NZ528507A - Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction - Google Patents

Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction

Info

Publication number
NZ528507A
NZ528507A NZ528507A NZ52850702A NZ528507A NZ 528507 A NZ528507 A NZ 528507A NZ 528507 A NZ528507 A NZ 528507A NZ 52850702 A NZ52850702 A NZ 52850702A NZ 528507 A NZ528507 A NZ 528507A
Authority
NZ
New Zealand
Prior art keywords
process according
sequence
oligonucleotide
double
stranded dna
Prior art date
Application number
NZ528507A
Inventor
Francis Blanche
Beatrice Cameron
Original Assignee
Centelion S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from FR0103953A external-priority patent/FR2822476B1/en
Application filed by Centelion S filed Critical Centelion S
Publication of NZ528507A publication Critical patent/NZ528507A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6839Triple helix formation or other higher order conformations in hybridisation assays
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Double stranded DNA target sequences capable of interacting with a third strand and forming a stable triple helix are described. Also described is a method for purifying a double stranded DNA molecule that consists of contacting a solution containing a double-stranded DNA molecule with a third DNA strand capable of forming by hybridisation a triple helix structure with a double stranded DNA target sequence borne by the double-stranded DNA molecule.

Description

528507 WO 02/077274 PCT/FR02/01034 1 METHODS FOR PURIFYING AND DETECTING DOUBLE STRANDED DNA TARGET SEQUENCES BY TRIPLE HELIX INTERACTION The present invention relates to novel target 5 DNA sequences capable of forming structures of the triple helix type,-and also to a novel process for purifying DNA. More particularly, the purification process according to the invention implements hybridization between a target DNA sequence and an 10 oligonucleotide. The process according to the invention proves to be particularly useful since it makes it possible to purify double-stranded DNA of pharmaceutical quality with high yields.
The present invention also relates to novel 15 methods for detecting, for quantifying, for isolating or for sorting DNA molecules containing said specific target sequences.
The purification processes according to the invention are essentially based on triple helix 20 interaction between a particular target DNA sequence and an oligonucleotide composed of natural or modified bases.
It has been shown that homopyrimidine oligonucleotides are capable of interacting 25 specifically in the major groove of the PNA double helix so as to locally form three-stranded structures intellectual property office of nz 3 1 MAY 2005 2 named triple helices (Moser et al., Science 238 (1987) 645; Povsiz et al., J. Am. Chem. Ill (1989) 3059).
These oligonucleotides selectively recognize the DNA double helix at oligopurine-oligopyrimidine sequences, 5 i.e. at regions having an oligopurine sequence on one strand and an oligopyrimidine sequence on the complementary strand, and form a triple helix locally there. The bases of the homopyrimidine oligonucleotide third strand form hydrogen bonds (Hoogsteen-type bonds) 10 with the purines of the Watson-Crick base pairs.
Similarly, structures of the triple helix type can form between a homopurine oligonucleotide and a homopurine-homopyrimidine double-stranded DNA. In this type of structure, the purine bases of the 15 oligonucleotide form reverse Hoogsteen-type bonds with the purine bases of the double-stranded DNA.
These site-specific triple helix interactions have in particular been used by Looney et al. (Science 241 (1988) 456) for controlling the expression of 20 certain genes, and by Helene et al. (BBA 1049 (1990) 99; WO 95/18223) who describe the formation of triple helix structures between oligonucleotides and target sequences present in promoters or coding regions, and thus the possibility of modulating the expression 25 profile of these genes, probably via inhibitory action of RNA polymerase at the level of initiation and/or elongation. 3 This type of triple helix interaction, for purifying plasmid DNA from a complex mixture which contains the DNA molecule mixed with other components, has also been described in international application 5 WO 96/18744 for purifying plasmid DNA. More particularly, that application describes a process for purifying double-stranded DNA, consisting in bringing the complex mixture into contact with a support to which an oligonucleotide capable of forming, by 10 hybridization, a triple helix with a specific sequence of the target DNA is covalently coupled.
In this specific interaction of the triple helix type for purification purposes, the specificity is due to pairings involving hydrogen bonds of the 15 Hoogsteen type between, firstly, thymine (T) bases of the third strand consisting of the oligonucleotide and, secondly, AT base pairs of the double-stranded DNA, so as to form T*AT triads. Similarly, protonated cytosines located in the third strand pair with GC base pairs of 20 the double-stranded DNA so as to form +C*GC triads (Sun et al., Curr. Opin Struc Biol. 3 (1993) 345). It has so far been established that these T*AT and +C*GC triads (named canonical triads) ensure maximum stability of the triple helix. However, many other factors are also 25 involved in the stabilization of the triple helix, such as for example the percentage of cytosines, the pH, the salinity of the medium or the environment of the triple 4 helix. It is also widely described that the introduction of triads termed noncanonical (i.e. different from the T*AT and +C*GC triads) causes a more or less considerable structural deformation in the 5 triple helix and systematically leads to significant destabilization thereof. The introduction of various noncanonical triads has, moreover, been studied in the context of comparative studies (Roberts et al., Proc. Natl. Acad. Sci. USA 88, 9397; Fossella et al., (1993) 10 Nucleic Acids Research 21, 4511; Govers et al., Nucleic Acids Research (1997) 25, 3787) showing variable destabilization of the triple helix as a function of the nature of the noncanonical triad introduced.
While this process allows rapid and efficient 15 purification of a target DNA of pharmaceutical quality, it requires however a sufficiently long, preferably totally homopurine, sequence to be present on one of the two strands of the DNA to be purified, and to be complementary to the third DNA strand. This sequence 20 may be naturally present in, or be inserted artificially into, the target double-stranded DNA sequence, the purification of which is desired.
The applicant has now discovered, surprisingly and unexpectedly, that a DNA molecule 25 bearing, on one strand, a target DNA sequence not essentially composed of purine bases is also capable of forming a stable triple helix structure with a third DNA strand, despite the presence of bases which are not complementary to those of the oligonucleotide producing the formation of noncanonical triads. ' More precisely, the target double-stranded 5 DNA sequences newly identified by the applicant comprise, on one strand, a homopurine sequence interrupted with a given number of pyrimidine bases. The applicant has also discovered that these partly homopurine-partly homopyrimidine DNA sequences can be used to efficiently purify the DNA molecules containing them, by triple helix interaction.
The newly identified sequences are also particularly useful for detecting, quantifying, isolating or sorting DNA molecules containing them.
One aspect of the present invention relates to a process for purifying a double-stranded DNA molecule, wherein said double-stranded DNA molecule is brought into contact with a third DNA strand, said double-stranded DNA molecule comprising at least one target sequence of general formula: '-(R)n-(N)t-(R')ra-3' in which: R and R' represent nucleotides composed only of purine bases; n and m are integers less than 9, and the sum of n+m is greater than 5; N is a nucleotide sequence comprising both purine bases and pyrimidine bases; t is an integer less than 8; intellectual property office of N.Z. 3 1 MAY 2005 6 said target sequence being capable of interacting with a third DNA strand and thus of producing the formation of a triple helix structure.
The homopurine sequences R and R' located in 5 the 5/ and 3' portions, respectively, of the target DNA sequence therefore have a total length greater than or equal to 6. They comprise adenine and guanine bases capable of interacting with a third strand in order to produce the"formation of a triple helix structure 10 consisting of T*AT and +C*GC canonical triads.
Preferably, the homopurine sequences R and R' comprise at least 2 guanines in total and at least 2 adenines.
Even more preferably, these purine sequences comprise a motif of the (AAG) type.
The central sequence N is less than 8 pairs of purine and pyrimidine bases in length t, and is capable, according to the invention, of interacting with a third DNA strand in order to produce the formation of noncanonical triads. Preferably, the 20 length of the central sequence N is greater than or equal to 1, and less than 8. Even more preferably, the length of the central sequence N is greater than or equal to 2, and less than 8.
The term "canonical triad" is intended to 25 mean the two nucleotide triads resulting from the interaction of the AT and GC doublets of the double-stranded DNA, with the T and +C bases so as to give the pNTELLECTUAL PROPERTTofRCE I OF N.Z.
I 3 I MAY 2005 I " RFf!Pi\/er\ 1 7 T*AT and +C*GC triads, respectively. These two triads are, among the 16 existing triads, those which have the greatest stability.
The term "noncanonical triad" is intended to 5 mean the set of 14 other nucleotide triads. They result from the interaction of a double-stranded DNA with a third DNA strand, in a nonspecific way, and exhibit decreased stability with respect to the T*AT and +C*GC canonical triads. Mention may be made in particular of 10 the T*CG and T*GC noncanonical triads which are formed, respectively, by interaction between a CG or GC doublet of the target sequence and thymine (T) of the third strand, the G*CG noncanonical triad resulting from the interaction between a CG doublet of the target sequence 15 and a guanine (G) of the third strand, the C*AT and C*TA noncanonical triads which result from the interaction, respectively, of the AT and TA doublets of the target sequence and of cytosines (C) located on the third strand, the G*CG noncanonical triad which is formed by 20 interaction of a CG doublet with a guanine (G) of the third strand, or the T*TA triad which results from the interaction of a TA doublet with a thymine (T) of the third strand.
It is clearly understood that, like the 25 purine ends in 5' and in 3', the central sequence N can also form T*AT and +C*GC canonical triads resulting from the respective interaction of AT and GC doublets with 8 thymine (T) and cytosine (C) bases located on the third DNA strand.
Preferably, the central sequence N comprises purine and pyrimidine bases which produce the formation 5 of at most 6 noncanonical triads. More preferably, the noncanonical triads resulting from the interaction of the central portion with the oligonucleotide are chosen from the T*CG, T*GC, C*AT and C*TA noncanonical triads. By way of examples of preferred distributions of these 10 triads, mention may be made of the formation of six noncanonical triads comprising a C*AT, a C*TA, two T*CGs and two T*GCs, the formation of five noncanonical triads comprising two C*ATs and three T*GCs, or the formation of three noncanonical triads comprising two T*GCs and 15 one C*AT. Several T*TA noncanonical triads may also be present but, in this case, they are not positioned consecutively in the triple helix.
The central sequence preferably comprises at most three C or T pyrimidine bases producing the 2 0 formation of the T*CG and C*TA or G*TA noncanonical triads. Preferably, the three pyrimidine bases are not consecutive but are separated by A or G purine bases, which can interact with the third DNA strand so as to form the T*GC and C*AT noncanonical bases and also the 25 T*AT and +C*GC canonical triads.
According to a particular embodiment of the invention, the target double-stranded DNA sequence is 9 the sequence 5'-AA GAA GCA TGC AGA GAA GAA-3' (SEQ ID No. 1).
The third DNA strand which is capable of interacting with the double-stranded DNA sequences 5 according to the invention perhaps, for example, an oligonucleotide or the strand of another double-stranded DNA, in the locally unpaired state, and can contain the following bases: - thymine (T), which is capable of forming T*AT canonical triads with the AT doublets of the target double-stranded DNA sequence, and also T*CG and T*GC noncanonical triads with the CG and GC doublets, respectively, of the target DNA sequence (Soyfer et al., in Triple Helical Nucleic Acids (1996) Springer, 15 New York, pp. 151-193); - guanine (G), which is capable of forming G*TA triads with the TA doublets of the double-stranded DNA (Soyfer et al., in Triple Helical Nucleic Acids (1996) Springer, New York, pp. 151-193); - cytosine (C), which is capable of forming +C*GC (protonated cytosine C+) canonical or C*AT and C*TA noncanonical triads with the GC, AT and TA doublets, respectively, of the target double-stranded DNA; and - uracil, which is capable of forming triplets with the 25 AU or AT base pairs of the target sequence (Bates et al., Nucleic Acids Research 23 (1995) 3627).
Preferably, the third DNA strand used comprises a homopyrimidine sequence rich in cytosines, which are present in the protonated state at acid pH and stabilize the triple helix. Such oligonucleotides 5 can, for example, comprise the (CCT)n sequence, the (CT)n sequence or the (CTT)n sequence, in which n is an integer between 1 and 20 inclusive. It is particularly advantageous to use sequences of the (CT)n or (CTT)n type, or sequences in which (CCT), (CT) or (CTT) motifs 10 are combined.
When the third DNA strand is present in the form of an oligonucleotide, the latter may be natural, i.e. composed of natural, unmodified bases, or be chemically modified. In particular, the oligonucleotide 15 can advantageously have certain chemical modifications making it possible to increase its resistance to or its protection against nucleases, or its affinity with respect to the specific sequence.
According to the present invention, the term 20 "oligonucleotide" is intended to mean any chain of nucleosides having undergone a modification of the backbone with the aim of making it more resistant to nucleases. Among the possible modifications, mention may be made of phosphorothioate oligonucleotides which 25 are capable of forming triple helices with DNA (Xodo et al., Nucleic Acids Research, 22 (1994) 3322), as well as oligonucleotides having formacetal or methyl 11 phosphonate backbones (Matteucci et al., J. Am. Chem. Soc., 113 (1991) 7767). It is also possible to use oligonucleotides synthesized with a-anomers of nucleotides, which also form triple helices with DNA 5 (Le Doan et al., Nucleic Acids Research, 15 (1987) 7749). Another modification of the backbone is the phosphoramidate linkage. Mention may be made, for example, of the phosphoramidate N3'-P5' internucleotide linkage described by Gryaznov et al. {J. Am. Chem. 10 Soc., 116 (1994) 3143), which gives oligonucleotides which form particularly stable triple helices with DNA. Among the other modifications to the backbone, mention may also be made of the use of ribonucleotides, of 2'-O-methylribose, or of a phosphodiester (Sun et al., 15 Curr. Opinion in Struct. Biol., 3 (1993) 3143).
Finally, the phosphorous backbone can be replaced with a polyamide backbone as in PNAs (Peptide Nucleic Acids), which can also form triple helices (Nielsen et al., Science, 254 (1991), 1497; Kim et al., J. Am. 20 Chem. Soc., 115 (1993) 6477-6481).
The thymine of the third strand can also be replaced with a 5-bromouracil, which increases the affinity of the oligonucleotide for DNA (Povsic et al., J. Am. Chem. Soc., Ill (1989) 3059). The third strand 25 can also contain unnatural bases, among which mention may be made of 7-deaza-2'-deoxyxanthosine (Milligan et al., Nucleic Acids Res., 21 (1993) 327), l-(2-deoxy- 12 alpha-D-ribofuranosyl)-3-methyl-5-amino-lH-pyrazolo[4,3-d]pyrimidine-7-one (Koh et al., J. Am. Chem. Soc., 114 (1992) 1470), 8-oxoadenine, 2-aminopurine, 2'-O-methylpseudoisocytidine or any 5 other modification known to those skilled in the art (Sun et al., Curr. Opinion in Struct. Biol., 3 (1993) 345) .
The object of another type of modification of the third strand is more particularly to improve the 10 interaction and/or the affinity between the third strand and the specific sequence. In particular, an entirely advantageous modification according to the invention consists in methylating the cytosines of the oligonucleotide in the 5 position. The oligonucleotide 15 thus methylated has the notable property of forming a stable triple helix with the specific sequence, in pH ranges closer to neutrality (> 5; Xoda et al., Nucleic Acids Research 19 (1991) 5625). It therefore makes it possible to work at higher pHs than the 20 oligonucleotides of the prior art, i.e. at pHs at which the risks of degradation of the plasmid DNA are considerably less.
The length may be adjusted case by case by those skilled in the art, as a function of the desired 25 selectivity and stability of the interaction.
The third DNA strands according to the invention can be synthesized by any known technique. In 13 particular, they can be prepared by means of nucleic acid synthesizers. Any other method known to those skilled in the art can of course be used.
These third DNA strands or these 5 oligonucleotides are capable of forming a triple helix with a specific double-stranded DNA sequence as described above, comprising a mixed (pyrimidine-purine) internal region N less than 8 nucleotides long, flanked by two homopurine regions R and R'. The latter may, for 10 example, comprise a motif of the GAA type.
By way of example, mention may be made of the target double-stranded DNA sequence corresponding to the sequence: 5'-AA GAA GCA TGC AGA GAA GAA-3' (SEQ ID No. 1), which is capable of forming a triple helix with 15 an oligonucleotide comprising a sequence chosen from the following sequences: '-TT CTT CTT CTT CTT CTT CTT-3' (SEQ ID No. 2), 5'-TT CTT CTT GCT TCT CTT CTT-3' (SEQ ID No. 3), 5'-TT CTT CTT GTT TCT CTT CTT-3' (SEQ ID No.4), and 20 5'-TT CTT CTT CCT TCT CTT CTT-3' (SEQ ID No. 5).
The formation of the triple helix may be obtained in the presence of Mg2+ ions which may optionally promote the stabilization of this structure (Vasquez et al., Biochemistry 34 (1995) 7243; Beal et 25 al., Science 251 (1991) 1360).
According to a preferred embodiment, the target DNA sequences according to the invention can be 14 naturally present on the double-stranded DNA, and it is then particularly advantageous to use an oligonucleotide capable of forming a triple helix with such a sequence present, for example, in the sequence 5 of genes of interest, such as genes of therapeutic or experimental interest, or marker genes. In this respect, the applicant has analyzed the nucleotide sequences of various genes of interest and has tested the stability of the triple helix interactions with an 10 oligonucleotide of the (CTT)n type, and it has been able to show that certain regions of these genes produce the formation of a stable triple helix despite the presence of noncanonical triads such as T*CG, T*GC, C*AT, C*TA and T*TA.
Among the sequences which are naturally present on a double-stranded DNA, mention may be made of the 5'-AA GAA GCA TGC AGA GAA GAA-3' sequence (designated IDl) (SEQ ID No. 1) present in the sequence of the human FGF1 gene (Jaye et al., Science 233 (1986) 20 541), the 5'-GAA GAA GCA CGA GAA G-3' sequence (SEQ ID No. 6) of the human gene encoding factor IX involved in clotting (Kurachi et al., Proc. Natl. Acad. Sci. U.S.A. 79 (1982) 6461), the 5'-AAA GAA AGC AGG GAA G-3' (SEQ ID No. 7) and 5'-GAA GAG GAA GAA G-3' (SEQ ID No. 8) 25 sequences of the SeAP secreted alkaline phosphatase gene (Millan et al., J. Biol. Chem., 261 (1986) 3112), the 5'-AAG GAG AAG AAG AA-3' sequence (SEQ ID No. 9) of the human alpha feto-protein haFP gene (Gibbs et al., Biochemistry 26 (1987) 1332), the 5'-AA GAT GAG GAA GAA G-3' sequence (SEQ ID No. 10) of the human GAX gene for controlling restenosis (Gorski et al., Mol. Cell.
Biol., 13 (1993) 3722) and, finally, the 5'-GGC AAC GGA GGA A-3' sequence (SEQ ID No. 13) of the human VEGFB-167 gene (Olofsson et al., J. Biol. Chem., 271 (1986) 19310). The formation of a triple helix with a sequence present in a gene of therapeutic or 10 experimental interest is particularly advantageous since the target sequence is naturally present on the double-stranded DNA molecule and it is not necessary to modify the target double-stranded DNA or the plasmid carrying this gene so as to incorporate into it an 15 artificial specific sequence. Alternatively, a target sequence may also be introduced artificially into the double-stranded DNA.
A second aspect of the present invention is based on a process for purifying double-stranded DNA, 20 according to which a solution containing a DNA, mixed with other components, is brought into contact with a third DNA strand as described above, which is then preferably an oligonucleotide capable of forming, by hybridization, a triple helix with a specific sequence 25 present on the double-stranded DNA as described above. Preferably, the double-stranded DNA is brought into contact in solution with the oligonucleotide 16 immobilized on a support. Even more preferably, the oligonucleotide is covalently or noncovalently coupled to said support in a stable manner. Thus, the step for bringing a solution containing a double-stranded DNA 5 into contact can advantageously consist in passing the solution of DNA, mixed with other components, over the support to which the oligonucleotide is coupled, in order to obtain the double-stranded DNA, the purification of which is desired, in an efficient and 10 rapid manner.
Such supports are well known to those skilled in the art and comprise, for example, consisting of beads or of microparticles, such as latex particles, or of any other support in suspension. The oligonucleotide 15 can also be grafted onto a molecule of the polymer type of natural or synthetic origin. Preferably, the polymer to which the oligonucleotide is attached has a property which allows it to be easily separated from the solution after formation of the triple helix with the 20 double-stranded DNA. Among natural polymers, mention may be made of proteins, lipids, sugars and polyols. Among synthetic polymers, mention may be made of polyacrylamides, polyethylene glycols, styrene derivatives and heat-sensitive polymers such as, for 25 example, compounds of the type poly(N-isopropyl- acrylamide), which are soluble at low temperature and become insoluble above their phase transition 17 temperature (T. Mori et al., Biotechnology and Bioengineering, 72 (2001) 261).
The purification process according to the present invention is particularly useful since it 5 enables the purification i) of DNA molecules which do not contain a homopurine sequence of sufficiently great length to allow the formation of a stable triple helix structure with a homopyrimidine oligonucleotide, but also ii) the DNA molecules in which the homopurine 10 sequence is interrupted with several pyrimidine bases. In addition to allowing the purification of a greater variety of DNA molecules, this process is also rapid and produces yields and degrees of purity which are particularly high.
Moreover, it makes it possible to purify DNA molecules from complex mixtures comprising other nucleic acids, proteins, endotoxins (such as lipopolysaccharides), nucleases, etc., and to obtain a purified DNA of pharmaceutical quality. 20 In order to allow its covalent coupling to the support, the oligonucleotide is generally functionalized. Thus, it may be modified with a terminal thiol, amine or carboxyl group, in the 5' or 3' position. In particular, the addition of a thiol, 25 amine or carboxyl group makes it possible, for example, to couple the oligonucleotide to a support bearing disulfide, maleimide, amine, carboxyl, ester, epoxide, 18 cyanogen bromide or aldehyde functions. These couplings are formed through the establishment of disulfide, thioether, ester, amide or amine attachments between the oligonucleotide and the support. Any other method 5 known to those skilled in the art can be used, such as difunctional coupling reagents for example.
Moreover, in order to improve the hybridization with the coupled oligonucleotide, it may be advantageous for the oligonucleotide to contain an 10 "arm" and a "spacer" sequence of bases. The use of an arm in fact makes it possible to attach the oligonucleotide at a chosen distance from the support, making it possible to improve the conditions of interaction with the DNA. The arm advantageously 15 consists of a linear carbon-based chain comprising 1 to 18, and preferably 6 to 12, groups of CH2 type, and an amine which allows the attachment to the column. The arm is linked to a phosphate of the oligonucleotide or of a "spacer" composed of bases which are not involved 20 in the hybridization. Thus, the "spacer" can comprise purine bases. By way of example, the "spacer" can comprise the sequence GAGG.
The oligonucleotide coupled to the purification support can, for example, have the 25 sequence 5'-GAGG CTT CTT CTT CTT CTT CTT CTT-3' (GAGG (CTT)7; SEQ ID No. 11) in which the GAGG bases are not involved in a triple helix structure, but make it 19 possible to form a space between the oligonucleotide and the coupling arm.
Various types of support can be used for carrying out the present invention. They may be 5 functionalized chromatography supports, loose or prepackaged in columns, functionalized plastic surfaces or functionalized latex beads, which may or may not be magnetic. They are preferably gel permeation chromatography supports. By way of example, 10 chromatography supports which can be used are agarose, acrylamide or dextrans, and also derivatives thereof (such as Sephadex®, Sepharose®, Superose®, etc.), polymers such as poly(styrenedivinylbenzene), or grafted on nongrafted silica, for example. The 15 chromatography columns can function in diffusion or perfusion mode, or in a "fluidized bed" or "expanded" system, using a chromatography support with a density which is suitable for this particular embodiment.
The process according to the present 20 invention can be used to purify any type of double- stranded DNA. This is, for example, circular DNA, such as a minicircle (Darquet et al., Gene Therapy 6 (1999) 209), a linear fragment, or a plasmid carrying generally one or more genes of therapeutic or 25 experimental interest. This plasmid may also carry an origin of replication, for example of the conditional type (such as the pCOR plasmids which are described by Soubrier et al., Gene Therapy 6 (1999) 1482), a marker gene, etc. The process of the invention can be applied directly to a cell lysate. In this embodiment, the plasmid, amplified by transformation and then cell 5 culture, is purified directly after cell lysis. The process according to the invention can also be applied to a clear lysate, i.e. to the supernatant it obtained after neutralization and centrifugation of the cell lysate. It can, of course, also be applied to a 10 solution which is prepurified using known methods. This process also makes it possible to purify linear or circular DNA carrying a sequence of interest, from a mixture comprising DNAs of various sequences. The process according to the invention can also be used for 15 purifying double-stranded RNA.
The cell lysate can be a lysate of prokaryotic or eukaryotic cells. Regarding prokaryotic cells, mention may be made, for example, of E. coli, B. subtilis, S. typhimurium, S. aureus or Streptomyces 20 bacteria. Regarding eukaryotic cells, mention may be made of animal cells, yeasts, fungi, etc., and more particularly Kluyveromyces or Saccharomyces yeasts, or COS, CHO, CI27, NIH3T3, MRC5, 293, etc. cells.
The process of the invention is particularly 25 advantageous since it makes it possible to obtain, rapidly and simply, plasmid DNA of very high purity. In particular, as illustrated in the examples, this 21 process makes it possible to efficiently separate plasmid DNA from contaminating components such as fragmented chromosomal DNA, RNAs, endotoxins, proteins or nucleases.
The process of the invention is also useful for purifying and enriching DNA molecules, and particularly genes of therapeutic interest, such as the FGF1 gene, which are produced and purified on an industrial scale, and the purity of which must be 10 compatible with pharmaceutical use.
According to a third aspect, a subject of the present invention is a process for detecting, quantifying and sorting double-stranded DNA molecules comprising at least one target sequence as described 15 above, which consists a) in bringing a solution suspected of containing said molecules into contact with a third DNA strand, for example a labeled oligonucleotide, so as to form a stable triple helix, and b) in detecting the complex possibly formed between 20 the double-stranded DNA and the third DNA strand.
This process is useful in particular in the context of the analysis of genomes, by allowing, for example, the detection of a particular DNA sequence in a genome or the sorting of specific sequences. 25 The third DNA strand or the oligonucleotide, according to this aspect of the present invention, can be labeled by incorporating a label which is detectable 22 by spectroscopic, photochemical, biochemical, immunochemical or chemical means.
For example, such labels can consist of radioactive isotopes (32P, 33P, 3H, 35S) or fluorescent 5 molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin).
The labeling is preferably carried out by incorporating labeled molecules into the polynucleotides by primer extension, or by adding to 10 the 5' or 3' ends.
Examples of nonradioactive labeling are described in particular in French patent No. FR 78 109 75, or in the articles by Urdea et al. (1988, Nucleic Acids Research, 11: 4937-4957) or 15 Sanchez-pescador et al. (1988; J. Clin. Microbiol., 26(10) : 1934-1938) .
According to this particular aspect of the present invention, the third DNA strand or the oligonucleotide can also be immobilized on a support as 20 described above.
A fourth aspect of the present invention relates to a pack or kit for purifying and/or detecting the presence of a double-stranded DNA according to the invention in a complex mixture, said pack comprising 25 one or more oligonucleotides as described above. The latter can be immobilized on a support and/or comprise a detectable label. 23 According to this aspect of the present invention, the detection kit described above, such as kit will comprise a plurality of oligonucleotides in accordance with the invention which may be used to 5 detect target double-stranded DNA sequences of interest.
Thus, the oligonucleotides immobilized on a support can be organized in matrices such as "DNA chips". Such organized matrices have in particular been 10 described in US patent No. 5,143,854, and in PCT applications No. WO 90/15070 and 92/10092.
Support matrices on which the oligonucleotides have been immobilized at a high density are, for example, described in US patent 15 No. 5,412,087 and in PCT application No. WO 95/11995.
The present application will be described in greater detail using the examples which follow, which should be considered as illustrative and nonlimiting. Legend of the figures: Figure 1: Schematic representation of the plasmid PXL3179; Figure 2: Schematic representation of the plasmid pXL 3296; Figure 3: Schematic representation of the plasmid 25 pXL3426; Figure 4: Schematic representation of the plasmid PXL3402; 24 Figure 5: Schematic representation of the plasmid PXL3678; Figure 6: Schematic representation of the plasmid PXL3207; Figure 7: Schematic representation of the plasmid PXL3388; Figure 8: Schematic representation of the plasmid PXL3579.
Figure 9: Schematic representations of the plasmids 10 pXL3601 and pXL3977.
General cloning and molecular biology techniques.
The conventional methods of molecular biology, such as digestions with restriction enzymes, gel electrophoresis, DNA fragment ligation, 15 transformation in E. coli, precipitation of nucleic acids, sequencing, etc., are described in the literature (Maniatis et al., (1989) Molecular cloning: a laboratory manual, second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New 20 York; Ausubel et al., (1987) Current protocols in molecular biology, John Willey and Sons, New York). The restriction enzymes were supplied by New-England Biolabs, Beverly, MA (Biolabs).
The oligonucleotides are synthesized using 25 the chemistry of phosphoramidites protected in the a position with a cyanoethyl group (Sinha et al. Nucleic Acids Research, 12 (1984) 4539; Giles (1985), with the 394 automatic DNA synthesizer from the company Applied Biosystem using the manufacturer's recommendations.
The oligonucleotides used for synthesizing affinity gels are obtained from the company Amersham 5 Pharmacia Biotech (Uppsala, Sweden) or from Eurogentec (Seraing, Belgium), and are used without modification.
The strains allowing the replication of the pCOR plasmids, and the conditions for growth and for selection of these plasmids, have already been 10 described (Soubrier et al., Gene Therapy 6 (1999) 1482) .
Example 1: Construction of plasmids 1.1 The plasmid pXL3179 (pCOR-FGFl) The plasmid pXL3179, which is represented in 15 Figure 1, is a vector derived from the plasmid pXL2774 (WO 97/10343; Soubrier et al., Gene Therapy 6 (1999) 1482) into which the gene encoding a fusion between the signal peptide of human fibroblast interferon and the FGF1 (Fibroblast Growth Factor 1) cDNA (sp-FGFl, 20 Jouanneau et al., PNAS 88 (1991) 2893) has been introduced under the control of the promoter originating from the early region of the human Cytomegalovirus (hCMV IE E/P) and of the polyadenylation signal of the SV40 virus late region 25 (SV40 late polyA; Genbank SC4CG). 1.2 The plasmid pXL 3296 (pCOR) 26 The plasmid pXL3296 derives from the plasmid pXL3179 in which the sequence of the sp-FGFl gene has been replaced with the multiple cloning site of the plasmid pUC28 (Benes et al., Gene 130 (1993) 151). The 5 plasmid pXL2396 is represented in Figure 2. 1.3 The plasmid pXL3426 (pCOR-IDl) The plasmid pXL3426 derives from the plasmid pXL3296 into which the sequence '-GATCCAAGAAGCATGCAGAGAAGAATTC-3' has been inserted 10 between the Bglll and Xhol sites. The plasmid pXL 3426 is represented in Figure 3.
Example 2: Construction of other plasmids carrying target sequences The plasmid pXL367 5 derives from the plasmid 15 pXL3296 into which the sequence '-GAAGAAGGGAAAGAAGATCTG-3' has been inserted between the Hpal and Xbal sites; the plasmid pXL3676 also derives from the plasmid pXL.3296, in which the sequence 5'-GAAGAAAGGAGAGAAGATCTG-3' has been inserted between 20 Hpal and Xbal, and finally the plasmid pXL3713 which contains the DNA sequence 5'-GAAGAAGTTTAAGAAGATCTG-3' inserted between the Hpal and Xbal sites of pXL3296. The plasmids thus constructed were purified by CsCl chloride gradient, and the sequence of the inserts was 25 confirmed by sequencing. These preparations were used in the examples described hereinafter. 27 Example 3: Identification of a 20-mer sequence internal to the FGF1 gene, forming a stable triple helix The various plasmids as described in the 5 examples which follow were chromatographed by triple helix interaction affinity chromatography under standardized conditions. The affinity support was synthesized in the following way, using the chromatography support Sephacryl® S-1000 SF (Amersham 10 Pharmacia Biotech). In a first step, the Sephacryl® S-1000 gel dispersed in a 0.2 M sodium acetate buffer was activated with sodium meta-periodate (3 mM, 20°C, 1 h) and then, in a second step, the oligonucleotide was coupled, through its 5' -NH2-terminal portion, to the 15 aldehyde groups of the activated matrix via a reductive amination reaction in the presence of ascorbic acid (5 mM), following a procedure similar to that described for the coupling of proteins (Hornsey et al., J.
Immunol. Methods 93 (1986) 83). For all the experiments 20 reported in the present invention, the oligonucleotides were coupled by following this general procedure; all the oligonucleotides have an NH2-(CH2)6~ functionalized arm located at the 5' end of the oligonucleotide.
The experiments directed toward demonstrating 25 the formation of a triple helix structure between an oligonucleotide and a double-stranded DNA, and toward measuring the stability, were all carried out under the 28 following conditions. In each experiment, 300 fig of purified plasmid dissolved in 6 ml of 50 mM sodium acetate buffer (pH 4.5) containing 2 M NaCl was injected, at a flow rate of 30 cm/h, onto an HR 5/5 5 column (Amersham Pharmacia Biotech) containing 1 ml of affinity gel functionalized with an oligonucleotide according to the invention. After washing the column with 5 ml of the same buffer, the plasmid was eluted with 3 ml of 100 mM Tris/HCl column buffer (pH 9.0) 10 containing 0.5 mM EDTA, and the amount of plasmid eluted by the pH 9.0 buffer was quantified, i) by measuring the absorbence at 260 nm of the solution and ii) by anion exchange chromatography on a Millipore GenPak-Fax column (Marquet et al., BioPharm, 8 (1995) 15 26).
Using a column functionalized with the oligonucleotide 5 '-NH2-(CH2) 6-TT (CTT) 6-3 ' (SEQ ID No. 2), the results of the purification which are given in Table 1 below demonstrate the formation of a stable 20 triple helix with the plasmids comprising either the entire FGFl gene (pXL3179), or an internal ID1 sequence of the human FGFl gene (pXL3426), in contrast with a control plasmid (pXL3296) which comprises no sequence of the human FGFl gene and which is not retained on the 25 column in question.
Table 1 29 Plasmids Sequence of the oligonucleotide Target sequence in the plasmid Capacity (pg plasmid attached per ml of gel) PXL3179 (pCOR-FGFl) TT CIT CIT CTT CTT CTT CTT 175 PXL3426 (pOOR-IDl) IT CTT CTT CTT CTT CTT CTT AA GAA GCA TGC AGA GAA GAA 130 PXL3296 (pCQR) TT CTT CTT CTT CTT CTT CTT < 1 The sequence of the plasmid pXL3426 was identified by subcloning various fragments of the FGFl 5 gene, of increasingly small size. The internal sequence designated ID1 5'-AA GAA GCA TGC AGA GAA GAA-3' (SEQ ID No. 1) of the FGFl gene therefore forms a stable triple helix structure with the oligonucleotide used of sequence SEQ ID No. 2. The triple helix structure 10 obtained contains two regions of the type pyrimidine-purine-pyrimidine (Py*PuPy) which form T*AT and +C*GC canonical triads 6 units (R, 5' side) and 7 units (R', 3' side) long, separated by an internal region (T) of 7 triads, six of which are noncanonical 15 and comprise, more precisely, two T*GC triads, two T*CG triads, one C*AT triad and one C*TA triad.
Example 4: Identification of the bases required, in the internal ID1 20-mer sequence internal to the FGFl gene, for the stability of the triple helix structure 20 4 oligonucleotides were prepared based on the internal IDl sequence. For two of them, 7 or 13 nucleotides are absent from the 5' side of IDl, and for the other 2, 7 or 14 nucleotides are absent from the 3' side. The plasmid pXL3426 was chromatographed on a triple helix interaction column functionalized using the oligonucleotide 5'-TT(CTT)6-3' (SEQ ID No. 2) or the oligonucleotides FRB36, FRB38, FRB39 or FRB40. The 5 stability of the triple helix structure formed with the various truncated internal IDl sequences was then tested by measuring the amount of each of the plasmids retained on the column.
Table 2 Oligonucleotide Sequence targeted in the plasmid pXL3426 Capacity (pg plasmid attached per ml of gel) (CIT) 7 AA GAA GCA TGC AGA GAA GAA 130 FRB36 A GAA GAA < 1 FRB38 AA GAA G < 1 FRB39 AA GAA GCA. IOC AG 22 FRB40 A TOC AGA. GAA GAA 33 The results given in Table 2 above show that all of the IDl sequence of pXL3426 (20-mer) is required for the formation of a stable triple helix structure 15 with an oligonucleotide of the type 5'-TT(CTT)6-3 ' . In particular, the two Py*PuPy portions located at the 5' and 3' ends, and also the central portion, contribute very greatly and cooperatively to the stability of the final structure.
Example 5: Influence of the canonical triads and of the number of noncanonical triads on the stability of the triple helix The sequence of the oligonucleotide 5'-TT (CTT) 6-3' (SEQ ID No. 2) was modified, and the 31 capacity of these various oligonucleotides (FRB15, FRB16 and FRB17) to form a stable triple helix with the internal IDl sequence (5'-AA GAA GCA TGC AGA GAA GAA-3'; SEQ ID No. 1) of the plasmid pXL3426 was 5 tested.
Table 3 Oligonucleotide Sequence of the oligonucleotide Target IDl sequence in the plasmid Number of noncananical triads Capacity (|jg plasmid attached per ml of gel) (CTT) 7 IT CIT CIT CIT CIT CIT CIT AA GAA GCA IOC AGA GAA GAA 6 130 FRB15 TT CIT CIT GCT TCT CIT CIT AA GAA GCA TGC AGA GAA GAA 3 189 ERB16 TT CIT CIT GIT TCT CIT CTT AA GAA GCA TGC AGA GAA GAA 4 171 FRB17 TT CIT CIT OCT TCT CIT CTT AA GAA GCA TGC AGA GAA GAA 3 183 The results given in Table 3 above show that it is possible to increase the stability of the triple helix structure by modifying the sequence of the oligonucleotide so as to increase the number of T*AT and +C*GC canonical triads, which, at the same time, decreases the number of noncanonical triads in the 15 median internal region N of the triple helix structure. Example 6: Influence of the noncanonical triads on the stability of the triple helix structure The sequence of the plasmid pXL3426 comprising the internal IDl sequence (SEQ ID No. 1) of 20 the FGFl gene, which is capable of forming a stable triple helix with the oligonucleotide 5'-TT(CTT) 6-3 ' 32 (SEQ ID No. 2), was modified in order to introduce into the central region N two consecutive identical noncanonical triads of the T*GC type, followed in 5' by a C*AT noncanonical triad (pXL3675). In another 5 experiment, five successive C*AT, T*GC, T*GC, C*AT and T*GC noncanonical triads were introduced (pXL3676). Finally the sequence of the plasmid pXL3426 was modified so as to introduce into the median region two consecutive noncanonical triads of the T*TA type, 10 followed in 5' by a C*TA noncanonical triad (pXL3713) .
Table 4 Plasmids Sequence of the oligonucleotide Target sequence in the plasmid Capacity (fjg plasmid attached per ml of gel) PXL3426 TT CIT CIT CIT CIT CIT CIT AA. GAA GCA TGC AGA GAA GAA 112 pXL3675 CTT CIT CIT CIT CIT CT GAA GAA GOG AAA GAA GA 99 PXL3676 CIT CIT CIT CIT CIT CT GAA GAA AGG AGA GAA GA 78 PXL3713 CIT CIT CIT CIT CIT CT GAA GAA GIT TAA GAA GA < 1 The results of purification of the various plasmids, which are given in Table 4 above, show that a stable triple helix structure is formed when the noncanonical central region forms triads of the T*CG, T*GC, C*AT and C*TA type. As shown by the yield of attachment to affinity gel of the plasmids pXL3675 and 20 pXL3676, a stable triple helix is also formed when two consecutive noncanonical T*GC triads are introduced, this being whatever the context, i.e. whether the 33 surrounding triads are canonical or noncanonical in nature. On the other hand, the introduction of a pair of contiguous triads of the T*TA type and of a contiguous C*TA triad leads to complete destabilization 5 of the triple helix structure.
Example 7: Constructions of plasmids comprising a cassette encoding an SeAP, haFP, FIX and GAX gene The genes used in these experiments in order to demonstrate the activity of the compositions of the 10 invention are, for example, the human gene encoding factor F IX (Kurachi et al., Proc. Natl. Acad. Sci. U.S.A. 79 (1982) 6461), the human gene encoding secreted alkaline phosphatase SeAP (Millan et al., J. Biol. Chem., 261 (1986) 3112), the human' gene encoding 15 alpha feto-protein haFP (Gibbs et al., Biochemistry 26 (1987) 1332), and the human gene encoding GAX (Gorski et al., Mol. Cell. Biol., 13 (1993) 3722). These genes were amplified by PCR using plasmids or cDNA libraries (Clontech), and then cloned downstream of the 20 eukaryotic CMV E/P promoter and upstream of the SV40 late polyA signal sequence, in a pCOR plasmid derived from pXL3296. The gene encoding secreted alkaline phosphatase (SeAP) was introduced into a pCOR plasmid derived from pXL3296 so as to generate the plasmid 25 pXL3402 (Figure 4). The gene encoding alpha fetoprotein (haFP) was introduced into a pCOR plasmid derived from pXL3296 so as to generate the plasmid 34 pXL3678 (Figure 5). The gene encoding GAX was introduced into a pCOR plasmid derived from pXL3296 so as to generate the plasmid pXL3207 (Figure 6). The gene encoding factor FIX was introduced into a pCOR plasmid 5 derived from pXL3296 so as to generate the plasmid pXL3388 (Figure 7).
Example 8: Use of an oligonucleotide of the 5'-(CTT)7-3' type to generate the formation of stable triple helix 10 structures with various genes of interest The interaction of various sequences with the triple helix interaction gel functionalized with the oligonucleotide 5'-TT(CTT) 6-3 ' (SEQ ID No.: 2) was studied by measuring the capacity obtained with 15 plasmids carrying various genes. The genes studied were i) the human gene encoding the factor IX, ii) the gene for secreted alkaline phosphatase SeAP, iii) the human gene for alpha feto-protein (aFP) and iv) the human GAX gene.
Table 5 Genes Target sequence(s) in the gene Capacity (|og plasmid attached per ml of gel) Factor IX GAA GAA GCA CGA GAA G 71 SEAP AA GAA AGC AGG GAA G GAA GAG GAA GAA G 100 haFP AAG GAG AAG AAG AA 146 hGAX AA GAT GAG GAA GAA G 118 The results given in Table 5 above show that it is possible, using an oligonucleotide of the (CTT)n type, to form stable triple helix structures with a gene of interest, even though this gene does not contain a target sequence of the 5'-(GAA)n-3' type complementary to the oligonucleotide. The existence, in 5 the central portion of the target sequence, of bases involved in triads of the T*CG, C*CG, T*GC and C*AT type is tolerated by the triple helix structure, as is the presence of an isolated T*TA triad (GAX gene).
Example 9: Use of a column functionalized with an oligonucleotide of the 5' -(CTT)7-3' type for purifying a plasmid containing the internal IDl sequence (5'-AA GAA GCA TGC AGA GAA GAA-3'; SEQ ID No. 1) The possibility of purifying plasmids carrying a sequence of the 5 ' - (R)n-(N) t~ (R')m~3 ' type, as described above, using a chromatographic support for affinity by triple helix interaction, functionalized with an oligonucleotide of the 5'-(CTT)7-3' type was studied based on Example 8.
The plasmid pXL3179 (comprising the human FGFl gene, which carries the sequence '-AA GAA GCA TGC AGA GAA GAA-3') was chromatographed on a Sephacryl S-1000 interaction column functionalized with the oligonucleotide 5 ' -NH2- (CH2) 6- (CTT) 7-3 ' . For this, 9.40 mg of plasmid pXL3179 in 60 ml of 50 mM sodium acetate, 2 M NaCl buffer (pH 4.5) were injected, at a flow rate of 30 cm/h, onto a 10 ml affinity column 36 containing the oligonucleotide 5' -NH2- (CH2) 6~ (CTT) 7-3 ' covalently coupled to Sephacryl S-100 SF as described in Example 3. After washing the column with 5 volumes of the same buffer, the attached plasmid was eluted 5 with 2 column volumes of 100 mM Tris/HCl, 0.5 mM EDTA buffer and quantified by measuring the UV absorbance (260 nm) and by ion exchange chromatography on a GenPak-Fax column (Waters). The E. coli genomic DNA content in the initial preparation and in the purified 10 fraction was measured by PCR as described in WO 96/18744. 7.94 mg of plasmid pXL3179 were found in the eluted fraction (elution yield, 84%) and the level of contamination with E. coli genomic DNA was decreased from 7.8 to 0.2% with the affinity chromatography 15 described. Similarly, the level of contamination with RNAs was decreased from 43% in the starting plasmid to 0.2% in the purified plasmid.
In various other chromatography experiments carried out on various plasmid pXL3179 preparations 20 chromatographed on a Sephacryl S-1000 affinity column functionalized with the oligonucleotide 5 ' —NH2— (CH2) 6- (CTT) 7-3 ' , the genomic DNA content was reduced from 0.2% to 0.007%, from 0.7% to 0.01%, from 7.1% to 0.2%, or from 7.8% to 0.1%.
Example 10: Use of an oligonucleotide of the '-CCT TTT CCT CCT T-3' type (SEQ ID No.: 12) to 37 generate the formation of stable triple helix structures with a gene of therapeutic interest, human VEGFB-167 The interaction of a sequence internal to a 5 gene of therapeutic interest, such as the human VEGFB-167 gene, with a triple helix interaction support functionalized with the oligonucleotide '-CCT TTT CCT CCT T-3' (SEQ ID No.: 12) was studied by measuring the capacity obtained with the plasmid 10 pXL3579 carrying the human VEGFB-167 gene (Figure 8) (Olofsson et al., J. Biol. Chem., 271 (1986) 19310). The plasmid pXL3579, which is represented in Figure 8, contains the VEGF-B167 gene amplified by PCR from a human heart cDNA library (Clontech), and then cloned 15 downstream of the eukaryotic CMV E/P promoter (~522/+74) and upstream of the SV40 late polyA signal sequence, between the Nsil and Xbal sites of the multiple cloning site of pXL3296.
Table 6 Oligonucleotide Target sequence in the gene (VEGFB-167 or control) Capacity (pg plasmid attached per ml of gel) CCT TTT CCT CCT T GGC AAC GGA GGA A 87 none (control vector) < 0.5 CCT CCT T GGA GGA A < 0.5 none (control vector) < 0.5 TTT TTT TTC CT AAA AAA AAG GA none (control vector) < 0.5 38 The results given in Table 6 above show that it is possible, using an oligonucleotide, such as for example the oligonucleotide 5'-CCT TTT CCT CCT T-3' (SEQ ID No. 12), which targets a sequence of the 5 5' - (R)n- (N) t- (R' )m-3 ' type, here the region '-GGC AAC GGA GGA A-3' (SEQ ID No. 13) of the human VEGFB-167 gene, to form a stable triple helix structure with a region of a gene of interest. Although, moreover, the human VEGFB-167 gene contains a 10 homopurine sequence 5'-AAA AAA AAG GA-3' targeted by the oligonucleotide 5'-TTT TTT TTC CT-3' (Table 6), the interaction obtained with the oligonucleotide 5'-CCT TTT CCT CCT T-3' is very greatly superior to the interaction obtained with the homopyrimidine 15 oligonucleotide. Similarly, the internal homopurine sequence 5'-GGA GGA A-3' is not sufficiently long to enable the formation of a stable triple helix with the oligonucleotide 5'-CCT CCT T-3'.
This example therefore clearly shows the 20 advantage of the sequences of the 5'-(R) n- (N) t- (R' )m~3' type for forming stable triple helix structures, even in a context in which the double-stranded DNA studied exhibits, moreover, at least one homopurine structure of significant length.
Example 11: Use of an oligonucleotide of the 5'-T CCT CTCCCT C-3' type (SEQ ID No.14) for separating the non- deleted VEGFB-186 cDNA via the formation of stable 39 triple helix structures with a target sequence within the modified VEGFB-186 cDNA It was observed, during the steps for producing the human VEGFB-186 gene in a fermenter, that 5 said gene was the site of genetic rearrangements and deletions, in particular in exon 6A. Silent point mutations were therefore introduced by sequential and mutagenizing PCR at nucleotides 510 (A/C), 513 (C/T), 516 (A/T), 519 (C/T) and 522 (C/T), relative to 10 translation point +1. The amino acid sequence of the VEGFB-186 protein included between amino acid 170 and 174 remains unchanged. On the other hand, the VEGFB-186 gene thus modified (VEGFB-186m) exhibits a target DNA sequence according to the present invention, 5'-A GGA 15 GCG GGA G-3' (SEQ ID No. 15), which is capable of forming a stable triple helix interaction with an oligonucleotide of sequence 5'-T CCT CTC CCT C-3' (SEQ ID No.14). This stable triple helix interaction is advantageously used to implement the process according 20 to the invention and to separate the modified VEGFB-186 gene which has not undergone rearrangements and deletions after it has been produced in a fermenter.
In order to illustrate the process of purification by triple helix interaction of the 25 modified VEGFB-186 gene, two plasmids, pXL3601 and pXL3977, as represented in Figure 9, were used. The VEGFB-186 gene was first of all amplified by PCR from a 40 human heart cDNA library (Clontech), and then cloned downstream of the eukaryotic CMV E/P (-522/+74) promoter and upstream of the polyadenylation signal of the SV40 virus late region between the Nsil and Xbal 5 sites of the multiple cloning site of the pXL3296 (Example 1.2), in order to generate the plasmid pXL3601. The latter was modified by sequential and mutagenizing PCR, in order to generate the plasmid pXL3977 in which the VEGFB-186 gene is modified in exon 10 6A as described above.
The interaction of the target sequence 5'-A GGA GCG GGA G-3' (SEQ ID No. 15) within the VEGFB-186m gene, with a triple helix interaction support functionalized with the oligonucleotide 5'-T CCT CTC 15 CCT C-3' (SEQ ID No.14), was studied by measuring the capacity obtained with the plasmid pXL3977 carrying the modified human VEGFB-186 gene (Figure 9). Since the sequence of VEGFB-167 is contained in the sequence of VEGFB-186m, the plasmid pXL3579 as described in Example 20 10, and which comprises the human VEGFB-167 gene, is therefore used as a negative control. 41 Table 7 Oligonucleotide pCOR-VEGF- PCOR-VEGF- Empty pCOR B186m B167 (PXL3296) (PXL3977) (PXL3579) (|j.g plasmid (jog plasmid (jag plasmid attached per attached per attached per ml of gel) ml of gel) ml of gel) ID No. 14 234 32 < 1.0 ID No. 16 224 0.5 - 1.0 < 1.0 The results given in Table 7 above show that it is possible, using an oligonucleotide, such as, for 5 example, the oligonucleotide (SEQ ID No.14), targeting a sequence of the 5'-(R) n- (N) t- (R' )m~3' type, here the region 5'-A GGA GCG GGA G-3' (SEQ ID No.15) of the modified human VEGFB-186 gene, to form a stable triple helix structure with a region of a gene of interest, 10 and thus to purify it efficiently. The oligonucleotide 5'-TTT CCT CTC CCT C-3' (SEQ ID No. 16) can also be used to purify the modified human VEGFB-186 gene.

Claims (38)

42 What We Claim Is:
1. Process for purifying a double-stranded DNA molecule, wherein said double-stranded DNA molecule is brought into contact with a third 5 DNA strand, said double-stranded DNA molecule comprising at least one target sequence of general formula: 5'-(R)„-(N)t-(R')m-3' in which: R and R' represent nucleotide sequences composed only of purine 10 bases; n and m are integers less than 9; and the sum of n+m is greater than 5; N is a nucleotide sequence comprising both purine bases and pyrimidine bases; and 15 t is an integer less than 8; said target sequence being capable of interacting with a third DNA strand so as to form a triple helix structure.
2. Process according to claim 1, wherein the interaction 2 0 between the region N and the third DNA strand produces the formation of at most 6 noncanonical triads.
3. Process according to claim 2, wherein the noncanonical triads thus formed are chosen from the T*CG, T*GC, C*AT and C*TA triads. 25
4. Process according to any one of the preceding claims, wherein the regions R and R' comprise at least two guanines (G) in total.
5. Process according to any one of the preceding claims, 3 0 wherein the regions R and R' comprise at least 2 adenines. 11" i lull i ual property ofrcei of n.z. 3 J MAY 2005 RECEIVE 43
6. Process according to any one of the preceding claims, wherein the regions R and R' form, with the third DNA strand, canonical triads chosen from T*AT and +C*GC. 5
7. Process according to any one of the preceding claims, wherein the third DNA strand is of the homopyrimidine type.
8. Process according to claim 7, wherein the third DNA strand comprises a poly-CTT sequence.
9. Process according to any one of the preceding claims, wherein the third DNA strand is an oligonucleotide.
10. Process according to any one of the preceding claims, 15 wherein the target sequence present on said double-stranded DNA molecule comprises the sequence SEQ ID No. 1, and said oligonucleotide is chosen from the oligonucleotides of sequence SEQ ID No. 2 to 5.
11. Process according to one of the preceding claims, wherein the target sequence is naturally present on the double-stranded DNA molecixle, or is a target sequence introduced artificially into the double-stranded DNA molecule.
12. Process according to one of the preceding claims, wherein the target sequence naturally present on the DNA molecule is present in the coding 2 5 sequence of genes of therapeutic or experimental interest.
13. Process according to claim 12, wherein the target DNA sequence comprises all or part of the sequence SEQ ID No. 1 included in the human FGFl gene. 30 44
14. Process according to claim 12, wherein the target DNA sequence comprises the sequence SEQ ID No. 6 included in the human gene encoding factor IX. 5
15. Process according to claim 12, wherein the target DNA sequence comprises the sequence SEQ ID No. 7 or No. 8 included in the human gene for secreted alkaline phosphatase.
16. Process according to claim 12, wherein the target DNA sequence comprises the sequence SEQ ID No. 9 included in the human gene for alpha feto-protein (aFP).
17. Process according to claim 12, wherein the target DNA sequence comprises the sequence SEQ ID No. 10 included in the human GAX 15 gene. 20
18. Process according to claim 12, wherein the target DNA sequence comprises the sequence SEQ ID No. 13 included in the human VEGFB167 gene.
19. Process according to any one of the preceding claims, wherein the double-stranded DNA molecule is a circular DNA, such as a plasmid, a minicircle or a linear fragment. 2 5
20. Process according to any one of the preceding claims, wherein the oligonucleotide is covalently or noncovalently, stably coupled to a support.
21. Process according to any one of the preceding claims, wherein the oligonucleotide is grafted to a polymer of natural or synthetic origin. 30 3 1 May 2005 SSljVEO I 45
22. Process according to claim 20, wherein the support is chosen from chromatography supports, plastic surfaces and functionalized latex beads. 5
23. Process according to claim 22, wherein the chromatography support is a gel permeation support.
24. Process according to any one of the preceding claims, wherein the solution containing said double-stranded DNA molecule is a cell
25. Process according to any one of the preceding claims, wherein the cell lysate is a clear lysate. 15
26. Process according to any one of the preceding claims, wherein the double-stranded DNA molecule is prepurified.
27. Process according to one of claims 20 to 26, wherein the oligonucleotide has the sequence GAGGCTTCTTCTTCTTCTTCTTCTT (SEQ ID 20 No. 11).
28. Process according to one of claims 20 to 27, wherein the oligonucleotide is coupled to the support via disulfide, thioether, ester, amide or amine attachment. 25
29. Process according to one of claims 20 to 28, wherein the oligonucleotide is attached to the support via an arm composed of a carbon-based chain (CH2)n in which n is an integer between 1 and 18 inclusive, said arm being linked to the oligonucleotide via a phosphate and to the support via an amine 3 0 attachment. 46
30. Process according to one of the preceding claims, wherein the oligonucleotide has at least one chemical modification which makes it resistant to or protected against nucleases, or which increases its affinity for the specific sequence.
31. Process according to any one of the preceding claims, wherein the oligonucleotide comprises a sequence in which at least one of the cytosines is methylated in the 5' position.
32. Process according to any one of the preceding claims, wherein it comprises at least one step in which a solution containing said double-stranded DNA, mixed with other components, is brought into contact with the support to which said oligonucleotide is covalently coupled. 15
33. Process according to any one of the preceding claims, wherein a solution containing said double-stranded DNA, mixed with other components, is passed over the chromatography support to which said oligonucleotide is covalently coupled. 2 0
34. Process according to any one of the preceding claims, wherein said third DNA strand or said oligonucleotide is labeled. 25 30
35. Purified double-stranded DNA obtained using the process according to any one of the preceding claims.
36. Process for detecting a double-stranded DNA, wherein a solution suspected of containing said double-stranded DNA molecule is brought into contact with a labeled third DNA strand capable of forming, by hybridization, a triple helix with a target sequence of said double-stranded DNA, said target sequence having the following general formula: 5'-(R)„-(N)r(R')m-3' inteuxoiual property office] of n.z. 3 1 MAV 2005 RECEIVED 47 in which: R and R' represent nucleotide sequences composed only of purine bases; n and m are integers less than 9; and the sum of n+m is greater than 5 5; N is a nucleotide sequence comprising both purine bases and pyrimidine bases; and t is an integer less than 8. 10
37. Process according to claim 1 or 36 substantially as described hereinbefore in any one of the Examples.
38. Purified double-stranded DNA according to claim 35 substantially as described hereinbefore in any one of the Examples. 15 END OF CLAIMS intellectual property office of n.z. 3 1 MAY 2005 received I
NZ528507A 2001-03-23 2002-03-25 Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction NZ528507A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0103953A FR2822476B1 (en) 2001-03-23 2001-03-23 METHODS OF PURIFICATION AND DETECTION OF TARGET SEQUENCES OF DOUBLE-STRANDED DNA BY TRIPLE-HELICE INTERACTION
US28527201P 2001-04-23 2001-04-23
PCT/FR2002/001034 WO2002077274A2 (en) 2001-03-23 2002-03-25 Methods for purifying and detecting double stranded dna target sequences by triple helix interaction

Publications (1)

Publication Number Publication Date
NZ528507A true NZ528507A (en) 2005-08-26

Family

ID=26212934

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ528507A NZ528507A (en) 2001-03-23 2002-03-25 Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction

Country Status (13)

Country Link
EP (1) EP1370692A2 (en)
JP (1) JP4444564B2 (en)
KR (2) KR20030088464A (en)
CN (1) CN1498276A (en)
BR (1) BR0208292A (en)
CA (1) CA2440133A1 (en)
HU (1) HUP0303632A3 (en)
IL (2) IL158017A0 (en)
MX (1) MXPA03008642A (en)
NO (1) NO20034184L (en)
NZ (1) NZ528507A (en)
PL (1) PL365208A1 (en)
WO (1) WO2002077274A2 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL1737945T3 (en) 2004-04-19 2011-07-29 Aventis Pharma Sa Method for purifying plasmid dna
EA034241B1 (en) 2009-11-06 2020-01-21 Те Чайниз Юниверсити Ов Гонконг Method for performing prenatal diagnosis of a sequence imbalance
EP2407552B1 (en) * 2010-07-13 2012-11-14 Cnrs Method for the isolation of the proteins bound to any kind of interesting nucleic acid sequence
US9892230B2 (en) 2012-03-08 2018-02-13 The Chinese University Of Hong Kong Size-based analysis of fetal or tumor DNA fraction in plasma
AU2018321760A1 (en) * 2017-08-25 2020-02-27 Zoetis Services Llc A nucleic acid probe, a method of immobilizing the nucleic acid to a solid support using UV light, a solid support comprising an immobilized nucleic acid probes, and a test device comprising a solid support
CN109959691B (en) * 2019-04-15 2021-06-08 济南大学 Method for detecting nucleic acid based on cascade photoelectric active material and triple helix molecular switch
CN116396963B (en) * 2023-04-12 2023-10-13 南通大学 Triple-chain forming oligonucleotide for inhibiting expression of vascular endothelial growth factor A and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0566670A4 (en) * 1990-12-17 1993-12-08 Idexx Laboratories, Inc. Nucleic acid sequence detection by triple helix formation
FR2728264B1 (en) * 1994-12-16 1997-01-31 Rhone Poulenc Rorer Sa DNA PURIFICATION BY TRIPLE PROPELLER FORMATION WITH A IMMOBILIZED OLIGONUCLEOTIDE
FR2731014B1 (en) * 1995-02-23 1997-03-28 Rhone Poulenc Rorer Sa DNA MOLECULES, PREPARATION AND USE IN GENE THERAPY
FR2746412B1 (en) * 1996-03-21 1998-06-12 Rhone Poulenc Rorer Sa PURIFICATION OF PLASMID DNA OF PHARMACEUTICAL QUALITY
FR2776669B1 (en) * 1998-03-24 2001-06-15 Rhone Poulenc Rorer Sa NUCLEIC ACID TRANSFER VECTORS, COMPOSITIONS CONTAINING SAME, AND USES THEREOF

Also Published As

Publication number Publication date
CA2440133A1 (en) 2002-10-03
KR20030088464A (en) 2003-11-19
CN1498276A (en) 2004-05-19
NO20034184D0 (en) 2003-09-19
EP1370692A2 (en) 2003-12-17
KR101002499B1 (en) 2010-12-17
IL158017A0 (en) 2004-03-28
IL158017A (en) 2011-07-31
PL365208A1 (en) 2004-12-27
BR0208292A (en) 2004-04-13
JP4444564B2 (en) 2010-03-31
JP2004523245A (en) 2004-08-05
AU2002253261C1 (en) 2002-10-08
AU2002253261C9 (en) 2002-10-08
HUP0303632A2 (en) 2004-01-28
WO2002077274A3 (en) 2003-10-02
NO20034184L (en) 2003-11-04
KR20090094870A (en) 2009-09-08
HUP0303632A3 (en) 2005-12-28
MXPA03008642A (en) 2004-06-30
WO2002077274A2 (en) 2002-10-03

Similar Documents

Publication Publication Date Title
JP2009045070A (en) Dna purification by formation of triple helix with immobilized oligonucleotide
KR100502116B1 (en) Purification of Pharmaceutical Plasmid DNA
US8399636B2 (en) Purification of a triple helix formation with an immobilized obligonucleotide
NZ528507A (en) Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction
US7514218B2 (en) Processes for purifying and for detecting target double-stranded DNA sequences by triple helix interaction
AU2007202804B8 (en) Purification of a triple helix formation with an immobilized oligonucleotide
AU2001263459A1 (en) Purification of a triple heli formation with an immobilized oligonucleotide
IL152860A (en) Purification of dna by a triple helix formation with an immobilized oligonucleotide

Legal Events

Date Code Title Description
PSEA Patent sealed
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)