci Res 84:58-67). HEK293 culture supernatants containing formed iral particles with human chRnEco and human 82M transgenes, respectively, were cleared from cell debris by centrifugation and filtration. The two types of lentiviral particles were used to sequentially transduce SKOV—3 cells. sful double integrants containing both the human chRnECD and the 82M genes were selected for by the addition of blasticidin (Invitrogen) and G418 sulfate (lnvitrogen) to culture medium while passaging the cells for two weeks. The resulting, stably transduced SKOV-3 cell line was d SKOV- 3 hFCRnECD/hBZM.

Expression of recombinant human FcRn: SKOV—3 cells, co-expressing human chRnEcp and 82M resulting in human FcRn, were expanded and 1.5 x 107 cells were seeded in a HYPERFIask (Corning) in 560 ml complete growth . After five days, when the cells had settled and multiplied, the medium was d to complete growth medium without FBS. After five days, the culture was terminated and the supernatant was collected, passed through a 45 um filter and frozen at ~80 °C.

Purification of recombinant human FcRn using human lgG chromatography: Protein purification was carried out in an AKTA Explorer system (GE Healthcare). Human lgG (Pharmacia), 1 ml in 0.2 M NaHCOa, 0.5 M NaCl pH 8.3 at a concentration of 10 mg/ml, was coupled to a 1 ml HiTrap NHS-activated HP column (GE care) according to the manufacturer’s 1O instruction. The supernatant containing recombinant human FcRn from SKOV—3 cells was thawed and the pH was adjusted to 5.8 with HCl. The supernatant was subsequently loaded in batches of 100 ml onto the column previously equilibrated with 20 mM Bis—Tris pH 5.8. The column was washed with 20 ml of 20 mM Bis-Tris pH 5.8 and eluted in fractions of 1 ml using 50 mM Tris, pH 8.1. Buffer exchange to PBS (phosphate buffered saline, 10 mM phosphate, 137 mM NaCl, 2.68 mM KCI, pH 7.4) was performed using dialysis.

SDS-PAGE and Western blot: The purity of the eluted fractions from the protein purification was analyzed by SDS-PAGE and staining with GeICode Blue Stain Reagent (Pierce) and SilverXpress® Silver Staining Kit (lnvitrogen). n blotting was carried out using an Amersham HybondTM— C Extra nitrocellulose membrane (GE care). The membrane was blocked with 5 % t dry milk (Semper) in TBS+T (50 mM Trizma base, 150 mM NaCl, 0.05 % 20, pH 8) for 1 hour, then probed with a mixture of rabbit anti-FCGRT polyclonal antibody (Atlas Antibodies) at a concentration of 0.15 ug/ml and rabbit anti—82M polyclonal antibody (Atlas Antibodies) at a concentration of 0.23 ug/ml in TBS+T. The membrane was subsequently ted with stabilized goat anti—rabbit antibody conjugated with horse radish peroxidase (Pierce) diluted 1:10,000 in TBS+T. After addition of TMB ate (Pierce), an image of the membrane was acquired on Amersham Hyperfilm ECL (GE Healthcare). The Hyperfilm was processed using GBX developer and GBX fixer (Sigma-Aldrich).

Production ofa non—complexed form of human B2M: Human 82M was produced in E. coli. The expression and purification was med essentially as described in Sandalova etal. (2005) Acta Chryst F6121090— 1093 and Michaelsson et al. (2001) J l 166:7327—7334. The purified protein, consisting of amino acids 21—1 19 of human 82M, in urea was subjected to arginine ing as follows; 0.5 mg of BZM was rapidly added to 2 ml refolding buffer (20 ml 1 M Cl pH 8.0, 16.87 g L—Arginine (buffered with HCl), 0.8 ml 0.5 M EDTA, 61 mg GSSG, 307 mg GSH and milli— Q water to a final volume of 200 ml, pH 8.0, and supplemented with protease inhibitor (Roche, cat. no. 11 873 580 001)). The refolding procedure was performed at 4 °C during 4 hours. Refolded 82M protein was buffer exchanged to PBS using a PD—10 column (GE Healthcare).

Results Construction of plasmids containing the genes for human chRn and human @2—microglobulin to be used for co—expression: Genes encoding the extracellular domain of the or—chain of human FcRn (chRnEco) and human B2M were inserted into the lentiviral er plasmids 2K7bsd and 2K7neo, respectively. In both cases, the inserted gene is under the control of a CMV promoter. The genes were extended so that the resulting ns would have an lg kappa chain leader sequence in the N—terminus to target the protein for export through the endoplasmic reticulum to the culture medium (the signal sequence was cleaved upon secretion). In addition, chRneco had a C- terminal spacer ce followed by a FLAG—tag for potential detection.

Human 82M had a C—terminal spacer sequence followed by a Hi85 tag for potential detection. The spacer sequence was added to enhance accessibility of the tag. The lentiviral transfer plasmids also contained two ent otic resistance genes to allow selection of cells where both constructs had been inserted.

Expression and purification of inant human FcRn: The genes encoding ClFCRnECD and 82M were inserted into the genome of SKOV—3 by lentiviruses, and the resulting FcRn protein was secreted into the culture . To capture only FcRn having retained pH—dependent lgG binding, affinity chromatography using lized lgG was used where the receptor was captured at pH 5.8 and eluted at pH 8.1. Captured protein was eluted in three fractions.

SDS—PAGE and Western blot: To investigate the presence of two peptide chains co and 82M) of the produced FcRn protein, and to analyze the purity of the eluted material, an SDS-PAGE analysis was performed on the eluted fractions. For the gel stained with GelCode Blue Stain, two bands were detected with molecular weights of 12 and 36 kDa, respectively. This corresponds approximately to the theoretical molecular weights of the non—glycosylated peptide chains of 12 kDa for 82M and 31 kDa for GFCRnECD. The ochRnEco part of the protein contains one glycosylation site and it was therefore expected that its molecular mass would be higher than 31 kDa. The gel was also silver stained to increase sensitivity and possibly detect impurities. A band of approximately 66 kDa was detected in the first eluted fraction, which could correspond to BSA (bovine serum albumin) originating from cell attachment. The total amount of protein red in on 2 and 3 corresponded to 1.4 mg/l culture medium. A western blot analysis on the pooled material was carried out, which showed 1O essentially only the two major bands and in on a very weak band below 12 kDa which might correspond to a ation product.

Example 2 Selection and ELISA binding of FcRn binding Z variants In this e, human FcRn was used as target in phage display selections using a phage library of Z variants. Selected clones were DNA sequenced, produced in E. coli periplasmic fractions and assayed against FcRn in ELISA (enzyme-linked sorbent assay).

Materials and methods Biotinylation of target protein FcRn and of 82M: Human FcRn and human 82M, produced as described in Example 1, were biotinylated using No-Weigh EZ—Link Sulfo-NHS-LC—Biotin (Pierce, cat. no. 21327) at a 31 x (FcRn) and 10 x (82M) molar excess, respectively, according to the manufacturer’s recommendations. The reactions were performed at room temperature (RT) for 30 min. Subsequent buffer exchange to PBS was performed using Slide-a-lyzer is cassettes (FcRn; Pierce, cat. no. 66380, 10,000 MWCO and 82M; Pierce, cat. no. 66333, 3,500 MWCO), according to the manufacturer’s instructions.

Phage display selection of FcRn binding Z variants: A library of random variants of protein Z displayed on bacteriophage, constructed in phagemid 92 ially as described in Gronwall et al. (2007) J Biotechnol, 128:162—183, was used to select FcRn g Z variants. In this library, an albumin binding domain (ABD, GA3 of n G from Streptococcus strain G148) is used as fusion partner to the Z variants. The library is denoted Zlib006Naive.ll and has a size of 1.5 x 1010 library members (Z variants).

E. coli 5 cells (R'L'Ither et a/., (1982) Nucleic Acids Res 10:5765—5772) from a glycerol stock containing the phagemid library Zlib006Naive.ll, were ated in 20 l of a defined proline free medium [dipotassium enphosphate 7 g/l, ium citrate dihydrate 1 g/l, uracil 0.02 g/l, YNB (DifcoTM Yeast Nitrogen Base w/o amino acids, Becton Dickinson) 6.7 g/l, glucose monohydrate 5.5 g/l, L—alanine 0.3 g/l, L-arginine monohydrochloride 0.24 g/l, ragine monohydrate 0.11 g/l, L-cysteine 0.1 g/l, L—glutamic acid 0.3 g/l, L-glutamine 0.1 g/l, glycine 0.2 g/l, L-histidine 0.05 g/l, L— isoleucine 0.1 g/l, L—leucine 0.1 g/l, L—lysine monohydrochloride 0.25 g/l, L— methionine 0.1 g/l, L-phenylalanine 0.2 g/l, L-serine 0.3 g/l, L-threonine 0.2 g/l, L-tryptophane 0.1 g/l, L—tyrosine 0.05 g/l, L—valine 0.1 g/l], supplemented with 100 ug/ml ampicillin. The cultivations were grown at 37 °C in a fermenter h Bioteknik, BR20). When the cells reached an l density at 600 nm (ODsoo) of 0.75 2.6 l of the cultivation was infected using a , imately x molar excess of M13K07 helper phage (New England Biolabs, cat. no.

N0315S). The cells were incubated for 30 minutes, whereupon the fermenter was filled up to 20 l with TSB—YE (Tryptic Soy Broth—Yeast Extract; 30 g/l TSB, 5 g/l yeast extract) supplemented with 100 pM isopropyl—B—D thiogalactopyranoside (IPTG) for induction of expression and with 25 pg/ml kanamycin and 12.5 ug/ml icillin and grown at 30 °C for 22 h. The cells in the cultivation were pelleted by centrifugation at 15,900 g. The phage particles were precipitated from the supernatant twice in PEG/NaCl thylene glycol/sodium chloride), filtered and dissolved in PBS and ol as described in Gronwall et al., supra. Phage stocks were stored at — 80 °C before use.

Selections against biotinylated human FcRn were performed in four cycles divided in two different tracks. Phage stock preparation and selection procedure were performed essentially as described for selection against another biotinylated target in W02009/077175. The amplification of phage between the selection cycles was performed by infecting E. coli RRIAM15 with phage, then performing cultivation in solution as follows. Eluted phage and 10 x excess of M13K07 helper phage compared to ia were allowed to simultaneously infect log phase bacteria at 37 °C for 30 min t rotation, followed by 30 min with slow rotation. Prior to infection, bacteria were grown to log phase in the defined proline free medium described above.

Infected bacteria were pelleted by centrifugation at 4,300 g for 10 min and resuspended in 200 ml TSB+YE medium supplemented with 0.1 mM IPTG, pg/ml kanamycin and 100 pg/ml ampicillin and cultivated at 30 °C overnight for phage tion.

The selection buffer consisted of 100 mM sodium phosphate and 150 mM sodium chloride adjusted to pH 5.5 with hydrogen de and supplemented with 0.1 % gelatin and 0.1 % Tween—20. At selection, human serum albumin (HSA, Albucult, Novozymes) was added to the selection buffer to a final concentration of 1.5 pM. In order to reduce the amount of background binders, pre-selection was performed by incubation of phage 1O stock with Dynabeads® M—280 Streptavidin (SA—beads, Dynal, cat. no. ) for 1 hour at RT. A second pre—selection was performed during 30 min at RT against human BZM immobilized in immunotubes (Nunc, cat. no. ). 5 pg/ml of human 82M in carbonate buffer (Sigma, cat. no. 068K8214) was immobilized in the tube at 7 °C for >1 h. After g twice with tap water, the tubes were blocked with PBS + 0.5 % casein (Sigma, cat. no. C8654) for 30 min at RT before use. All tubes and beads used in the selection were pre—blocked with PBS + 0.1 % gelatin. Selection was performed in solution at RT, ed by capture of target—phage complexes on SA—beads where 1 mg beads per 2.9 pg biotinylated FcRn were used. in cycle 1 of the ions, 100 nM ylated FcRn was used and two washes of two min each were performed using selection buffer. An increased stringency, using a lowered target concentration and an increased number of washes, was applied in the subsequent cycles: 50 nM/5 washes, 25 nM/8 washes and 10 nM/12 washes were applied in cycle 2, 3 and 4, respectively.

After the washes, bound phage was eluted from the two selection tracks using two different procedures; 1) 500 pl 0.1 M glycine—HCI, pH 2.2, followed by immediate neutralization with 50 pl 1 M Tris—HCI, pH 8.0, and 450 pl PBS, or; 2) 500 pl of 100 mM sodium phosphate and 150 mM sodium chloride, pH 8.0 and neutralization with 500 pl PBS.

Seguencing: PCR fragments were amplified from single colonies using a standard PCR m and the primers AFFl—21 (5’-tgcttccggctcgtatgttgtgtg (SEQ ID 1)) and 2 (5’—cggaaccagagccaccaccgg (SEQ ID NO:1072)). Sequencing of amplified fragments was performed using the biotinylated oligonucleotide AFFI—72 (5’—biotin—cggaaccagagccaccaccgg (SEQ lD NO:1073)) and a ® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), used in accordance with the manufacturer’s protocol. The sequencing reactions were purified by binding to magnetic streptavidin coated beads (Detach Streptavidin Beads, Nordiag, cat. no. 2012—01) using a rix 8000 (Magnetic Biosolution), and analyzed on ABI PRISM® 3130xl c Analyzer (PE Applied Biosystems).

Production of Z variants for ELISA: Sequenced Z variants were produced by inoculating single colonies from the selections into 10 ml TSB— YE medium mented with 100 pg/ml ampicillin and 0.1 mM IPTG and incubating for 24 h at 37 °C. Cells were ed by centrifugation, re— suspended in 2 ml PBST (PBS supplemented with 0.05 % 20), frozen at ~80 °C and thawed in a water bath, to release the periplasmic fraction of 1O the cells. The freeze-thawing procedure was repeated seven times and cells were then pelleted by centrifugation. The supernatant of the asmic extract contained the Z variants as s to ABD, expressed as AQHDEALE—[Z#####]—VDYV—[ABD]-YVPG (Grénwall et al., supra). Z##### refers to individual, 58 amino acid residue Z ts.

ELISA KD analysis of Z variants: The binding of Z variants to FcRn was ed in ELISA assays. Half—area 96—well ELISA plates were coated with 2 pg/ml of an anti—ABD goat antibody (produced in—house) diluted in coating buffer (50 mM sodium carbonate, pH 9.6) at 4 °C overnight. The antibody solution was poured off and the wells were blocked with 100 pl of PBSC (PBS supplemented with 0.5 % casein) for 1.5 h at RT. The blocking solution was discarded and 50 pl periplasmic solution, diluted 1:4, was added to the wells and incubated for 1.5 h at RT under slow shaking. The solutions were poured off and the wells were washed four times with either 0.05% PCT buffer, pH 6.0 (Mcllvaines phosphate-citrate buffer, pH 6.0, supplemented with 0.05 % Tween—20) or 0.05% PCT buffer, pH 7.4 aines phosphate—citrate , pH 7.4, supplemented with 0.05 % Tween—20). The target protein, biotinylated human FcRn, was added to the wells in a 1:3 diluted concentration series from 2 ug/ml (45 nM) to 0.3 ng/ml (6.9 pM) diluted in PCC buffer, pH 6.0 or pH 7.4, (Mcllvaines phosphate—citrate buffer, pH 6.0 or pH 7.4, supplemented with 0.5 % ), respectively. The plates were incubated for 1.5 h at RT followed by washes as described above. Streptavidin conjugated HRP (Thermo Scientific, cat. no. N100) was diluted 1:30 000 in PCC buffer, pH 6.0 or pH 7.4, respectively, and added to the wells followed by 45 min incubation.

After washing as described above, 50 pl ImmunoPure TMB substrate (Thermo Scientific, cat. no. 34021) was added to the wells and the plates were treated according to the cturer’s recommendations. Absorbance was measured at 450 nm using a multi—well plate reader, Victor3 (Perkin Elmer). A Z variant g an irrelevant protein was used as negative control and a blank was created by omitting the periplasmic step. A Z variant which bound to FcRn in a pre—experiment 8, SEQ lD NO:707) was used as positive control. Measured values were analyzed using GraphPad Prism 5 (GraphPad Software, LaJoIla, CA, USA) and non—linear regression in order to determine the affinities (Kn) of the interactions.

ELISA specificity analysis of Z variants: in another ELlSA experiment, the specificities of the Z ts were tested by assaying them against 2 ug/ml biotinylated human proteins 82M, PSMA (in house produced) and lgG (polyclonal, cia, Sweden) and against PCC buffer pH 6.0 or pH 7.4, respectively. The assay was med at pH 6.0 and at pH 7.4, respectively, as described above. The biotinylated proteins or buffer were added to the wells instead of FcRn in the target n step.

Results Phage display selection of FcRn binding Z variants: Individual clones were obtained after four cycles of phage display ions against biotinylated human FcRn. cing: Sequencing was performed on clones picked at random from selection round four. Each Z variant was given a unique fication number ##### and individual variants are referred to as 2#####. The amino acid sequences of the 58 amino acid residues long Z variants are listed in Figure 1 as SEQ ID NO:707—722 and SEQ lD NO:1059.

The deduced FcRn binding motifs of these Z variants are listed in Figure 1 as SEQ lD NO:1—16 and SEQ ID NO:353. The amino acid sequences of the 49 amino acid residues long polypeptides predicted to constitute the complete three-helix bundle within each of these Z variants are listed in Figure 1 as SEQ lD NO:354-369 and SEQ lD NO:706. 3O ELlSA assays with Z variants: Sixteen clones were produced as ABD fusion proteins in E. coli. The asmic fractions were used in an ELISA against a dilution series of human FcRn. The clones were: 207909 (SEQ ID NO:719), 207918 (SEQ ID NO:707), 207930 (SEQ lD NO:712), 207960 (SEQ lD NO:710), 210109 (SEQ ID NO:709), 210111 (SEQ lD NO:714), 210127 (SEQ lD NO:718), 210129 (SEQ ID NO:715), 210140 (SEQ ID NO:711), 210141 (SEQ ID NO:716), 210145 (SEQ ID ), 210152 (SEQ lD NO:720), 210156 (SEQ lD NO:717), 210161 (SEQ ID NO:722), 210183 (SEQ ID NO:713) and 210193 (SEQ ID NO:708). Kn values were determined for all variants at pH 6.0 and for three variants at pH 7.4 (Table 1). For thirteen ts, data was not obtained for a KD analysis at pH 7.4. None of the sixteen variants displayed non—specific binding when assayed against human B2M, lgG or PSMA.

Table 1. ELISA KD is of 2~ABD variants in E. coliperiplasmic fractions.

Z variant SEQ ID NO: Ko pH 6.0 (M) Kn pH 7.4 (M) 207909 719 24.5 x10“9 n.d. 207918 707 2.0 x10“9 10.9 x10‘9 207930 712 10.4 x10“9 n.d. 207960 710 6.0 x10"9 n.d. 210109 709 3.9 x10'9 23.9 x10“9 210111 714 11.4 x10'9 n.d. 210127 718 21.3 x10‘9 n.d. 210129 715 17.6 x10'9 n.d. 210140 711 8.8 x109 n.d. 210141 716 21.2 x10'9 n.d. 210145 721 42.0 x10“9 n.d. 210152 720 24.6 x109 n.d. 210156 717 21.3 x10”9 n.d. 210161 722 163.0 x10”9 n.d. 210183 713 10.9 x10“9 n.d. 210193 708 2.3 x10"9 25.9 x109 n.d.= not determinable Production and characterization of FcRn binding 2 variants In this Example, seventeen 2 variants were produced in E. coli, purified and assayed against human FcRn in Biacore. A subset of said variants was also assayed against mouse FcRn. Circular dichroism (CD) spectroscopy was performed for a subset of 2 variants for investigation of their secondary structure.

Materials and methods Subcloning of Z variants: The DNA of een FcRn binding Z variants (SEQ lD NO:707—722 and SEQ lD NO:1059) was amplified from the library vector pAY02592. A subcloning strategy for construction of monomeric Z t les with N—terminal His6 tag was applied using standard molecular biology techniques (essentially as described in detail in /077175 for Z variants binding another target). The Z gene nts were subcloned into the expression vector pAY01448 ing in the d sequence MGSSHHHHHHLQ-[Z#####]—VD. 1O In addition, the FcRn binding variant 207918 (SEQ ID N02707), but starting with the amino acids AE instead of VD and denoted 211948 (SEQ ID NO:1060), was cloned as homodimeric constructs with two different linkers between the Z variants and followed by a C~terminal Hl86 tag. This was performed using conventional molecular biology methods including DNA amplification, restriction with suitable restriction enzymes and ligation of the DNA. The two linkers were obtained from Thermo Fisher Scientific. The Z gene fragments were subcloned into the expression vector (pET—26 origin, Novagen) resulting in the encoded sequence #]~GT—(G4S)-PR— [Z#####]—LEHHHHHH and #]-GT-(G4S)3—[Z#####]-LEHHHHHH, respectively.

Cultivation and purification: E. coli BL21(DE3) cells (Novagen) were transformed with plasmids ning the gene fragment of each respective FcRn binding Z variant and ated at 37 °C in 800 or 1000 ml of TSB—YE medium supplemented with 50 ug/ml kanamycin. At ODsoo = 2, lPTG was added to induce expression at a final concentration of 0.17 or 0.2 mM and the culture was incubated at 37 °C for r 5 h. The cells were harvested by centrifugation.

Approximately 2—5 g of each cell pellet was resuspended in 10—25 ml binding buffer (20 mM sodium phosphate, 0.5 M NaCl, 20 mM imidazole, pH 7.4) supplemented with Benzonase® (Merck, cat. no. 1016540001) to a concentration of 15 U/ml and Lysozyme (Sigma, cat. no. L—7651) to a concentration of 0.5 mg/ml. After cell disruption by three freeze—thawing cycles or sonication, cell debris was removed by centrifugation and each supernatant was applied on a 1 ml His GraviTrap lMAC column (GE Healthcare, cat. no. 11-0033—99). inants were removed by washing with wash buffer (20 mM sodium phosphate, 0.5 M NaCl, 20 or 60 mM imidazole, pH 7.4), and the FcRn binding Z variants were subsequently eluted with elution buffer 1 (20 mM sodium phosphate, 0.5 M sodium chloride, 250 mM imidazole, pH 7.4) or elution buffer 2 (0.1 M acetic acid, 0.5 M sodium chloride, pH 4.5). Purified Z variants were buffer ged to PBS using PD- columns (GE care), according to the manufacturer’s ol.

Protein concentrations were determined by measuring the absorbance at 280 nm, using a NanoDrop® ND—1000 spectrophotometer, and using the extinction coefficient of the respective n. The purity of the FcRn binding Z variants was analyzed by SDS—PAGE stained with Coomassie Blue. The identity of each purified FcRn binding Z variant was confirmed using LC/MS analysis. 1O CD analysis: Purified HiSG—tagged Z variants were diluted to 0.5 mg/ml in PBS. For each diluted Z variant, a CD um at 250—195 nm or 250—190 nm was obtained at 20 °C. In on, a variable temperature measurement (VTM) was performed to determine the melting temperature (Tm). In the VTM, the absorbance was measured at 221 nm while the temperature was raised from 20 to 90 °C, with a temperature slope of 5 . A new CD um was obtained at 20 °C after the heating procedure in order to study the ing ability of the Z variants. The CD measurements were performed on a Jasco J—810 spectropolarimeter (Jasco Scandinavia AB) using a cell with an optical path—length of 1 mm.

Biacore binding and c analysis: The interaction of FcRn binding HiSe-tagged Z variants with human FcRn was analyzed in a Biacore 2000 instrument (GE Healthcare). Human FcRn was lized in a flow cell on the carboxylated dextran layer of a CM5 chip surface (GE Healthcare). The immobilization was performed using amine coupling chemistry according to the manufacturer’s protocol and using HBS—EP (GE Healthcare) as running buffer. One flow cell surface on the chip was activated and deactivated for use as blank during e injections. In the two binding experiments presented below, Mcllvaines phosphate-citrate buffer pH 6.0 supplemented with 0.005 % Tween-20 (0.005% PCT) was used as running buffer. In all experiments, a flow rate of 50 ul/min was used.

In one experiment, the dissociation at pH 6.0 was compared to the dissociation at pH 7.4. HISG-tagged Z variants and a human monoclonal IgG1 were diluted in g buffer to a final concentration of 250 nM or 2.5 nM, respectively, and injected over the FcRn chip for 1 minute using the co—inject procedure. The second injection of the ect procedure, representing the dissociation phase of the interactions, contained either running buffer (pH 6.0) or 0.005% PCT pH 7.4. The Z variants were allowed to dissociate for 1 minute, except for 207918 and 210193, which were allowed to iate for 4 s, before a surface equilibration during 5 minutes in g buffer. lgG was allowed to dissociate for 4 minutes before equilibration. Buffer injections were performed in a similar way; co—injection of buffer pH 6.0 followed by pH 6.0 or co—injection of buffer pH 6.0 followed by pH 7.4. The results were analyzed in BiaEvaluation software 4.1 (GE Healthcare). Curves of the blank surface were subtracted from the curves of the ligand surface. In addition, curves of buffer injections were subtracted from the Z variant curves and from the lgG curves to adjust for the buffer effects.

In another experiment, approximate kinetic constants (kon and kof‘f) and affinities (KD) were determined for a subset of HiSs~tagged Z variants. Three concentrations of the Z variants were ed for 1 minute followed by iation in running buffer for 1 minute. The surfaces were equilibrated with running buffer during 7.5 minutes before the start of next cycle. lnjected concentrations were either 675 nM, 225 nM and 75 nM (210140, 210156 and 210183) or 225 nM, 75 nM and 25 nM (207918 and 210193). Kinetic constants were calculated from the sensorgrams using the Langmuir 1:1 model of BiaEvaluation software 4.1 (GE Healthcare).

In a separate experiment, the affinity of the interactions of 2 ts to hFcRn (SEQ ID NO:1065) and chRn (SEQ ID NO:1070), respectively, was measured at both pH 6.0 and pH 7.4 on a Biacore 3000 instrument (GE Healthcare). hFcRn and chRn were produced essentially as bed in Example 1 but using mouse 3T3 cells instead of human SKOV—3 cells for production of chRn, and immobilized on separate flow cells on a CM5 chip in acetate buffer at pH 4.65. The immobilization level was approximately 1000 RU for both receptors. A reference flow cell was created by activation and deactivation. 0.005% PCT pH 6.0 or 7.4 was used as running buffer and for dilution of the analytes. All analyses were performed at 25 °C. The affinity constants for the HiSs—tagged Z variants 207918 (SEQ lD NO:707), 207960 (SEQ ID NO:710) and 210193 (SEQ ID NO:708) were determined by injecting a on series from 1024 nM to 0.5 nM (pH 6.0) or from 10240 nM to 5 nM (pH 7.4). The affinities were derived using GraphPad Prism 5 re, using a one site g saturation model.

AlphaLlSA blocking assay: The potential of 2 variants to inhibit binding of lgG to FcRn was analyzed in an AlphaLlSA assay with an EnSpire multiplate reader 2300 (Perkin Elmer). Human lgG (Roactemra) was immobilized on lSA acceptor beads (Perkin Elmer, cat. no. 6772002) ing to the cturer’s recommendations. Stepwise serial dilutions 1:3 of His-tagged Z variants to final concentrations of 250 nM to 38 pM were made in a 384—well plate (Perkin Elmer, cat. no. G6005350) and incubated for 45 min with 10 nM biotinylated human FcRn (Biorbyt, cat. no. orb84388; ylated essentially as described in Example 2) in AlphaLISA buffer (Perkin Elmer, cat. no. AL000F) adjusted to pH 6.0 using HCl. lgG-coated Acceptor beads were added to a final concentration of 10 uM and incubated for 45 min. Finally, streptavidin coated Donor beads (Perkin Elmer, cat. no. 6772002) were added to a final concentration of 40 pg/ml and incubated for 1O 30 min. All incubations were performed at RT in the dark. The plate was analyzed in the EnSpire instrument and the 1050 values were calculated using GraphPad Prism 5.

Results Cultivation and purification: The seventeen FcRn binding Z variants (SEQ lD NO: 707—722 and SEQ lD N011059), constructed with an N—terminal His6 tag, were produced in E. coli. The amount of lMAC-purified protein from approximately 2—5 g bacterial pellets, determined spectrophotometrically by measuring the absorbance at 280 nm, ranged from imately 10 mg to 20 mg for the different FcRn binding Z ts. SDS—PAGE analysis of each final protein preparation showed that these predominantly ned the FcRn binding Z variant. The t identity and molecular weight of each FcRn binding Z variant was confirmed by HPLC-MS is.

CD analysis: The CD spectra determined for six Z variants showed that each had an a—helical ure at 20 °C. This result was also verified in the variable temperature measurements, wherein melting temperatures (Tm) were determined (Table 2). A reversible g was seen for the six Z variants when overlaying spectra measured before and after heating to 90 °C. 3O Table 2. Meltingtemperatures for a selection of Z variants.

Z variant SEQ lD NO: Tm (°C) 207909 719 56 207918 707 49 207930 712 56 207960 710 58 210109 709 61 Z10193 708 59 Biacore g and kinetic analyses: The binding of seventeen Z variants to human FcRn and the dissociation at different pH were tested in a Biacore instrument by sequentially injecting each of the Z variants at pH 6.0 and either buffer pH 6.0 or pH 7.4 over a chip surface ning FcRn. The ligand immobilization level of the surface was 1668 RU human FcRn. The seventeen Z variants showed binding to FcRn at pH 6.0, and for all variants, faster off—rates were seen at pH 7.4 compared to pH 6.0. The result for lgG was similar, displaying a faster off-rate at pH 7.4. The ts 207918 and 210193 showed the slowest iation curves. Sensorgrams for a subset of variants and lgG are displayed in Figure 2 A—E.

Table 3. Biacore kinetic constants and affinities for hFcRn binding at pH 6.0. z variant SEQ ID NO: kon(M'1S'1) kofr(S'1) KD (M) 207918 707 1.4 x 106 0.022 1.6 x10-8 210140 711 1.4 x106 0.12 8.8 x10“8 210158 717 7.6 x 106 0.28 3.7 x10”7 210183 713 1.0x106 0.13 1.3x10-7 210193 708 1.5 x106 0.033 2.2 x10-8 The kinetic constants of five Z variants interacting with FcRn at pH 6.0 were determined (see Table 3). The immobilization level of the surface was 2015 RU human FcRn. For each Z variant, kinetic constants were calculated using a curve set of three injected concentrations. ty (K0) constants were also ined for HiSs-tagged Z variants ZO7918 (SEQ ID NO:707), 207960 (SEQ ID NO:710) and Z10193 (SEQ ID NO:708) interacting with human and mouse FcRn at pH 6.0 and pH pH 7.4 (Table 4). For all three variants, KD values were lower at pH 6.0 compared to pH 7.4.

Table 4. Biacore ties for hFcRn and chRn at pH 6.0 and pH 7.4.

SEQ ID KD (M) hFcRn KD 1M) chRn Z variant NO: pH 6.0 pH 7.4 pH 6.0 pH 7.4 207918 707 1.2 X 10'8 >5 X 10'7 9.0 X 10'8 >5 X 10'7 207960 710 5.0 X 10'8 >1 X 10'6 3.5 X 10'7 >5 X 10'5 Z10193 708 1.4 X 10‘8 >5 X 10~7 9.5 X 10'8 >5 X 10‘7 Table 5: Calculated lCSO values from Al haLlSA blockin assa . 210193 — 12x108 213993 1059 1.3 x107 Z11948—G4S—Z1 1948 1060 3.8 X 10'10 Z11948— G48 48 1060 4.1 X 1O~10 AlphaLlSA blocking assay: The ability of seventeen HiS5—tagged monomeric Z variants (SEQ ID NO:707—722 and SEQ ID NO:1059) and two dimeric variant, Z11948—G4S—Z11948 and Z11948—(G4S)3—Z11948to inhibit lgG binding to FcRn was tested in an AlphaLlSA blocking assay. Serial dilutions of the Z variants were incubated with biotinylated human FcRn and the blocking ability of each respective variant was measured after addition of lgG 1O coated Acceptor beads and uently streptavidin coated Donor beads.

Inhibition could be measured as a decrease in AlphaLlSA counts for positive Z variants. The calculated lC5O values for the ten monomeric ts and the two dimeric variants that were shown to block lgG binding to FcRn in this assay are shown in Table 5.

Example 4 Binding of FcRn binding Z variants to human or mouse FcRn/eGFP transfected HeLa cells In this example, the binding ability of FcRn binding Z variants was investigated. The production of HeLa cells sing human and murine FcRn—eGFP gene transgene and the use of these cells for flow cytometry analysis with 47 labeled Z variants is described.

Materials and s Cloning of FcRn-eGFP and 82M viral vectors: The genes encoding murlne FcRn (chRn, Genbank BC003786.1, OpenBiosystems) and murine BZM (mBZM, Genbank 800851641 OpenBiosystems) were ied in a similar way as the genes for human FcRn and human 82M as described in Example 1. Human and murlne FcRn and 82M genes were amplified as follows: for hFcRn, the sequence ng amino acids 1-365 (SEQ ID NO:1068) was amplified; for hBZM, the sequence encoding amino acids 21 — 1O 119 (SEQ lD NO:1066) was amplified; for chRn, the sequence encoding amino acids 1-369 (SEQ ID NO:1069) was amplified; and for mBZM, the sequence encoding amino acids 21-119 (SEQ ID NO:1067) was amplified.

The vector pHR—cPPT—CMV—EGFP (Jakobsson et al. (2003) J Neurosci Res 73:876—85) and FcRn PCR ons (human and murine) were cut using the restriction enzymes BamHl (human) or Bc/l (murlne) and Mlul (New England Biolabs, cat. nos. R0136M, R0160L and RO198L, respectively), and ligated using T4 DNA Ligase (New England Biolabs, cat. no. ). The ligation mix was chemically transformed into E. coli RRIAM15 and spread on ampicillin . Colonies were picked and screened with suitable primer 2O pairs. The construct encoding the al signal peptide, human or murlne FcRn and eGFP at the cytoplasmic tail were ed by sequencing and denoted pHR—cPPT—CMV-hFcRn—eGFP and pHR—cPPT—CMV—chRn-eGFP, respectively.

The human and murlne 82M PCR amplicons were ed into the plasmid pDONOR221 (lnvitrogen, cat. no. 12536—017) by ination using the Gateway system (lnvitrogen, cat. no. 11789020, Gateway® BP Clonase® ll Enzyme mix) ing to the manufacturer’s recommendations. After verification of correct sequences, human or murlne B2M was inserted into p2k7_gtc (Suter et al., supra) using a multi-site gateway cloning system (lnvitrogen, cat. no. 11791020, y® LR Clonase® ll Enzyme mix) together with the promoter containing plasmid pENTR-CMV (Tai et al. supra), resulting in the vectors 2k7neo—CMV—hBZM and 2k7neo-CMV—mBZM, respectively.

Lentiviral transduction of HeLa cells: The vector pairs 2k7neo—CMV— hBZM and pHR—cPPT—CMV—hFcRn-eGFP or 2k7neo—CMV—mBZM and pHR- cPPT—CMV—chRn-eGFP were co-transfected together with VSV-G envelope and gag/pol packaging plasmid into HEK293T cells using calcium chloride transfection (Zufferey et al., supra; Jakobsson er al. (2006) supra). HEK293T culture supernatants containing formed lentiviral particles with FcRn and 82M transgenes respectively were used to sequentially uce HeLa Cervix adenocarcinoma cells (Cell Line Service) at low passage . The resulting two stably transduced HeLa cell lines are in the following denoted eGFP (transduced with genes for human FcRn—eGFP and hBZM) and chRn—eGFP (transduced with genes for mouse FcRn—eGFP and mBZM).

Alexa647 labeling of FcRn binding Z ts: The three HiSs—tagged Z variants 207918, 207930 and 207960 were labeled with Alexa Fluor® 647 Carboxylic Acid Succinimidyl Ester (lnvitrogen cat. no. A20106). Before labeling, buffer was exchanged to 0.2 M carbonate buffer, pH 8.3, using Vivaspin500 centrifugal filter units (10 kDa MWCO, Vivaproducts cat. no. 512— 2838) spun at 10,000 g. The ng was med in the Vivaspin500 and 1 pl of Alexa647 Succinimidyl Ester dye (40 pg/pl in DMSO corresponding to 1.3 x molar excess) was added to 200 pg/25 pl Z variant. The mixes were incubated at RT in the dark for 40 minutes in a wiggling rota mixer. The reaction mixes were subsequently put on ice for 3.5 hours and free dye was removed by washing with 15 x 100 pl PBS in the Vivaspin500. lmmunofluorescence staining of human and mouse GFP transfected HeLa-cells with FcRn binding Z variants: hFcRn—eGFP and GFP HeLa cells were harvested by trypsination and washed twice in PBS at pH 6.0 before counting. 100,000 cells were pipetted per well of a v— bottomed 96 well plate (Nunc, cat no 277143) and the cells in the plate were subsequently ed at 1,700 rpm for 4 min at 4 °C. The supernatants were removed and the cells were fixed with 50 pl of 2 % formaldehyde (Sigma Aldrich, cat. no. F8775) in PBS at pH 6.0 for 10 min at RT. Cells were thereafter washed with 2 x 100 pl PBS pH 6.0, saturated with casein (PBSC), and resuspended in PBSC plus 0.1 % saponin (AppliChem, cat no A4518.0100) containing 620 nM of Alexa647 d HiSG—tagged Z variants; 207960, 207930 and 207918. Transduced HeLa cells, incubated with buffer alone, were used as control. The cells were incubated for 1 h at 8 °C on a shaker in the dark, washed with 2 x 100 pl PBSC and resuspended in 180 pl of PBS pH 6.0 plus 1 % BSA (fraction V, Merck, cat. no. 1.120180100). ,000 well were analyzed in a Gallios Flow Cytometer (Beckman Coulter) and the data was analyzed using Kaluza software (Beckman Coulter).

Results Flow cytometry analysis was ed to determine whether the FcRn binding Z variants could bind to human and/or mouse FcRn on human or mouse FcRn/eGFP transduced HeLa cells. The experiment was performed at pH 6.0 with Alexa647 labeled , 207930 and 207918 (SEQ ID N02710, 712 and 707, respectively). Dot plot analysis (y—axis: Alexa647, x—axis: eGFP) showed that the transduced cell population could be divided into FcRn-eGFP negative and positive population (Figure 3, gate H and l, respectively) indicating heterogeneous expression of the FcRn-eGFP fusion protein by HeLa cells e 3). Accordingly, the mean fluorescence ity (MFI) values for Alexa647 in gate l were subtracted by background MFI values of Alexa647 in gate H. The calculated MFI values are presented in Figure 4. The results show that 207960, 207930 and 207918 are capable of binding HeLa cells displaying human (Figure 4A) or murine e 4B) FcRn—eGFP.

Example 5 Blocking of lgG binding to FcRn with the FcRn binding Z variant 207918 In this example, the potential competition of FcRn binding Z variants with lgG for g to FcRn was igated in a cell based assay. Such binding will result in blocking of the lgG-FcRn ction.

Materials and methods Blocking of lgG—FcRn immunofluorescence ng: Human or murine FcRn-eGFP transduced HeLa cells were prepared as described in Example 4. Fixed cells were resuspended in 50 pl of a mix of either 100 nM Alexa647— conjugated human or mouse lgG (Jackson laboratories, cat. no. 009—600—003 and 015—600—003, respectively) and 1000, 100, 10, 1 or 0 (buffer control) nM His6-tagged 207918 d in PBS-casein, pH 6.0, plus 0.1 % saponin (AppliChem). The cells were incubated for 1 h at 37 °C on a shaker in the dark, washed with 2 x 100 pl PBS—casein pH 6.0 and re-suspended in 180 pl of PBS, pH 6.0, plus 1 % BSA. Data from 10,000 cells/well (except somewhat fewer cells for mouse 100 nM mlgG-Alexa647) were obtained using a Gallios Flow Cytometer (Beckman Coulter) and the data was analyzed using Kaluza re (Beckman Coulter).

Results The experiment was performed to determine if the FcRn g Z variant 207918 (SEQ ID NO:707) blocks the IgG—FcRn interaction. Human or murine FcRn-eGFP transduced HeLa cells were incubated with human or mouse AIexa647-conjugated IgG. The binding was blocked with unlabeled 207918 at different concentrations. Due to the geneous expression of FcRn by the transduced HeLa cells (described in Example 4), the MFI values for Alexa647 in gate N of each sample was subtracted by the ponding MFI values in gate M (Figure 5). The percent IgG Alexa647 g was calculated by dividing the different MFI values with the MFI for the blank control. The results showed that 207918 effectively blocked hlgG binding to hFcRn (Figure 6A) in a dose dependent manner. Furthermore, 207918 also blocked mlgG binding to chRn (Figure 68) although less efficiently compared to hlgG-binding.

Example 6 Pharmacokinetic study of three FcRn binding Z variants In this e, the ability of FcRn binding Z ts to prolong serum half—life of a non-specific Z variant was investigated by a pharmacokinetic study performed in mice.

Materials and methods Subcloning of Z variants: A subset of Z ts (207918, 207960 and 210193) was submitted to a second subcloning. DNA from the subcloned HiSs-tagged variants in Example 3 was used as template. First, PCR amplification using suitable primer pairs was med to create genes encoding 2 variants starting with the amino acids AE instead of VD. The mutated Z variants are listed in Figure 1 and were d 211948 (SEQ ID NO:1060), 211946 (SEQ ID NO:1061) and 211947 (SEQ ID NO:1062), corresponding to mutated 207918, 207960 and 210193, respectively. Genes encoding the new 2 variants were restriction cleaved and d into a vector harboring the genes encoding albumin g variant PPO13 (SEQ ID NO:1063) and 203638 (SEQ ID NO:1064) with spacer sequences resulting in a gene fusion encoding [2#####]—GAP(G4S)4TS—[PP013]—GT(G4S)4PR- (also denoted “2#####-PP013-203638” or “Z variant in fusion with PP013-ZO3638"). The ve control molecule [ZO3638]—GAP(G4S)4TS— [PP013] was subcloned in a similar way by ligating 203638 into a vector containing a (G4S)4 linker and the sequence for PP013. The subsequent steps for vector transformation into E. coli were med as in Example 3.

Cultivation and cation: Z variants in fusion with PP013-ZO3638 were produced in E. coli as described in Example 3. Approximately 3 g of each cell pellet was re-suspended in 30 ml TST—buffer (25 mM Tris-HCl, 1 mM EDTA, 200 mM NaCl, 0.05 % Tween20, pH 8.0) supplemented with Benzonase® (Merck). After cell disruption by sonication and clarification by centrifugation, each supernatant was applied on a y flow column with 5 ml agarose immobilized with an anti—ABD ligand (produced in—house). After washing with TST-buffer and 5 mM NH4Ac buffer, pH 5.5, the Z variants were eluted with 0.1 M HAc. Acetonitrile (ACN) was added to a final concentration of 10 % to the eluted fractions from the anti—ABD agarose affinity chromatography cation step and the samples were loaded on a 3 ml Resource 15RPC column (GE Healthcare), previously equilibrated with RPC solvent A (0.1 % trifluoroacetic acid (TFA), 10 % ACN, 90 % water). After column wash with RPC solvent A, bound protein was eluted with a linear gradient 0—50 % RPC solvent B (0.1 % TFA, 80 % ACN, 20 % water) during 60 ml. ons containing pure Z variant were identified by SDS~PAGE analysis and pooled. After the RPC purification, the buffer of the pools was exchanged to PBS using a HiPrep 26/10 Desalting column (GE Healthcare).

Finally, the Z variants were purified on 1 ml EndoTrap red columns (Hyglos, cat. no. 321063) to ensure low endotoxin content.

Protein concentrations, es and the identity of each purified Z t were analyzed as described in Example 3.

Biacore analysis: Expressed and purified Z variants fused to PP013— 203638 were assayed against human FcRn at pH 6.0 essentially as bed for the kinetic analysis in Example 3. The Z variants and the ve control ZO3638—PP013 were injected at 40 nM, 160 nM and 640 nM during 1 minute followed by dissociation for 2.5 minutes and equilibration for 1 minute. Kinetic constants and affinities were ined for the Z variants using the BiaEvaluation software.

Pharmacokinetic study: Z11947, Z11946 and 211948 fused to PP013— 203638 were administered intravenously (i.v.) to male NMRl mice (Charles River, Germany) at a dose of 92 g body weight. Sera from groups of three mice were obtained at 0.08, 6, 18, 78, 120, 168 and 240 hours. The concentration of respective Z variant was determined by ELISA.

ELISA: Half—area 96—well ELISA plates were coated at 4 °C overnight with 50 l of an Z specific goat antibody (produced in—house) diluted to 4 ug/ml in coating buffer (50 mM sodium carbonate, pH 9.6). The antibody on was poured off and the wells were blocked with 100 pl of PBSC for 1.5 h at RT. The sera were diluted in PBSC plus 1 % mouse serum x) from 1:100 to 1:51,200 in a two—fold dilution series in a dilutions plate. A standard titration for respective Z variant and four quality controls (very low, 1O low, medium and high control) diluted in matrix were ed on each plate. 50 pl of the ons were transferred per well and the ELISA plates were incubated for 1.5 h at RT. The plates were washed four times with PBST.

Bound Z variants were detected with 50 pl/well of rabbit anti—PP013 lg (produced in—house) diluted to 4 ug/ml in PBSC. The plates were uently incubated for 1.5 h at RT followed by washes as described above. HRP ated donkey abbit HRP obtained from Jackson laboratories (cat. no. 711—035—152), diluted 120,000 in PBSC, was added and the plates were incubated for 1 hour. After washing as described above, 50 pl of ImmunoPure TMB substrate was added to the wells and the plates were developed ing to the manufacturer’s recommendations. After 15 minutes of development, the absorbance was measured at 450 nm using a multi—well plate reader (Victor3). The absorbance values were analyzed using GraphPad Prism 5 to determine the concentrations (cubic—spline curve fit) and area under curve (AUC). The concentrations were then plotted as their natural logarithms against time. The ing curves followed a two compartment model and the terminal half—life was calculated as ln2 divided by the slope based on the last three time points.

Results Cultivation and Qurification: The three FcRn binding Z variants 211947, 211946 and 211948 (SEQ ID NO:1062, 1061 and 1060), constructed as Z#####—PP013—ZOB638, and the negative control 203638-PP013, were produced in E. coli. The amount of purified protein from approximately 3 g bacterial pellets, determined spectrophotometrically by measuring the ance at 280 nm, ranged from approximately 10 to 25 mg for the different FcRn binding Z variants. SDS—PAGE analysis of each final protein ation showed that they predominantly contained respective FcRn binding Z variant. The correct molecular weight of each FcRn binding Z t was confirmed by LC/MS analysis.

Table 6. Kinetic nts and affinities for FcRn at pH 6.0 of Z variants produced as fusions to PP013—ZOS638. z variant SEQ lD NO: kon (M‘s‘) koﬁ (3") K6 (M) Z11948 1060 773 X105 0.047 62 x168 211946 1061 3.35 x105 0.275 82 x107 211947 1062 554 x105 0.064 98 x108 Biacore analysis: The binding to FcRn was analyzed for the three PP013—203638 fused Z variants. The immobilization level of the surface was 548 RU of human FcRn. The resulting rough kinetic constants and affinities 1O for the target binding at pH 6.0 are displayed in Table 6. Fitted curves are displayed in Figure 7A—C. The negative control ZOS638—PPO13 was negative against FcRn.

Pharmacokinetic study: The pharmacokinetic es of the above— mentioned constructs of Z variants fused to PPO13-ZOS638 were compared to the negative control ZO3638—PP013 in a mouse pharmacokinetic study. In previous work, eg. as described in PCT application /O16043, it is shown that ABD fusion proteins have a long ife in serum, caused by ABD binding to serum albumin. in accordance with the previous results, terminal half—life of ABD—fused Z variant molecule (ZOB638—PPO13) was approximately 43 hours, which is comparable to half-life of mouse albumin (35 hours). The terminal half—lives of the constructs containing FcRn g Z variant molecule in addition to ABD were two— to fold longer (Figure 8). The calculated terminal half—lives were 99 hours 7), 69 hours (211946) and 58 hours (211948), suggesting that FcRn g of the Z variants contributed to the prolonged half—life.

Examgle 7 Design and construction of a maturation library of FcRn binding Z variants in this Example, a ted library was constructed. The library was used for selections of FcRn binding Z ts. Selections from maturated libraries are usually expected to result in binders with increased affinity a et al., (2006) Cancer Res 66(8):4339—48). In this study, randomized single ed linkers were generated using split—pool synthesis enabling incorporation of defined codons in desired ons in the synthesis.

Materials and methods Library design: The library was based on the sixteen sequences of the human FcRn binding Z variants in Table 1 and r described in Examples 2—6. In the new library, 13 variable positions in the Z molecule ld were biased towards certain amino acid residues, according to a strategy mainly based on the binding motifs of the Z variants defined in SEQ lD NO:707-722.

A DNA linker was generated using split—pool synthesis containing the 147 bp partially randomized helix 1 and 2 of the amino acid sequence: 5’— AA ATA AAT CTC GAG GTA GAT GCC AAA TAC GCC AAA GAA NNN NNN NNN GCG NNN NNN GAG ATC NNN NNN TTA CCT AAC TTA ACC NNN NNN CAA NNN NNN GCC TTC ATC NNN AAA TTA NNN GAT GAC CCA AGC CAG AGC TCA TTA TTT A ~3’ (SEQ ID 4; randomized codons are illustrated as NNN) flanked by restriction sites Xhol and Sacl, was ordered from DNA 2.0 (Menlo Park, CA, USA). The theoretical distributions of amino acid residues in the new library, including eight variable amino acid positions (9, 10, 11, 13, 14, 24, 32 and 35) and five constant amino acid positions (17, 18, 25, 27 and 28) in the Z molecule scaffold are given in Table 8. The resulting theoretical library size is 5.3 x 108 variants.

Table 7: Desin of libra for maturation.

Amino acid Randomization (amino acid position in the abbreviations) Z variant A,D,E,F,H,l,K,L,N,Q,R,S,T,V,W,Y 16 1/17 A D E F H I K,L,N,Q,R,S,T,V,W,Y - 1/16 A D E F G H N,Q,R,S,T,V,W,Y - 1/17 A,F H 25 % l,K,L,N,Q,R,S,T,V,W,Y - 3/52, 13/52 H 1/16 16 1/16 Libram construction: The library was amplified using AmpliTaq Gold polymerase (Applied Biosystems, cat. no. 4311816) during 12 cycles of PCR and pooled products were purified with QlAquick PCR Purification Kit N, cat. no. 28106) according to the supplier’s recommendations. The purified pool of ized library fragments was digested with restriction enzymes Xhol and Sacl—HF (New England Biolabs, cat. no. R0146L, and cat. no. R3156M) and trated using a PCR cation Kit. Subsequently, the product was subjected to preparative 2.5 % agarose (Nuisieve GTC agarose, Cambrex, lnvitrogen) gel electrophoresis and purified using QIAGEN gel extraction Kit (QlAGEN, cat. no. 28706) according to the supplier's recommendations.

The phagemid vector pAY02592 (essentially as pAffi1 described in Gronwall et al., supra) was restricted with the same enzymes, purified using phenol/chloroform tion and ethanol precipitation. The restricted fragments and the restricted vector were d in a molar ratio of 5:1 with T4 DNA ligase (Fermentas, cat. no. ) for 2 hours at RT, followed by overnight incubation at 4 °C. The ligated DNA was recovered by phenol/chloroform extraction and ethanol precipitation, followed by dissolution in 10 mM Tris—HCl, pH 8.5. Thus, the resulting library in vector pAYO2592 encoded Z ts, each fused to an albumin binding domain (ABD) derived from streptococcal protein G.

The ligation reactions (approximately 160 ng DNA/transformation) were oporated into electrocompetent E. coli ER2738 cells (50 pl, Lucigen, Middleton, Wl, USA). ately after electroporation, approximately 1 ml of recovery medium ied with the ER2738 cells) was added. The transformed cells were incubated at 37 °C for 60 min. Samples were taken for titration and for determination of the number of ormants. The cells were 1O thereafter pooled and cultivated overnight at 37 °C in 1 l of TSB—YE medium, supplemented with 2 % glucose, 10 ug/ml tetracycline and 100 pg/ml llin. The cells were pelleted for 7 min at 4,000 g and resuspended in a PBS/glycerol solution (approximately 40 % glycerol). The cells were aliquoted and stored at ~80 °C. Clones from the library of Z variants were sequenced in order to verify the content and to evaluate the outcome of the ucted library vis-a-vis the library design. Sequencing was performed as bed in Example 1 and the amino acid bution was verified.

Preparation of phage stock: Phage stock ning the phagemid library was prepared in a 20 l fermenter (Belach Bioteknik). Cells from a 2O glycerol stock containing the phagemid library were inoculated in 10 l of TSB— YE (Tryptic Soy Broth-Yeast Extract; 30 g/l TSB, 5 g/l yeast extract) supplemented with 1 g/l glucose, 100 mg/l ampicillin and 10 mg/l tetracycline.

When the cells reached an optical density at 600 nm (0D600) of 0.6, approximately 1.5 l of the cultivation was infected using a 5 x molar excess of M13K07 helper phage. The cells were incubated for 30 min, whereupon the fermenter was filled up to 10 lwith complex fermentation medium [2.5 g/l (NH4)2SO4; 5.0 g/l yeast extract; 30 g/l tryptone, 2 g/l K2HP04; 3 g/l KH2P04, 1.25 g/l; NasCeH507 ' 2 H20; Breox FMT30 antifoaming agent 0.1 ml/l]. The following components were added: 10 ml carbenicillin 25 mg/ml; 5 ml kanamycin 50 mg/ml; 1 ml 1 M isopropyl—B—D—1—thiogalactopyranoside (lPTG); 17.5 ml/l of 300 g/l M9804, and 5 ml of a trace element solution [35 g/l FeCls ' 6 H20; 10.56 g/l ZnSO4 ' 7 H20; 2.64 g/l Cu804 ° 5 H20; 13.2 g/l MnSO4 - H20; 13.84 g/l CaCl2 - 2 H20, dissolved in 1.2 M HCl]. A glucose limited fed— batch cultivation was started where a 600 g/l glucose solution was fed to the reactor (3.5 g/h in the start, 37.5 g/h after 20 h and until the end of the cultivation). pH was controlled at pH 7 through the automatic addition of 25 % NH40H, air was supplemented (5 l/min), and the stirrer was set at 500 rpm.

After 24 h of fed—batch cultivation the OD600 was 33.2. The cells in the cultivation were pelleted by centrifugation at 15,900 g. The phage particles were precipitated from the supernatant twice in PEG/NaCl, filtered and dissolved in PBS and glycerol astin Example 2. Phage stocks were stored at —80 °C until use in selection.

Results Library construction: The new library was designed based on a set of 16 FcRn binding Z variants with verified g properties (Example 2—6).

The theoretical size of the designed y was 5.3 x 108 Z variants. The actual size of the library, determined by titration after transformation to E. coli ER2738 cells, was 4.5 x 109 transformants.

The library quality was tested by sequencing of 96 transformants and by ing their actual sequences with the theoretical design. The contents of the actual library compared to the designed library were shown to be satisfying. A maturated library of potential binders to FcRn was thus successfully constructed.

Example 8 Selection and screening of Z variants from a maturated libram Materials and methods Phage display selection of matured FcRn binding Z variants: The target proteins human FcRn yt, cat. no. 88) and murine FcRn (Biorbyt, cat. no. orb99076) were biotinylated essentially as described in Example 2 using biotin at 10x molar excess. Phage display ions, using the new library of Z variant molecules described in Example 7, were performed in four cycles against human FcRn or murine FcRn essentially as in Example 2 but with the following exceptions. Selection buffers were 0.1% PCTG buffer, pH .5 (Mcllvaines phosphate—citrate buffer, pH 5.5, supplemented with 0.1 % and 0.1% n) or 0.1% PCTG buffer, pH 7.4, (Mcllvaines phosphate—citrate buffer, pH 7.4, supplemented with 0.1 % Tween-20 and 0.1% gelatin) tively. Prior to selection, HSA was added to the selection buffers to a final concentration of 1.5 pM. All tubes and beads used in the selection were pre-blocked with either of the two different selections buffers.

A pre—selection step, by incubation of phage stock with SA-beads for 45 min, was performed in cycle 1. For capture of phage—target complexes, 1 mg beads per 1.1 ug biotinylated human FcRn or 1.6 pg biotinylated murine FcRn was used. Washes were med with 0.1% PCT buffer pH 5.5 or pH 7.4 except for tracks 2—1—2—1 and 22—2 where 0.1 % PCT supplemented with 25 nM lgG (Herceptin®) or 10 nM lgG, respectively, was used as outlined in Table 7.

The five tracks (1—5) in cycle 1 were d in the second to fourth cycles, resulting in totally seven tracks (1-1 to 5—1) in cycle 2, eleven tracks (1-1—1 to 5—1—1) in cycle 3 and fourteen tracks (1—1—1—1 to 5—1-1—1) in cycle 4. 1 O The bound phage particles were eluted as described in Example 2.

An overview of the selection strategy, describing an increased stringency in subsequent cycles, using a lowered target concentration and an increased number of , is shown in Table 8. 1 5 Table 8. Overview of the maturation selection data.

Cycle Selection Phage stock Target Target Selection Wash Number from library or selection track human murine human human 2 murine Cycle Selection Phage stock from library or selection track Amplification of phage particles: Amplification of phage les between selection cycle 1 and 2 was performed essentially as described in Example 2, with the following exceptions. E. coli ER2738 was used for phage amplification and M13KO7 helper phage was used in 5 x excess. The amplification of phage particles between the selection cycles 2 and 4 was done by performing infection of ia in solution as follows. After infection of log phase E. coli ER2738 with phage particles, TSB supplemented with 2 % e, 10 pg/ml tetracycline and 100 ug/ml ampicillin was added, ed by incubation with rotation for 30 min at 37 °C. Thereafter, the bacteria were infected with M13K07 helper phage in 5 x excess. The infected bacteria were pelleted by centrifugation, re—suspended in TSB-YE medium supplemented with 100 uM lPTG, 25 ug/ml kanamycin and 100 ug/ml ampicillin, and grown overnight at 30 °C. The overnight cultures were pelleted in a centrifuge, and phage particles in the supernatant were precipitated twice with PEG/NaCl buffer. Finally, the phage particles were pended in selection buffer before entering the next selection cycle.

In the final selection cycle, log phase bacteria were ed with eluate and diluted before spreading onto TBAB plates (30 g/l tryptose blood agar base, Oxoid cat. no. CMOZBSB) supplemented with 0.2 g/I ampicillin in order to form single colonies to be used in ELISA screening.

Sequencing of potential binders: Individual clones from the different selection tracks were picked for sequencing. All clones run in the ELISA screening were sequenced. Amplification of gene fragments and sequence is of gene fragments were performed essentially as bed in Example 2.

ELISA screening of Z variants: Single colonies containing Z variants ssed as Z t ABD fusion proteins as described in Example 2) were randomly picked from the selected clones of the FcRn maturated library and grown in 1 ml cultivations essentially as described in Example 2. ation of the periplasmic supernatants was med as in Example 2 with eight freeze thawing cycles and the periplasmic fractions were used undiluted in the ELISA screening. ELISA screenings were performed at both pH 6.0 and pH 7.4 essentially as described in Example 2 using biotinylated human FcRn at a concentration of 2 nM in each well. The periplasmic fraction of the primary FcRn binder 210193 (SEQ ID N01708; assayed in above ments) was used as a positive control. Periplasm containing the ABD moiety only was used as a negative control.

ELISA KD analysis of FcRn binding Z variants: A selection of FcRn s was subjected to an analysis of the response against a dilution series of biotinylated human FcRn using ELISA at both pH 6.0 and pH 7.4 as described above. Biotinylated human FcRn was added at a tration of nM and diluted stepwise 1:3 down to 14 pM. As a background control, all Z variants were also d with no target protein added. Periplasm samples containing the primary FcRn binder 207918 (SEQ :707) was included and analyzed as a positive control. Periplasm containing the ABD moiety only was used as a negative control. Data were analyzed using GraphPad Prism 5 and non—linear regression and KD values (the half maximal effective concentration) were calculated.

Results Phage display selection of maturated FcRn binding Z variants: ion was performed in totally 14 parallel tracks containing four cycles each. The different selection tracks differed in target concentration, target type (human FcRn or murine FcRn), selection time, and wash conditions.

Seguencing of potential binders: Randomly picked clones were sequenced. Each individual Z variant was given an identification number, Z#####, as described in Example 2. In total, 445 new unique Z variant les were identified.

The amino acid sequences of the 58 amino acid residues long Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:723— 1058. The deduced FcRn binding motifs of these Z variants are listed in Figure 1 and in the sequence listing as SEQ ID NO:17-352. The amino acid sequences of the 49 amino acid residues long ptides predicted to 1O constitute the te helix bundle within each of these Z variants are listed in Figure 1 and in the ce listing as SEQ ID NO:370-705.

ELISA screening of Z variants: Clones obtained after four selection cycles were produced in 96-well plates and screened for FcRn binding activity using ELISA. All randomly picked clones were analyzed. At pH 6.0, 333 of the 445 unique Z variants were found to give a response of 0.3 AU or higher (corresponding to at least 3x the negative control) t human FcRn at a concentration of 2 nM. At pH 7.4, 278 of the 445 unique Z variants were found to give a response of 0.3 AU or higher (corresponding to at least 3x the ve control) against human FcRn at a concentration of 2 nM. Clones with a positive signal against human FcRn were found in all tracks (including those with murine target) except 1—1—1—1. The negative controls had absorbances of 0.070—0.096 AU (pH 6.0) and 0060—01 12 AU (pH 7.4), tively. The average response of the blank controls was 0.070 AU (pH 6.0) and 0.062 (pH 7.4).

ELISA KD analysis of FcRn binding Z ts: A subset of Z variants was selected based on the result in the ELISA experiment described above (highest ELISA value at pH 6.0 and/or pH 7.4) and subjected to a target titration in ELISA format. Periplasm samples were incubated with a serial dilution of biotinylated human FcRn. A periplasm sample with the primary binder 207918 (SEQ ID NO:707) was also assayed as a ve control.

Obtained values were analyzed and their respective KD values were calculated (Table 9).

Table 9: Calculated KD values from ELISA titration anaiysis of Z—ABD variants from the maturation.

K0 K9 K9 K0 2 2 pH 6.0 pH 7.4 pH 6.0 pH 7.4 t variant M M M M 820 2.2x109 K0 Ko K9 K0 Z 2 pH 6.0 pH 7.4 pH 6.0 pH 7.4 t variant M M M M 784 846 Example 9 Production and terization of Z variants from a maturated y in this Example, twelve Z variants were produced in E. coli, purified and assayed for binding to FcRn as well as for inhibition of lgG binding to FcRn.

Materials and methods ning of Z ts into expression vectors: The DNA of twelve 1O FcRn binding Z variants (213577 (SEQ ID NO:725), 213578 (SEQ lD ), 213583 (SEQ ID NO:729), 213592 (SEQ ID NO:734), 213616 (SEQ ID NO:747), 213621 (SEQ ID NO:750), 213654 (SEQ ID NO:771), 213663 (SEQ lD NO:776), 213669 (SEQ ID NO:779), 213674 (SEQ ID ), 213675 (SEQ ID NO:782) and 213676 (SEQ ID )) were amplified from the library vector pAY02592. The subcloning was performed as described in Example 3. The 2 gene fragments were subcloned into the expression vector pAYO1448 resulting in the encoded sequence MGSSHHHHHHLQ—[Z#####]— Production of Z variants: Cultivation and purification of the Hi35—tagged Z variants was performed essentially as described in Example 3.

Biacore binding and kinetic analyses: The interaction of FcRn binding HiSG—tagged Z variants with human FcRn was analyzed in a Biacore 2000 instrument essentially as described in Example 3. Human FcRn purchased from Biorbyt (cat. no. orb84388) was used as target protein. The analytes were injected during 2 minutes at 30 pl/min. The dissociation phase was 4 minutes and the bration time between the analyte injections was 30 In one experiment, the 2 variants were injected at pH 6.0 followed by dissociation in buffers of pH 6.0 or pH 7.4, respectively, using the ect procedure. The concentration of the 2 variants was 100 nM. in another experiment, approximate kinetic constants (km and koff) and affinities (Ko) were determined for a subset of Z variants. Injected trations were 540 nM, 180 nM, 60 nM, 20 nM and 6.7 nM.

AlphaLlSA blocking assay: The potential of 2 variants to inhibit binding of lgG to FcRn was analyzed in the AlphaLlSA assay described in Example 3.

Results Production of Z variants: The twelve FcRn binding Z ts constructed with an N-terminai HiS6 tag were produced in E. coli. SDS—PAGE analysis of each final protein preparation showed that these predominantiy contained the FcRn binding Z variant. The correct identity and molecular weight of each FcRn binding Z variant was confirmed by HPLC—MS analysis.

Biacore binding and kinetic analyses: The binding of the twelve Z variants to human FcRn and the dissociation at different pH were tested in a Biacore instrument by sequentially injecting each of the Z variants at pH 6.0 and either buffer pH 6.0 or pH 7.4 over a chip e ning FcRn. The ligand lization level of the surface was 890 RU human FcRn. The twelve Z variants showed binding to FcRn at pH 6.0, and for all variants, faster off—rates were seen at pH 7.4 compared to pH 6.0.

The kinetic constants of the Z ts Z1357? (SEQ iD N02725) and Z13621 (SEQ ID ) interacting with FcRn at pH 6.0 were determined (see Table 10). Kinetic constants were calculated using curve sets of two or four injected concentrations of Z1357? and 213621, respectively.

Table 10. Biacore kinetic constants and affinities for FcRn binding at pH 6.0.

Z variant SEQ ID NO: kon (M434) koff(S'1) Kn (M) 213577 725 3.0 X 105 4.0 X 10’3 13 X 10'9 213621 750 6.4 X 105 3.7 X 10'3 6 X 10'9 AlphaLiSA blocking analysis: The ability of twelve maturated Hiss— tagged monomeric Z variants to inhibit lgG binding to FcRn was tested in an AlphaLiSA blocking assay. Serial dilutions of the Z ts were incubated with biotinylated human FcRn and the blocking y of each respective variant was measured after addition of igG coated Acceptor beads and subsequently streptavidin coated Donor beads. inhibition could be measured as a decrease in AlphaLiSA counts for positive Z variants. All twelve tested Z ts were shown to block 196 binding to FcRn and the calculated IC50 values are shown in Table 11.

Table 11: Calculated lC50 values from Al haLlSA blockino assa . lC50 725 _1.2 x 10'8 726 -1.2x 10'8 729 -2.7 X 10'9 213654 771 -3.5 X 10'9 776 —1.1 x10'8 779 _5.2 x109 781 _2.5 x109 782 _8.2 x109 783 _3.9 x109 Example 10 ison of blocking capacity of lgG binding to FcRn In this e, the lgG blocking capacity of the FcRn g Z variant Hi36-ZO7918 (SEQ ID NO:707) was compared to Intravenous immunoglobulin (Mg) and Subcutaneous immunoglobulin (SClg) currently 1O used in the treatment of some autoimmune disorders.

Materials and methods Blocking of lgG-FcRn immunofluorescence staining: Human or murine FcRn-eGFP transduced HeLa cells were prepared as described in Example 4. Fixed cells were resuspended in 50 pl of a mix of 50 nM Alexa647— conjugated human lgG (Jackson tories, cat. no. 009-600—003) and HlSB- tagged 207918, lVlg (Octagam®, Octapharma) or SClg (Gammanorm®, Octapharma), respectively, d at concentrations of 1000, 100, 10, 1, 0.1 or 0 (buffer control) nM in Mcllvanes, pH 6.0, plus 2.5 % FCS (Ultra low lgG, Life technologies) and 0.1 % saponin (AppliChem). The cells were incubated for 1 h at 37 °C in the dark, washed with 2 x 100 pl Mcllvanes, pH 6.0, plus 2.5 % FCS (Ultra low lgG) pH 6.0 and re—suspended in 180 pl of Mcllvanes, pH 6.0, plus 1 % BSA. Data from 10,000 GFP/FcRn positive cells were obtained using a FACS Calibur (Beckman Coulter) and the data was analyzed using Flowing software 2.5.0 (Turku University).

Results The experiment was performed to ine if the FcRn binding Z variant O7918 (SEQ ID NO:707) blocks the lgG-FcRn interaction and compare the ng effect to Mg and SClg . Human or murine FcRn—eGFP transduced HeLa cells were ted with human Alexa647—conjugated lgG. 1O The binding was blocked with unlabeled Hise—ZO7918, IVIg or SClg at different concentrations. The results showed that HISe-ZO7918 effectively blocked hlgG binding to hFcRn to a similar extent as IVlg or SClg (Figure 9).

Example 11 Increased lgG catabolism by FcRn binding Z variants in mice The ability of the FcRn binding Z variant 207918 to block lgG g to FcRn in vitro was shown in Example 10. In this example, the blocking ability of the same Z t was evaluated in vivo. ng of lgG—FcRn interactions in vivo will lead to increased [96 catabolism and concomitant reduced levels of lgG (Mezo 2008, supra).

Materials and methods Animal study: The FcRn—binding Z variants 211948 (SEQ ID NO:1060) and ZO7918-PP013 (Z07918 (SEQ ID NO:707) identical to 211948 but with the N—terminus starting with the amino acids VD instead of AE, in fusion with the ABD variant PP013 (SEQ ID NO:1063)) or vehicle (PBS buffer), were administered to male NMRI (Charles River), at a dose of 16.3 pmol/kg. The 3O mice were treated with five intravenous ions given at 0, 24, 48, 72 and 96 h. Serum samples were taken at 0, 72, 120 and 168 h (termination of study) and stored at —20 °C. The concentration of mouse IgG in serum was quantified by ELISA.

Mouse lgG ELISA: The concentration of mouse lgG in mouse serum samples was analyzed by a mouse lgG ELISA kit ch 3825—1AD—6) and performed as described by the manufacturer. The concentration of mlgG was calculated from a standard curve ed and GraphPad prism5 using a non— linear regression formula. The concentration of lgG in dual mice at 24, 72, 120 and 168 h were related to the level at 0 h and the results are therefore presented as tage of lgG (O h).

Results The results showed a reduction of mouse lgG concentration in mice treated with FcRn-specific Z variants. Both 211948 and the ABD—fused variant ZO7918—PP013 lowered the concentration of endogenous lgG in mice in vivo.

Most pronounced effects were obtained with the ABD—fused variant and after 1O 120 hours. Thus, the results indicates that the pecific Z variants blocked recycling of lgG ing in increased lgG catabolism and subsequent lower levels of lgG in mice.

Exam le 12 In vitro transcytosis of FcRn binding Z variants in this example, the FcRn binding Z variants are tested for their ability to be transported through epithelial or elial cells or recycled by FcRn in vitro. A drug containing a Z variant with the power of transcytosis will facilitate drug uptake after for e oral or pulmonary administration.

Materials and methods Cells, for example T84, MDCK, HeLa, CaCo2, CaLu-1 and/or CaLu—3 cells, with or without endogenous or recombinant expression of FcRn, are grown in respective growth medium on a membrane in a transwell to form a monolayer. The integrity of yers can be ted by measuring the electrical resistance or adding a probe that is not able to penetrate or being actively transported over the cell monolayer. A defined monolayer of cells is pulsed from the apical or basolateral side with ligand such as FcRn binding Z variants, HSA or lgG in a buffer such as HBSS (Hanks’ Balanced Salt Solution, SigmaAldrich, cat. no. H9269) or growth medium at a suitable pH and temperature, and chased with s such as HBSS or growth medium at a suitable pH and temperature on the opposite side.

In a variant of this assay, s can be chased with buffers such as HBSS or growth medium at suitable pH and temperature on the same side as administration to measure recycled ligand as well. This can be done in a transwell or in a cell culture dish. Cells are seeded into transwell or cell culture dishes and pulsed with ligands such as FcRn binding Z variants, HSA or lgG. Endocytosed s will bind to FcRn and return to the cell surface at the same or te side as they were loaded. After pulsing, free ligands are removed by washing the cells with cold buffer. To chase ligands, warm buffer or medium is added to the cells and, after a period in the range from 10 minutes to several hours, the buffer or medium is removed and assayed for the presence of ligands. ln a variant of this assay, ligands such as FcRn binding Z variants, HSA or lgG can be used to block the binding to FcRn by s such as other FcRn binding Z variants, HSA or lgG by administering them at the same time or sequentially to the cells.

The amount of ligand can be quantified by methods such as ELISA, HPLC—MS, fluorescent dye or radio labeling.

The results of the experiment described above are expected to show that the FcRn—specific Z variants can be transcytosed and/or ed in vitro.

ITEMlZED LISTING OF EMBODIMENTS 1. FcRn binding polypeptide, comprising an FcRn binding motif BM, which motif consists of the amino acid sequence EX2 X3 X4 AXs X7 EIR WLPNLX16X17 X18 QR X21 AFIX25 X26LX28 X29 n, independently from each other, X2 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, G, H, l, K, L, M, N, Q, R, S, T, V, Wand X4 is selected from A, D, E, F, G, H, I, K, L, N, Q, R, S, T, V, W and Y; X6 is ed from A, E, F, G, H, l, K, Q, R, S and V; X7 is selected from A, F, H, K, N, Q, R, S and V; X15 is selected from N and T; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, E, G, H, l, K, L, N, Q, R, S, T, V, W and Y; X26 is selected from K and S; X28 is selected from A, D, E, F, H, i, K, L, N, Q, R, S, T, V, W and Y; X29 is ed from D and R. 2. FcRn binding polypeptide according to item 1, wherein, independently from each other, X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, H, l, K, L, M, N, Q, R, S, T, V, W and Y; X4 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X8 is selected from A, E, F, G, H, l, K, Q, R and S; X7 is selected from A, F, H, K, N, Q, R, S and V; X16 is selected from N and T; X17 is selected from F and Y; X18 is D; X21 is V; X25 is selected from D, E, H, l, K, L, N, Q, R, S, T, V, W and Y; X26 is selected from K and S; X28 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V and W; and X29 is selected from D and R. 3. FcRn binding polypeptide according to item 1, wherein the BM consists of an amino acid ce selected from i) EX2 X3 X4 AX5 HElR WLPNLTX17 X18 QR X21 AF|X25 KLX28 D wherein, ndently from each other, X2 is selected from A, D, E, F, H, l, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y; X4 is selected from A, D, E, F, G, l, K, L, N, Q, R, S, T, V and Y; X6 is selected from A, G, K, R, S and V; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, G, H, K, L, N, R, V and W; X28 is ed from A, D, E, H, K, L, N, Q, R, S, T, W and Y; ii) an amino acid sequence which has at least 96 % identity to a sequence d by i). 4. FcRn binding polypeptide ing to any preceding item, wherein X2 is selected from A, D, E, F, l, L, N, Q, R, S, T, V, W and Y.

. FcRn binding polypeptide according to item 4, wherein X2 is selected from A, D, F, l, L, N, Q, R, S, T, V, W and Y. 6. FcRn binding polypeptide according to item 5, wherein X2 is selected from A, D, F, l, L, N, Q, R, S, V and W. 7. FcRn binding polypeptide according to item 5, wherein X2 is selected from A, l, L, N, Q, R, S, T, V, W and Y. 8. FcRn binding polypeptide according to item 7, wherein X2 is selected from A, l, L, N, Q, S, T, Vand W. 9. FcRn binding polypeptide according to item 6 or 8, wherein X2 is selected from A, l, L, N, Q, V and W.

. FcRn binding polypeptide according to item 9, wherein X2 is selected from A, l, L, Q, V and W. 11. FcRn binding polypeptide according to item 10, wherein X2 is selected from A, l, L and Q. 12. FcRn binding polypeptide according to item 11, wherein X2 is selected from i, L and Q. 13. FcRn binding ptide according to item 12, wherein X2 is selected from i and Q. 14. FcRn binding polypeptide according to item 13, wherein X2 is I.

. FcRn binding polypeptide according to item 13, n X2 is Q. 16. FcRn g polypeptide according to any one of items 1 and 3—15, wherein X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y. 17. FcRn binding polypeptide according to item 2 or 16, n X3 is 1O selected from A, D, E, H, K, L, M, N, Q, R, S, T, V and Y. 18. FcRn binding polypeptide according to item 16, wherein X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S and T. 19. FcRn binding polypeptide according to item 18, wherein X3 is selected from A, D, E, G, H, K, M, N, Q, S and T.

. FcRn binding polypeptide according to item 19, wherein X3 is selected from A, D, E, G, H, M, N, Q, S and T. 21. FcRn binding polypeptide according to item 19, wherein X3 is ed from A, D, E, K, N, Q, S and T. 22. FcRn binding polypeptide according to item 21, wherein X3 is selected from A, D, E, K, Q and T. 23. FcRn binding polypeptide according to item 22, wherein X3 is selected from A, D, E, Q and T. 24. FcRn binding polypeptide according to item 23, wherein X3 is selected from D, E and T.

. FcRn binding ptide according to item 24, wherein X3 is selected from D and E. 26. FcRn g polypeptide according to item 25, wherein X3 is D. 27. FcRn binding polypeptide according to item 25, n X3 is E. 28. FcRn binding polypeptide according to any one of items 1 and 3-27, wherein X4 is selected from A, D, E, F, G, l, K, L, N, Q, R, S, T, V and Y. 29. FcRn binding polypeptide ing to item 28, wherein X4 is selected from A, D, E, G, N, Q, R, S, T and V.

. FcRn binding polypeptide according to item 2 or 28, wherein X4 is 1O selected from A, D, E, F, l, K, L, N, Q, R, S, T and V. 31. FcRn binding polypeptide ing to item 30, wherein X4 is selected from A, D, E, l, K, N, Q, R, S and T. 32. FcRn g polypeptide according to item 31, wherein X4 is selected from A, D, E, l, K, Q, S and T. 33. FcRn binding polypeptide according to item 32, n X4 is selected from A, D, l, K, Q and S. 34. FcRn binding polypeptide according to item 32, wherein X4 is selected from A, D, E, K and S.

. FcRn binding polypeptide according to item 33 or 34, wherein X4 is selected from A, D, K and S. 36. FcRn binding polypeptide according to item 34, wherein X4 is selected from A, D, E and K. 37. FcRn binding polypeptide according to item 35 or 36, n X4 is selected from A, D and K. 38. FcRn binding polypeptide according to item 37, wherein X4 is selected from A and D. 39. FcRn binding polypeptide according to item 36, wherein X4 is selected from A and E. 40. FcRn g polypeptide according to item 38 or 39, wherein X4 is A. 41. FcRn binding polypeptide according to item 38, wherein X4 is D. 42. FcRn binding polypeptide according to item 39, wherein X4 is E. 43. FcRn binding polypeptide according to any one of items 1 and 442, wherein X5 is selected from A, G, K, O, R, S and V. 44. FcRn binding polypeptide according to item 3 or 43, wherein X6 is ed from A, G, K, R, S and V. 45. FcRn binding polypeptide according to item 2 or 44, wherein X5 is selected from A, G, K, R and S. 46. FcRn binding polypeptide according to item 44, wherein X6 is ed from A, G, K, S and V. 47. FcRn binding polypeptide according to item 46, wherein X5 is selected from A, G, K and V. 48. FcRn binding polypeptide according to item 45 or 46, wherein X6 is selected from A, G, K and S. 49. FcRn binding ptide according to item 47 or 48, wherein X6 is selected from A, G and K. 50. FcRn binding polypeptide according to item 47, wherein X5 is ed 3O from A, G and V. 51. FcRn binding polypeptide according to item 49 or 50, wherein X6 is selected from A and G. 52. FcRn binding polypeptide according to item 51, wherein X6 is A. 53. FcRn g polypeptide according to item 51, wherein X6 is G. 54. FcRn binding polypeptide according to any one of items 1, 2 and 4—53, wherein X7 is selected from A and H. 55. FcRn binding polypeptide according to item 54, wherein X7 is H. 56. FcRn binding ptide according to any one of items 1, 2 and 4—55, wherein X15 is T. 1O 57. FcRn binding polypeptide according to any one of items 1, 2 and 4—55, wherein X16 is N. 58. FcRn binding polypeptide ing to any one of items 1 and 3-57, wherein X17 is selected from F and Y. 59. FcRn binding polypeptide according to any preceding item, wherein X17 is 60. FcRn binding polypeptide according to any one of items 1 and 3—59, wherein X18 is selected from A, D and E. 61. FcRn binding polypeptide according to item 60, wherein X18 is selected from A and D. 62. FcRn binding polypeptide according to item 61, n X18 is D. 63. FcRn binding polypeptide ing to any one of items 1 and 3—62, wherein X21 is selected from V and W. 64. FcRn binding polypeptide according to item 63, wherein X21 is V. 65. FcRn binding polypeptide according to any one of items 1 and 4—64, n X25 is selected from D, E, G, H, K, L, N, Q, R, V and W. 66. FcRn g polypeptide according to item 65, wherein X25 is selected from D, G, H, K, L, N, R, V and W. 67. FcRn g polypeptide according to any one of items 2, 3 and 66, wherein X25 is selected from H, L, R, V and W. 68. FcRn binding polypeptide according to item 67, wherein X25 is selected from H, R, V and W. 69. FcRn binding polypeptide according to item 68, wherein X25 is selected from H, R and V. 70. FcRn binding polypeptide according to item 67, wherein X25 is ed from H, L and R. 71. FcRn binding ptide according to item 69 or 70, wherein X25 is selected from H and R. 72. FcRn g polypeptide according to item 69, wherein X25 is ed from H and V. 73. FcRn binding polypeptide according to item 71 or 72, wherein X25 is H. 74. FcRn binding polypeptide according to any one of items 1, 2 and 4—73, wherein X25 is K. 75. FcRn binding polypeptide according to any one of items 1, 2 and 4—73, wherein X25 is S. 76. FcRn binding polypeptide according to any one of items 1 and 3-75, wherein X28 is selected from A, D, E, H, K, L, N, Q, R, S, T, W and Y. 77. FcRn binding polypeptide according to item 76, wherein X23 is selected from A, D, E, K, L, N, Q, R, S, T, W and Y. 78. FcRn binding polypeptide according to item 77, wherein X28 is selected from A, D, E, L, R, S, T, W and Y. 79. FcRn g polypeptide according to item 2 or 77, wherein X28 is selected from A, D, K, L, N, Q, R, S, T and W. 80. FcRn binding polypeptide according to item 78 or 79, wherein X28 is selected from A, D and R. 81. FcRn binding polypeptide ing to item 80, wherein X28 is ed from A and R. 82. FcRn binding polypeptide according to item 80, wherein X28 is selected from D and R. 83. FcRn binding polypeptide according to item 81, wherein X28 is A. 84. FcRn binding polypeptide according to item 81 or 82, wherein X28 is R. 85. FcRn binding polypeptide according to item 82, wherein X28 is D. 86. FcRn binding ptide according to any one of items 1, 2 and 4-85, n X29 is D. 87. FcRn binding polypeptide according to any one of items 1, 2 and 4-85, wherein X29 is R. 88. FcRn binding polypeptide according to any one of items 1, 2 and 4-87, wherein X6X7 is selected from AH and GH. 89. FcRn binding polypeptide according to item 88, wherein X6X7 is AH. 90. FcRn binding polypeptide according to item 88, wherein X6X7 is GH. 3O 91. FcRn binding polypeptide according to any preceding item, wherein X17X18 is selected from FD and YD. 92. FcRn binding polypeptide according to item 91, n X17X18 is FD. 93. FcRn g polypeptide according to any preceding item, wherein the sequence fulfills at least three of the six conditions l—Vl: I. X6 is ed from A, G, K and S, such as in particular A; II. X7 is H; III. X17 is selected from F and Y, such as in particular F; IV. X18 is D; V. X21 is selected from V and W, such as in particular V; VI. X25 is selected from H and R, such as in particular H. 94. FcRn binding polypeptide according to item 93, wherein the sequence fulfills at least four of the six conditions l-VI. 95. FcRn binding polypeptide according to item 94, n the sequence fulfills at least five of the six conditions I—Vl. 96. FcRn binding ptide according to item 95, wherein the sequence fulfills all of the six conditions |~Vl. 97. FcRn binding polypeptide according to any preceding item, wherein the sequence is selected from the group consisting of SEQ ID NO:1—353. 98. FcRn binding polypeptide according to item 97, wherein the sequence is selected from the group consisting of SEQ ID NO:1—15, SEQ ID 14O and SEQ ID N02353. 99. FcRn binding polypeptide according to item 98, wherein the sequence is ed from the group consisting of SEQ ID Nng1—2 and SEQ ID NO:17— 140. 100. FcRn binding polypeptide according to item 99, wherein the sequence is selected from the group consisting of SEQ ID NO:1—2, SEQ ID NO:17—92, SEQ ID NO:94—103, SEQ ID NO:105-125 and SEQ ID NO:127-140. 101. FcRn binding polypeptide according to item 98, wherein the sequence is ed from the group consisting of SEQ ID NO:1—8, SEQ ID NO:13, SEQ ID NO:19-20, SEQ ID N023, SEQ ID N028, SEQ ID NO:41, SEQ ID NO:44, SEQ ID NO:65, SEQ ID NO:70, SEQ ID NO:73, SEQ ID NO:75-77 and SEQ ID NO:353. 102. FcRn binding polypeptide according to item 100 or 101, wherein the sequence is ed from the group consisting of SEQ ID N021, SEQ ID NO:23, SEQ ID N0228, SEQ ID NO:41, SEQ ID N0:44, SEQ ID N0:65, SEQ ID N0273 and SEQ ID NO:75-77. 103. FcRn binding polypeptide according to item 102, wherein the sequence is selected from the group consisting of SEQ ID N0:1, SEQ ID NO:23, SEQ ID N0z44, SEQ ID N0165, SEQ ID NO:75 and SEQ ID NO:77. 104. FcRn binding polypeptide according to item 103, wherein the sequence is selected from the group consisting of SEQ ID N021, SEQ ID N023 and SEQ ID NO:75. 105. FcRn binding polypeptide according to item 104, wherein the sequence is SEQ ID N021. 106. FcRn binding polypeptide according to any preceding item, wherein said FcRn g motif forms part of a three—helix bundle protein domain. 107. FcRn binding polypeptide according to item 106, n said FcRn binding motif essentially forms part of two helices with an interconnecting loop, within said three-helix bundle protein domain. 108. FcRn binding polypeptide according to item 107, wherein said three—helix bundle protein domain is selected from ial receptor domains. 109. FcRn binding polypeptide ing to item 108, wherein said three—helix bundle protein domain is selected from domains of protein A from Staphylococcus aureus or derivatives thereof. 110. FcRn binding polypeptide ing to any preceding item, which comprises an amino acid sequence ed from: iii) —DPSQS xaxbLLxc EAKKL xdxexfo; wherein [BM] is an FcRn binding motif as defined herein, provided that X29 is D; Xa is selected from A and S; Xb is selected from N and E; Xc is selected from A, S and C; Xd is selected from E, N and S; Xe is selected from D, E and S; Xf is ed from A and S; iv) an amino acid sequence which has at least 93 % identity to a sequence defined by iii). 111. FcRn binding polypeptide according to any one of items 1—109, which ses an amino acid sequence selected from v) K—[BMJ—QPEQS XaXbLLXc EAKKL XdXeXfQ; [BM] is an FcRn binding motif as defined herein, provided that X29 is R; Xa is selected from A and S; Xb is selected from N and E; Xc is selected from A, S and C; Xd is selected from E, N and S; Xe is selected from D, E and S; Xr is selected from A and S; vi) an amino acid sequence which has at least 93 % identity to a ce defined by v). 112. FcRn binding polypeptide according to item 110 or 111, wherein Xa in sequence iii) or v) is A. 113. FcRn binding polypeptide according to item 110 or 111, wherein Xa in sequence iii) or v) is S. 114. FcRn g polypeptide according to any one of items 3, wherein Xb in sequence iii) or v) is N. 115. FcRn binding polypeptide according to any one of items 110—113, wherein Xb in sequence iii) or v) is E. 116. FcRn binding polypeptide according to any one of items 110-115, wherein Xc in sequence iii) or v) is A. 1O 117. FcRn binding polypeptide according to any one of items 110—115, wherein X0 in sequence iii) or v) is S. 118. FcRn binding polypeptide according to any one of items 110-115, wherein Xc in sequence iii) or v) is C. 119. FcRn binding polypeptide according to any one of items 110—118, wherein Xd in sequence iii) or v) is E. 120. FcRn binding polypeptide according to any one of items 8, wherein Xd in sequence iii) or v) is N. 121. FcRn binding polypeptide according to any one of items 110-118, n Xd in sequence iii) or v) is S. 122. FcRn binding ptide according to any one of items 110—121, wherein Xe in sequence ill) or v) is D. 123. FcRn g polypeptide according to any one of items 110-121, wherein Xe in sequence iii) or v) is E. 124. FcRn binding polypeptide according to any one of items 110-121, wherein Xe in sequence iii) or v) is S. 125. FcRn binding polypeptide according to any one of items 110-119, 121, 123 and 124, n XdXe in sequence iii) or v) is ed from EE, ES, SE and SS. 126. FcRn binding polypeptide according to item 125, wherein XdXe in sequence ill) or v) is ES. 127. FcRn binding polypeptide according to item 125, wherein XdXe in 1O sequence iii) or v) is SE. 128. FcRn binding polypeptide according to any one of items 110—127, n Xr in sequence iii) or v) is A. 129. FcRn binding polypeptide according to any one of items 7, wherein Xf in sequence iii) or v) is S. 130. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; X0 is A and Xf is A. 131. FcRn g polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; Xc is C and Xr is A. 132. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), X3 is S; Xb is E; Xc is S and Xf is S. 133. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; Xc is C and Xf is S. 134. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; Xc is A; XdXe is ND and Xr is A. 135. FcRn binding polypeptide according to item 110 or 111, wherein in sequence ill) or v), Xa is A; Xb is N; Xc is C; XdXe is ND and Xf is A. 136. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; Xc is S; XdXe is ND and Xf is S. 137. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; Xc is C; XdXe is ND and Xf is S. 138. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; Xc is A; XdXe is SE and Xr is A. 139. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; Xc is C; XdXe is SE and Xf is A. 140. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; X0 is S; XdXe is SE and Xf is S. 141. FcRn binding polypeptide according to item 110 or 111, wherein in ce iii) or v), X3 is S; Xb is E; Xc is C; XdXe is SE and Xf is S. 142. FcRn g polypeptide according to item 110 or 111, wherein in ce iii) or v), Xa is A; Xb is N; Xc is A; XdXe is ES and Xr is A. 143. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is A; Xb is N; X0 is C; XdXe is ES and Xf is A. 144. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; Xc is S; XdXe is ES and Xf is S. 145. FcRn binding polypeptide according to item 110 or 111, wherein in sequence iii) or v), Xa is S; Xb is E; Xc is C; XdXe is ES and Xf is S 146. FcRn binding polypeptide ing to any one of items 110 and 112- 145, wherein ce iii) is selected from the group consisting of SEQ ID NO:354-706. 147. FcRn binding polypeptide according to item 146, wherein sequence iii) is selected from the group ting of SEQ ID NO:354~368, SEQ ID N02370- 493 and SEQ ID NO:706. 148. FcRn binding polypeptide according to item 147, wherein sequence iii) is selected from the group consisting of SEQ ID N02354—355 and SEQ ID NO:370-493. 149. FcRn g polypeptide according to item 148, wherein sequence iii) is 1O selected from the group consisting of SEQ ID NO:354—355, SEQ ID NO:370- 445, SEQ ID NO:447-456, SEQ ID NO:458—478 and SEQ ID NO:480-493. 150. FcRn g polypeptide according to item 147, n sequence iii) is selected from the group consisting of SEQ ID -361, SEQ ID N01366, SEQ ID NO:372—373, SEQ ID NO:376, SEQ ID NO:381, SEQ ID NO:394, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:423, SEQ ID NO:426, SEQ ID NO:428—430 and SEQ ID NO:706. 151. FcRn binding polypeptide ing to item 149 or 150, wherein ce iii) is selected from the group consisting of SEQ ID NO:354, SEQ ID NO:376, SEQ ID NO:381, SEQ ID N02394, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:426 and SEQ ID —430. 152. FcRn binding polypeptide according to item 151, wherein sequence iii) is selected from the group consisting of SEQ ID , SEQ ID NO:376, SEQ ID N02397, SEQ ID NO:418, SEQ ID NO:428 and SEQ ID NO:430. 153. FcRn binding polypeptide according to item 152, wherein sequence iii) is selected from the group consisting of SEQ ID NO:354, SEQ ID N02376 and SEQ ID NO:428. 154. FcRn binding polypeptide according to item 153, wherein sequence iii) is SEQ ID NO:354. 155. FcRn binding polypeptide according to any one of items 1—109, which comprises an amino acid sequence selected from: vii) YAK—[BAﬂ-DPSQS SELLXc EAKKL NDSQA P; wherein [BM] is an FcRn binding motif as defined in any one of items 1-105 and Xc is selected from A, S and C; and viii) an amino acid sequence which has at least 94 % identity to a sequence d by vii). 156. FcRn binding polypeptide according to any one of items 1—109, which comprises an amino acid ce selected from: ix) FNK-[BW—DPSQS ANLLXc EAKKL NDAQA P; wherein [BM] is an FcRn binding motif as defined in any one of items 1—105 and X0 is selected from A and C; and x) an amino acid sequence which has at least 94 % identity to a sequence defined by ix). 157. FcRn binding ptide according to item 109, which comprises an amino acid sequence selected from: ADNNFNK—[BMl—DPSQSANLLSEAKKLNESQAPK; ADNKFNK-[BM]~DPSQSANLLAEAKKLNDAQAPK; ADNKFNK—[BM]~DPSVSKElLAEAKKLNDAQAPK; ADAQQNNFNK—[BAﬂ—DPSQSTNVLGEAKKLNESQAPK; AQHDE-[BW—DPSQSANVLGEAQKLNDSQAPK; VDNKFNK—[BW—DPSQSANLLAEAKKLNDAQAPK; AEAKYAK—[BAﬂ—DPSESSELLSEAKKLNKSQAPK; VDAKYAK—[BM-DPSQSSELLAEAKKLNDAQAPK; VDAKYAK-[BM-DPSQSSELLAEAKKLNDSQAPK; AEAKYAK—[BM-DPSQSSELLSEAKKLNDSQAPK; AEAKYAK-[BM-DPSQSSELLSEAKKLSESQAPK AEAKYAK—[BM]-DPSQSSELLSEAKKLESSQAPK VDAKYAK-[BM-DPSQSSELLSEAKKLNDSQAPK; VDAKYAK-[BM]—DPSQSSELLSEAKKLSESQAPK; VDAKYAK—[BW—DPSQSSELLSEAKKLESSQAPK; VDAKYAK—[BW—DPSQSSELLAEAKKLNKAQAPK; and AEAKYAK-[BM1—DPSQSSELLAEAKKLNKAQAPK; wherein [BM] is an FcRn binding motif as defined in any one of items 1—105. 158. FcRn binding polypeptide according to any preceding item, which comprises an amino acid sequence selected from: Xi) AEAKYAK—[BM]—DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined in any one of items 1—105; 1O and xii) an amino acid sequence which has at least 94 % identity to the sequence defined in xi). 159. FcRn binding polypeptide ing to item 158, in which sequence xi) is selected from the group consisting of SEQ ID NO:1060-1062. 160. FcRn binding polypeptide according to any preceding item, which ses an amino acid sequence selected from: xiii) VDAKYAK—[BAﬂ—DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined in any one of items 1-105; xiv) an amino acid sequence which has at least 94 % ty to the sequence defined in xiii). 161. FcRn binding polypeptide according to item 160, in which sequence xiii) is selected from the group consisting of SEQ lD NO: 707—1059. 162. FcRn binding polypeptide according to item 161, in which sequence xiii) is selected from the group consisting of SEQ lD NO:707—721, SEQ ID —846 and SEQ lD NO:1059. 163. FcRn binding polypeptide according to item 162, in which sequence xiii) is selected from the group consisting of SEQ ID -708 and SEQ ID NO:723—846. 164. FcRn binding polypeptide according to item 163, in which sequence xiii) is selected from the group consisting of SEQ ID NO:707-708, SEQ ID NO:723-798, SEQ ID NO:800—809, SEQ ID NO:811—831 and SEQ ID N01833— 846. 1O 165. FcRn binding polypeptide according to item 162, in which sequence xiii) is selected from the group consisting of SEQ ID NO:707—714, SEQ ID NO:719, SEQ ID NO:725—726, SEQ ID NO:729, SEQ ID NO:734, SEQ ID NO:747, SEQ ID , SEQ ID NO:771, SEQ ID NO:776, SEQ ID NO:779, SEQ ID NO:781—783 and SEQ ID NO:1059. 166. FcRn binding polypeptide according to item 163 or 165, in which sequence xiii) is selected from the group consisting of SEQ ID NO:707, SEQ ID , SEQ ID NO:734, SEQ ID NO:747, SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:779 and SEQ ID NO:781-783. 167. FcRn binding polypeptide according to item 166, in which sequence xiii) is selected from the group consisting of SEQ ID , SEQ ID NO:729, SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:781 and SEQ ID NO:783. 168. FcRn binding polypeptide ing to item 167, in which ce xiii) is selected from the group consisting of SEQ ID NO:707, SEQ ID NO:729 and SEQ ID NO:781. 169. FcRn binding polypeptide according to item 168, in which sequence xiii) is SEQ ID NO:707. 170. FcRn binding polypeptide ing to any preceding item, which is capable of g to FcRn at pH 6.0 such that the KB value of the interaction is at most 1 x 10'6 M, such as at most 1 x10‘7 M, such as at most 1 x10“8 M, such as at most 1 x10“9 M, such as at most 1 x10'10 M. 171. FcRn binding polypeptide according to any preceding item, wherein the K0 value of the ction n FcRn binding polypeptide and FcRn at pH 7.4 is higher than the KB value of said ction at pH 6.0, such as at least 2 times higher, such as at least 5 times higher, such as at least 10 times higher, such as at least 50 times higher, such as at least 100 times higher than the KD value of said interaction at pH 6.0. 172. FcRn binding polypeptide according to any preceding item, wherein the K0 value of said interaction at pH 7.4 is at least 1 x 10'8 M, such as at least 1O 1 x107 M, such as at least 1 x 10'6 M, such as at least 1 x 10'5 M. 173. FcRn binding polypeptide according to any one of items 1-170, wherein the KB value of said interaction at pH 7.4 is the same as or lower than the K13 value of said interaction at pH 6.0. 174. FcRn binding ptide according to any one of items 1-170, n the K0 value of said interaction at pH 7.4 is at most 1 x 10'6 M, such as at most 1 x10‘7 M, such as at most 1 x10"8 M, such as at most 1 x10'9 M, such as at most 1 x10'10 M. 175. FcRn binding polypeptide according to any preceding item, which ses at least one additional amino acid at the C—terminal and/or N— terminal end. 176. FcRn binding polypeptide according to item 175, wherein said at least one additional amino acid extension improves production, purification, stabilization in vivo or in vitro, ng or detection of the polypeptide. 177. FcRn binding polypeptide according to any preceding item in eric form, comprising at least two FcRn binding polypeptide monomer units, whose amino acid sequences may be the same or different. 178. FcRn binding polypeptide according to item 177, wherein said FcRn binding polypeptide monomer units are covalently coupled together. 179. FcRn binding polypeptide according to item 177, wherein the FcRn binding polypeptide monomer units are expressed as a fusion protein. 180. FcRn binding polypeptide according to any one of items 177-179, in dimeric form. 181. Fusion protein or conjugate comprising - a first moiety consisting of an FcRn g ptide according to any preceding item; and - a second moiety consisting of a polypeptide having a desired biological activity. 182. Fusion protein or conjugate according to item 181, wherein the in vivo half—life of said fusion n or conjugate is longer than the in vivo half-life of the polypeptide having a desired biological activity per 39. 183. Fusion protein or conjugate according to any one of items 181-182, wherein said desired biological activity is a therapeutic activity. 184. Fusion protein or conjugate according to any one of items 181—182, wherein said desired biological activity is a binding activity to a selected target. 185. Fusion protein or conjugate according to item 184, n said selected target is n. 186. Fusion protein or conjugate according to item 185, n said albumin binding activity is provided by the albumin binding domain of streptococcal protein G, or a derivative thereof. 187. Fusion protein or ate according to any one of items 185—189, wherein said albumin binding activity increases in vivo half—life of the fusion protein or conjugate. 188. Fusion protein or conjugate ing to any one of items 181—182, wherein said desired biological activity is an enzymatic activity. 189. Fusion protein or ate according to any one of items 181-183, wherein the second moiety having a desired biological activity is a therapeutically active polypeptide. 190. Fusion protein or conjugate according to any one of items 181—183 and 9, wherein the second moiety having a desired biological activity is selected from the group consisting of enzymes, es, growth factors, chemokines and cytokines. 1O 191. FcRn binding polypeptide, fusion n or conjugate according to any preceding item, which inhibits binding of lgG to FcRn. 192. FcRn binding polypeptide, fusion n or conjugate according to item 191, wherein the KB value of the interaction between said FcRn binding polypeptide, fusion protein or conjugate and FcRn is lower than the KB value of the interaction between lgG and FcRn. 193. FcRn binding polypeptide, fusion protein or conjugate according to any preceding item, further comprising a label. 194. FcRn binding polypeptide, fusion protein or conjugate according to item 193, wherein said label is selected from the group ting of fluorescent dyes and , chromophoric dyes, chemiluminescent compounds and bioluminescent proteins, enzymes, radionuclides and particles. 195. FcRn g polypeptide, fusion protein or ate according to any preceding item, comprising a chelating environment provided by a polyaminopolycarboxylate chelator conjugated to the FcRn binding polypeptide via a thiol group of a ne residue or an amine group of a 3O lysine residue. 196. FcRn binding polypeptide, fusion protein or conjugate according to item 195, wherein the polyaminopolycarboxylate chelator is 10— tetraazacyclododecane—1,4,7,10-tetraacetic acid or a derivative thereof. 197. FcRn binding polypeptide, fusion protein or conjugate according to item 196, wherein the 1 ,4,7,10-tetraazacyclododecane—1,4,7,10—tetraacetic acid tive is 1,4,7,10—tetraazacyclododecane—1,4,7-tris—acetic acid—10— maleimidoethylacetamide. 198. FcRn binding polypeptide, fusion protein or conjugate according to item 195, wherein the polyaminopolycarboxylate chelator is 1,4,7— triazacyclononane-1,4,7-triacetic acid or a derivative thereof. 199. FcRn binding polypeptide, fusion protein or conjugate according to item 195, wherein the polyaminopolycarboxylate chelator is 1O diethylenetriaminepentaacetic acid or derivatives thereof. 200. A poiynucleotide encoding a polypeptide according to any one of items 1-192. 201. Expression vector comprising a polynucleotide ing to item 200. 202. Host cell comprising an expression vector according to item 201. 203. Method of ing a polypeptide ing to any one of items 1—192, comprising — culturing a host cell according to item 202 under conditions permissive of expression of said polypeptide from said expression vector, and — isolating said polypeptide. 204. Composition comprising an FcRn binding polypeptide, fusion protein or conjugate ing to any one of items 1—199 and at least one pharmaceutically able excipient or carrier. 205. ition according to item 204, further comprising at least one additional active agent. 206. Composition ing to any one of items 204—205, which is adapted for administration by a route selected from the group consisting of oral administration, intranasal administration, pulmonar administration, vaginal administration, rectal administration, intravenous ion, intraperitoneal injection, intramuscular injection, subcutaneous injection and intradermal injection. 207. FcRn binding polypeptide, fusion protein or conjugate according to any one of items 1—199 or composition according to any one of items 204—206 for use as a medicament. 208. FcRn binding polypeptide, fusion protein, conjugate or composition for use according to item 207, wherein said medicament is intended for treatment of an mmune condition. 1O 209. FcRn binding polypeptide, fusion protein, conjugate or composition for use according to item 207 or 208, wherein said medicament is intended for treatment of a condition selected from the group consisting of myasthenia gravis, Guillain—Barré syndrome, autoimmune limbic encephalitis, pediatric mune neuropsychiatric disorders associated with streptococcal ion (PANDAS), neuromyotonia (lsaac’s syndrome), morvan syndrome, multiple sclerosis, pemphigus vulgaris, foliaceus, bullous goid, epidermolysis bullosa acquisita, pemphigoid gestationis, mucous membrane goid, lichen sclerosus, antiphospholipid syndrome, erlapsing polychondritis, autoimmune anemia, idiopathic cytic purpura, autoimmune Grave’s disease, dilated cardiomyopathy, itis, Goodpasture’s syndrome, idiopathic membranous nephropathy, rheumatoid arthritis and systemic lupus erythematosus. 210. Method of treatment of a subject in need thereof, sing administering to the subject a eutically active amount of an FcRn binding ptide, fusion protein or conjugate according to any one of items 1—199 or composition according to any one of items 204—206. 211. Method according to item 210, for treatment of an auto—immune condition. 212. Method according to item 210 or 211, n said subject is suffering from a ion selected from the group consisting of myasthenia gravis, Guillain—Barré syndrome, autoimmune limbic encephalitis, pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection (PANDAS), neuromyotonia (Isaac’s syndrome), morvan syndrome, multiple sclerosis, gus vulgaris, foliaceus, bullous pemphigoid, epidermolysis bullosa acquisita, pemphigoid gestationis, mucous membrane pemphigoid, lichen sclerosus, antiphospholipid syndrome, erlapsing polychondritis, autoimmune anemia, idiopathic trombocytic purpura, autoimmune Grave’s disease, dilated cardiomyopathy, vasculitis, Goodpasture’s syndrome, idiopathic membranous pathy, toid arthritis and systemic lupus erythematosus.

Claims

1. FcRn binding polypeptide, comprising an FcRn binding motif BM, which motif consists of the amino acid sequence EX2 X3 X4 AX6 X7 EIR WLPNLX16X17 X18 QR X21 AFIX25 X26LX28 X29 wherein, independently from each other, 10 X2 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, F, G, H, I, K, L, M, N, Q, R, S, T, V, W and X4 is selected from A, D, E, F, G, H, I, K, L, N, Q, R, S, T, V, W and Y; X6 is selected from A, E, F, G, H, I, K, Q, R, S and V; 15 X7 is selected from A, F, H, K, N, Q, R, S and V; X16 is ed from N and T; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; 20 X25 is selected from D, E, G, H, I, K, L, N, Q, R, S, T, V, W and Y; X26 is selected from K and S; X28 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X29 is selected from D and R.

2. FcRn binding polypeptide according to claim 1, wherein the BM consists of an amino acid sequence ed from i) EX2 X3 X4 AX6 HEIR WLPNLTX17 X18 QR X21 AFIX25 KLX28 D wherein, independently from each other, X2 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y; 35 X4 is ed from A, D, E, F, G, I, K, L, N, Q, R, S, T, V and Y; X6 is selected from A, G, K, R, S and V; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; X25 is selected from D, G, H, K, L, N, R, V and W; X28 is selected from A, D, E, H, K, L, N, Q, R, S, T, W and Y.

3. FcRn binding ptide according to claim 1, wherein the BM ts of the amino acid sequence EX2 X3 X4 AX6 HEIR WLPNLTX17 X18 QR X21 AFIX25 KLX28 D wherein, ndently from each other, X2 is selected from A, D, E, F, H, I, K, L, N, Q, R, S, T, V, W and Y; X3 is selected from A, D, E, G, H, K, L, M, N, Q, R, S, T, V and Y; 15 X4 is selected from A, D, E, F, G, I, K, L, N, Q, R, S, T, V and Y; X6 is selected from A, G, K, R, S and V; X17 is selected from F, W and Y; X18 is selected from A, D, E and N; X21 is selected from A, S, V and W; 20 X25 is selected from D, G, H, K, L, N, R, V and W; and X28 is selected from A, D, E, H, K, L, N, Q, R, S, T, W and Y.

4. FcRn binding polypeptide according to any one of claims 1-3, wherein ce i) fulfills at least three of the six conditions I-VI: I. X6 is selected from A, G, K and S, such as in particular A; II. X7 is H; III. X17 is selected from F and Y, such as in particular F; IV. X18 is D; 30 V. X21 is selected from V and W, such as in particular V; VI. X25 is selected from H and R, such as in particular H.

5. FcRn binding polypeptide according to any one of claims 1-4, wherein the sequence is selected from the group consisting of SEQ ID NO:1-353.

6. FcRn binding polypeptide according to any one of claims 1-5, wherein the sequence is selected from the group consisting of SEQ ID NO: 1-15, SEQ ID NO: 17-140 and SEQ ID NO:353. 5

7. FcRn binding polypeptide according to any one of claims 1-6, wherein the sequence is selected from SEQ ID NO:1-2 and SEQ ID NO:17-140.

8. FcRn binding polypeptide according to any one of claims 1-6, wherein the sequence is selected from SEQ ID NO:1-2, SEQ ID 92, SEQ ID 10 NO:94-103, SEQ ID NO:105-125 and SEQ ID NO:127-140 or selected from the group consisting of SEQ ID NO:1-8, SEQ ID NO:13, SEQ ID NO:19-20, SEQ ID NO:23, SEQ ID NO:28, SEQ ID NO:41, SEQ ID NO:44, SEQ ID NO:65, SEQ ID NO:70, SEQ ID NO:73, SEQ ID NO:75-77 and SEQ ID NO:353.

9. FcRn binding polypeptide according to any one of claims 1-8, wherein the sequence is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:23, SEQ ID NO:28, SEQ ID NO:41, SEQ ID NO:44, SEQ ID NO:65, SEQ ID NO:73 and SEQ ID NO:75-77.

10. FcRn binding polypeptide according to any one of claims 1-9, wherein the sequence is selected from the group ting of SEQ ID NO:1, SEQ ID NO:23, SEQ ID NO:44, SEQ ID NO:65, SEQ ID NO:75 and SEQ ID NO:77. 25

11. FcRn binding polypeptide according to any one of claims 1-10, wherein the sequence is ed from the group consisting of SEQ ID NO:1, SEQ ID NO:23 and SEQ ID NO:75.

12. FcRn binding polypeptide according to any one of claims 1-11, wherein 30 the ce is SEQ ID NO:1.

13. FcRn binding polypeptide according to any one of claims 1-12, wherein said FcRn binding motif forms part of a helix bundle protein domain. 35

14. FcRn binding ptide according to any one of claims 1-13, which comprises an amino acid ce selected from: iii) K-[BM]-DPSQS XaXbLLXc EAKKL XdXeXfQ; wherein [BM] is an FcRn binding motif as defined in any one of claims 1-12, 5 ed that X29 is D; Xa is selected from A and S; Xb is selected from N and E; Xc is selected from A, S and C; Xd is selected from E, N and S; 10 Xe is selected from D, E and S; Xf is selected from A and S.

15. FcRn binding ptide ing to claim 14, wherein sequence iii) is selected from the group consisting of SEQ ID NO:354-706.

16. FcRn binding ptide according to claim 15, wherein the sequence is selected from the group consisting of SEQ ID NO:354-368, SEQ ID NO:370- 493 and SEQ ID NO:706. 20

17. FcRn g polypeptide according to claim 16, wherein the sequence is selected from the group consisting of SEQ ID NO:354-355 and SEQ ID NO:370-493.

18. FcRn binding polypeptide according to claim 16, wherein the sequence is 25 selected from the group consisting of SEQ ID NO:354-355, SEQ ID NO:370- 445, SEQ ID NO:447-456, SEQ ID NO:458-478 and SEQ ID NO:480-493 or selected from the group consisting of SEQ ID NO:354-361, SEQ ID NO:366, SEQ ID NO:372-373, SEQ ID NO:376, SEQ ID NO:381, SEQ ID NO:394, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:423, SEQ ID , SEQ ID 30 NO:428-430 and SEQ ID NO:706.

19. FcRn binding polypeptide according to claim 18, wherein the sequence is ed from the group consisting of SEQ ID NO:354, SEQ ID NO:376, SEQ ID NO:381, SEQ ID NO:394, SEQ ID NO:397, SEQ ID , SEQ ID 35 NO:426 and SEQ ID NO:428-430.

20. FcRn binding ptide according to claim 19, wherein the sequence is selected from the group consisting of SEQ ID NO:354, SEQ ID NO:376, SEQ ID NO:397, SEQ ID NO:418, SEQ ID NO:428 and SEQ ID NO:430. 5

21. FcRn g polypeptide according to claim 20, wherein the sequence is ed from the group consisting of SEQ ID NO:354, SEQ ID NO:376 and SEQ ID NO:428.

22. FcRn binding polypeptide according to claim 21, wherein the sequence is 10 SEQ ID NO:354.

23. FcRn binding polypeptide according to any one of claims 1-22, which comprises an amino acid sequence selected from: 15 xi) AEAKYAK-[BM]-DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined in any one of claims 1-12.

24. FcRn binding polypeptide according to claim 23, in which sequence xi) is 20 selected from the group ting of SEQ ID NO:1060-1062.

25. FcRn binding ptide according to any one of claims 1-22, which comprises an amino acid sequence selected from: 25 xiii) VDAKYAK-[BM]-DPSQSSELLSEAKKLNDSQAPK; wherein [BM] is an FcRn binding motif as defined in any one of claims 1-12.

26. FcRn binding polypeptide according to claim 25, in which sequence xiii) is 30 selected from the group consisting of SEQ ID NO:707-1059.

27. FcRn g ptide according to claim 26, wherein the sequence is selected from the group consisting of SEQ ID NO:707-721, SEQ ID NO:723- 846 and SEQ ID NO:1059.

28. FcRn binding ptide according to claim 27, n the sequence is selected from the group ting of SEQ ID NO:707-708 and SEQ ID NO:723-846. 5

29. FcRn binding polypeptide according to claim 27, wherein the sequence is ed from the group consisting of SEQ ID NO:707-708, SEQ ID NO:723- 798, SEQ ID NO:800-809, SEQ ID NO:811-831 and SEQ ID NO:833-846 or selected from the group consisting of SEQ ID NO:707-714, SEQ ID NO:719, SEQ ID NO:725-726, SEQ ID NO:729, SEQ ID NO:734, SEQ ID NO:747, 10 SEQ ID NO:750, SEQ ID NO:771, SEQ ID NO:776, SEQ ID NO:779, SEQ ID NO:781-783 and SEQ ID NO:1059.

30. FcRn binding polypeptide according to claim 29, wherein the sequence is selected from the group consisting of SEQ ID NO:707, SEQ ID NO:729, SEQ 15 ID NO:734, SEQ ID , SEQ ID NO:750, SEQ ID , SEQ ID NO:779 and SEQ ID NO:781-783.

31. FcRn binding polypeptide according to claim 30, wherein the sequence is selected from the group consisting of SEQ ID NO:707, SEQ ID NO:729, SEQ 20 ID NO:750, SEQ ID NO:771, SEQ ID NO:781 and SEQ ID NO:783.

32. FcRn binding polypeptide according to claim 31, wherein the sequence is selected from the group consisting of SEQ ID NO:707, SEQ ID NO:729 and SEQ ID NO:781.

33. FcRn binding polypeptide according to claim 32, wherein the sequence is SEQ ID .

34. FcRn binding polypeptide according to any one of claims 1-33, which has 30 the ability to bind to FcRn at pH 6.0 such that the KD value of the interaction is at most 1 x 10-6 M.

35. FcRn binding polypeptide according to claim 34, wherein the KD value of the interaction is at most 1 x 10-7 M.

36. FcRn binding polypeptide according to claim 35, wherein the KD value of the interaction is at most 1 x 10-8 M.

37. FcRn binding polypeptide according to claim 36, wherein the KD value of the interaction is at most 1 x 10-9 M. 5

38. FcRn binding ptide according to claim 37, wherein the KD value of the interaction is at most 1 x 10-10 M.

39. FcRn g polypeptide according to any one of claims 1-38, wherein the KD value of the interaction between FcRn g polypeptide and FcRn 10 at pH 7.4 is higher than the KD value of said interaction at pH 6.0.

40. FcRn binding polypeptide according to claim 39, wherein the KD value of the interaction between FcRn g polypeptide and FcRn at pH 7.4 is at least 2 times higher than the KD value of said interaction at pH 6.0.

41. FcRn binding polypeptide according to claim 40, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 5 times higher than the KD value of said interaction at pH 6.0. 20

42. FcRn binding polypeptide according to claim 41, wherein the KD value of the interaction n FcRn binding polypeptide and FcRn at pH 7.4 is at least 10 times higher than the KD value of said interaction at pH 6.0.

43. FcRn binding polypeptide according to claim 42, wherein the KD value of 25 the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 50 times higher than the KD value of said interaction at pH 6.0.

44. FcRn binding polypeptide according to claim 43, wherein the KD value of the interaction between FcRn g polypeptide and FcRn at pH 7.4 is at 30 least 100 times higher than the KD value of said interaction at pH 6.0.

45. FcRn binding polypeptide according to any one of claims 1-44, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 1 x 10-8 M.

46. FcRn binding polypeptide according to claim 45, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 1 x 10-7 M. 5

47. FcRn binding polypeptide according to claim 46, n the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 1 x 10-6 M.

48. FcRn g polypeptide according to claim 47, wherein the KD value of 10 the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at least 1 x 10-5 M.

49. FcRn binding polypeptide according to any one of claims 1-33, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn 15 at pH 7.4 is at most 1 x 10-6 M.

50. FcRn binding polypeptide ing to claim 49, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at most 1 x 10-7 M.

51. FcRn binding polypeptide according to claim 50, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at most 1 x 10-8 M. 25

52. FcRn binding ptide according to claim 51, wherein the KD value of the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at most 1 x 10-9 M.

53. FcRn binding polypeptide according to claim 52, wherein the KD value of 30 the interaction between FcRn binding polypeptide and FcRn at pH 7.4 is at most 1 x 10-10 M.

54. Fusion protein or conjugate comprising: - a first moiety ting of an FcRn binding polypeptide according to 35 any one of claims 1-53; and - a second moiety consisting of a polypeptide having a desired biological activity.

55. FcRn binding polypeptide, fusion protein or conjugate according to any one of claims 1-54, which inhibits binding of IgG to FcRn. 5

56. A cleotide encoding a polypeptide according to any one of claims 1-53.

57. A composition sing an FcRn binding polypeptide, fusion protein or conjugate according to any one of claims 1-55 and at least one 10 pharmaceutically acceptable excipient or carrier.

58. FcRn binding ptide, fusion protein or conjugate according to any one of claims 1-55 or a composition according to claim 57 formulated for use as a ment.

59. FcRn binding polypeptide, fusion n, conjugate or composition according to claim 58, wherein said medicament is formulated for the treatment of an auto-immune condition. 20

60. The use of an FcRn binding polypeptide, fusion protein or conjugate according to any one of claims 1-55 or a composition according to claim 57 for the ation of a medicament, wherein said medicament is formulated for treatment of an auto-immune condition. 25

61. The use of an FcRn binding polypeptide, fusion protein or conjugate according to any one of claims 1-55 or a composition according to claim 57 for the preparation of a medicament, wherein said ment is formulated for inhibiting binding of IgG to FcRn. 30

62. The use according to claim 60 or 61, wherein said medicament is formulated for ent of a condition selected from the group ting of myasthenia gravis, Guillain–Barré syndrome, autoimmune limbic encephalitis, pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection (PANDAS), neuromyotonia (Isaac’s syndrome), 35 morvan syndrome, multiple sclerosis, pemphigus vulgaris, foliaceus, bullous pemphigoid, epidermolysis a acquisita, goid gestationis, mucous membrane pemphigoid, lichen sclerosus, antiphospholipid syndrome, erlapsing polychondritis, autoimmune anemia, idiopathic trombocytic purpura, autoimmune Grave’s e, dilated cardiomyopathy, vasculitis, Goodpasture’s me, idiopathic membranous nephropathy, rheumatoid arthritis and systemic lupus erythematosus.