NZ622284B2 - Novel plant defensins and use in the treatment of proliferative diseases - Google Patents

Abstract

Disclosed is an isolated polypeptide or nucleotide, that is isolated from Nicotiana occidentalis or produced recombinantly, that is at least 95% identical to the sequences as defined in the specification. Also disclosed is its use to treat proliferative diseases such as cancer.

Description

Novel plant defensins and use in the treatment of proliferative diseases Field of the invention The’~present invention relates to compositions and methods for ting or ng proliferative diseases. in particular, the present invention relates to the use of compositions derived or derivable from plants, such as plant defensins, particularly in s for the prevention or ent of proliferative diseases such as cancer. The present invention also relates to associated uses, systems and kits.

Cross-reference to d applications This application claims priority to US Provisional Patent Application number 61/548,825 filed on 19 October 2011, which is hereby incorporated by reference in its entirety ‘ Statement regarding federally funded research Not applicable. ound to the ion Plants are known to e a variety of‘chemical compounds, either constitutively or inducibly, to protect themselves against environmental stresses, wounding, or microbial invasion.

Of the plant antimicrobial proteins that have been characterized to date, a large proportion share common characteristics. They are generally small Da), highly basic proteins and often contain an even number of cysteine residues (typically 4, 6 or 8). These cysteines all participate in intramolecular disulfide bonds and provide the protein with stru'ctural and thermodynamic stability (Broekaert et al. (1997)). Based on amino acid sequence identities, primarily with reference to the number and spacing of the cysteine residues, a number of distinct families have been defined.

They include the plant defensins (Broekaert et al.,1995,1997; Lay et al., 2003a), thionins (Bohlmann, 1994), lipid er ns (Kader,.1996,1997), hevein aert et al., 1992) and knottin-type ns (Cammue et al., 1992), as well as antimicrobial proteins from Macadamia integrifoliafl (Marcus et al., 1997; McManus et al., 1999) and Impatiens balsamina (Tailor et al., 1997; Patel et al., 1998) (Table 1). All these antimicrobial proteins appear to exert their activities at the leVel of the plasma membrane of the target microorganisms, although it is likely thatthe different protein families act via different mechanisms (Broekaert et al.,.1997)v. The 'cyclotides arena new family of small, cysteine-rich plant peptides that are common in members of the Rubiaceae and Violaceae families (reviewed in Craik et al., 1999, 2004; Craik, 2001). .These unusual cyclic peptides (Table 1) haVe been ascribed various ical activities including antibacterial (Tam, et al., 1999), anti-HIV (Gustafson et al., 1994) and insecticidal (Jennings‘et al., 2001) ties.

TABLE 1: Small, cysteine-rich antimicrobial proteins in plants.

Peptide ' Representative family member . ‘ 3-C-l0-CC—3-CCCal.-CC Plant \ defensms' RS-AFPZ , I L4ZE—J I . . 2-CC—7-CC-8—C—3-C-1—CC-6 _ or/B-Thlonm a—Purothionin (8-Cys type) . I I L.__I::J__-_J i I Llpld transfer protein ' CCCC- 10—03 Knottin—type Mj-AMPI '—1::Ei__l ‘ 10-CCC—25-C—14—C-1 l-C Macadamia MiAMPl, L—:E:'__l -ccc—4-c— l-CC-6 Cyclotide ‘ Kalata Bl ‘ L—‘EZJEJ : g ___________________| The size of the mature n and spacing of cysteine residues for representative 1'0 members of plant antimicrobial proteins is shown in Table 1. The numbers in the consensus sequence represent the number of amino acids between the highly conserved cysteine residues in the representative member but other members of the family may vary slightly in the inter-cysteine lengths. The de connectivities are given by connecting lines. The cyclic ne of the cyclotides is depicted by the broken line (from Lay and Anderson, 2005).

Defensins The term 'idefensin” has previously been used in the art to describe a-diverse family of molecules that are produced by many different species and which function in innate defense against pathogens including bacteria, fungi, yeast and viruses.

. Plant defensins Plant defensins (also termed nins) are small (~5 kDa, 45 to '54 amino acids), basic . proteins with eight cysteine residues that form four strictly conserved disulfide bonds with a Cysi- 'Cy8vm, Cysii-Cysiv, Cysm-Cysw'and CysV-Cy3vu configuration. As well as these four strictly conserved disulfide bonds, some plant defensins have an onal disulfide bond (Lay et al., 2003a, 2003b; Janssen et al., 2003').

The name “plant defensin“ was coined in 1995 by Terras and colleagues who isolated two antifungal proteins from radish seeds (Rs-AFP1 and Rs-AFP2) and noted that at a primary and three-dimensional structural level these proteins were distinct from the plant a—lB-thionins but - shared some structural similarities to insect and ian defensins (Terras et al.,« 1995; .

Broekaert et al., 1995).

Plant defensins exhibit clear, althoUgh relatively limited, sequence conservation ly ' conserved are] the eight cysteine residues and a glycine at position '34 (numbering relatiVe to Rs- AFP2). in most of the sequences, a serineat on 8, an aromatic residue at position 11, a '20 glycine at position 13 and a glutamic acid at on 29 are also conserved (Lay et al., 2003a; Lay and Anderson, 2005).

Thethree-dimensional on structures of the first plant defensins were elucidated in 1993 by Bruix and colleagues for y1-P and y1-H. Since that-time, the structures‘of, other seed- ~derived and two flower-derived (NaD1 and PhD1) defensins have been ined (Lay et al., '25' 2003b; Janssen et al., 2003). All these defensins elaborate a motif ‘known as the cysteine-stabilized orB (CSaB) fold and share highly superimposable dimensional ures that comprise a well-defined a-helix and a -stranded antiparallel B-sheet. These elements are organized in a } arrangement and are reinforced by four disulfide bridges.

The CSo’cB motif is also displayed by insect ins and scorpion toxins. In comparing the amino acid sequences of the structurally characterized plant defensins, insect. defensins and scorpion toxins, it is apparent that the C804} scaffold is highly sive to size and compositional differences.

The plant in/y-thionin ure Contrasts to that which is adopted by the or- and B- thionins. The or- and B-thionins form compact, amphipathic, L—s'haped molecules where the long vertical arm of the L is ed of two a—helices, and the short arm is formed by two antiparallel B-strands and-the last (~10) C-terminal residues. These proteins are also stabilized by three or four disulfide bonds (Bohlmann and Apel, 1991).

Plant defensins have a widespread distribution throtrghout the plant kingdom and are likely to be present in most, if not all, plants. Most plant defensins have been isolated from seeds where they are abundant and have been characterized at the molecular, biochemical and structural levels (Broekaert et al., 1995; Thomma et at, 2003; Lay and. on, 2005). Defensins have also been identified in other tissues including leaves, pods, tubers, fruit, roots, bark and floral tissues (Lay and Anderson, 2005).

An amino acid sequence alignment Of several defensins that have been identified, either as or deduced from cDNAs, has been published by Lay. and Andersonl(2005). Other , purified protein plant defensins have been disclosed in US. Patent No. 6,911,577, International Patent Publication No. WO 00/11196 and International Patent Publication No. WO 05, the entire contents of which are incorporated herein by reference.

Mammalian defensins The mammalian ins form three distinct structural subfamilies known as the or-, B- and 9- defensins. In contrast to the plant defensins, all three subfamilies contain only six cysteine es which differwith respect to their size, the placement and connectivity of their cysteines, the nature of their precursors and their sites of expression (Selsted et at, 1993; Hancock and Lehrer, 1998; Tang et al., 1999a, b; 'and Ganz, 2002). All subfamilies have an implicated role in innate host immunity and more recently, have been linked with. adaptive immunity as ‘25 immunostimulating agents (Tang et al., 1999b; Lehrer and Ganz, 2002). It was in the context of their defense role e name "defensin" was originally coined (Ganz et at, 1985; Selsted et al., 1985] The cur-defensins (also known as classical defensins) are 29-35 amino acids in length and their six Cysteine residues form three disulfide bonds with a Cyst-Gysw, Cysn-Cysiv and Cysv configuration (Table 2). ' In contrast to the a—defensins, the B-defensins are larger (36-42 amino acids in size) and have a different cysteine g (Cysi-CySV, Cysw and CySm-Cysw) and spacing (Tang and Selsted, 1993). They are also ed as preprodefensins. HOwever, their prodomains are much 'shorter. Analogous to the a-defensins, the synthesis of B-defensins can be constitutive'or can be W0 2013/056309 d following injury or exposure to ia, parasitic protozoa, bacterial lipopolysaccharides, and also in response to humoral mediators (Le. cytokines) (Diamond et al., 1996; Russell et al., 1996; Tarveretal., 1998).

The size of the mature n and spacing of cysteine residues for representative members of defensin and» defensinLIike proteins from insects and mammals is shown in Table 2 The numbers in the Consensus sequence ent the number of amino acids between the highly conserved cysteineresidues in the representative member, but other members of the family may vary slightly in the inter-cysteine lengths. The disulfide connectivities are given by connecting lines.

The cyclic backbone of the mammalian theta-defensins is depicted by the. broken line.

Table 2: Representative members of defensin and defensin- V like proteins from insects and mammals 58 82 $2 82 382 58 85.3mm 4m. 4m. :3 .3 3 re a a 3 .._m E853 a 658 9me 523 a 88 am; N N o 0| _‘ N-O- 8533. 70. 23.528 vm-o-m-o..m-o-n-o- fill;flnj. vm-o-m-o-m- 79.304 0 THEME To Yoo-m-o-m-o-¢-o-wo- EH41. w r O-m.vmv o N *0 muss .oz oEEm 3335853.. < LionEoE £05085 EmcemEomws £23 mx__-c_w:&mn 52%“. smcgmué cacmhmué £23m: 85%“. 835 885 Em_>_ cm__.mE.Ems_ cngEm: Insect defensins A large number of defensin and defensin-like proteins have been identified in insects.

These proteins are produced in the-fat body (equivalent of the mammali an liver) from which they are subsequently ed into the hemolymph (Lamberty et al., 1999). Most insect defensins have three de bonds. r, a number of related proteins, namely drosomycin from Drosophila melanogaster, have four disulfides (Fehlbaum et al., 1994; Landon et al., 1997) (Table 2).

The three-dimensional structures of several insect defensins have been solved (e.g.

Hanzawa et al., 1990; Bonmatin et al., 1992; Cornet et al., 1995; ty et al.,2001; Da Silva et al., 2003). Their global fold, as typified by insect defensin A, features an a-helix, a double-stranded antiparallel B-sheet and‘ a long N-terminal loop. These elements of secondary structure are stabilized by three disulfide bonds that are arranged in a Cysr-Cyslv, Cysu-Cysv and Cysm—Cysvr configuration tin et al., 1992; Cornet et al., 1995). ‘ Two classes of plant defensins

[0022] .Plant'defensins can be divided into two major classes according to the structure of the sor proteins predicted from cDNA clones (Lay et al., 2003a) (Figure 1). In the first and largest class, the precursor protein is composed of plasmic reticulum (ER) signal sequence and a mature defensin domain. These proteins enter the secretory pathway and have no obvious signals for post-translational modification or subcellular targeting e 1A).

[0023] The second class of defensins are produced as larger precursors with inal prodomains or propeptides (CTPPs) of about 33 amino acids (Figure 18). Class II defensins have been identified in solanaceous species where they are expressed constitutiVely in floral tissues (Lay et al., 2003a; Gu et al., 1992; Milligan et‘.al., 1995; Brandstadter et al., 1996) and fruit (Aluru et al., 1999) and in salt stressed leaves i et al., 1997; Yamada _et al., 1997). The CTPP of the, solanaceous defensins from Nicotiana alata (NaD1) and Petunia hybrida (Pth and PhDZ) is removed proteolytically during maturation (Lay et al., 2003a).

The CTPPs on the ceous defensins have an unusually high content of acidic and hydrophobic amino acids. Interestingly, at neutral pH, the negative charge of the CTPP counter- balances the positive charge of the defensin domain (Lay and Anderson, 2005).

Biological activity of plant defensins Some biological activities have been attributed to plant‘defensins including growth inhibitory effects on fungi (Broekaert et al., 1997; Lay et al., 2003a; Osborn etal., 1995;,Terras et . al., 1993),‘and Gram-positive and Gram—negative bacteria (Segura‘et al., 1998; Moreno et al., 1994; Zhang- and Lewis, 1997). Some ins are also effective inhibitors of digestive enzymes such as or-amylases (Zhang et al., 1997; Bloch et al., 1991) and serine proteinases .(Wijaya et al., 2000; Melo et al., 2002) Mo functions consistent with a role in tion against insect herbivory This is ted by the observation that bacterially expressed mung bean defensin VrCRP, is lethal to the bruchid Callosobruchus chinensis when incorporated into an artificial diet at O2% (w/w) (Chen ef al., 2002). Some defensins also inhibit protein translation (Mendez et al., 1990; Colilla et al., 1990; Mendez et al., 1996) or bind to ion channels (Kushmerick et al., 1998). A defensin from Arabidopsis haIIeri also confers zinc tolerance, suggesting a roleIn stress tion (Mirouze et al., 2006). More recently, a sunflower in was shoWn to induce cell death in Orobanche parasite plants (de Zélicourt et al., 2007).

Antifungal actiVity The best characterized activity of some but not all plant defensins is their y to inhibit, with varying potencies, a large number of fungal species (for examples, see‘Broekaert et al., 1997; _ Lay et al., 2003a; Osborn et al., 1995). Rs-AFPZ, for example, inhibits the growth of Phoma betae at 1 pg/mL, but is ineffective against Sclerofinia sclerotiorum at 100 pg/mL (Terras et al., 1992).

Based on their effects on the growth and morphology of the fungus, FusariIJm culmorum, two groups of defensins can be distinguished. The “morphogenic” plant defenSins cause reduced ‘20 :hyphal elongation with a concomitant increase in hyphal branching, whereas the “non- morphogenic" plant defensins . the rate of hyphal elongation, but do not induce marked morphological distortions (OSborn et al., 1995).~ More ly, the pea defensin Psd1 has been shown to be taken up ellularly and _ [0027] enter the nuclei of Neurospora crassa where it interacts with a nuclear cyclin-like protein involvedIn . 'cell cycle control (Lobo et al., 2007). For MSDef1,a defensin from alfalfa, two n-activated protein (MAP) kinase signalling cascades have a major role in regulating MsDef1 activity on um graminearum (Ramamoorthy et al., 2007).

Permeabilization of fungal membranes has also been reported for some plant defensins . (Lay and Anderson, 2005). For example, NaD1 is. a plant defensin isolated from floral tissue of Nicotiana alata. The amino acid and coding sequences ,of NaD1 are disclosed in International Patent ation No. WO 02/063011, the entire contents of which are incorporated by nce herein. NaDl was tested in vitro for antifungal ty against the filamentous fungi Fusarium oxysporum f. sp. vasinfectum (Fov), VerticiIIium dahliae,‘ Thieiaviopsis basico/a, Aspergillus nidulans and Leptosphaeria maculans. At 1pM, NaD1 retarded the growth’of F0v and L. maculans by 50% while V. dahliae, T. basicola, and A. nidulans were all inhibited by approximately 65%. At 5 pM NaD1, the growth of all five species was inhibited by more than 80%. These five fungal species are all members of the ascomycete phylum and are distributed among three classes in the subphylum pezizomycotiria. These fungi are agronomically important fungal pathogens. All filamentous fungi tested thus far are sensitive to inhibition by NaD1 (van der’ Weerden et al.', 2008). ‘ The importance of the four disulfide bonds in NaD1 was investigated by reducing and alkylating the cysteine residues. Reduced and alkylated NaD1 ?&A) was completely inactive in the growth tory assays with Fov, even at a concentration ten-fold higher than the leo for NaD1 (van der Weerden ef al., 2008).

Prior work with antimicrobial peptides and tumour cells.

Use of small cysteine-richlcationic antimicrobial peptides in the treatment of human disease There is an increasing body of literature implicating human a— and B-defensins in various aspects of cancer, tumourigenesis, angiogenesis and invasion». The‘ use of mammalian defensins has also been proposed for the treatment of viral and fungal infections and as an alternative or adjunct to antibiotic treatment of bacterial infeCtions. r, their cytOtoxicity towards mammalian cells s a significant barrier. Moss et a] (United States Patent No. 7,511,015) have shown that modification of the defensin peptide through ribosylation or ADP-ribosylation of arginine residues modifies the texicity of the peptide and enhances its antimicrobialproperties.

The review by Mader and Hoskin (2006) describes the use of cationic antimicrobial es as novel cytotoxic agents for cancer treatment. it should be noted however that a review by Pelegrini and Franco (2005) incorrectly describes oc-IB-thionins from “mistletoe, which are , anticancer molecules, as y—thionins (another name for plant ins). The person skilled in the art would tand that such prior art does not relate to plant defensins onins) but instead to the structurally and functionally distinct -thionins.

Reports of plant defensins with antiproliferative activity on human cancer cells Since 2004, some isolated s have suggested that plant defensin(-like) proteins could also display in vitro antiproliferative activity against s human tumour cell lines (with differing ies) (see, for example, Wong and N9 (2005), Ngai and N9 (2005), Ma et al.1(2009) and Lin et al. (2009)). These proteins have largely been isolated from leguminous plants (e.g. beans). The assignment'of these proteins to‘ the plant defensin class was based on their estimated molecular mass (~5 kDa) and in some cases, on limited N-terminal amino acid similarities to known defensin ' r, the proteins sequences. as disclosed in these references lack the strictly conserved ne residues and cysteine spacings that define defensins. in addition, the proteins disclosed in such references are not Class ll defensins, nor are they from the family Solanaceae.

A review cf the literature indicates thatthe Capsicum chinese defensin (Cch), also referred to as Cc-gth, was the only other Class II defensin of the Solanaceae family that has been previously implicated as having the potential to t the viability of mammalian cells (Anaya- Lopez et al., 2006). It is reported that the transfection of an expression construct encoding a full- Iength sequence for CcD1 into the bovine endothelial cell line BE-E6E7 resulted in conditioned media that exhibited anti-proliferative effects on the human transformed cell line HeLa. There are a number of major flaws in the experimental design and'interpretation of these data that make it‘ impossible for the person d in the art to draw a valid sion from the described studies as to whether CcD1 exhibits anti-proliferative activity. These include: (i) although mRNA h was suggested in the transfected cells, no evidence was provided to demonstrate thatthe CcD1 protein ’ was actually expressed in the conditioned media, (ii) the use of the full-length open-reading frame of CcD1 rather than the mature coding domain would require. the sing of the sed' precursor by removal ”of the CTPP domain to produce an ve'l defensin - this was not demonstrated, (iii) the process of transfection can result in changes to a cell and the l for the transfection experiment was not adequate in that untransfected cells were used rather than the correct control of vector alone transfected cells, (iv) the use of conditioned media rather than purified CcD1 protein could influence the mental readout as components of the media or “ other secreted molecules from the transfected cells may themselves, or in combination with CcD1, (have anti-proliferative ty, (v) the expression levels of CcD1 mRNA in the various transfected endothelial cell populations (Anaya-Lopez et al., 2006, Figure 2) do not correlate with the proposed anti-proliferative activity of the CcD1 transfected cell conditioned media -Lopez et al., 2006, Figure 4) as there is no statistically significant ence between the observed anti-proliferative responses mediated by the different conditioned media samples. It should also be noted that these deficiencies in the experimental design and interpretation were expressly acknowledged in (an independently published paper by the same authors in 2008 (Loeza-Angeles et al., 2008). Based on these observations, it would be impossible for the person skilled in the art to” interpret from Anaya-Lopez et al. (2006) that CcD1 has any anti-proliferative activity against mammalian cells.

The inventors have previously disclOsed in International Patent Publication No. W0 011 certain novel defensins and their use in inducing resistance in plants or parts of plants to pathogen infestation. The entire contents of WO 02/063011 are incorporated herein by reference. 2012/001267 As a result of follow dies into plant ins, the inventors have also previously disclosed in International Patent Publication No. WO 60174 that Class II defensins from the Solanaceae plant family have potent cytotoxic properties. These cant findings described a _- novel and important way in which proliferative diseases may be ted and treated. The entire a ts of are incorporated herein by nce.

As a result of yet further studies into plant ins, it has been determined that a - previously undisclosed Class II defensin from the Solanaceae plant family has pOtent cytotoxic properties that are surprisingly coupled with a very high IC50 and hence a very high degree of. specificity for tumour cells, as opposed to normal, healthy cells. Accordingly, these findings provide '10 for vastly improved compositions and methods for ,the prevention and treatment‘of proliferative diseases such as cancer, as well as associated'systems and kits. Such compositions, methods, systems and kits provide a hitherto unseen degree of specific targeting against tumour cells versus normal, healthy cells, and thereforegminimize side effects. Such compositions also allow for much higher safe‘ doses of, treatment, thereby facilitating a much improved degree of efficacy} in treatment.

Summary of the invention ' [0037] In a first aspect of the present invention, there is provided a plant defensin.

In a second aspect of the present invention, there is provided a nucleic acid ng the plant defensin of the first aspect.

In a third aspect of the present invention, there is provided a vector comprising the c acid of the second aspect.

In a fourth aspect of the present invention, there is provided a host cell comprising the vector of the third aspect.

[0041] In a fifth aspect of the present invention, there is provided an expression product produced by the host cell of the fourth aspect.

In a siXth aspect of the present invention, there is provided a pharmaceutical composition} for use in preventing or treating a proliferative disease, wherein the pharmaceutical composition c0mprises the plant in of the first aspect, the nucleic acid of the second , the vector of '30 the third , the host cell of the fourth aspect or the expression product of the fifth aspect, together with a pharmaceutically acceptable carrier, diluent or excipient._ In a seventh aspect of the present invention, there is provided a method for preventing or treating a proliferative disease, wherein the method comprises administering to a subject a therapeutically effective amount of the plant defensin of the first aspect, the nucleic acid of the WO 56309 ;12- second aspect, the vector of the third aspect, the host Icell'of the fourth aspect, the expression product of the fifth aspect or the'pharmaceutical composition of the sixth aspect, thereby preventing or treating the proliferative disease.

In an eighth aspectof the present invention, there is provided use of the plant defensin of ' the first aspect, the nucleic acid of the second aspect, the vector of the third aspect, the host cell of the fourth , the sion product of the fifth aspect or the pharmaceutical composition of ' the sixth aspect in the ation of a medicament for preventing or treating ,a proliferative disease.

In a ninth aspect of the present invention, there is provided a kit fOr preventing or treating a 1O proliferative disease, Wherein the kit comprises a therapeutically effective amount of the plant defensin of the first aspect, the nucleic acid of the second aspect, the vector of the third aspect, the host cell of the fourth aspect,the expression product of the fifth aspect or the pharmaceutical composition of the sixth aspect.

In a tenth aspect of the present invention, there'is provided use of the kit of the ninth aspect for preventing or treating a proliferative e, wherein the therapeutically effective amount offthe plant defensin) of the first aspect, the nucleic acid of the second aspect, the vector of the third aspect, the host cell of the fourth aspect, the expression product of the fifth aspect or the pharmaceutical composition of the sixth aspect is administered be t, thereby preventing or ng the proliferative e.

[0047] in an eleventh aspect of the tinvention, there is provided a method for producing a plant in with reduced haemolytic activity, wherein the method comprises introducing into the plant defensin at least one alanine residue at or near the N-terminal of the defensin.

In a twelfth aspect ofthe present invention, there is provided a plant defensinwith reduced haemolytic activity produced by the method according to the eleventh aspect.

Definitions The term able” includes, and may be used interchangeably with, the terms “obtainable" and “isolatable”. Compositions or other matter of the t invention that is “derivable", nable" or “isolatable” from a particular source or process include not only compositions or other matter derived, obtained or isolated from thatsource or process, but also the same compositions or matter however sourced or produced.

As used herein the term "polypeptide" means a' polymer made up of amino acids linked together by peptide bonds, and includes fragments or ues thereof. The terms “polypeptide”, “protein" and “amino acid" are used interchangeably herein, although for the purposes of the present invention a ”polypeptide" may constitute a portion of a full length protein.

The term “nucleic acid" as used herein refers to a single- or double- stranded polymer of deoxyribonucleotide, ribonucleotide bases or known ues of natural nucleotides, or mixtures thereof. The term includes reference to the specified ce as well as to the sequence complementary o, unless otherwise indicated. The terms “nucleic acid”, “polynucleotide” and “nucleotide sequence" are used herein interchangeably. It will be understood that “5’ end" as used herein in relation to a nucleic acid corresponds to the inus of the encoded ptide and “3' end" corresponds to the C-terminus of the encoded ptide. [0052) The term "purified" means that the material in question has been removed from its natural environment or host, and associated impurities reduced or eliminated such that the molecule in question is the predominant species present. The term “purified" therefore means that an object species is the predominant species present (ie., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially, purified fraction is a '15 composition wherein the object species comprises at least about 30 percent (on a molar basis) of all macromolecular species present. Generally, a ntially pure composition will comprise more than about 80 to 90 percent of all olecular species present in the cemposition. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists ially of a single macromolecular species. The terms “purified" and “isolated” may be used interchangeably. Purity and homogeneity are typically determined using analytical chemistry ques such as polyacrylamide gel electrophoresis or high mance liquid chromatography.

A protein or nucleic acid that is the predominant-species present in a preparation is substantially purified. The term "purified" in some embodiments denotes that a protein or c acid gives rise to essentially one band in an electrophoretic gel.

The term “fragment” refers to a ptide Or nucleic acid that s a constituent or is a constituent of a polypeptide or nucleic acid of the invention thereof. Typically the fragment possesses qualitative ical activity in common with the polypeptide or nucleic acid of which it is a constituent. A peptide fragment may be between about 5 to about 150 amino acids in length, between about 5 to about 100' amino' acids in length, between about 5_ to about 50 amino acids in length,'or between about 5 to about 25 amino acids in . Alternatively, the peptide fragment may be between about 5'to about 15 amino acids in length. The term “fragment" therefore includes a ptide that is a constituent of a full-length plant defensin polypeptide and possesses qualitative biological ty in common with a full-length plant defensin polypeptide. A fragment maybe derived frOm a full-length plant defensin polypeptide" or alternatively may be sised by some other means,‘for example chemical synthesis.

The term “fragment” may also refer to a nucleic acid that encodes a constituent or isya . constituent of a polynucleotide of the invention. Fragments of a nucleic acid do not necessarily need to encode polypeptides which‘retain biological activity. Rather the nt may, for example, be useful as a hybridization probe or PCR . The fragment may be derived from a polynucleotide of the invention or alternatively may be synthesized by some other means, for example chemical'synthesis. Nucleic acids of the present invention and fragments thereof may also be-used in the production of antisense molecules using techniques known to those skilled in ‘ the art.

The term "recombinant" when used with reference, for example, to a cell, nucleic acid, protein or vector, indicates that the cell, nucleic acid, protein or vector has been modified by the introduction of a heterologOUS nucleic acid or protein or by the alteration of a native c acid or protein, or that the cell is derived from a cell so d. Accordingly, “recombinant" cells express that are not found Within the native (non-recombinant) form of the cell or express native _ genes genes that are othenlvise abnormally expressed, under sed or not expressed at all. By the term binant nucleic acid" is meant a c acid, originally formed in vitro, in general, by the . lation of a nucleic acid, for example, using polymerases and endonucleases, in a form not ly found in nature. In this , le linkage of different sequences is achieved. Thus , an isolated nucleic acid, in a linear form, or an expression vector formed'in vitro by ligating DNA molecules that are not normally , are both considered “recombinant” for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and, reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e., using the in vivo cellular machinery of the host cell rather than in ,vitro manipulations. However, such nucleic acids, once produced . recombinantly, although subsequently. replicated non-recombinantly, are still considered recombinant for the purposes of the invention. Similarly, a "recombinant protein" is aprotein made .' Using/recombinant techniques, i.e., through the expression of a recombinant'nucleic acid as depicted above. ,[0056] The terms "identical" or percent "identity" in the context of two Or more polypeptide (or nucleic acid) sequences, refer to two or moresequences or sub-sequences that are the same or have a ed percentage of amino acid es (or nucleotides) that are the same over a specified region, when ed and aligned for maximum correspondence over a comparison window or designated region, as measured using sequence comparison algorithms, or by manual alignment and visual inspection, such techniques being well known to the person skilled in the art.

As used herein the term "treatment", refers to any and all uses which remedy a disease state or ms,‘prevent the establishment of e, or othenrvise prevent, , retard, ameliorate or reverse the progression of disease or other undesirable symptoms in any way whatsoever.

Unless defined othenlvise, all cal and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (eg. in cell biology, chemistry, molecular biology and cell e). rd ques used for molecular and biochemical methods can. be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed. (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor,vN.'Y. and Ausubel et at, Short Protocols 1O in Molecular Biology (1999) 4th Ed, John Wiley & Sons, inc. - and the full version entitled Current ' Protocolsin Molecular Biology). .

Throughout this specification the word '7comprise", or variations such as “comprises“ or “comprising", ,will be understood to imply the inclUsion of a stated t, integer or step, or group of elements, integersor steps, butnot the exclusion of any other element, integeror step, or group of elements, integers or steps.

Throughout this specification, reference to numerical , unless stated otherwise, is to be taken’as meaning “about" that cal value. The term “about" is used to indicate that a value includes the inherent variation of error for thedevice and the method being employed. to determine the value, or the variation that exists among the study subjects.

[0061] The reference to any prior art in this specification is not, and should not be taken as an acknowledgement or any form of suggestion that prior art forms part of the common general knowledge of the person skilled in the art.

The entire content of all publications, patents, patent applications and other material recited in this specification is incorporated herein by reference.

Brief description of'the sequence listing SEQ lD NO: 1 is an exemplary full length amino\acid sequence for the plant in NoD173, with SEQ lD NO: 2 being the corresponding nucleic acid sequence.

SEQ ID NO: 3is an exemplary amino acid sequence for the mature domain of the plant defensin NoD173, with SEQ‘lD NO: 4 being the corresponding nucleic acid sequence.

SEQ ID NO: 5 is an exemplary amino aCid'sequence for a recombinantly altered mature ' domain of the plant defensin NoD173, having an additional'alanine residue at the N-terminal, With SEQ lD NO: 6'beingthe corresponding c acid sequence.

WO 56309 SEQ lD NO: 7 is the forward primer FLOR1 used for PCR amplification of NoD173 from genomic DNA with SEQ lD NO: 8 being the e primer .

SEQ ID NO: 9Is the forward primer Nth73fw used for Cloning of NoD173 into pPICQ for . expression in Pichia pastoris, with SEQ ID NO: 10 being the reverse primer.

Brief description of the figures The present invention will nowbe described, by way of example only, with reference to the following fgures Figure 1: is a diagrammatic representation of the ure of the sor proteins of the ‘10 two major classes of plant ins, as predicted from cDNA clones. In the first and largest class, the precursOr protein is ed of an endoplasmic reticulum (ER) signal sequence and a mature ‘ (defensin domain. (1A). The second class of defensins are produced as-larger precursors with inat propeptides (CTPPs) (1 B).

Figure 2: is an amino acid sequence alignment of the mature domains of various Class | (and Class II plant defensins. Identity or homology is indicated by black- or grey-boxed residues, respectively ((A) shaded version). Conserved disulfide bonds are shown as solid lines. (B) The same information is shown as an unshaded n.

Figure 3: shows that NoD173 kills mouse melanoma B16F1 cells with similarefficiency to NaD1 (leo 1.5 M) as indicated by‘in vitro cell viability assays.

[0072] Figure 4: shows that NoD173 is highly selective for the g of tumour cells compared to normal cells. The lC50 of NoD173 for normal human umbilical vein endothelial cells ) is ' shown as 75pM, indicating that normal cells are 50-fold more resistant to being killed than B16F1 tumour cells. NoD173 is shown to kill HUVEC only at a muchrhigher concentration when compared with another model class II defensin,'NaD1, which kills HUVEC at an |Csn of 15pM.

[0073] Figure 5: shows that the intra-tumour injection of 10mm3 established subcutaneous tumours with Nth73 (active) over two weeks dramatically reduced tumour growth when compared to reduced and Valkylated NoD173 (inactive) and vehicle control (Phosphatefbuffered saline, PBS). ‘} Figure 6: shows the effect of NoD173 on (A) the human us cell carcinoma cell line (A431) and (B) the human BCC cell line (CRL-7762) using MTT cell viability assays. NoD173 killed .30; CRL-7762 and A431 at low [M concentrations (le0 15pM and 10pM, respectively) indicating that both of these non-melanoma skin cancers are sensitive to killing by .

Figure 7: shows a graphical representation of the effect of untreated NoD173 (black bars) or inactive reduced and alkylated NoD173 (white bars) on the permeabilisation of human U937 myelomonocytic cells. 2012/001267 .

Detailed description of the invention The inventors have isolated and Characterized a previously undisclosed Class II defensin from the Solanaceae plant family that has potent cytotoxic ties and which surprisingly has a Very high ICso. This newly disclosed plant defensin has a very high degree of specificity for g tumour cells, as opposed to normal, healthy cells. Accordingly, these findings provide for vastly improved compositions and methods for the prevention and treatment of proliferative diseases such, as cancer,'as well as associated systems and kits. Such compositions, methods, systems and kits provide a hitherto unseen degree of specific targeting against tumour cells versus normal, healthy cells, and ore minimize sideeffects. Such compositions also allowfor much higher safe doses of treatment, y facilitating a much improved degree of efficacy in ent.’ These significant findings describe a n0vel and important way in which proliferative diseases may be prevented and treated. Accordingly, these findings provide for compositions and methods for the tion or ent of proliferative diseases such as cancer, as well as associated uses, systems and kits.

NoD173 is a plant defensin isolated from floral tissue of Nicofiana occidenta/is ssp obliqua.

The amino acid and coding seqUences 'of Nth73 are disclosed herein. The ability to produce ' large quantities of active defensins such as NoD173 is of fundamental importance when considering potential use as a therapeutic in a clinical setting. The purification of the required large ’20 amounts of Nth73 from its natural source s of the tobacco N. occidentalis) is not le, necessitating the production of active recombinant protein. A Pichia pastoris expression system ‘ combined with a defined protein purification approach has been successfully established to produce high levels of pUre active recombinant N_oD173.

The inventors have shown that NOD173 selectively kills a number of different'tumour cells.

For e, NoD173 has been shown to kill mouse melanoma BtBF 1 cells with similar efficiency to NaD1 (le0 1.5 pm as indicated by in vitro cell viability assays (Figure 3). Furthermore, NoD173 is highly selective for the g of tumour cells over normal cells.,The IC59 of NoD173 for normal human cells umbilical vein elial cells (HUVEC) is _75uM, indicating normal cells are 50~fold more resistant to being killed than Bl6F1 (Figure 4).. The cant improvement of NOD173 over other class It defensins is also clearly evident when compared to NaD1, which kills HUVEC at a much lower concentration (le0 of 15uM) (Figure 4).

In addition, toxicity s in mice administered NoDl73 showed no toxicity when NoD173 was delivered subcutaneously or intratumourly at concentrations of up to 5mg/kg. _NoD173 has also been shown to reduce the growth of aggressive solid tumours in vivo. For ‘ example, after the intra-tumour injection of mice, causing the establishment of subcutaneous tumours, subsequent administration with NoD173 over tWo weeks dramatically reduced tumour growth when compared to inactive NoD173 (reduced and alkylated) and a vehicle control (Phosphate-buffered saline, PBS) (Figure 5)., These data indicate that NoD173_represents a class II defensin with significant selectivity improvements over other class II defensins such as NaD1.

' NoD173_ has further been shown to provide ive treatment fOr basal cell and squamous cell Carcinoma. The susceptibility of the human us cell carcinoma cell line (A431) and the human BCC cell line (CR1.-7762) to NoD173 was ed in vitro using MTT Cell viability assays. 1O NoD173 killed CRL-7762 and A431 at low [N concentrations (le0 15M and 1,0uM tively) indicating that both of these non-melanoma skin cancers are sensitive to killing by NoD173 (Figures 6A and B).

Plant defensins for use in preventing or treating a erative disease

[0082] The present invention provides novel plant ins. The novel plant defensins are useful in preventing or treating a proliferative disease.

In preferred embodiments, the plant defensin is NoD173 (SEQ ID NOs: 1, 3 or 5), being a plant gamma-thionin having at least eight canonical cysteine residues .which form disulfide bonds in the configuration: CysI-CySVIII, CysII-CySIv, CySIII-Cyva and ySVII. ‘2o [0084] The plant defensin is also a Class H plant defensin with or having previously had a C- . terminal prodomain or tide (CTPP), and being derived or derivable from ceae.

In some embodiments, the plant defensin comprises the amino acid sequence set forth as SEQ ID NOs: 1, 3 or 5 or a fragment thereof. in yet other embodiments, the plant defensin comprises an amino acid sequenCe that is 95%, 90%, 85%, 80%, 0% 65% or 60% identical to the amino acid Sequence set forth as SEQ ID NOsz1, 30r50rafragment thereof in 'still other embodiments, the plant defensin comprises an amino acid'sequence that is 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%,81%, 80%, 79%, 78%, 77%, 76% 75%,774%,773%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 9%, 58%, 557%,6%,y55%, 54%, 53%, 2%, 51%, 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, . 14%, 13%,: 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% identical to the amino acid sequence set forth as SEQ ID NOsz1, 3 or 5 or a fragment thereof. -19..

In some embodiments, the plant defensin comprises an amino acid sequence that is 85% identical to the amino acid sequence set forth as SEQ ID NOs:1 ,‘ 3 or 5 or a fragment thereof.

In particular embodiments, the plant defensin is derived or derivable from Nicotiana Occidentalis.

In particular embodiments, the plant defensin is derived or ble from Nicotiana Occidentalis spp obliqua.

In some embodiments, the plant defensin may be a fragment of any amino acid sequence or a fragment or complement of any nucleic acid sequence disclosed ; In particular embodiments, the fragment may comprise a mature domain.

[0093] In preferred embodiments, the amino acid ce of the mature domain is set forth as SEQ ID NO: 3. ' [0094] In some embodiments, the plant defensin may be an isolated, purified or recombinant plant defensin. - In particular ments, the recombinant plant defensin has an additional alanine .15 residueat or near the N-terminal end.

In preferred embodiments, the recombinant plant defensin has reduced haemolytic ty.

In particularly preferred embodiments, therecombinant plant defensin comprises the amino ' acid sequence set forth as SEQ ID NO: 5, or a fragment thereof.

In particular embodiments, the plant defensin‘comprise's an amino acid sequence derived 2o from the folIowing genomic clone, wherein the ER amino acid signal ce is shown in s, the inal propepetide is shown in underline, and the intronic nucleotide ce is shown with nucleotides in lowercase. The uppercase amino acid sequence shown without italics or underline is the mature protein domain (SEQ’ID'NO: 3). 10 20 30 40 50 60 ....l....l....|....l....|....]....l....l...,I....|....|....l ATGGCTCGCTCCTTGTGCTTCATGGGATTTGCTATCTTGGCAATGATGCTCTTTGTTGCC M A R S L C F "M G F A I L A M M L F V A 70 80 90 100- * '110 120 ...|....|....l....|..,.|....|....I....I....|....I....I TAngtttgtctccatttattcctctaaaacccCattaaaataataaaagctatgactgg 130 140 150 160 170 180 f...l....l....I....|....lu...l....l.J..|..c.|....l....l....| tttagttatcatgatgaacatcaagttacacttcttatgatttgtctagtaattattcaa 2012/001267 190 200 210 ' a 220 230 240 .|....1....|;..,|.;..|;...|....|.;..|....|....|;...|....II gtgtggttatcattttgatgtatttgttgttaaaécgacgaattaatctatagtatacgt 250* 260 270 280 290 300 ....|....l.‘..l....l....If...l...}1....I....1....l;..,l....| ctgatagctttgaaaaatcctgaaaaatatgtgttcgcattagttcttccaaaatagtat 350 V . 310 320 .330 340 360 ....|....|.,..|....|....l....|....|....|....|5...|....|....| ataggggcggtatattttttagggtatgatgtcgatctatattacatcccttggaatgcg' 370. 380 390 400 410 420 ....l....|....|....l....|....|....|....l....|..}.|....|....| gcctgattttctggaccctttatgcactggactgcccttatatatatacacacatgtatg 430 440 450 460, 470 480 ...|....|....|fl...|....I...;|....|....|....|....|;...| tatgtttaataaccttgaatcctgtttttttattgtttctttcaattctatcttttcttt 490" " . 500 ,. 510 520 530 540 -I....|....|.;..|....|....;....|....| .|....|....1. ..| -tgttctaacattggtaagtacttgtgaatgattgtaGAGGTGCAAGCTAGACAATGCAAA E V Q A R Q C K 550 560 570' 580 590 v 600 ....r....¢....p....|....|....|....|.~..|....|....|;...|....| GCAGAAAGCAATACATTCACTGGAATATGCATTGCCAAACCACCATGCAGACAAGCTTGT A E s N T F T G I c I A K P P c -R Q A c '610 620' .630 640 650 '660 ...L1....I....|....|....|....I....|....|....|....|....|....|.

ATCCGTGAGAAATTTACTGATGGTCATTGTAGCAAAGTCCTCAGAAGGTGTCTATGCACT I R .E K F T D G H C S K V L R 'R C ‘L C T 670 680 690 700 710 720 ..| .l...'.rl-.--| I .....l....l....I....|.;..I.;..|....l AAGCGATGTGTGTTTGATGAGAAGATGATCGAAACAGGAGCTGAAACCTTAGCTGAGGAA K R C V E D E ,K M I E T G A E T L A E E ’730 740, 750 760 770 ....|,...l....|....I..;.l....|....I....l....l....|.

GCAAAAACTTTTGCTGCAGCTTTGCTTGAAGAAGAGATAATGGATAACTGA A K T F A A A AL L E E E .I M D N _* Polynucleotides In embodiments where the compositions of the t invention comprise polypeptides, thepresent invention also provides nucleic acids encoding such polypeptides, or fragments or complements thereof. Such nucleic acids may be naturally occurring or may be synthetic or recombinant.

] In some embodiments, the nucleic acids may be operably linked to one or more promoters.

In. particular embodiments, the nucleic acids may encode ptides that prevent or, treat proliferative es.

In some embodiments, the plant in is therefore provided in the form of a nucleic acid.

In some embodiments, the plant defensin c acid encodes the amino acid sequence set forth ' as SEQ ID NOS: 1, '3 ‘or 5 or a fragment thereof. In yet other embodiments, the plant defensin nucleic acid comprises the nucleotide sequence set forth as SEQ ID NOS: 2, 4 or 6 or a fragment or complement thereof.

In yet other embodiments, the plant defensin nucleic acid comprises a nucleotide sequence that is 95%, 90%, 85%, 80%, 75%, 70%, 65% or 60% identical to the nucleotide sequence set forth as SEQ ID NOs: 2, 4 or 6 or a fragment or complement thereof. '[00103] In still other embodiments, the plant defensin c acid comprises a nucleotide sequence that is 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%,I82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%, 51%, 50%, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%; ’%. 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%. 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% cal to the nucleotide sequence set forth as SEQ ID NOs: 2,4 or 6 or a fragment or ment thereof. . [00104] In some embodiments, the plant defensin-comprises a otide sequence that is 85%, cal to the nucleotide sequence set forth as SEQ ID Nos: 2, 4 or 6 or a fragment or complement thereof.

Vectors, host cells and expression products

[00105] The present invention also provides vectors comprising the nucleic acids as set forth herein. The vector may be a plasmid vector, a viral vector, Or any other suitable vehicle adapted for the insertion of foreign sequences, its introduction into cells and the expression of the introduced sequences. The vector may be a eukaryotic expression vector and may include expression control. -- and processing sequences such as a er, "an enhancer, ribosolme binding sites, polyadenylation signals and transcription termination sequences. In preferred embodiments, the ‘ vector comprises one or more nucleic acids ly encoding any one or more of the plant defensins set forth .

The present invention further provides host cells comprising the s as set fOrth herein.

Typically, a hOSt cell is ormed, transfected or transduced with a vector, for example, by using , electroporation followed by subsequent selection of transformed, transfected or transduced cells on selective media. The resulting heterologous nUcleic acid sequences in the‘form of vectors and 7 nucleic acids inserted therein may be maintained extrachromosomally or may be introduced into 1O the host cell genome by homologous recombination. Methods for such cellular transformation, transfection or transduction are well known to those of Skill in the art. Guidance may be obtained. for example, from standard texts such as Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989 and Ausubel et al., Current Protocols inMolecu/ar Biology, .

Greene Publ. Assoc. and Wiley-lntersciences, 1992. .

[00107] The present ion moreover provides expression products of the host cells as set forth * herein. In some embodiments, the expression product may be polypeptides that prevent or treat proliferative diseases. In preferred embodiments, the expression product is. any one or more of the ‘ plant defensins disclosed herein. itions The t ion also provides pharmaceutical compositions for use in preventing or treating proliferative diseases, wherein the pharmaceutical compositions comprise a plant defensin, a c acid, a vector, a host cell or an expression product as sed , together with a I h pharmaceutically acceptable carrier, diluent or excipient.

[00109] Compositions of the present invention may therefore be administered therapeutically. In such applications, compositions may be, administered to a subject already suffering from a condition, in an amount sufficient to cure or at least lly arrest the condition and any complications. The ty of the composition should be sufficient to effectively treat the t.

Compositions may be prepared according to methods which are known to those of ordinary skill in the art and accordingly may include a cosmetically orpharmaceutically acceptable carrier, excipient or diluent. Methods for preparing administrable compositions are apparent to those skilled in the art, and are described in more detail in, for example, Remington's Pharmaceutical Science, 15th ed., Mack Publishing Company, Easton, Pa., incorporated by nce herein.

The composition may incorporate any suitable surfactant such as an anionic, cationic or non-ionic surfactant such as sorbitan (esters or polyoxyethylene derivatives thereof. Suspending agents Such as natural gums, cellulose derivatives or inorganic materials such as silicaceous silicas, and other ingredients such as lanolin, may also be ed.

The itions may also be administered in the’form of liposomes. Liposomes may be derived from phospholipids or other lipid nces, and may be formed by mono- or multi- ar hydrated liquid crystals dispersed‘in an aqueous medium. Any non-toxic, logically acceptable and metabolisable lipid capable of forming liposomes may be used. The compositions in liposome form may contain isers, preservatives and excipients. Preferred lipids include "10 holipids and phosphatidyl cholines (lecithins),'both natural and synthetic. s for producing liposomes are known in the art and in this regard ic reference is made to: Prescott, Ed., Methods'In Cell Biology, Volume XIV, Academic Press New York NY. (1976), p. 33 et seq, the contents of which are incorporated herein by reference.

In some embodiments, the composition may beIn the form of a tablet, liquid, , cream, gel, paste or emulsion.

Dosages The .“therapeutically effective” dose level 'for any particular patient will depend upon a variety of factors including the condition being treatedand’ the severity of the condition, the actiVity . of the compound or agent employed, the composition employed, the age, body weight, general health, sex and diet of the patient, the time of administration, the route of administration, the rate of sequestration of the plant defensin or composition, the duration of the ent, and any drugs used in chthion or dental with the treatment, togetheruwith Other related factors well known in the art." One skilled in the art would therefore be able, by routine experimentation, to determine an ive, non-toxic amount of the plant defensin or composition which‘would be required to treat applicable conditions. ' Typically, in eutic applications, the treatment would be for the duration of the disease state.

Further, it will be apparent to one of ordinary skill in the art that the l quantity and '30 spacing of individual dosages of the composition will be determined by the nature'and extent of the condition being treated, the form, route and site of administration, and the nature of the particular individual being treated. Also, such optimum conditions can be determined by conventional techniques. 2012/001267 _-24— , [00116] It will also be apparent to one of ordinary skill inthe art that the optimal course of ent, such as the number of doses of the composition given per day for a defined number of days, can be ascertained by those d in the art using conventional course of ent‘determination tests. in terms of weight, a therapeutically effective dosage of a composition for administration to a patient is ed to be in the range 0f about 0.01mg to about 150mg per kg body weight per 24 hours; typically, about 0.1mg to about 150mg per kg body weight per 24 hours; about 0.1mg to about 100mg per kg body weight per 24 hours; about 0.5mg to aboUt 100mg per kg body weight per 24 hours; or about 1.0mg to about 100mg per kg body weight per_ 24 hours. More typiCally, an .10.' effective dose range is expected to be in the range of about 5mg to about 50mg per kg body Weight per 24 hours.

] Alternatively, an effective dosage may be up to about 5000mg/m2. lly, 'an effective dosage is expected to be in the range of about 10 to about 5000mg/m2, typically about 10 to about 2500mg/m2, about 25 to‘ about 2000mg/m2, about 50 to abdut 1500mg/m2, about 50‘ to about 1000mg/m2, or about 75 to about 600mg/m2.

Routes of administration ' [00119] The compositions of the present invention can be stered by standard routes. In general, the itions may be administered by the parenteral (e.g., intravenous, intraspinal, subcutaneous or intramuscular), oral or topical route.

In other embodiments, the compositions may be administered by other enteral/enteric routes, such as rectal, subtinguaior sdbiabiat, or'via the central nervous system, such as through epidural, erebral’ or intracerebrdventricular routes. .Other locations for administration may include via epicutaneous, transdermal, intraderrnai, nasal, intraarterial, intracardiac, intraosseus, intrathecal, intraperitoneal, intravesical, intravitreal, intracavernous, intravaginal or intrauterine routes.

Carriers, excipients and diluents Carriers, excipients and diluents must be "acceptable" in terms of being compatible with the . other ingredients of the composition, and not deleterious to the recipient thereof. Such carriers, excipients and diluents may be used for enhancing the integrity and half-life of the compositions of the present invention. These may also be used to enhance or} protect the biologicalactivities of the compositions of the present invention.

Examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, safflower oil, olive oil', cottonseed oil, maize oil, sesame oils, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and: methylphenyl lpoxane; volatile silicones; " mineral oils such as liquid paraffin, soft paraffin or squalane; cellulose tives suchhas methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium carboxymethylcellulose or hydroxypropylmethylcellulose; lower, ls, for e ethanol or iso-propanol; lower nols; lower polyalkylene glycols or lower ne glycols, for example polyethylene glycol, polypropylene , ethylene . propylene glycol, 1,3-butylen'e glycol or glycerin; fatty acid esters such as isopropyl palinitate, isopropyl myristate or ethyl oleate; polyvinylpyrolidone; agar; gum tragacanth or gum acacia, and petroleum jelly. lly, the carrier or carrierswill form from % to 99.9% by weight of the compositions. . [00123] The compositions of the invention may be in a form suitable for administration by injection, in the form of a formulation suitable for oral ingestion (such as capsules, tablets, caplets, elixirs, for’ example), in the form of an ointment, cream or lotion suitable for topical administration, in an , aerosol form suitable for administration by inhalation, such as, by intranasal inhalation. or oral inhalation, in a form suitable for parenteral administration, that is, subcutaneous, intramuscular or intravenous injection.

For administration as an injectable solution or suspension, non-toxic acceptable diluents or carriers can include Ringer's solution, isotonic saline,.phosphate buffered saline, ethanol and 1,2 - propylene glycol.

Methods for preventing or treating proliferative diseases The present invention provides methods for ting or treating a proliferative disease, Wherein the methods comprise administering to a subject a therapeutically ive amount of a plant defensin, a c acid, a vector,- a host cell, an expression product or a pharmaceutical . composition as disclosed herein, thereby preventing or treating the proliferative disease. , ] The present invention also provides use of plant defensins, nucleic acids, vectors, host cells and- expression products as herein disclosed in the preparation of medicaments for preventing or treating a proliferative disease.

In some ments, the proliferative disease may be a cell proliferative disease selected from the groUp comprising an angiogenic e, a metastatic disease, a tumourigenic disease, a stic disease and cancer.

WO 56309 , in some embediments, the proliferative disease may be cancer. in particular embodiments, the cancer may be selected from the group comprising basal cell carcinoma, squamous cell oma, actinic keratosis, bone cancer, bowel cancer, brain cancer, breast cancer, cervical cancer, leukemia, liver cancer, lung cancer, lymphoma, melanoma, ovarian cancer, pancreatic cancer, prostate cancer orthyroid cancer.

In other embodiments, the cancer may be selected from the group comprising acute lymphoblastic leukemia, actinic sis, acute myeloid leukemia, adrenocortical carcinoma, AIDS— related cancers, anal cancer, appendix cancer, ytoma, B-cell lymphoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, bowel , brainstem glioma, brain 1O tumour, breast , bronchial adenomas/carcinoids, Burkitt's ma, carcin'oid tumour, cerebral astrocytoma/malignant , cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmOplastic small round cell tumour, endometrial cancer, ependymoma, esophageal cancer, extracranial germ cell tumour, extragonadal germ cell tumour, extrahepatic bile duct cancer, eye cancer, intraocular melanoma/retinoblastoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid , intestinal stromal tumour (GIST), germ cell tumour, gestational trophoblastic tumour, glioma, gastric carcinoid, head and/or‘neck cancer, heart cancer, hepatocellular (liver) cancer, hypopharyngeal , hypothalamic and visual pathway glioma, Kaposi sarcoma,‘kidney cancer, eal cancer, leukemia (acute blastic/acute myeloid/chronic lymphocytic/chronic myelogenous/hairy cell), lip and/or oral cavity , liver cancer, all cell lung cancer, small cell lung cancer, lymphoma (AIDS— ‘ relatedIBurkitt/cutaneous T-Cell/Hodgkin/non-Hodgkin/primary central nervous system), ‘macroglobulinemia, ant fibrous histiocytoma of bone/osteosarcoma, oblastoma, melanoma, Merkel cell oma, mesothelioma, atic squamous neck cancer, mouth ‘25 cancer. multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, myeloid leukemia, myeloproliferative disorders, nasal cavity and/or paranasal sinus , nasopharyngeal carcinoma, lastoma, non-Hodgkinlymphoma, all cell lung cancer, oral cancer, oropharyngeal , osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumour, pancreatic cancer, islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and/or supratentorial primitive. neuroectodermal tumours, pituitary adenoma, plasma cell neoplasia/multiple myeloma, pleuropulmonary blastorna, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal Cell carcinoma, retinoblastoma, rhademyosarcoma, salivary gland cancer, Ewing sarcoma, Kaposi sarcoma, soft tissue Sarcoma, .' uterine sarcoma, Sezarysyndrome, skin cancer (non-melanoma), skin cancer (melanoma), skin carcinOma (‘Merkel-cell), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer with metastatic occult primary, stomach cancer, supratentorial ive neuroectodermal tumour, T-celi lymphoma, testicular cancer, throat cancer, thymoma and/or thymic carcinoma, thyroid cancer, transitional cancer, trophoblastic tumour, ureter and/or renal pelvis cancer, urethralcancer, uterine endometrial cancer, e sarcoma, vaginal , cancer, visual pathway and hypothalamic glioma, vulva cancer, Waldenstrom macroglobulinemia or Wilms tumour. .

Kits The present inventiOn provides kits for preventing or treating ferative disease, wherein the kits comprise a therapeutically ive amount of a plant defensin, a nucleic acid, a a host cell,'an expression product or a pharmaceutical composition as herein disclosed. _ vector, The t invention also provides use of the kits disclosed herein for preventing or treating a proliferative disease, wherein the therapeutically effective amount of a plant defensin, a nucleic acid, a , a host cell, an expression product or a pharmaceutical composition as herein 1 sed is administered to a subject, thereby preventing or treating the proliferative disease. .20 [00132] Kits of the preSent invention facilitate the employment of the methods of the t invention. Typically, kits for carrying out a method of the invention contain all the necessary reagents to carry out the . For example, in one embodiment, the kit may comprise a plant in, a polypeptide, a polynucleotide,’a vector, a host cell, -an expression product or a pharmaceutical composition as herein disclosed. ] lly, the kits described herein will Omprise one or more containers. In the context of the present invention, a compartmentalised kit-includes any kit in which compounds or compositions ntained in separate cbntainers, and may include small glass containers, plastic containers or strips of plastic or paper. Such containers may allow the nt transfer of compounds or compositions from ‘one compartment to another compartment whilst ng cross- 30_ contamination of s, and the addition of agents or solutions of each nerfrom one compartment to another in a quantitative fashion. .[00134] Typically, a kit of the present‘invention will also include instructions for using the kit components to conduct the appropriate methods.

Methods and kits of the present invention are equally applicable to any animal, ing humans and other animals, for example including non-human primate, equine, bovine, ovine, caprine, leporine, avian, feline and canine species. AccOrdingly, for application to different species, a single kit of the invention may be applicable, or alternatively different kits, for example containing nds or compositions specific for each individual species, may be required.

] Methods and kits of the present invention} find application in any circumstance in which it is ble to‘ prevent or treat a proliferative disease.

Methods for producing plant defensins with reduced haemolytic activity '[00137]Thet present invention provides s for producing plant defensins with reduced. haemolytic activity, wherein the method comprises ucing into the plant defensin at least one alanine residue at or near the.N-termina| of the in. The person skilled in the art would Understand that several methods may be employed to achieve such addition of an N-terminal e, such as site-directed nesis, homologous recombination, transposons and non- '15 homologous end-joining.

Haemolytic activitymay be regarded as “reduced" if the activity of' the plant defensinresults in relatively less hemolysis than occurs, or would ably be expected to occur, through use of ,a corresponding plant defensin that has not been modified to reduce haemolytic activity.

The t ion also provides plant defensins with reduced haemolytic activity produced by the methods disclosed herein.

Combination Therapies Those skilled in the art will appreciate that the polypeptides, nucleic acids, vectors, host cells, expression products and itiOns disclosed herein may be stered as part of a combinationtherapy approach, employing one or more of the ptides, nucleic acids, vectors, host cells, expression products and compositions disclosed herein in conjunction with other therapeutic approachesto the methods disclosed . For such combination therapies, each component of the combination may be administered at the same time, or tially in any order, or at different times, so as to provide the desired therapeutic effect. When administered separately, it may be preferred for the components to be administered by the same route. of administratidn, although it is not necessary for this to be so. Alternatively, the components may be formulated together in a single dosage unit as a combination product. Suitable agents which may be used in combination with the compositions of the present invention will be known to those of ordinary skill in -29! the art, and may include, for example, chemotherapeutic agents, radioisotopes and targeted therapies such as antibodies. [001411Chemotherapeutic agents to be used in combination with the polypeptides, nucleic'acids, vectors, host cells, expression products and compositions sed herein may include alkylating agents such as cisplatin, carboplatin, oxaliplatin, mechlorethamine, cyclophosphamide, chlorambucil and ifosfamide, anti-metabolites such as purine or pyramidine, plant ids and terpenoids such as vinca alkaloids (including vincristine, vinblastine, vinorelbine and ine), and s (including paclitaxel and docetaxel), podophyllotoxin, omerase inhibitors such as irinotecan, topotecan amsacn’ne, ide, etoposide phosphate and teniposide, anti--neoplastics such as doxorubicin, epirubicin and bleomycin, and tyrosine kinase inhibitors.

Targeted ies to be used in combinatidn with the polypeptides, nucleic acids, vectors, ,host cells, expression products and itions disclosed herein may include, for example, imatinib mesylate, nib, nilotinib, trastuzumab, lapatinib, gefitinib, erlotinib, cetuximab, panitumumab, temsirolimus, everolimus, stat, romidepsin, bexarotene, tinoin, tretinoin. bortezo‘mib, pralatrexate, bevacizumab, sorafenib, sunitinib,-pazopanib, mab, alemtuzumab, ofatumuab, tositumomab, ositumomab, ibritumomab tiuxetan, denileukin diftitox, tamoxifen, toremifene, fulvestrant, ozole, exemestane and letrozole Other therapies may also be used in combination with the polypeptides, nucleic acids, ‘ vectors, host cells, expression products and compositions disclosed herein, including, for example, surgical intervention, dietary regimes and. supplements, hypnotherapy, alternative medicines and physical therapy.

Timing of Therapies Those skilled in the art will appreciate that the polypeptides, polynucleotides, vectors, host cells, expression products and compositions disclosed herein may be stered as a single agent or as part of a combination therapy approach to the methods disclosed herein,leither at diagnosis or subsequently fter, for example, as follow-up treatment or consolidation therapy as a complimentto currently available therapies for such treatments, The polypeptides, polynucleotides, vectors, host cells, expression products and compositions disclosed herein may '30 also be used as preventative therapies for subjects who are genetically or environmentally predisposed to developing such diseases. 2012/001267 The person skilled in the' art Will understand and appreciate that ent features disclosed herein may be combined to form-cembinations of features that are within the scope of the present invention.

The present invention will now be further described with reference to the following examples, which are illustrative only and non-limiting.

Examples Materials and methods’ PCR amplification of NoD173 from genomic DNA The REDExtract-N-Amp Plant PCR Kit (Sigma) was used to t and y the genomic DNA encoding NoD173 from a leaf section of Nicotiana occidentalis ssp. obliqua. In brief, a crude genomic DNA preparation was prepared by incubating a piece of leaf tissue (using a standard hole—punch) in 100 pL of Extraction Solution at 95°C for 10 min. This was followed by the addition of an equal volume of Dilution Solution. An aliquot of the diluted extract (20 pl) was then ‘ combined with the 2 x REDExtract-N-Amp PCR ReadyMix (50 pl) and 4 pleach of 10 pM forward primer FLORl (5’-G GAA TTC TAA ACA ATG GCT CGC TCC TTG TGC-3‘) (SEQ lD NO: 7) and pM reverse primer FLOR2 (5f-GC TCT AGA TCA GTT ATC CAT TAT CTC TTC-3') (SEQ ID .NO: 8). The reaction volume was adjusted to 100 pl with the addition of’ e milliQ water. The REDExtract—N-Amp PCR ReadyMix contained the‘required buffer, salts, dNTPs and‘ Taq DNA rase required for the PCR. .

The PCR was performed with the following ature profile: an initial cycle of 95°C, 2 _ min; 30 cycles of 95°C, 1 min; 55°C, 1 min; 7250, 2min, and a final extension cycle of 72°C for 10 . min. Following the reaction, the amplified t(s) were loaded directly onto a 1.8% (w/v) agarose gel and subjected to gel electrophoresis.

A prominent DNA band of ~800 bp was observed. it Was excised from the gel, d and cloned into the pCR2.1-TOPOI vector (lnvitrogen) before confirmation of its identity by DNA sequencing using primers to the g M13 priming sites on the plasmid. The cing reactions were performed at the Australian Genome and Research Facility, Melbourne. Subsequent analysis of DNA Sequences was performed using the BioEdit sequence alignment editor (version .0.9) software (Hall TA, 1999, Nucl Acids Symp 41-: 95—98)‘.

Cloning of NoD173 into pPIC9 for expression in Pichia pastoris The DNA sequence encoding the mature defensin domain of NoDi73 was ed with forward primer NoD173fw (5’-CTC GAG AAA AGA GCT AGA CAA TGC AAA GCA GAA AG-3') (SEQ ID NO: 9) and reverse primer rv (5’-GCG GCC GCT TAA CAT CGC TTA GTG CAT . AGA CA-3’) (SEQ ID NO: 10), using pCR2.1-TOPO-Nth73 plasmid 'as the DNA template, together with Phusion DNA polymerase (Finnzymes) and the corresponding buffer and dNTPs. The PCR was pen‘o'rmed with the following temperature profile: an initial cycle of 98°C, 30 sec; 30 cycles of 98°C, 30 sec; 58°C, 30 sec; 72°C, 30 sec, and a final extension cycle of 72°C for 10 min.

The amplified PCR product-corresponding to mature , was subsequently cloned into the pPlC9 expression vector (Invitrogen) directly in-frame with the yeast a-mating factor secretion Signal using the restriction enzymes Xhol and Nail. An e was added to the N- terminus of the NoD173 sequence to ensure efficient cleavage of the signal at the Kex2 cleavage site. After transformation into E. coli TOP10 cells, the pPIC9-NoD173 plasmid was isolated and linearized using Salt to allow integration .at the his4 locus of the'P. pastoris genome. Linearized ‘ "DNA was transformed into electrocompetent yeast as described by Chang et al. (2005) and His+ . ormants were selected for by plating onto MD agar (1.34% YNB, 4 x 105% biotin, 1% dextrose and 1.5% agar). A single positive colony was used to inoculate .200 mL of BMG (100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4 x 105% biotin, 1% glycerol) and incubated with nt shaking at 30°C until the' ODeoo reached ~5.0. The cell mass was ted by ' centrifugation (1,500 g, 10 min) and resuspended into 1 L of BMM (100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4X 105% biotin, 0.5% ol) to a final 00600 Of 1.0 to induce sion.

Expression was continued for 4 days with constant shaking at 30°C after which time the cell mass was removed by centrifugation (10,000 g, 10 min) and the NoD173-containing supernatant was collected. ' [00152] One-twentieth volume of 1 M potassium phosphate buffer (pH 6.0) was added to the supernatant and the pH was adjusted to 6.0 with the addition of 10 M KOH. The supernatant was then applied to an SP Sepharose column (GE Healthcare BioscienceS) pre-equilibrated with 100 . mM potassium phOSphate buffer (pH 6.0). ing extensive washing with 100 mM potasSium phosphate buffer (pH 6.0), the bound proteins were eluted with 100 mM potassium phosphate buffer (pH 6.0) containing 0.5 M NaCI. The eluted proteins were subsequently concentrated using Amicon Ultra 3000 MWCO centrifugal filters (Millipore) and desalted in milliQ water using the same centrifugal filters.

The protein cencentration was ined using the BCA assay (Pierce) and the purity and identity of NOD173 was assessed by reducing SDS-PAGE and mass spectrometry. 2012/001267 Purification of NoD173 from Nicotiana occidentalis As would be known to those of skill in the art, it is also possible to isolate NOD173 from its natural source, n whole N. occidentalis flowers can be ground to a fine powder and extracted in dilute sulfuric acid as described previously (Lay et al., 0003a). Briefly, flowers can be frozen in liquid en, ground to a fine powder in a mortar and pestle, and homogenized in 50 mM ic acid (3 mL per g fresh weight) for 5 min using an Ultra-Turrax homogenizer (Janke and Kunkei).

After stirring for 1 h at 4°C, cellular debris can "be removed by filtration through Miracloth (Calbiochem, San Diego, CA) and centrifugation (25,000 x g, 15 min, 4°C). The pH can then be ’ adjusted to 7.0 by addition of 10 M NaOH and the extract can be stirred for 1 h at 4°C before centnfugation (25,000 x g, 15 min, 4°C) to remove itated proteins. The atant (1.8 L) can be applied to an .SP‘SepharoseT" Fast Flo'w (GE Healthcare Bio-Sciences) column (2.5.x 2.5. cm) preequilibrated with 10 mM sodium ate buffer. d proteins can be removed by g with 20 column volumes of 10 mM sodium phosphate buffer (pH 6.0) and bound prOteins > can be eluted in 3 x 10 mL fractions with 10 mM sodium phosphate buffer (pH 6.0) containing 500 mM NaCl. Samples from each purification step can be analyzed by SDS-polyacrylamide gel _ eledtrophoresis (SDS-PAGE) and blotting with anti-NoDl73 dies. ons from the SP Sepharose column containing NoD173 can be subjected to reverse-phase high performance liquid chromatography (RP-HPLC).

Reverse-phase high performance liquid chromatography- Reverse-phase" high performance liquid chromatography (RP-HPLC) can' be performed on a System Gold HPLC (Beckman) coupled to a detector (model 166, Beckman) using a preparative C8 column (22 x 250 mm, Vydac) with a guard column attached. Protein samples can be loaded in '25 buffer A (0.1% [vlv] triflubroacetic acid) and eluted with a linear gradient of 0-100% (v/v) buffer B (60% [vlv] acetonitrile in 0.089%(v/v] trifluoroacetic acid) at a flow ”rate of 10 mUmin over 40 min.

Proteinscan be detected by monitoring absorbance at 215nm (Figure 18). Protein peaks can be collected and analyzed by SOS-PAGE.

Samples from each stage of NoD173 purification (30 (JL) can be added to NuPAGE® LDS _30 sample loading buffer (10 pL, lnvitrogen) and heated to 70°C for 10 min. The samples can then be loaded onto'NuPAGE® precast 4-12% Bis-Tris polyacrylamide gels (lnvitrogen) and the proteins can be separated using an XCell-SUrelock electrophoresis apparatus (lnvitrogen) run at 200 V. 2012/001267 Proteins can be visualized by Coomassie Blue staining or) transferred onto ellulose for immunoblotting with anti-N00173 antibodies. ion of NoD173 ins from seeds As would also be known to the person skilled in the art, it is also possible to e NoD173 defensins from seeds, wherein Nicotiana occidentalis seeds (5009) can be placed in an Ultra- Turrax homogenizer (Janke and Kunkel) and ground to a fine powder before addition of 50 mM sulfuric acid (4 mL per g fresh weight) Homogenisation can be continued for 5 min before the homogenate'IS transferred to a beaker and stirred for 1 h at 4°C. Cellular debris can be remOVedby 1O filtration through Miracloth (Calbiochem, San Diego, CA) and centrifugation (25,000 x g, 15 min, 4°C). The pH can then be adjusted to 7.0 by addition of -10 M NaOHvand the extract can be stirred for 1 h at 4°C before centrifugation (25,000 x g, 15 min, °C) to remove precipitated ns. The ' supernatant can be applied to an harosem Fast Flow (GE Healthcare Bio-Sciences) column (2.5 x 2.5 cm) pre-equilibrated with 10 mM sodium phosphate buffer. Unbound proteins can be removed by washing with 20 column volumes-of 10'mM sodium phosphate buffer (pH 6.0) and bound proteins can be eluted in 3 x 10 mL fractions with 10 mM sodium phosphate buffer (pH 6.0) ‘ containing 500 mM NaCl.

] Fractions from the SP Sepharose column can be ted to reverse-phase high, performance liquid chromatography (RP—HPLC) using, for example, an analytical Zorbax BOOSB-CB C. column and an Agilent Technologies 1200 series system or a preparative Vydac C8 RP- HPLC column on a Beckman Coulter System GoldHPLC. Protein samples can be loaded. in buffer A. (0.1% (v/v) trifluoroacetic acid) and eluted with a linear nt of 0-100% (v/v) buffer B (60% (v/v) acetonitrile in 0.089% (v/v) trifluoroacetic acid..Eluted proteins can be detected by monitoring abso‘rbance at 215nm. Protein peaks can be collected and defensins can be identified using SDS— PAGE and mass spectrometry.

Preparation of reduced and alkylated NoD173 LyOphilized NoD173 (500 pg) was dissolved in 400 pL of stock buffer (200 mM Tris-HCl pH 8.0, 2 mM EDTA, 6 M guanidine-HCI, 0.02% [v/v] Tween®-20). Reduction buffer (stock buffer 3.0 with 15 mM dithiothreitol [DTT]) was added (44 pL) ed by a 4.5 h incubation at 40°C. The reaction mixture was cooled to RT before iodoacetic acid (0.5 M in 1 M NaOH, 55 pL) was added and the incubation continued in the dark for 30 min at RT. A Nanosep omega® (Registered Trademark) spin column (3K molecular weight cut off, PALL Life Sciences) was used to remove . salts, DTT and iodoacetic acid and the protein concentration was determined using the BCA protein assay (Pierce). The effect of reduced and alkylated NoD173 (NOD173R&A) is described herein.

Cell lines and culture Mammalian cell lines used in this study were as follows: mouse melanoma B16F1 cells, human umbilical vein elial (HUVEC) cells, the human squamous cell carcinoma cell line -(A431), the human BCC cell line (CRL-7762) and human U937 myleomonocytic cells. The cells were grown in tissue culture flasks at 37°C under a humidified atmosphere of 5% 002 / 95% air, and sub—cultUred routinely two to three times a week according to the rate of proliferation. All ian cells were cultured in RPMl-1640 medium (Invitrogen) supplemented with 10 % heat- inactivated fetal bovine serum (FBS, Invitrogen), 100 U/mL penicillin (Invitrogen) and 100 pg/mL streptomycin (lnvitrogen), with the exception that CHO and PGS cells were cultured in F12 medium (DMEM, lnvitrogen) supplemented with 10% FBS, 100 U/mL penicillin and 100 pg/mL streptomycin. Adherent cell lines were detached from the flask by adding 3-5 mL of a mixture containing 0.25% trypsin and 0.5 pM EDTA (lnvitrogen).

. VMTTcell viability assays Tumour cells were seeded in quadrUplicate into wells of a flat-bottomed l microtitre plate.(50 pL) at various densities starting at 2 x 106 ceils/mL. Four wells ning complete culture medium alone were included in each assay as a background control. The itre plate was incubated overnight at 37°C under a humidified atmosphere containing 5% C02 / 95% air,- prior to the addition of complete culture medium (100 pL) to each well and further incubated at 37°C for 48 h. Optimum cell ies % confluency) for cell viability assays were determined for each cell line by light microscopy. .25 [00162] Tumour cells were seededIn a 96-well microtitre plate (50 pL / well) at an optimum density determined in the cell optimisation assay as above. Backgrdund control wells (n = 8) containing the same volume of complete culture medium were included in the assay. The microtitre plate was incubated overnight at 37°C, prior to the addition of proteins at various trations and the plate. was ted for a further 48 h. The cell viability 3-(4, 5-dimethylthiazolyl)-2, 5-diphenyl-2H- tetrazolium bromide (MTT Sigma-Aldrich) assay was carried out as fellows: the MTT‘ solution (1 mg/mL) was added to each well (100 pL) and the plate incubated for 2-3 h at 37°C under a humidified atmosphere containing 5% C02 l 95% air. uently, for adherent cell lines, the media was removed and replaced with dimethyl sulfoxide (100 pL, DMSO, Sigma-Aldrich), and placed on_ a shaker for 5 min to dissolve the tetrazolium salts. In the case of suspension cells, prior to the addition of DMSO the cells are spun at 1500 rpm for 5 min. Absorbance of each well was measured at 570 'nm and the leo values. (the protein concentration to inhibit 50% of Cell growth) were determined using the Origin Software Program.

Example 1: NoD173 selectively kills tumour cells The effect of Nth73 on the ity of a'tumour cell line and a normal human cell isolate was determined using a 3—(4,5-dimethylthiazolyl)-2, enyl-ZH-tetrazolium bromide (MTT) in * 1O vitro cell culture viability assay. The cell lines tested were mouse melanoma B16F1 cells and human umbilical vein endothelial ) cells. NoD173 was tested alongside recombinant NaD1. ,Cells were seeded into 96-well flat-bottomed microtitre plates at the following cell numbers: B16-F1 /well), HUVEC (3x103IWell), and then cultured overnight. NoD173 or NaD1 were then added to cells to final concentrations ranging from 1 to 100 M and incubated for 48 h, upOn '15 which MTT assays were carried out as describedIn the Materials and Methods.

NoD173 was shoWn to kill mouse melanoma B16F1 cells with r efficiency to NaD1 (le0 1.5 pM) as indicated by the results of the in vitro cell ity assays shown.In Figure 3.

Furthermore, NoD173 was shown to be highly selective for the killing of tumour cells over normal. cells. The |C50 of NoD173 for normal human umbilical vein endothelial cells (HUVEC) was 75uM, indicating normal cells are 50-fold more resistant to being killed than B16F1 (Figure 4). The cant improvement of NoD173 over other class ll defensins is also clearly evident'when compared to NaD1 that kills HUVEC at a much lower concentration (le0 of 15pM) (Figure 4). .

Example 2: NoD173 reduces growth of an aggressive solid tumour in vivo The effect of NoD173 on tumour growth was assessed in an in vivo model of solid melanoma growth in mice. CS7BL/6 mice were injected subcutaneously with 5x105 B16-F1 tumour cells and solid tumours grown to a diameter of ~10 mm. One 'mg/kg body'weight NoD173 or , NOD173R&A in 50p.L of PBS, or 50 uL of PBS alone was then ed intratumuorally every 2 days until mice were sacrificed. The tumour size was measured before injection every 2 days. Six mice were used in each group. 1 Experimental g of the in viva-activity of NOD-173 with intratumour injection of 5mg/kg resulted in a significant reduction in tumour growth when compared to the controls of NOD173R&A and PBS atone e 5). It should be noted that the B16—F1 tumours were established at a highly advanced stage when treatment was initiated.

Example 3: Acute subcutaneous and intratumoural toxicity testing of NoD173 in mice In vivo toxicity testing of NoD173» was undertaken using model of solid melanoma growth in mice; C57BL/6' mice were injectedsubcutaneously with 5x105 BtG-Ft tumour cells and solid tumours grown to a diameter of ~10 mm. One mg/kg body weight NoD173 or N00173R8A in. 50p.L of PBS, or 50 pL of PBS alone was then injected intratumourally or subcutaneously every 2 days. .10 The tumour size was measured before injection every 2 days. Six mice were used in each group.

Each of the test mice received g amounts of NoD173/kg body weight.

The mice were observed hourly for 4 h after dosing on day 1 and at least twice daily thereafter until scheduled sacrifice. Signs of gross toxicity, adverse pharmacologic effects and behavioural s were assessed and recorded daily as was the food and water consumption.

The mice were reweighed regular intervals. On" the last day of the study, the mice were ced by inhalation of carbondioxide and necropsied. All the mice ed a gross pathological examination. The weights of the following organs were recorded: brain, heart, liver, lungs, kidneys, gastrointestinal tract, spleen and thymus. Subsequently, the samples were fiXed in 4% (v/v) rmaldehyde until n embedding, sectioning and athological examination by the Austraiian Phenomics Network, University of Melbourne node. The gastrointestinal tract was divided into the following sections: stomach, duodenum, jejunum, ileum, cecum and colon.

All animals appeared healthy, showed no signs of gross toxicity, adverse pharmacologic effects or behavioural changes and survived to termination of the study. There was no treatment related effects on body weight, with weights closely matching that of the pre-fast weight at the commencementof the study No ogies, attribUtable to administration of NoD173 either subcutaneously or intertumourally, were observedIn any of the mice at a dose of 5mg NoD173/kg body . This » compares extremely favourably with previous studies shoWing that another plant defensin, NaD1, showed toxicity with ry via subcutaneous, intraperitoneal or intratumoural routes at a dose above 1mg/kg body weightT e 4: Basal cell and squamous cell carcinoma are Susceptible to NoD173 The effect of NoD173 on the viability of the human squamous cell carcinoma cell line , (A431) and the human BCC cell line (CRL-7762) was determined using a 3-(4,5-dimethyl-2— thiazolyl)—2, enyl-ZH-tetrazolium e (MTT) in vitro cell culture viability assay. Cells were d into 96-well flat-bottomed microtitre plates at the following cell numbers: B16—F1 (2x103/well), HUVEC (3x103/well), and then cultured overnight. NoDi 73 was then added to cells to final concentrations ranging from 1 to 100 'pM and incubated for 48 h, upon which MTT assays were carried out as described in the Materials and Methods.

[00172] NoD173 killed CRL-7762 and A431 at low pM concentrations (le0 15pM and .10pM, respectively) indicating that both of these non-melanoma skin cancers are sensitive to killing by NoD173 (Figure 6A and B).

Example 5: Functional role of tertiary structure of NoD173 In order to validate the use of reduced and alkylated NoDl73 as a negative control, for example as shown in Figure 5 (Iabeledas “inactive"), and in order to determine the role of ry ure in the ability of NoD173 to permeabilize cells, U937 cells were incubated with increasing concentrations 0f either untreated NoDl73 or reduced and alkylated NoD173 (0 to 20 M) for 30 min at 37°C, upon which; propidium iodide (PI) was then added. The number of cells that d vely for PI (P|‘+) was determined by flow cytometry. ' ([00174]As shown in Figure 7, disruption of the tertiary structure of NoD173 by reduction and alkylation resulted in Ioss_of function. Reduced and alkylated NoD173 was unable to bilise U937 cells. These data demonstrate that the tertiary structure of NoDl73 is critical for its cell permeabilisation activity, and also validate the use of reduced and alkylated NOD173 as a negative l in other experiments, such as that shown in Figure 5.

References Aluru et al. (1999) Plant Physiol 120: 633-635 Anaya-prez et al. (2006) Biotechnol Lett 28: 1 101 -8.

Bensch et al. (1995) FEBS Let. 368:331-335 Bloch et al. (1991) FEBS Lett 279: 101-104 Bohlmann (1994) Crit Rev Plant Sci 13: 1-16) W0 2013/056309 _ 33 - Bohlmann and Apel (1991) Annu Rev Plant l Plant Mol Biol 42: 227-240 ‘ Bonmatin et al. (1992) J Biolnol NMR 2? 235-256 , Brandstadter et al. (1996) Mol Gen Genet 252: 146-154 Broekaert et al. (1992) Biochemistry 32: 4308-4314 BrOekaerl et al. (1995) Plant Physiol 108: 1353-1358 Broekaert et al. (1997) Crit Rev Plant Sci 16: 297-323 Bruix et al._ (1993) Biochemistry 323715—724 Cammue et al. (1992) J Biol Chem 267: 2228—2233 Chang et al.(2005) Mol Biol Cell 16: 4941-4953 . Chen et al. (2002) J Agric Food Chem 50: 7258-63 Colilla et al. (1990) FEBS Lett 270: 191-4 Cornet et al., (1995) Structure 3: 435-448 Craik et al. (1999) J Moi Biol 294: 1327-1336 Craik (2001) Toxicon 39: 1809-1813 ' 15_ Craik et al. (2004) Curr Pro‘t Pept Sci 5: 297-315 Da Silva et al. (2003) Protein Sci 12: 6 de Zélicourt et al. (2007) P/anta 226: 591-600 Diamond at al. (1996) Proc Natl Acad Sci USA 93: 160 Fehlbaum et al. (1994) J Biol Chem 269: 33159-33163 Ganz et al. (1985) J Clin invest 76: 1427-1435 Gu et al. (1992) Mol Gen Genet 234: 89-96» Gustafson et ai; (1994) J Am Chem Soc 116: 9337-9338 Hancock and Lehrer (1998) Trends Biotech 16: 82-88 Hanzawa eta]. (1990) FEBS Lett 2691413420 Harwig et al. (1992) Blood 79: 1532-1537 Janssenet al. (2003) mistry‘42: 8214-8222 Jennings et al. (2001) Proc Natl Acad Sci U. SA. 98: 10614-10619 Kader (1996) Annu Rev Plant l Plant Mol Biol 47: 627-654 Kader (1997) Trends Plant) Sci 2: 66-70 Komori et al. (.1997) Plant l 115: 314 Kushmerick et al. (1998) FEBS Lett 440: 302-306 Lamberty et al. (1999) J Biol Chem 274: 9320-9326 Lamberty et al. (2001) Biochemistly 40: 1 1995-12003 Landon et al. (1997) Protein Sci 6: 1878-1884 wo 56309 - 39 _ Lay _and Anderson (2005) Curr Protein Pept Sci 6: 85-101 Lay et al. (2003a) Plant Physio/.131: 1283-1293 Lay et al. (2003b) J Mol Biol 325: 175-188 Lehrer and Ganz (2002) Corr Opin lmmunol14: 96-102 I ‘ Lin et al. (2009) Biosci Rep 30: 101-109 Lobo et al. (2007) Biochemistry 46: 987-96 Loeza-Angeles et al. (2008) Biotechno/ Lett 30: 719 Ma et al. (2009) Peptides 30: 2089-2094 Mader and Hoskin (2006) Expert Opin lnvestig Drugs 15: 933-46. Review Marcus et al. (1997) Eur J Biochem 244: 743-749 s‘ et al. (1999) J Mol Biol 293: 629-638 Melo et al. (2002) Proteins 48: 311-319 Mendez et al. (1990) Eur J Biochem 194: 533-539.

Mendez et 'al. (1996) Eur J Biochem 239: 67-73 Milligan et al. (1995) Plant Mol Biol 28: 691-711 Mirouze et al. (2006) Plant J 47: 329-342 Moreno et al. (1994) Eur J Biochem 223: 135-139 Ngai and N9 (2005) Biochem Cell Biol 83: 212-20 Osborn et al: (1995) FEBS Lett-368: 257-262 Patel et' al. (1998) Biochemistry 37: 983-990 'Pelegrini and Franco (2005) lnt J Biochem Cell Biol 37: 2239-53 Ramamoorthy et al. (2007) Mol iol 66: 771-786 Russell et al. (1996) Infect lmmun 64: 1565-1568 segura et al. (1998) FEBS Lett 435: 159-162 Selsted et al. (1985) J Clin Invest 76: 1436-1439. d et al. (1993) J Biol Chem 268: 6641-6648 Tailor et'al. (1997) J Biol Chem 272: 24480-24487 Tam et al. (1999) Proc Natl Acad Sci U;S.A. 96: 8913-8918 Tang and Selsted (1993) J Biol Chem 268: 6649-6653 Tang et al. (1999a)-Science 286: 2 Tang et al. (1999b) Infect Immun 67: 6139-6144 Tarver et al. (1998) infect Immun 66: 1045-1056“ Terras et al. (1992) J Biol Chem 267: 15301 -15309 Terras et al. (1993) FEBS Lett 316: 233-240 W0 2013/056309 Terraset al. (1995) Plant Cell 7: 573-588 Tho’mma et al. (2003) CurriDrug Targets - Infect. Dis. 3: 1-8 Trabi et al. (2001) mistry 40: 4211-4221 van der Weerden (2008) J Biol Chem 283: 14445-14452 Wijaya et al. (2000) Plant Sci 159: 243-255 , Wong and Ng‘(2005) Int J Biochem Cell Biol 37: 1626—32 Yamada et al. (1997) PiantPhysiol115: 314 Zhang and Lewis (1997) FEMS Microbiol Lett 149: 59-64 Zhang et al. (1997) Cereal Chem 74.: 119-122

Claims (15)

Claims

1. An isolated polypeptide, wherein the polypeptide: (a) comprises an amino acid sequence set forth as SEQ ID NOs: 1, 3 or 5 or a functional fragment thereof; or (b) comprises an amino acid sequence g not less than 95% ty to the amino acid sequence set forth as SEQ ID NOs: 1, 3 or 5 or a functional fragment thereof; or (c) is encoded by a nucleic acid sequence set forth as SEQ ID NOs: 2, 4 or 6 or a functional fragment or complement thereof.

2. The isolated polypeptide according to claim 1, wherein the polypeptide: (a) is isolated from Nicotiana ntalis; or (b) is produced recombinantly.

3. An isolated nucleic acid, wherein the nucleic acid: (a) comprises a nucleic acid sequence set forth as SEQ ID NOs: 2, 4 or 6 or a functional fragment or complement thereof; or (b) comprises a nucleic acid sequence sharing not less than 95% identity to the c acid sequence set forth as SEQ ID NOs: 2, 4 or 6 or a functional fragment or ment

4. The isolated nucleic acid according to claim 3, wherein the nucleic acid: (a) is isolated from Nicotiana occidentalis; or (b) is produced recombinantly.

5. The isolated nucleic acid according to claim 3 or 4, wherein the c acid is operably linked to one or more promoters.

6. A vector comprising the nucleic acid ing to any one or more of claims 3 to 5.

7. A host cell comprising the vector according to claim 6, wherein the host cell is ex vivo, in vitro or non-human.

8. An ed expression product produced by the host cell of claim 7, wherein the expression product comprises the polypeptide according to claim 1 or 2, the c acid according to any one of claims 3 to 5 or the vector according to claim 6.

9. A pharmaceutical ition for use in preventing or treating a proliferative disease, wherein the pharmaceutical composition comprises the polypeptide according to claim 1 or 2, the nucleic acid according to any one of claims 3 to 5, the vector according to claim 6, the host cell according to claim 7 or the isolated expression product according to claim 8, together with a pharmaceutically acceptable carrier, diluent or excipient.

10. Use of the polypeptide according to claim 1 or 2, the nucleic acid according to any one of claims 3 to 5, the vector according to claim 6, the host cell according to claim 7, or the ed expression product according to claim 8 in the manufacture of a medicament for preventing or treating a proliferative disease.

11. The use according to claim 10, wherein the proliferative disease is cancer.

12. The use according to claim 11 wherein the cancer is selected from the group sing basal cell carcinoma, squamous cell carcinoma, actinic keratosis, bone cancer, bowel cancer, brain cancer, breast cancer, cervical cancer, leukemia, liver cancer, lung , lymphoma, melanoma, ovarian cancer, pancreatic cancer, prostate cancer or thyroid cancer.

13. A kit for ting or treating a proliferative e, wherein the kit comprises a eutically effective amount of the polypeptide according to claim 1 or 2, the nucleic acid according to any one of claims 3 to 5, the vector according to claim 6, the host cell according to claim 7, the isolated expression product according to claim 8 or the pharmaceutical composition according to claim

14. The kit according to claim 13, wherein the proliferative disease is cancer.

15. The kit according to claim 14 n the cancer is selected from the group comprising basal cell carcinoma, squamous cell carcinoma, actinic keratosis, bone cancer, bowel cancer, brain cancer, breast cancer, al cancer, leukemia, liver , lung cancer, lymphoma, melanoma, ovarian , pancreatic cancer, te cancer or thyroid cancer. W0