KR101002499B1 - Methods for purifying and detecting double stranded dna target sequences by triple helix interaction - Google Patents

Abstract

The present invention relates to a novel double-stranded DNA target sequence capable of interacting with the third strand to form a stable triple helix. In addition, the present invention is to contact the solution containing the DNA molecule with the third DNA strand, which can form a triple helix structure by hybridization with a double-stranded DNA target sequence obtained by the DNA molecule. And a method for purifying a double-stranded DNA molecule.

Double-stranded DNA, triple helix, hybridization

Description

METHODS FOR PURIFYING AND DETECTING DOUBLE STRANDED DNA TARGET SEQUENCES BY TRIPLE HELIX INTERACTION}

The present invention relates to novel target DNA sequences capable of forming triple helix-like structures, and novel methods of purifying DNA. More specifically, the purification method according to the invention results in hybridization between the target DNA sequence and the oligonucleotide. The method according to the invention appears to be particularly useful because of its high yield of purification of double-stranded DNA of pharmaceutical properties.

The present invention also relates to novel methods of detecting, quantifying, isolating or classifying DNA molecules containing said specific target sequences.

The purification method according to the invention is based substantially on the triple helix interaction between a particular target DNA sequence and an oligonucleotide consisting of a natural base or a modified base.

Homopyrimidine oligonucleotides have been shown to specifically interact in the major groove of DNA double helices to locally form a triple strand structure called triple helices [Moser et al., Science 238 (1987). ) 645; Povsiz et al., J. Am. Chem. 111 (1989) 3059. Such oligonucleotides selectively recognize oligopurine-oligopyrimidine sequences, ie oligopurine sequences on one strand and oligopyrimidine sequences on their complementary strands, thereby providing local Forms triple helices; The bases of the homopyrimidine oligonucleotide third strand form a hydrogen bond (Hoogsteen type bond) with the purines of the Watson Creek base pair.

Similarly, triple helical structures can be formed between homopurine oligonucleotides and homopurine-homopyrimidine double stranded DNA. In this form of structure, the purine base of the oligonucleotide forms an inverse hugstin-type bond with the purine base of the double stranded DNA.

Such site specific triple helix interactions have been used specifically to regulate expression of specific genes by Looney et al., Science 241 (1988) 456, and are present in promoter or coding regions. Helene et al. Exemplified the possibility of modulating the expression profile of the genes expected to occur through the inhibitory action of RNA polymerase in the initiation and / or elongation phase by forming a triple helix structure between the target sequence and the oligonucleotide. et al., BBA 1049 (1990) 99; WO 95/18223.

This type of triple helix interaction has also been described in the international application WO 96/18744 for plasmid DNA purification, for the purpose of purifying plasmid DNA from complex mixtures of said DNA molecules with other components. . More specifically, the application relates to a double-stranded DNA purification method consisting of contacting the complex mixture with a support in which an oligonucleotide capable of forming a triple helix by hybridization with a specific sequence of a target DNA is covalently bound. .

In specific interactions in the form of triple helixes for purification purposes, the specificity is a Hugstein-type hydrogen bond formed between the thymine (T) base of the third strand constituting the first oligonucleotide and the AT base pair of the second double-stranded DNA. Is caused by pairing to form a T ^* AT triad. Similarly, it is caused by the ⁺ C ^* GC triad formed between the protonated cytosine located in the third strand pair and the GC base pair of the double stranded DNA [Sun et al., Curr. Opin Struc Biol. 3 (1993) 345. To date, these T ^* AT and ⁺ C ^* GC triads (called normative triads) have been recognized to ensure maximum stability of the triple helix. However, the stability of the triple helix may also be affected by many other factors, such as the ratio of cytosine, pH, salinity of the medium or the environment of the triple helix. It is also widely known that the introduction of triads, which are called non-normative (i.e. different from T ^* AT and ⁺ C ^* GC triads), causes some significant structural deformation in the triple helix, intentionally leading to significant instability. have. Moreover, the introduction of various non-normative triads has been studied in the context of comparative studies to demonstrate various destabilization of the triple helix as a function of the introduced non-normative triad properties [Roberts et al., Proc. Natl. Acad. Sci. USA 88, 9397; Fossella et al., (1993) Nucleic Acids Research 21, 4511; Govers et al., Nucleic Acids Research (1997) 25, 3787].

This method can quickly and effectively purify target DNA of pharmaceutical quality but requires one of two strands of DNA to be purified, a sequence that is complementary and sufficiently long to the third DNA strand, preferably a complete homopurine sequence. . Such sequences may be naturally present or artificially inserted in the target double-stranded DNA sequence that requires purification.

Applicants now surprisingly and unexpectedly assume that a DNA molecule carrying a target DNA sequence on one strand, essentially consisting solely of purine bases, of a base that is not complementary to the base of the oligonucleotide to form a non-normative triplet. In spite of their existence, they found that they could form a stable triple helix structure with the third DNA strand.

More specifically, the target double-stranded DNA sequence newly identified by the applicant includes on one strand a homopurine sequence mediated by a given number of pyrimidine bases. Applicants have also found that such partial homopurine-partial homopyrimidine DNA sequences can be used to effectively purify DNA molecules containing such sequences by triple helix interaction.

Such newly identified sequences are also particularly useful for detecting, quantifying, separating or classifying DNA molecules containing such sequences.

It is therefore an object of the present invention to provide a novel target DNA sequence comprising a sequence represented by the following formula on one strand and capable of interacting with a third DNA strand to form a triple helix structure:

5 '-(R) _n- (N) _t- (R') _m -3 '

In this expression,

R and R 'represent nucleotides consisting solely of purine bases;

n and m are integers less than 9 and the sum of n + m is greater than 5;

N is a nucleotide sequence comprising both a purine base and a pyrimidine base;

t is an integer less than 8.

Thus, homopurine sequences R and R 'located in the 5' and 3 'portions of the target DNA sequence, respectively, have a total length of 6 or more. These sequences contain adenine and guanine bases that can interact with the third strand to form a triple helix structure consisting of T ^* AT and ⁺ C ^* GC normative triads. The homopurine sequences R and R 'preferably comprise a total of two or more guanines and two or more adenines. More preferably, this purine sequence contains a motif of the type (AAG).

The central sequence N has less than 8 purine and pyrimidine base pairs at t lengths, and can interact with the third DNA strand to form a non-normative triplet according to the present invention. Preferably, the central sequence N is at least 1 and less than 8 in length. More preferably, the length of the central sequence N is two or more and less than eight.

The term "normative triad" refers to two nucleotide triads created by the interaction of the AT and GC double chains of double-stranded DNA with the T and ^* C bases to form T ^* AT and ⁺ C ^* GC triads, respectively. It means. These two trio are the most stable of the 16 trio existing.

The term "non-normative triad" refers to the remaining 14 sets of nucleotide triads. This is made by the interaction of a third strand with a double stranded DNA in a nonspecific manner, which shows reduced stability compared to the T ^* AT and ⁺ C ^* GC normative triads. For example, T ^* CG and T ^* GC non-normative triads, respectively, formed by the interaction between the CG or GC double chain of the target sequence and thymine (T) of the third strand, CG 2 of the target sequence G ^* CG non-normative triplets formed by the interaction between heavy chain and guanine (G) of the third strand, by interaction of AT and TA double chains of the target sequence with cytosine (C) located on the third strand C ^* AT and C ^* TA non-reference each formed enemy triad, the third strand of the guanine (G) and CG 2 G formed by the interaction between the heavy chain ^* CG non-normative triad or a third strand of thymine There is a T ^* TA triad formed by the interaction of (T) and the TA double chain.

Like the purine ends present at 5 'and 3', the central sequence N is also T ^* AT obtained by the interaction of AT and GC double chains with thymine (T) and cytosine (C) bases located on the third DNA strand, respectively. It is self-evident that ^{+ and} C ^* GC can form normative trio.

The central sequence N preferably comprises purine and pyrimidine bases that form up to six non-normative triplets. More preferably, the non-normative triad formed by the interaction of the oligonucleotide with the central moiety is selected from T ^* CG, T ^* GC, C ^* AT and C ^* TA nonnormative triads. A preferred distribution of such triads is, for example, forming six non-normative triads comprising C ^* AT, C ^* TA, two T ^* CGs, and two T ^* GCs, two C ^* ATs And forming five non-normative triads containing three T ^* GCs or three non-normative triads containing two T ^* GCs and one C ^* AT. Several T ^* TA non-normative triads may exist, but in this case they do not continually be located in the triple helix.

The central sequence preferably includes up to three C or T pyrimidine bases that form a T ^* CG and C ^* TA or G ^* TA non-normative triad. These three pyrimidine bases are not contiguous and are separated by A or G purine bases, which interact with the third DNA strand to allow T ^* GC and C ^* AT non-normative bases as well as T ^* AT and ⁺ C ^* It is desirable to be able to form GC normative trio.

According to certain embodiments of the invention, the target double-stranded DNA sequence is SEQ ID NO: 5'-AA GAA GCA TGC AGA GAA GAA-3 '(SEQ ID NO: 1).

A third DNA strand capable of interacting with a double stranded DNA sequence according to the present invention may be, for example, oligonucleotides or strands of other double stranded DNA in a locally unpaired state, and may include the following bases: Can:

Thymine (T), which forms the T ^* AT normative triplet with the AT double strand of the target double strand DNA sequence, as well as the T ^* CG and T ^* GC non-normative with each CG and GC double chain Triads can be formed (Soyfer et al., In Triple Helical Nucleic Acids (1996) Springer, New York, pp. 151-193);

Guanine (G), which can form G ^* TA triads with TA double strands of double-stranded DNA (Soyfer et al., In Triple Helical Nucleic Acids (1996) Springer, New York, pp. 151-193) ;

Cytosine (C), which is the normative ⁺ C ^* GC (protonated cytosine C ⁺ ) triad or non-normative C ^* AT and C ^* TA triads of the target double-stranded DNA, respectively Can form;

Uracil, which may form a triple chain with an AU or AT base pair of a target sequence (Bates et al., Nucleic Acids Research 23 (1995) 3627).

The third DNA strand used preferably comprises a cytosine-rich homopyrimidine sequence, which cytosine remains protonated at acidic pH to form a stable triple helix. Such oligonucleotides can include, for example, a (CCT) n sequence, a (CT) n sequence or a (CTT) n sequence, where n is an integer between 1 and 20. In particular, it is advantageous to use sequences of the type (CT) n or (CTT) n or sequences in which the (CCT), (CT) or (CTT) motifs are combined.

If the third DNA strand is present in oligonucleotide form, the oligonucleotide may be composed of a natural product, ie a natural unmodified base or a chemical modification. In particular, it may be advantageous for oligonucleotides to have certain chemical modifications that can increase resistance or protection against nucleases or increase affinity for particular sequences.

According to the present invention, the term "oligonucleotide" means any nucleoside chain in which the backbone is modified for the purpose of increasing resistance to nucleases. Among the possible modifications are phosphorothioate oligonucleotides capable of forming triple helices with DNA (Xodo et al., Nucleic Acids Research , 22 (1994) 3322) as well as oligonucleotides with formacetal or methyl phosphonate backbones. (Mtteucci et al., J. Am. Chem. Soc. , 113 (1991) 7767). It is also possible to use oligonucleotides synthesized with α-anomers of nucleotides, which also form triple helices with DNA (Le Doan et al., Nucleic Acids Research , 15 (1987) 7749). . Another variation of the backbone is phosphoramidate linkages. An example is the interphosphodate N3'-P5 'nucleotide linkage described by Gryaznov et al., J. Am. Chem. Soc. , 116 (1994) 3143. And particularly oligonucleotides that form stable triple helices. Among other backbone modifications, the use of ribonucleotides, 2′-O-methylribose or phosphodiester is also exemplified (Sun et al., Curr. Opinion in Struct. Biol. , 3 (1993) 3143). Finally, the phosphorous backbone can be substituted with polyamide backbones such as those present in PNAs (peptide nucleic acids), which can also form triple helices (Nielsen et al., Science , 254 (1991), 1497). Kim et al., J. Am. Chem. Soc. , 115 (1993) 6477-6481).

The third strand of thymine can also be substituted with 5-bromouracil, which increases the affinity of the oligonucleotides for DNA (Povsic et al., J. Am. Chem. Soc. , 111 (1989) 3059). . The third strand may also include non-natural bases, for example 7-deaza-2'-deoxyxanthosine (Milligan et al., Nucleic Acids Res. , 21 (1993) 327), 1- (2-deoxy-alpha-D-ribofuranosyl) -3-methyl-5-amino-1H-pyrazolo [4,3-d] pyrimidin-7-one (Koh et al., J. Am . Chem. Soc. , 114 (1992) 1470), 8- oxoadenine , 2-aminopurine, 2'-0-methyl pseudoisocytidine or those skilled in the art (hereinafter referred to as those skilled in the art) Other variations (Sun et al., Curr. Opinion in Struct. Biol. , 3 (1993) 345).

The purpose of other modified forms of the third strand is to specifically increase the interaction and / or affinity between the third strand and the particular sequence. In particular, a completely advantageous modification according to the invention is the methylation of the cytosine of the oligonucleotide at position 5. These methylated oligonucleotides have the remarkable property of forming stable triple helices with specific sequences in the pH range closer to neutral (≥5; Xoda et al., Nucleic Acids Research 19 (1991) 5625). Such oligonucleotides make it possible to work at higher pH than prior art oligonucleotides, i.e., pHs with a significantly lower risk of degradation of plasmid DNA.

The length is a function of the required selectivity and stability of the interaction and can be adjusted by the person skilled in the art.

The third DNA strand according to the present invention can be synthesized by any known technique. Specifically, this strand can be prepared using a nucleic acid synthesizer. Of course, any other method known to those skilled in the art may be used.

Such third DNA strands or oligonucleotides comprise a specific two-stranded chain as described above comprising a complex (pyrimidine-purine) internal region N with two or less nucleotides in length and two homopurine regions R and R ′ adjacent thereto. It can form triple helices with DNA sequences. The homopurine region may comprise a motif of type GAA, for example.

For example, there is a target double-stranded DNA sequence corresponding to SEQ ID NO: 5'-AA GAA GCA TGC AGA GAA GAA-3 '(SEQ ID NO: 1), the sequence comprising an oligo comprising a sequence selected from the following sequences: May form triple helices with nucleotides:

5'-TT CTT CTT CTT CTT CTT CTT-3 '(SEQ ID NO: 2),

5'-TT CTT CTT GCT TCT CTT CTT-3 '(SEQ ID NO: 3),

5'-TT CTT CTT GTT TCT CTT CTT-3 '(SEQ ID NO: 4), and

5'-TT CTT CTT CCT TCT CTT CTT-3 '(SEQ ID NO: 5).

The formation of triple helices can be obtained in the presence of Mg ²⁺ ions which may optionally promote the stability of this structure (Vasquez et al., Biochemistry 34 (1995) 7243; Beal et al., Science 251 ( 1991) 1360).

According to a preferred embodiment, the target DNA sequence according to the invention may be naturally present in double-stranded DNA, in particular such as present in a gene sequence of interest such as a gene or marker gene sequence that is a therapeutic or experimental subject. It is very advantageous to use oligonucleotides that can form triple helices with sequences. In this regard, Applicants analyzed the nucleotide sequences of the various genes of interest and tested the stability of the triple helix interactions formed with oligonucleotides of the (CTT) n type, and as a result, a specific region of the gene was identified as T ^* CG. In spite of the presence of non-normative triads such as, T ^* GC, C ^* AT, C ^* TA and T ^* TA, it was confirmed that they form stable triple helices.

Among the sequences naturally present in the double-stranded DNA, for example, the 5'-AA GAA GCA TGC AGA GAA GAA-3 'sequence in the human FGF1 gene sequence (Jaye et al., Science 233 (1986) 541) ( 5'-GAA GAA GCA of the human gene (Kurachi et al., Proc. Natl. Acad. Sci. USA 79 (1982) 6461) encoding factor IX involved in coagulation 5′-GAA GAG GAA GAA G-3 ′ of the CGA GAA G-3 ′ sequence (SEQ ID NO: 6), SeAP secreted alkaline phosphatase gene (Millan et al., J. Biol. Chem. , 261 (1986) 3112) Sequence (SEQ ID NO: 8), the 5'-AAG GAG AAG AAG AA-3 'sequence (SEQ ID NO: 9) of the human alpha fetoprotein hαFP gene (Gibbs et al., Biochemistry 26 (1987) 1332), which controls stenosis 5'-AA GAT GAG GAA GAA G-3 'sequence of the human GAX gene (Gorski et al., Mol. Cell. Biol. , 13 (1993) 3722) (SEQ ID NO: 10) and finally the human VEGFB-167 gene ( Olofsson et al., J.Biol.Chem., 271 (1986) 5'-GGC AAC GGA GGA a-3 ' sequence (SEQ ID NO: 13 19 310)), the The. Forming a triple helix with a sequence present in a gene for therapeutic or experimental purposes means that the target sequence is naturally present in the double-stranded DNA molecule, so that the target sequence contains the target double-stranded DNA or this gene to feed in an artificial specific sequence. This is particularly advantageous because there is no need to modify the plasmid. Alternatively, the target sequence may be artificially introduced into the double stranded DNA.

A second aspect of the present invention is to triple the specific sequence present in a third DNA strand as described above, preferably in a double stranded DNA as described above by hybridization, to a solution containing DNA, mixed with other components. It is based on a method of purifying double-stranded DNA upon contact with oligonucleotides capable of forming a helix. Preferably, the double-stranded DNA is brought into contact with the oligonucleotides immobilized on the support in a solution state. Even more preferably, the oligonucleotide is covalently or non-covalently bound to the support in a stable manner. Thus, contacting a solution containing double-stranded DNA can advantageously be done by passing a DNA solution mixed with other components onto the support to which the oligonucleotides are bound, thereby efficiently purifying the double-stranded DNA to be purified. And in a rapid manner.

Such supports are known to those skilled in the art and include, for example, microparticles, such as beads or latex particles, or any other support in which the support is suspended. Oligonucleotides may also be fused onto molecules of polymer type of natural or synthetic origin. As described above, the polymer to which the oligonucleotide is attached has a property that can be easily separated from the solution after forming triple helixes with double-stranded DNA. Among the natural polymers are, for example, proteins, lipids, sugars and polyols. Among the synthetic polymers, there may be mentioned polyacrylamide, polyethylene glycol, styrene derivatives and thermosensitive polymers such as poly (N-isopropylacrylamide) type compounds which are soluble at low temperatures and insoluble in the range above the phase transition temperature (T). Mori et al., Biotechnology and Bioengineering , 72 (2001) 261).

The purification method according to the present invention comprises: i) a DNA molecule that does not contain a homopurine sequence of a length large enough to form a stable triple helix structure with homopyrimidine oligonucleotides, as well as ii) a homopurine sequence. It is particularly useful because it allows the purification of DNA molecules containing pyrimidine bases. In addition to being able to purify more diverse DNA molecules like this, the method is also fast and yields particularly high yields and degrees of purification.

Moreover, through this method, DNA molecules can be purified from complex mixtures containing other nucleic acids, proteins, endotoxins (e.g. lipopolysaccharides), nucleases, and the like, to obtain purified DNA of pharmaceutical quality. have.

Oligonucleotides are generally functionalized to covalently bind to a support. Thus, the 5 'or 3' position can be modified with terminal thiols, amines or carboxyl groups. Specifically, the addition of thiols, amines or carboxyl groups allows for the binding of oligonucleotides to a support having, for example, disulfide, maleimide, amine, carboxyl, ester, epoxide, cyanogen bromide or aldehyde functional groups. Such linkage is achieved through the formation of disulfide, thioether, ester, amide or amine attachments between the oligonucleotide and the support. It may also be formed using any other method known to those skilled in the art, such as a bifunctional binding reagent.

Furthermore, to enhance hybridization with bound oligonucleotides, it may be advantageous for the oligonucleotides to include bases of the "arm" and "spacer" sequences. Here, the arm serves to improve the conditions of interaction with the DNA by attaching oligonucleotides at a certain distance from the support. Thus, the arm is advantageously composed of a linear carbon-based chain comprising groups of 1 to 18, preferably 6 to 12, CH ₂ types, and an amine that can be attached to the column. This arm is linked to a "spacer" consisting of bases not involved in hybridization or to the phosphate salts of said oligonucleotides. Thus, a "spacer" may comprise a purine base. For example, a "spacer" may comprise the sequence GAGG.

Oligonucleotides bound to a purification support may have, for example, the sequence 5′-GAGG CTT CTT CTT CTT CTT CTT CTT-3 ′ (GAGG (CTT) ₇ ; SEQ ID NO: 11), wherein the GAGG base is triple It is not involved in the helical structure but can form a space between the oligonucleotide and the binding arm.

Various kinds of supports can be used in the practice of the present invention. Examples include pre-filled or loosely functionalized chromatographic supports, functionalized plastic surfaces or functionalized latex beads, which may be magnetic or nonmagnetic. In particular, gel permeation chromatography supports are preferred. Chromatographic supports that can be used include agarose, acrylamide or dextran and derivatives thereof (e.g. Sephadex ^® , Sepharose ^® , Superose ^®, etc.), polymers such as poly (styrenedivinylbenzene), or fusion or non-fusion Soluble silica and the like. The chromatography column may be operated in the form of a "fluidized bed" or "expansion" system or in a diffusion or perfusion manner using a chromatographic support of a density suitable for the particular embodiment.

The method according to the invention can be used to purify any type of double stranded DNA. Examples include circular DNA, such as minicircles (Darquet et al., Gene Theraphy 6 (1999) 209), linear fragments or plasmids carrying one or more genes, typically for therapeutic or experimental purposes. This plasmid may also carry, for example, a conditional type of origin of replication (eg, the pCOR plasmid described in Soubrier et al., Gene Therapy 6 (1999) 1482), marker genes, and the like. The method of the invention can be applied directly to cell lysates. In this embodiment, plasmids amplified by transformation and subsequent cell culture are purified immediately after cell lysis. The method according to the invention can also be applied to the clear lysate, ie the supernatant obtained after neutralization and centrifugation of the cell lysate. Of course, it can also be applied to the solution pre-purified according to known methods. This method also enables the purification of linear or circular DNA carrying the sequence from a mixture containing DNA of various sequences. The method according to the invention can also be used to purify double stranded RNA.

Cell lysates may be lysates of prokaryotic or eukaryotic cells. Prokaryotic

Examples include Escherichia coli (E.coli), B. subtilis (B.subtilis), S. typhimurium (S.typhimurium), S. aureus (S.aureus) or Streptomyces (Streptomyces) bacteria There is. Examples of eukaryotic cells include animal cells, yeasts, fungi, and more specifically, Kluyveromyces or Saccharomyces yeasts or COS, CHO, CI27, NIH3T3, MRC5, 293 cells, and the like. have.

The method of the present invention is particularly advantageous because it is a method for obtaining very high purity plasmid DNA quickly and simply. In particular, as illustrated in the Examples below, this method allows for efficient separation of plasmid DNA from contaminating components such as fragmented chromosomal DNA, RNA, endotoxins, proteins or nucleases.

The methods of the present invention are also useful for purifying and concentrating DNA molecules, particularly genes for therapeutic purposes, such as the FGF1 gene, whose production should be purified on an industrial scale and whose purity should be suitable for pharmaceutical use.

According to a third aspect, an object of the present invention is a method for detecting, quantifying and classifying double-stranded DNA molecules containing at least one target sequence as described above, comprising: a) a solution that is expected to contain the DNA molecule. Contacting with a third DNA strand, such as a labeled oligonucleotide, to form a stable triple helix, and b) detecting a complex that would have formed between said double-stranded DNA and said third DNA strand. will be.

This method is particularly useful in that it analyzes the genome, for example by detecting specific DNA sequences present in the genome or by classifying specific sequences.

The third DNA strand or oligonucleotide according to the present invention in this respect can be labeled by bottling a label detectable by spectroscopic, photochemical, biochemical, immunochemical or chemical means.

For example, such labels include radioactive isotopes ( ³² P, ³³ P, ³ H, ³⁵ S) or fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin). It may include.

Labeling is preferably carried out by bottling the labeled molecules into the polynucleotides by primer extension, or by adding at the 5 'or 3' end.

Examples of non-radioactive labeling are specifically described in French patent FR 78 109 75, or Urdea et al. (1988, Nucleic Acids Research , 11: 4937-4957) or Sanchez-pescador et al. (1988, J. Clin Microbiol. , 26 (10): 1934-1938).

According to this particular aspect of the invention, the third DNA strand or oligonucleotide may also be immobilized on a support as described above.

A fourth aspect of the invention is a pack or kit for purifying and / or detecting the presence of double stranded DNA according to the invention in a complex mixture, wherein the pack comprises one or more oligonucleotides as described above. It is about a pack or kit that is characteristic. The oligonucleotide may be immobilized on a support and / or comprise a detectable label.

According to the present invention in this respect, the above-described detection kit, such as a kit, includes a plurality of oligonucleotides according to the present invention that can be used to detect a target double-stranded DNA sequence of interest.

Thus, oligonucleotides immobilized on a support can be organized in a substrate such as a "DNA chip". Such knitted substrates are described in particular in US Pat. No. 5,143,854 and PCT Application Nos. WO 90/15070 and 92/10092.

Support substrates in which the oligonucleotides are immobilized at high density are described, for example, in US Pat. No. 5,412,087 and PCT Application No. WO95 / 11995.

The present application is described in more detail using the following examples, which should be considered as illustrative and not restrictive.

According to the present invention, a double-stranded DNA molecule having a target sequence containing a partial homopurine-partial homopyrimidine DNA sequence can efficiently purify the double-stranded DNA molecule by forming a stable triple helix structure with the third DNA strand. Can be.

General cloning and molecular biology techniques

Conventional molecular biology methods such as restriction digestion, gel electrophoresis, DNA fragmentation, E. coli transformation, nucleic acid precipitation, sequencing and the like are described in Maniatis et al., (1989) Molecular cloning: a laboratory manual , second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York; Ausubel et al., (1987), Current protocols in molecular biology , John Willey and Sons, New York. Restriction enzymes were used from New England Biolabs (Biolabs, Mass.).

Oligonucleotides were synthesized according to the manufacturer's instructions using phosphoramidite chemistry with α position protected with cyanoethyl groups in conjunction with a 394 automated DNA synthesizer from Applied Biosystems.

Oligonucleotides used to synthesize affinity gels were obtained from Amersham Pharmacia Biotech (Uppsala, Sweden) or Eurogentech (Seraing, Belgium) and used without modification.

The strains available for replication of the pCOR plasmid and the conditions available for propagation and selection of the plasmid have already been disclosed (Soubrier et al., Gene Therapy 6 (1999) 1482).

Example

Example 1 Construction of Plasmids

1.1 Plasmid pXL3179 (pCOR-FGF1)

Plasmid pXL3179 shown in Figure 1 is a vector derived from plasmid pXL2774 (WO 97/10343; Soubrier et al., Gene Therapy 6 (1999) 1482), a signal peptide and FGF1 (fibroblast growth factor 1) of human fibroblast interferon Genes encoding fusions between cDNA (sp-FGF1, Jouanneau et al., PNAS 88 (1991) 2893) may be selected from the early regions of human cytomegalovirus (hCMV IE E / P) and the polya of later SV40 virus regions. It was introduced under the control of the denylation signal (SV40 late polyA; Genbank SC4CG).

1.2 Plasmid pXL3296 (pCOR)

Plasmid pXL3296 is a vector derived from plasmid pXL3179, in which the sp-FGF1 gene sequence is substituted with multiple cloning sites of plasmid pUC28 (Benes et al., Gene 130 (1993) 151). Plasmid pXL3296 is shown in FIG. 2.

1.3 plasmid pXL3426 (pCOR-ID1)

Plasmid pXL3426 is a vector derived from plasmid pXL3296, in which the sequence 5'-GATCCAAGAAGCATGCAGAGAAGAATTC-3 'is inserted between the BglII and XhoI sites. Plasmid pXL3426 is shown in FIG. 3.

Example 2: Construction of another plasmid carrying a target sequence

Plasmid pXL3675 is a vector derived from plasmid pXL3296, in which the sequence 5'-GAAGAAGGGAAAGAAGATCTG-3 'is inserted between the HpaI and XbaI sites; Plasmid pXL3676 is also a vector derived from plasmid pXL3296, in which the sequence 5'-GAAGAAAGGAGAGAAGATCTG-3 'is inserted between HpaI and XbaI; Finally plasmid pXL3713 contains DNA sequence 5'-GAAGAAGTTTAAGAAGATCTG-3 'inserted between the HpaI and XbaI sites of pXL3296. The plasmid thus constructed was purified by CsCl gradient, and the sequence of the insert was confirmed by sequencing. Such preparations were used in the examples described below.

Example 3: Identification of the 20-mer sequence of the endogenous FGF1 gene forming a stable triple helix

Various plasmids as described in the Examples below were chromatographed using triple helix interaction affinity chromatography under standardized conditions. Affinity supports were synthesized using the chromatographic support Sephacryl ^® S-1000 SF (Amersham Pharmacia Biotech) in the following manner. As a first step, a Sephacryl ^® S-1000 gel dispersed in 0.2 M sodium acetate buffer was activated with sodium meta-iodate (3 mM, 20 ° C., 1 h) and then the aldehyde of the substrate thus activated as a second step. The oligonucleotides were then subjected to a reductive amination reaction in the presence of ascorbic acid (5 mM), following a similar procedure as described for protein binding (Hornsey et al., J. Immunol . Methods 93 (1986) 83). Binding via the 5′-NH ₂ -terminus of the oligonucleotide. In all experiments reported herein oligonucleotides were bound according to this general procedure; Every oligonucleotide has an NH _2- (CH ₂ ) ₆ -functionalized arm located at its 5 'end.

Experiments demonstrating triple helix structure formation between oligonucleotides and double-stranded DNA and measuring their stability were all performed under the following conditions. In each experiment, 6 ml of 50 mM sodium acetate buffer (pH 4.5) containing 2 M NaCl on an HR 5/5 column (Amersham Pharmacia Biotech) containing 1 ml of an affinity gel functionalized with an oligonucleotide according to the invention 300 µg of purified plasmid dissolved in was injected at a flow rate of 30 cm / h. After washing the column with 5 ml of such buffer, the plasmid was eluted with 3 ml of 100 mM Tris / HCl column buffer (pH 9.0) containing 0.5 mM EDTA, and the amount of plasmid eluted with pH 9.0 buffer, i) 260 nm absorbance was measured and ii) quantified by anion exchange chromatography over a column (Millipore GenPak-Fax column) (Marquet et al., BioPharm , 8 (1995) 26).

Purification results shown in Table 1 below obtained using a column functionalized with oligonucleotide 5'-NH _2- (CH ₂ ) ₆ -TT (CTT) ₆ -3 '(SEQ ID NO: 2) resulted in a human FGF1 gene sequence. In contrast to the control plasmid (pXL3296) which does not contain and is not retained on the column in question, it forms a stable triple helix with the plasmid containing the entire FGF1 gene (pXL3179) or the endogenous ID1 sequence (pXL3426) of the human FGF1 gene. Prove that.

TABLE 1

Plasmid Sequence of oligonucleotide target sequence present in plasmid Ability (attached per 1ml gel
Plasmid μg) pXL3179 (pCOR-FGF1) TT CTT CTT CTT CTT CTT CTT
- 175 pXL3426 (pCOR-ID1) TT CTT CTT CTT CTT CTT CTT
AA GAA GCA TGC AGA GAA GAA 130 pXL3296 (pCOR) TT CTT CTT CTT CTT CTT CTT
- <1

The sequence of plasmid pXL3426 was confirmed by subcloning various fragments of the FGF1 gene, which gradually decreased in size. As a result, the intrinsic sequence ID1 5'-AA GAA GCA TGC AGA GAA GAA-3 '(SEQ ID NO: 1) of the FGF1 gene formed a stable triple helix structure with the oligonucleotide used SEQ ID NO: 2. The triple helix structure thus obtained is pyrimidine-purine- forming a length of T ^* AT and ⁺ C ^* GC normative triad 6 units (R, 5 ') and 7 units (R', 3 '). It contains two regions of the pyrimidine (Py ^* PuPy) type, which are spaced into seven intrinsic regions (T), six of which are non-normative triads, more specifically 2 Three T ^* GC triads, two T ^* CG triads, one C ^* AT triad, and one C ^* TA triad.

Example 4 Identification of Bases Required for Stability of Triple Helix Structures in Endogenous ID1 20-mer Sequences Inherent in the FGF1 Gene

Four oligonucleotides were prepared based on endogenous ID1 sequences. Two of them removed seven or thirteen nucleotides from the 5 'side of ID1 and the other two removed seven or fourteen nucleotides from the 3' side. Oligonucleotide _{5'-TT (CTT) 6 -3} ' (SEQ ID NO: 2), or oligonucleotides FRB36, FRB38, plasmid pXL3426 through the third helix of the interaction column was functionalized with FRB39 or FRB40 was chromatographed. The stability of the triple truncated structure formed with the various truncated endogenous ID1 sequences was then tested by measuring the amount of each plasmid retained on the column.

TABLE 2

Oligonucleotides Sequence targeted in plasmid pXL3426 Ability (attached per 1ml gel
Plasmid μg) (CTT) 7 AA GAA GCA TGC AGA GAA GAA 130 FRB36 ---- --- --- --A GAA GAA <1 FRB38 AA GAA G-- --- --- --- --- <1 FRB39 AA GAA GCA TGC AG- --- --- 22 FRB40 ---- --A TGC AGA GAA GAA 33

As can be seen from the results shown in Table 2, There was required ID1 entire sequence (20-mer) of pXL3426 to form a 5'-TT (CTT) ₆ -3 helix of the nucleotide and stable oligonucleotide of structure 3 'type . Specifically, the central portion as well as the two Py ^* PuPy moieties located at the 5 'and 3' ends contributed quite significantly to the stability of the final structure.

Example 5: Influence of normative and non-normative triads on stability of triple helix

Oligonucleotide _{5'-TT (CTT) 6 -3} '( SEQ ID NO: 2) and a sequence variant of an oligonucleotide as described above and various modifications nucleotides (FRB15, FRB16 and FRB17) the intrinsic ID1 sequence of plasmid pXL3426 (5'- The ability to form stable triple helices with AA GAA GCA TGC AGA GAA GAA-3 ′; SEQ ID NO: 1) was tested.

TABLE 3

Oligonucleotides Sequence of oligonucleotide target ID1 sequence present in plasmid Non-normative
The number of triads Ability (attached per 1ml gel
Plasmid μg) (CTT) 7 TT CTT CTT CTT CTT CTT CTT
AA GAA GCA TGC AGA GAA GAA 6 130 FRB15 TT CTT CTT GCT TCT CTT CTT
AA GAA GCA TGC AGA GAA GAA 3 189 FRB16 TT CTT CTT GTT TCT CTT CTT
AA GAA GCA TGC AGA GAA GAA 4 171 FRB17 TT CTT CTT CCT TCT CTT CTT
AA GAA GCA TGC AGA GAA GAA 3 183

As can be seen from the results presented in Table 3 above, the sequence of oligonucleotides is modified to increase the number of T ^* AT and ⁺ C ^* GC normative triads, while at the same time in the intermediate endogenous region N of the triple helix structure. By reducing the number of non-normative triads, the stability of the triple helix structure could be increased.

Example 6 Influence of a Non-normative Triad on the Stability of Triple Helix Structures

Oligonucleotide _{5'-TT (CTT) 6 -3} '( SEQ ID NO: 2) and by modifying the sequence of the plasmid pXL3426 which contains the endogenous ID1 sequence (SEQ ID NO: 1) of FGF1 gene capable of forming a stable triple helix In the center region N, two identical non-normative triads of type T ^* GC were successively introduced, followed by a C ^* AT non-normative triad at 5 '(pXL3675). As another experiment, five non-normative triads C ^* AT, T ^* GC, T ^* GC, C ^* AT and T ^* GC were introduced in succession (pXL3676). Finally, the sequence of plasmid pXL3426 was modified to introduce two non-normative triads of type T ^* TA into the central region in succession, followed by the introduction of C ^* TA nonnormative triads at 5 '(pXL3713). ).

Table 4

Plasmid Sequence of oligonucleotide target sequence present in plasmid Ability (attached per 1ml gel
Plasmid μg) pXL3426 TT CTT CTT CTT CTT CTT CTT
AA GAA GCA TGC AGA GAA GAA 112 pXL3675 CTT CTT CTT CTT CTT CT
GAA GAA GGG AAA GAA GA 99 pXK3676 CTT CTT CTT CTT CTT CT
GAA GAA AGG AGA GAA GA 78 pXL3713 CTT CTT CTT CTT CTT CT
GAA GAA GTT TAA GAA GA <1

As can be seen from the purification results of the various plasmids shown in Table 4, when the non-normative central region forms a triad of T ^* CG, T ^* GC, C ^* AT and C ^* TA types, the stable triple helix structure is obtained. Formed. As can be seen from the adherence rate of the plasmids pXL3675 and pXL3676 to the affinity gels, two non-normative T ^* GC triads were contiguous, whatever the front and back base, ie whether the surrounding triad was inherently normative or non-normative. The stable triple helix was also formed when introduced. On the other hand, when a pair of T ^* TA type triads and a C ^* TA triad were introduced adjacently, the stability of the triple helix structure was completely lost.

Example 7 Construction of Plasmids Containing Cassettes Encoding SeAP, hαFP, FIX, and GAX Genes

The genes used in this experiment to demonstrate the activity of the compositions according to the invention are for example human genes encoding Factor IX (Kurachi et al., Proc. Natl. Acad. Sci. USA 79 (1982) 6461), Human gene encoding secreted alkaline phosphatase SeAP (Millan et al., J. Biol. Chem. , 261 (1986) 3112), human gene encoding alpha fetoprotein hαFP (Gibbs et al., Biochemistry 26 (1987) 1332) and the human gene encoding GAX (Gorski et al., Mol. Cell. Biol. , 13 (1993) 3722). These genes were amplified by PCR using a plasmid or cDNA library (Clontech) and then cloned into the pCOR plasmid from pXL3296 between the eukaryotic CMV E / P promoter and upstream of the SV40 late polyA signal sequence. The gene encoding secreted alkaline phosphatase (SeAP) was introduced into a pCOR plasmid derived from pXL3296 to obtain plasmid pXL3402 (FIG. 4). The gene encoding alpha fetoprotein (hαFP) was introduced into a pCOR plasmid derived from pXL3296 to obtain plasmid pXL3678 (FIG. 5). The gene encoding GAX was introduced into a pCOR plasmid derived from pXL3296 to obtain plasmid pXL3207 (FIG. 6). The gene encoding factor IX was introduced into pCOR plasmid from pXL3296 to obtain plasmid pXL3388 (FIG. 7).

Example 8 Use of 5 '-(CTT) 7-3' Type Oligonucleotides to Form Stable Triple Helix Structures with Various Genes of Interest

Oligonucleotide _{5'-TT (CTT) 6 -3} '( SEQ ID NO: 2) by the interaction of interaction gel and various sequences of the helix was three functionalized by measuring the power that is obtained by holding the various gene plasmid Studied. The genes studied were i) a human gene encoding Factor IX, ii) a gene of secreted alkaline phosphatase SeAP, iii) a human gene of alpha fetoprotein (αFP) and iv) a human GAX gene.

Table 5

gene Target sequences in genes Capacity (μg plasmid attached per ml of gel) Factor IX GAA GAA GCA CGA GAA G 71 SEAP AAA GAA AGC AGG GAA G
GAA GAG GAA GAA G 100 hαFP AAG GAG AAG AAG AA 146 hGAX AA GAT GAG GAA GAA G 118

As can be seen from the results shown in Table 5, as a result of using (CTT) _n type oligonucleotide, the gene of interest does not contain a target sequence of type 5 '-(GAA) _n -3' complementary to the oligonucleotide. If not, a stable triple helix structure was formed with the gene of interest. The presence of bases related to triads of type T ^* CG, C ^* CG, T ^* GC and C ^* AT in the central portion of the target sequence is identical to that of the isolated T ^* TA triad (GAX gene) Did not affect.

Example 9: 5 '-(CTT) for purifying a plasmid containing an endogenous ID1 sequence (5'-AA GAA GCA TGC AGA GAA GAA-3'; SEQ ID NO: 1) ₇ Use of functionalized columns with oligonucleotides of the -3 'type

_{5 '- (CTT) 7 -3} ' type oligonucleotide of the functionalized in nucleotides, has a chromatographic support using the affinity of the interaction of the helix 3, as described above, _{5 '- (R) n -} (N ) The possibility of purifying a plasmid having a sequence of type _t- (R ') _m -3' was investigated based on Example 8.

Plasmid pXL3179 (containing the human FGF1 gene carrying the sequence 5'-AA GAA GCA TGC AGA GAA GAA-3 ') acts as oligonucleotide 5'-NH _2- (CH ₂ ) _6- (CTT) ₇ -3' Chromatography was carried out through a vaporized Sephacryl S-1000 interaction column. To this end, a solution of 9.40 mg of plasmid pXL3179 dissolved in 60 ml of 50 mM sodium acetate, 2 M NaCl buffer (pH 4.5) was added to the oligonucleotide 5'-NH _2- () in Sephacryl S-100 SF as described in Example 3. CH _{2) 6} - (CTT) was _7-3 on a covalent bond which 10ml affinity column to 'injection at a flow rate of 30cm / h. After washing the column with 5 volumes of the same buffer, the attached plasmid was eluted with 2 column volumes of 100 mM Tris / HCl, 0.5 mM EDTA buffer, quantified by measuring UV absorbance (260 nm) and GenPak-Fax column (Waters). Product) was subjected to ion exchange chromatography for purification. E. coli genomic DNA content in the original preparation and E. coli genomic DNA content in the purified fractions were determined by PCR as described in WO96 / 18744. 7.94 mg of plasmid pXL3179 was observed in the eluted fraction (elution rate 84%) and the contamination rate of E. coli genomic DNA was reduced from 7.8% to 0.2% by the affinity chromatography described above. Similarly, contamination by RNA was reduced from 43% in the original plasmid to 0.2% in the purified plasmid.

Oligonucleotide _{5'-NH 2 - (CH 2} ) 6 - (CTT) 7 -3 ' with the Sephacryl S-1000 pro-functionalized different chromatography conducted on various chromatography plasmid pXL 3179 the preparation through the column Mars In the experiment, genomic DNA content decreased from 0.2% to 0.007%, from 0.7% to 0.01%, from 7.1% to 0.2%, or from 7.8% to 0.1%.

Example 10 Use of 5'-CCT TTT CCT CCT T-3 '(SEQ ID NO: 12) Oligonucleotides to Form a Stable Triple Helix Structure with Human VEGFB-167 Gene

The interaction between a sequence inherent in a therapeutic gene, such as the human VEGFB-167 gene, and a triple helix interaction support functionalized with an oligonucleotide 5'-CCT TTT CCT CCT T-3 '(SEQ ID NO: 12), The ability obtained by the plasmid pXL3579 (FIG. 8) carrying the human VEGFB-167 gene (Olofsson et al., J. Biol. Chem. , 271 (1986) 19310) was measured and investigated. The plasmid pXL3579 shown in FIG. 8 was amplified by PCR from the human cardiac cDNA library (Clontech) and then downstream of the eukaryotic CMV E / P (-522 / + 74) promoter and upstream of the SV40 late polyA signal sequence. , among the multiple cloning sites of pXL3296 , contains the VEGF-B167 gene cloned between the Nsi I and Xba I sites.

Table 6

Oligonucleotides Target sequence in the gene (VEGFB-167 or control) Capacity (μg plasmid attached per ml of gel) CCT TTT CCT CCT T GGC AAC GGA GGA A 87 None (control vector) <0.5 CCT CCT T GGA GGA A <0.5 None (control vector) <0.5 TTT TTT TTC CT AAA AAA AAG GA 15 None (control vector) <0.5

As can be seen from the results presented in Table 6, the sequence of type 5 '-(R) _n- (N) _t- (R') _m -3 ', where 5'-GGC AAC GGA GGA of the human VEGFB-167 gene Oligonucleotides targeting the A-3 ′ (SEQ ID NO: 13) region, such as oligonucleotide 5′-CCT TTT CCT CCT T-3 ′ (SEQ ID NO: 12), stabilize the triple helical structure with the region of the gene Could form. Moreover, although the human VEGFB-167 gene contains the homopurine sequence 5'-AAA AAA AAG GA-3 'which is the target of oligonucleotide 5'-TTT TTT TTC CT-3' (Table 6), oligonucleotide 5 ' The interaction obtained by -CCT TTT CCT CCT T-3 'was very markedly superior to the interaction obtained by homopyrimidine oligonucleotides. Likewise, the endogenous homopurine sequence 5'-GGA GGA A-3 'was not long enough to form a stable triple helix with the oligonucleotide 5'-CCT CCT T-3'.

Thus, as will be clear from this example, 5 '-(R) _n in forming a stable triple helix structure, especially in the situation where the irradiated double-stranded DNA shows at least one homopurine structure of significant length, It was confirmed that the sequence of the form-(N) _t- (R ') _m -3' is advantageous.

Example 11 Oligonucleotides of the 5'-T CCT CTCCCT C-3 'Form for Separation of Nondefective VEGFB-186 cDNAs through Formation of a Stable Triple Helix Structure with Target Sequences in the Modified VEGFB-186 cDNA 14) Uses

During the production of the human VEGFB-186 gene in the fermenter, it was observed that this gene was the site of gene rearrangement and deletion, particularly in exon 6A. Thus, for crypt point +1, continuous mutation PCR at the nucleotides 510 (A / C), 513 (C / T), 516 (A / T), 519 (C / T) and 522 (C / T) positions Silent point mutations were introduced. The amino acid sequence of the VEGFB-186 protein introduced between amino acids 170 and 174 remained unmodified. Meanwhile, the VEGFB-186 modified gene (VEGFB-186m) is a target according to the present invention, which can form a stable triple helix interaction with an oligonucleotide 5'-T CCT CTC CCT C-3 '(SEQ ID NO: 14) sequence. DNA sequence, 5'-A GGA GCG GGA G-3 '(SEQ ID NO: 15) is shown. This stable triple helix interaction is advantageously used to carry out the process according to the invention and to isolate VEGFB-186 modified genes which have not been rearranged and deleted after being produced in a fermenter.

In order to explain the purification process by the triple helix interaction of the VEGFB-186 modified gene, two plasmids pXL3601 and pXL3977 as shown in FIG. 9 were used. First, the VEGFB-186 gene is amplified by PCR from the human cardiac cDNA library (Clontech) and then downstream of the eukaryotic CMV E / P (-522 / + 74) promoter and upstream of the polyadenylation signal of the late SV40 virus region. , cloned between the Nsi I and Xba I sites in the multiple cloning site of pXL3296 (Example 1.2) to give plasmid pXL3601. This plasmid pXL3601 was modified by continuous mutant PCR to obtain plasmid pXL3977 in which the VEGFB-186 gene was modified in exon 6A as described above.

Triple-helix interaction support functionalized with oligonucleotide 5'-T CCT CTC CCT C-3 '(SEQ ID NO: 14) and target sequence 5'-A GGA GCG GGA G-3' present in VEGFB-186m gene The interaction of (SEQ ID NO: 15) was examined by measuring the ability obtained by plasmid pXL3977 (FIG. 9) carrying the VEGFB-186 modified gene. Since the VEGFB-167 sequence was included in the VEGFB-186m sequence, the plasmid pXL3579 containing the human VEGFB-167 gene and as described in Example 10 was used as a negative control.

TABLE 7

Oligonucleotides pCOR-VEGFB-186 m (pXL3977) (μg plasmid attached per ml of gel) pCOR-VEGFB-167 (pXL3579) (μg plasmid attached per ml of gel) pCOR (pXL3296) (μg plasmid attached per ml of gel) ID No.14 234 32 <1.0 ID No.16 224 0.5 to 1.0 <1.0

As can be seen from the results presented in Table 7, the sequence of type 5 '-(R) _n- (N) _t- (R') _m -3 ', where the 5'-A GGA of the modified human VEGFB-186 gene Oligonucleotides targeting the GCG GGA G-3 '(SEQ ID NO: 15) region, such as oligonucleotide (SEQ ID NO: 14), could be used to form a stable triple helix structure with the region of the gene and thus the gene. Could be purified efficiently. In addition, oligonucleotide 5'-TTT CCT CTC CCT C-3 '(SEQ ID NO: 16) can also be used to purify the human VEGFB-186 modified gene.

1 is a schematic of plasmid pXL3179;

2 is a schematic of plasmid pXL3296;

3 is a schematic of plasmid pXL3426;

4 is a schematic of plasmid pXL3402;

5 is a schematic of plasmid pXL3678;

6 is a schematic of plasmid pXL3207;

7 is a schematic of plasmid pXL3388;

8 is a schematic of plasmid pXL3579;

9 is a schematic diagram of plasmids pXL3601 and pXL3977.

<110> AVENTIS PHARMA SA <120> METHODS FOR PURIFYING AND DETECTING DOUBLE STRANDED DNA TARGET          SEQUENCES BY TRIPLE HELIX INTERACTION <130> ST01011 <140> ST01011 <141> 2001-03-21 <160> 16 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Homo sapiens <400> 1 aagaagcatg cagagaagaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 2 ttcttcttct tcttcttctt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 3 ttcttcttgc ttctcttctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 4 ttcttcttgt ttctcttctt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 5 ttcttcttcc ttctcttctt 20 <210> 6 <211> 16 <212> DNA <213> Homo sapiens <400> 6 gaagaagcac gagaag 16 <210> 7 <211> 16 <212> DNA <213> Homo sapiens <400> 7 aaagaaagca gggaag 16 <210> 8 <211> 13 <212> DNA <213> Homo sapiens <400> 8 gaagaggaag aag 13 <210> 9 <211> 14 <212> DNA <213> Homo sapiens <400> 9 aaggagaaga agaa 14 <210> 10 <211> 15 <212> DNA <213> Homo sapiens <400> 10 aagatgagga agaag 15 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 11 gaggcttctt cttcttcttc ttctt 25 <210> 12 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 12 ccttttcctc ctt 13 <210> 13 <211> 13 <212> DNA <213> Homo sapiens <400> 13 ggcaacggag gaa 13 <210> 14 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 14 tcctctccct c 11 <210> 15 <211> 11 <212> DNA <213> Homo sapiens <400> 15 aggagcggga g 11 <210> 16 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description for the artificial sequence: OLIGONUCLEOTIDE <400> 16 tttcctctcc ctc 13  

Claims (30)

A method of purifying a double stranded DNA molecule, comprising contacting a double stranded DNA molecule with a third DNA strand, The double-stranded DNA molecule comprises the following SEQ ID NO: 13 sequence contained in the human VEGFB-167 gene 5 '-(R) _n- (N) _t- (R') _m -3 ' (Wherein R and R 'represent a nucleotide sequence consisting solely of purine bases; n and m are integers less than 9; the sum of n + m is greater than 5; N is a nucleotide sequence comprising both a purine base and a pyrimidine base; t is an integer less than 8) It comprises at least one target sequence represented by, and characterized in that it can interact with the third DNA strand to form a triple helix structure, Method for Purifying Double-stranded DNA Molecules. The method of claim 1, wherein the interaction between region N and the third DNA strand forms up to six noncanonical triads. The method of claim 2, wherein the non-normative triad formed is selected from T ^* CG, T ^* GC, C ^* AT, and C ^* TA triads. The method of claim 1, wherein the regions R and R ′ comprise at least two guanine (G) as a whole. The method of claim 1, wherein the regions R and R ′ comprise two or more adenines. The method of claim 1, wherein the regions R and R ′ form an normative triad selected from the third DNA strand and T ^* AT and ⁺ C ^* GC. The method of claim 1 wherein the third DNA strand is homopyrimidine type. 8. The method of claim 7, wherein the third DNA strand comprises a poly-CTT sequence. The method of claim 1, wherein the third DNA strand is an oligonucleotide. 10. The method of claim 9, wherein the oligonucleotide is selected from oligonucleotide sequences of SEQ ID NOs: 2-5. The method of claim 1, wherein the target sequence is naturally present in a double stranded DNA molecule or is a target sequence artificially introduced into a double stranded DNA molecule. The method of claim 11, wherein the target sequence naturally present in the DNA molecule is a sequence present in a gene coding sequence for therapeutic or experimental purposes. The method of claim 1, wherein the double-stranded DNA molecule is a circular DNA, such as a plasmid or minicircle, or a linear fragment. The method of claim 9, wherein the oligonucleotide is stably bound to the support either covalently or non-covalently. The method of claim 9, wherein the oligonucleotide is fused to a polymer of natural or synthetic origin. The method of claim 14, wherein the support is selected from a chromatography support, a plastic surface and a functionalized latex bead. The method of claim 16, wherein the chromatography support is a gel permeate support. 18. The method of claim 17, wherein the solution containing double stranded DNA molecules is a cell lysate. The method of claim 18, wherein the cell lysate is a clear lysate. 20. The method of claim 19, wherein the double stranded DNA molecule is prepurified. The method of any one of claims 14-20, wherein the oligonucleotide has the sequence GAGGCTTCTTCTTCTTCTTCTTCTT (SEQ ID NO: 11). 21. The method of any one of claims 14-20, wherein the oligonucleotide is bound to the support via disulfide, thioether, ester, amide or amine attachment. 21. The method of any one of claims 14-20, wherein the oligonucleotide is attached to the support via an arm consisting of carbon-based chains (CH ₂ ) _n , where n is an integer between 1 and 18, wherein the arm is Characterized in that it is bound to the oligonucleotide via phosphate and to the support via amine attachment. The oligonucleotide of claim 14, wherein the oligonucleotide comprises at least one chemical modification that confers resistance or protection against nucleases or increases the affinity of the oligonucleotide for a particular sequence. How it is characterized. 21. The method of any one of claims 14-20, wherein the oligonucleotide comprises a sequence wherein at least one cytosine has a methyl group in the 5 'position. 21. The method of any one of claims 14-20, wherein the method comprises contacting a solution containing double-stranded DNA, mixed with other components, with a support to which the oligonucleotide is covalently bound. . 21. The method of any one of claims 14-20, wherein the solution containing double-stranded DNA, mixed with other components, is passed over a covalently bonded chromatography support with oligonucleotides. 21. The method of any one of claims 14-20, wherein the third DNA strand is labeled. delete Contacting a solution expected to contain a double stranded DNA molecule with a labeled third strand of DNA capable of forming a triple helix by hybridization with a target sequence of the double stranded DNA. As a detection method of  The target sequence is represented by the following formula comprising SEQ ID NO: 13 contained in the human VEGFB-167 gene, 5 '-(R) _n- (N) _t- (R') _m -3 ' (Wherein R and R 'represent a nucleotide sequence consisting solely of purine bases; n and m are integers less than 9; the sum of n + m is greater than 5; N is a nucleotide sequence comprising both a purine base and a pyrimidine base; t is an integer less than 8), Detection method of double stranded DNA.

Images