NZ527623A - Serine protease inhibitor - Google Patents

Abstract

Disclosed is a protein which exhibits, inter alia, anti-thrombin activity and divalent metal cation binding activity. The protein can be readily extracted from the green-lipped mussel, Perna canaliculus, and formulated into foodstuffs, nutraceuticals and the like, and has a molecular weight of about 55 kDa and an amino acid sequence which includes one or more of the following: (a) DGEQCNDGQN (SEQ ID NO.1), (b) QGGHEVESERVACCVIGRA (SEQ ID NO. 2), (c) GQSHPEIVH (SEQ ID NO. 3), (d) YHGHDDA (SEQ ID NO. 4), (e) VVNEVHH (SEQ ID NO. 5) (62) Divided out of 512021

Description

f t L- 5276 2 3 NEW ZEALAND PATENTS ACT 1953 No: Divided out of NZ 512021 Date: Dated 23 December 1999 COMPLETE SPECIFICATION SERINE PROTEASE INHIBITOR We, THE HORTICULTURE AND FOOD RESEARCH INSTITUTE OF NEW ZEALAND LIMITED, a New Zealand company and Crown Research Institute (under the Crown Research Institutes Act 1992) having a place of business at Corporate Office, Tennent Drive, Private Bag 11030, Palmerston North, New Zealand, do hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement: 1 (followed by page 1 a) INTELLECTUAL PROPERTY OFFICE OF N.Z.

AUG 2003 RECEIVED 1 a SERINE PROTEASE INHIBITOR This invention relates to a protein and compositions which contain it. More particularly, it relates to a protein which inter alia exhibits activity as a metal cation 5 binding agent and/or as an anti-thrombin agent.

BACKGROUND Thrombin is a serine protease involved in blood coagulation. It has specificity for the 10 cleavage of arginine-lysine bonds as well as cleaving an arginine-threonine bond in pro-thrombin, releasing pre-thrombin which is subsequently cleaved to produce active thrombin. This active thrombin can then release more thrombin from prothrombin. In blood clotting and coagulation, thrombin cleaves flbrinopeptide B from fibrinogen as well as converting blood factors IX to IXa, V to Va, VIII to Villa and XIII 15 toXIIIa.

Inhibitors of thrombin therefore inhibit coagulation and have application in any procedure where coagulation is undesirable. One such application is in the collection and storage of blood products. Another is in medicaments for preventing 20 or reducing coagulation for example in treating or preventing cardiac malfunctions.

Anti-thrombin agents are known. One example is anti-thrombin III (AT-III). However, AT-III is capable of effectively inhibiting thrombin only in the presence of heparin.

The applicants have now identified a novel protein which has a range of activities, including anti-thrombin activity, and which when active against thrombin does not require heparin as a cofactor. It is towards this protein that the present invention is broadly directed.

SUMMARY OF THE INVENTION In a first aspect, the present invention provides an isolated protein which has a molecular weight of about 55 kDa and an amino acid sequence which includes one or more of the following: ,ntelk!9TilAL property office of n.z - 9 JUL 2004 RECEIVED 2 (a) DGEQCNDGQN (SEQ ID NO. 1); (b) QGGHEVESERVACCVIGRA (SEQ ID NO. 2); (c) GQSHPEIVH (SEQ ID NO. 3); (d) YHGHDDA (SEQ ID NO. 4); (e) WNEVHH (SEQ ID NO. 5); or an active fragment thereof.

In a further aspect, the invention provides an isolated protein which comprises the amino acid sequence of DGEQCNDGQNKDDHHDDHHDDHHD ETMHYAQCEMEPNPHMASSLHHHV SQKGHGAVYLELHLVGFNTSEDHD HLHMLGDMSAGCDS IGELYNAHPE 15 DLGDLVDDDRGVVNEVHHYAWLDI TEALIGHSMTILQGSHTDADTPAS IGHGKARPETAAALHHELEEDKTE VRSNTHQPKALHHHVHGTIDFKQV VSYHLEGFNVSDDHKDHLHDVQIY 20 SGCDNLGAKYDPHEDYHSELGDLG HGVVNE SHRYSWI N I FGDDSVLGR RDHLHKSAKIACCVIGRGQSHPEI VVRPNTESTGLHHHVSGSITFEQT MTADLKGFNVSEDLSHHRHGVQLH 25 HGCHSLGRMYHGHDDAHDPKRPGD DSHGIVHSTRTFDHLNVEDLNARS GHEVESERVACCVIGRA (SEQ ID NO. 7) or an active fragment thereof.

Conveniently, said protein or fragment has activity as: (i) a serine protease inhibitor; or (ii) a divalent cation binding agent.

INTELLECTUAL PROPERTY OFFICE OF N.Z - 9 JUL 2001 RECEIVED D H D D D D H G S I E L D H H H G L K H A D P G D G T A P N R I A C C V H Y A H C D G Y G D L E A N G D L T D I H D D D S I A I H Q V H R A K C P G G S T H E W G D M S L G D V I D L V I M Q G 3 In yet a further aspect, the invention provides an isolated protein which is obtainable from the haemolymph of Perna canaliculus which has an apparent molecular weight of 75 kDa determined by PAGE and which has activity as a serine protease inhibitor and/or a divalent cation binding agent, or an active fragment thereof.

The invention further provides a protein which is a functionally equivalent variant of a protein or fragment as defined above.

Still further, the invention provides a protein which is obtainable from Perna canaliculus or a shellfish other than Perna canaliculus and is a functionally equivalent variant of a protein or fragment of the invention in that it is immunologically cross-reactive with a 10 protein or fragment of the invention and has at least the same serine protease inhibitor and/or divalent cation binding activity as a protein or fragment of the invention.

In another aspect, the invention provides a polynucleotide encoding a protein or fragment as defined above.

The polynucleotide may comprise the nucleotide sequence of 15 5' GAYGGGGAGCAGTGTAACGATGGGCAGAACAAAGATGACCACCATGACGA CCACCACGATGATCACCATGACGACCATGATGATGATGATGAAACAATGCACT ATGCCCAGTGTGAAATGGAACCAAACCCTCATATGGCTAGCAGCCTTCACCA CCATGTCCATGGCAGCATAGAGTTGTCACAGAAGGGTCATGGAGCTGTTTAT CTAGAACTTCATCTTGTCGGATTCAACACAAGTGAAGACCATGACGACCACCA 20 TCATGGACTTCATCTGCACATGCTTGGTGACATGTCAGCAGGTTGTGATTCTA TTGGCGAACTGTACAATGCTCACCCAGAAAAACATGCTGACCCTGGTGACCT CGGTGACCTGGTTGACGATGATAGGGGCGTGGTTAATGAAGTTCATCATTATG CTTGGTTGGACATTGATGGTACAGCACCAAACACCGAAGCTCTCATTGGACA CTCAATGACTATTTTACAAGGGAGTCACACCGATGCTGATACCCCAGCCAGTA 25 GAATCGCCTGTTGTGTTATTGGTCATGGAAAAGCTCGCCCAGAAACAGCAGC TGCTCTACATCACGAGCTAGAGGAAGATAAAACTGAGCATTATGCCCATTGTG ACGTAAGATCTAATACACACCAACCAAAGGCTCTTCATCATCATGTCCACGGA ACCATCGATTTCAAACAAGTTGGTTATGGTGACCTTGAAGTGTCCTACCATTTA GAGGGATTTAATGTAAGTGATGACCACAAAGATCATCTCCATGACGTACAGAT 30 CTACGCCAACGGTGACCTGACCAGTGGATGTGATAACCTCGGTGCTAAATAT GATCCTCATGAAGATTACCACAGTGAGTTGGGTGATCTAGGAGATATTCACGA TGATGACCATGGCGTTGTCAATGAAAGCCACAGATATTCCTGGATCAATATCT TCGGTGATGACAGTGTCCTGGGACGTTCTATTGCCATTCACCAAAGAGACCAT CTTCATAAAAGTGCCAAAATTGCCTGTTGTGTCATAGGACGTGGACAGAGCCA 3 5 TCC AGAAATTGTTCACAGAGCTAAATGTGTTGTCAGACCTAATACAGAATCTAC TGGTTTACATCACCATGTCTCTGGTTCTATAACATTCGAACAGACCCCTGGAG intellectual property office of n.z - 9 JUL 2004 4 GATCAACACATATGACGGCTGATCTCAAAGGATTTAACGTTAGTGAGGACTTG TCACATCATCGTCATGGTGTGCAGCTCCATGAATGGGGAGATATGTCCCATG GCTGTCACTCCTTAGGCAGAATGTACCATGGTCATGATGATGCTCATGACCCC AAAAGACCTGGTGACCTTGGTGATGTTATAGATGATTCCCATGGCATCGTTCA 5 TTCAACTAGAACCTTTGATCATCTTAATGTTGAAGATCTTAACGCACGTTCCCT TGTGATTATGCAGGGCGGACATGAGGTCGAGAGTGAGAGGGTTGCTTGCTGT GTTATAGGACGGGCA (SEQ ID NO. 6) or a variant thereof.

Still further, the invention provides a vector or construct which includes a 10 polynucleotide as defined above.

In another aspect, the invention provides a composition which comprises a protein or fragment as defined above.

The composition may be a medicament, a food, a dietary supplement, (optionally including the protein associated with or bound to at least one divalent cation of 15 dietary significance) or a bioremediation agent.

Described but not claimed is a process for obtaining a protein as defined above which comprises the step of centrifuging material containing Perna canaliculus haemolymph or an extract thereof and recovering the sedimented protein.

DESCRIPTION OF THE DRAWINGS While the present invention is broadly as defined above, it also includes embodiments of which the following description provides examples. In particular, a better understanding of the present invention will be gained through reference to the 25 accompanying drawings in which Figure 1: Purification of pernin from mussel haemolymph a) light-scattering band following centrifugation of P. canaliculus haemolymph 30 in CsCl; haemolymph was first centrifuged at low speed to remove intellectual property office of n.z - 9 JUL 2001 haemocytes and then at high speed; the re-suspended pellet was then centrifuged in CsCl. b) UV absorption profile (254 nm wavelength) from fractionation of the CsCl 5 gradient; the light-scattering material in figure la appears as a peak. c) protein composition in 1 ml fractions of a CsCl gradient following electrophoresis in a 12% polyaciylamide gel; the heavily stained (Coomassie) bands coincide with the position of the light-scattering and UV-absorbing regions of the gradient; the molecular weight was approximately 75 kDa as compared with polypeptide molecular weight standards (lane 6) (refer Figure 4a for standards). Lanes 1-5 and 7-9 contained samples from the CsCl gradient.

Figure 2: Virus-like particles observed by transmission electron microscopy of material in light scattering band in a CsCl gradient. Bar in micrograph represents 100 nm.

Figure 3: HPLC elution profile of pernin at 280 nm wavelength purified by CsCl 20 gradient centrifugation..

Figure 4: SDS-PAGE profiles (12% gels) of aggregating protein species from P. canaliculus and other shellfish species a) proteins extracted from whole shellfish and purified as described in Materials and Methods: lane 1: molecular weight standards (Bio-Rad, USA) :pb phosphorylase B, 97.4 kDa; bsa bovine serum albumin, 66 kDa; ova ovalbumin, 45 kDa; ca carbonic anhydrase, 31 kDa; lane 2: Greenshell™ mussel P. canaliculus; lane 3: blue mussel Mytilis edulis; lane 4: oyster 30 Crassostrea gigas; lane 5: pipis Paphies australis. b) PAGE analysis of human transferrin (Sigma, USA, MW ca. 80 kDa), a glycosylated protein, and pernin from P. canaliculus following treatment with endoglycosidase-F: lane 1: untreated transferrin; lane 2: transferrin treated 6 with glycosidase-F; lane 3: untreated pernin lane 4: pernin treated with glycosidase-F.

Figure 5: Activity of P. canaliculus haemolymph protein following centrifugation in a 5 30 kDa molecular weight exclusion filter for 10 min at 1000 g (Ultrafree-MC filter, 30,000 MW exclusion, Millipore, USA) a) SDS-PAGE profile of haemolymph protein at various stages of purification. Lane 1: "crude" haemolymph (haemocytes removed); lane 2: resuspended 10 pellet after ultracentrifugation of "crude" haemolymph for 80 min at 250,000 g-, lane 3: pernin retentate; lane 4: filtrate (no proteins evident); lane 5: molecular weight markers, (refer Figure 4a); lanes 6,7: 10-fold dilutions of samples from lanes 2 and 3. b) Anti-thrombin activity of 30,000 MW exclusion filter retentate and filtrate. con+ = the standard 1/41 dilution of human plasma (i.e. standard anti-thrombin III activity); con - thrombin with no added plasma (buffer control); filtrate: 20 material passed through a 30,000 MW exclusion filter; retentate: pernin protein retained by exclusion filter.

DESCRIPTION OF THE INVENTION As broadly outlined above, in one aspect the present invention provides a novel protein. The protein of the invention has an apparent molecular weight of 75 kDa, calculated by polyacrylamide gel electrophoresis (PAGE). The molecular weight inferred from the gene sequence is approximately 55 kDa.

One specific protein of the invention was initially identified as an extract from the New Zealand green lipped mussel P. canaliculus. It is therefore obtainable by extraction directly from P. canaliculus.

This protein has the amino acid sequence of SEQ ID NO. 7. 7 The protein of the invention can include its entire native amino acid sequence or can include only parts of that sequence where such parts constitute fragments which remain biologically active (active fragments). Such activity will normally be as a serine protease inhibitor or a divalent cation binding agent but is not restricted 5 to these activities.

The invention also includes within its scope functionally equivalent"variants of the protein of SEQ ID NO. 7.

The phrase "functionally equivalent variants" recognises that it is possible to vaiy the amino acid of a protein while retaining substantially equivalent functionality. For example, a protein can be considered a functional equivalent of another protein for a specific function if the equivalent peptide is immunologically cross-reactive with and has at least substantially the same function as the original protein.

The functionally equivalent protein need not be the same size as the original. The equivalent can be, for example, a fragment of the protein, a fusion of the protein with another protein or carrier, or a fusion of a fragment with additional amino acids. It is also possible to substitute amino acids in a sequence with equivalent 20 amino acids using conventional techniques. Groups of amino acids normally held to be equivalent are: (a) Ala, Ser, Thr, Pro, Gly; (b) Asn, Asp, Glu, Gin; (c) His, Arg, Lys; (d) Met, Leu, lie, Val; and (e) Phe, Tyr, Trp.

Polypeptide sequences may be aligned, and percentage of identical amino acids in a 30 specified region may be determined against another sequence, using computer algorithms that are publicly available. The similarity of polypeptide sequences may be examined using the BLASTP algorithm. BLASTP software is available on the NCBI anonymous FTP server (ftp://ncbi.nlm.nih.gov) under /blast/executables/. The use of the BLAST family of algorithms, including BLASTP, is described at NCBI's website 35 at URL http: / /www.ncbi.nlm.nih.gov /BLAST /newblast.html and in the publication 8 of Altschul, Stephen F., et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-34023.

The protein of the invention together with its active fragments and other variants 5 may be generated by synthetic or recombinant means. Synthetic polypeptides having fewer than about 100 amino acids, and generally fewer than about 50 amino acids, may be generated by techniques well known to those of ordinary skill in the art. For example, such peptides may be synthesised using any of the commercially available solid-phase techniques such as the Merryfield solid phase synthesis 10 method, where amino acids are sequentially added to a growing amino acid chain (see Merryfield, J. Am. Chem. Soc 85: 2146-2149 (1963)). Equipment for automative synthesis of peptides is commercially available from suppliers such as Perkin Elmer/Applied Biosystems, Inc. and may be operated according to the manufacturers instructions.

The protein, or a fragment or variant thereof, may also be produced recombinantly by inserting a polynucleotide (usually DNA) sequence that encodes the protein into an expression vector and expressing the protein in an appropriate host. Any of a variety of expression vectors known to those of ordinary skill in the art may be 20 employed. Expression may be achieved in any appropriate host cell that has been transformed or transfected with an expression vector containing a DNA molecule which encodes the recombinant protein. Suitable host cells includes procaiyotes, yeasts and higher eukaiyotic cells. Preferably, the host cells employed are E. coli, yeasts or a mammalian cell line such as COS or CHO, or an insect cell line, such as 25 SF9, using a baculovirus expression vector. The DNA sequence expressed in this matter may encode the naturally occurring protein, fragments of the naturally occurring protein or variants thereof.

DNA sequences encoding the protein or fragments may be obtained by screening an 30 appropriate P. canaliculus cDNA or genomic DNA library for DNA sequences that hybridise to degenerate oligonucleotides derived from partial amino acid sequences of the protein. Suitable degenerate oligonucleotides may be designed and synthesised by standard techniques and the screen may be performed as described, for example, in Maniatis et al. Molecular Cloning - A Laboratory Manual, Cold 35 Spring Harbour Laboratories, Cold Spring Harbour, NY (1989). The polymerase 9 chain reaction (PCR) may be employed to isolate a nucleic acid probe from genomic DNA, a cDNA or genomic DNA library. The library screen may then be performed using the isolated probe.

Variants of the protein may be prepared using standard mutagenesis techniques such as oligonucleotide-directed site specific mutagenesis.

A specific polynucleotide of the invention has the nucleotide sequence of SEQ ID NO. 6 as follows: 5' GAYGGGGAGCAGTGTAACGATGGGCAGAACAAAGATGACCACCATGACGA CCACCACGATGATCACCATGACGACCATGATGATGATGATGAAACAATGCACT ATGCCCAGTGTGAAATGGAACCAAACCCTCATATGGCTAGCAGCCTTCACCA CCATGTCCATGGCAGCATAGAGTTGTCACAGAAGGGTCATGGAGCTGTTTAT CTAGAACTTCATCTTGTCGGATTCAACACAAGTGAAGACCATGACGACCACCA 15 TC ATGGACTTCATCTGC AC ATGCTTGGTGAC ATGTCAGC AGGTTGTGATTCTA TTGGCGAACTGTACAATGCTCACCCAGAAAAACATGCTGACCCTGGTGACCT CGGTGACCTGGTTGACGATGATAGGGGCGTGGTTAATGAAGTTCATCATTATG CTTGGTTGGACATTGATGGTACAGCACCAAACACCGAAGCTCTCATTGGACA CTCAATGACTATTTTACAAGGGAGTCACACCGATGCTGATACCCCAGCCAGTA 20 GAATCGCCTGTTGTGTTATTGGTCATGGAAAAGCTCGCCCAGAAACAGCAGC TGCTCTACATCACGAGCTAGAGGAAGATAAAACTGAGCATTATGCCCATTGTG ACGTAAGATCTAATACACACCAACCAAAGGCTCTTCATCATCATGTCCACGGA ACCATCGATTTCAAACAAGTTGGTTATGGTGACCTTGAAGTGTCCTACCATTTA GAGGGATTTAATGTAAGTGATGACCACAAAGATCATCTCCATGACGTACAGAT 2 5 CTACGCCAACGGTGACCTGACCAGTGGATGTGATAACCTCGGTGCTAAATAT GATCCTCATGAAGATTACCACAGTGAGTTGGGTGATCTAGGAGATATTCACGA TGATGACCATGGCGTTGTCAATGAAAGCCACAGATATTCCTGGATCAATATCT TCGGTGATGACAGTGTCCTGGGACGTTCTATTGCCATTCACCAAAGAGACCAT CTTCATAAAAGTGCCAAAATTGCCTGTTGTGTCATAGGACGTGGACAGAGCCA 30 TCCAGAAATTGTTCACAGAGCTAAATGTGTTGTCAGACCTAATACAGAATCTAC TGGTTTACATCACCATGTCTCTGGTTCTATAACATTCGAACAGACCCCTGGAG GATCAACACATATGACGGCTGATCTCAAAGGATTTAACGTTAGTGAGGACTTG TCACATCATCGTCATGGTGTGCAGCTCCATGAATGGGGAGATATGTCCCATG GCTGTCACTCCTTAGGCAGAATGTACCATGGTCATGATGATGCTCATGACCCC 35 AAAAGACCTGGTGACCTTGGTGATGTTATAGATGATTCCCATGGCATCGTTCA TTCAACTAGAACCTTTGATCATCTTAATGTTGAAGATCTTAACGCACGTTCCCT TGTGATTATGCAGGGCGGACATGAGGTCGAGAGTGAGAGGGTTGCTTGCTGT GTTATAGGACGGGCA.

A further polynucleotide has the sequence of SEQ ID NO. 8 as follows: 'GAYGGGGAGCAGTGTAACGATGGGCAGAACAAAGATGACCACCATGACGA CCACCACGATGATCACCATGACGACCATGATGATGATGATGAAACAATGCACT ATGCCCAGTGTGAAATGGAACCAAACCCTCATATGGCTAGCAGCCTTCACCA 10 CCATGTCCATGGCAGCATAGAGTTGTCAC AGAAGGGTC ATGGAGCTGTTTAT CTAGAACTTCATCTTGTCGGATTCAACACAAGTGAAGACCATGACGACCACCA TCATGGACTTCATCTGCACATGCTTGGTGACATGTCAGCAGGTTGTGATTCTA TTGGCGAACTGTACAATGCTCACCCAGAAAAACATGCTGACCCTGGTGACCT CGGTGACCTGGTTGACGATGATAGGGGCGTGGTTAATGAAGTTCATCATTATG 15 CTTGGTTGGACATTGATGGTACAGCACC AAACACCGAAGCTCTCATTGGAC A CTCAATGACTATTTTACAAGGGAGTCACACCGATGCTGATACCCCAGCCAGTA GAATCGCCTGTTGTGTTATTGGTCATGGAAAAGCTCGCCCAGAAACAGCAGC TGCTCTACATCACGAGCTAGAGGAAGATAAAACTGAGCATTATGCCCATTGTG ACGTAAGATCTAATACACACCAACCAAAGGCTCTTCATCATCATGTCCACGGA 20 ACCATCGATTTCAAACAAGTTGGTTATGGTGACCTTGAAGTGTCCTACCATTTA GAGGGATTTAATGTAAGTGATGACCACAAAGATCATCTCCATGACGTACAGAT CTACGCCAACGGTGACCTGACCAGTGGATGTGATAACCTCGGTGCTAAATAT GATCCTCATGAAGATTACCACAGTGAGTTGGGTGATCTAGGAGATATTCACGA TGATGACCATGGCGTTGTCAATGAAAGCCACAGATATTCCTGGATCAATATCT 25 TCGGTGATGACAGTGTCCTGGGACGTTCTATTGCCATTCACCAAAGAGACCAT CTTCATAAAAGTGCCAAAATTGCCTGTTGTGTCATAGGACGTGGACAGAGCCA TCCAGAAATTGTTCACAGAGCTAAATGTGTTGTCAGACCTAATACAGAATCTAC TGGTTTACATCACCATGTCTCTGGTTCTATAACATTCGAACAGACCCCTGGAG GATCAACACATATGACGGCTGATCTCAAAGGATTTAACGTTAGTGAGGACTTG 30 TCACATCATCGTCATGGTGTGCAGCTCCATGAATGGGGAGATATGTCCCATG GCTGTCACTCCTTAGGCAGAATGTACCATGGTCATGATGATGCTCATGACCCC AAAAGACCTGGTGACCTTGGTGATGTTATAGATGATTCCCATGGCATCGTTCA TTCAACTAGAACCTTTGATCATCTTAATGTTGAAGATCTTAACGCACGTTCCCT TGTGATTATGCAGGGCGGACATGAGGTCGAGAGTGAGAGGGTTGCTTGCTGT 35 GTTATAGGACGGGCATGAATAACCTCACTAGAGTGACTTTGTCTAACATGACA 11 ATTAACAATTGTATAACTTCGCTAAAAAATAAAACAATGACACAATGNAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA3' with TGA being the opal stop codon and AATAAA the polyadenylation signal.

Variants or homologues of the above polynucleotide sequences also form part of the present invention. Polynucleotide sequences may be aligned, and percentage of identical nucleotides in a specified region may be determined against another sequence, using computer algorithms that are publicly available. Two exemplary 10 algorithms for aligning and identifying the similarity of polynucleotide sequences are the BLASTN and FASTA algorithms. The BLASTN software is available on the NCBI anonymous FTP server (ftp://ncbi.nlm.nih.gov) under /blast/executables/. The BLASTN algorithm version 2.0.4 [Feb-24-1998], set to the default parameters described in the documentation and distributed with the algorithm, is preferred for 15 use in the determination of variants according to the present invention. The use of the BLAST family of algorithms, including BLASTN, is described at NCBI's website at URL http: / /www.ncbi.nlm.nih.gov/BLAST/newblast.html and in the publication of Altschul, Stephen F, et al (1997). "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Adds Res. 25:3389-3402. The 20 computer algorithm FASTA is available on the Internet at the ftp site ftp://ftp.virginia.edu.pub/fasta/. Version 2.0u4, February 1996, set to the default parameters described in the documentation and distributed with the algorithm, is preferred for use in the determination of variants according to the present invention. The use of the FASTA algorithm is described in the W R Pearson and D.J. Lipman, 25 "Improved Tools for Biological Sequence Analysis," Proc. Natl. Acad. Sci. USA 85:2444-2448 (1988) and W.R. Pearson, "Rapid and Sensitive Sequence Comparison with FASTP and FASTA," Methods in Bnzymology 183:63-98 (1990).

All sequences identified as above qualify as "variants" as that term is used herein.

Variant polynucleotide sequences will generally hybridize to the recited polynucleotide sequence under stringent conditions. As used herein, "stringent conditions" refers to prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in 35 IX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% 12 SDS at 65°C. Such hybridizable sequences include those which code for the equivalent protein from sources (such as shellfish) other than P. canaliculus.

While the above synthetic or recombinant approaches can be taken to produce the 5 protein of the invention, it is however practicable (and indeed presently preferred) to obtain the protein by isolation from P. canaliculus. This reflects the applicants' finding that the protein is the dominant protein of the haemolymph of P. canaliculus and also that the protein is self-aggregating. It can therefore be isolated in commercially significant quantities direct from the mussel itself. For example, 10 approximately 2 mg of the protein can be obtained per ml of haemolymph.

Once obtained, the protein is readily purified if desired. This will generally involve centrifugation in which the self-aggregating nature of the protein is important. Other approaches to purification (eg. chromatography) can however also be followed.

Furthermore, if viewed as desirable, additional purification steps can be employed using approaches which are standard in this art. These approaches are fully able to deliver a highly pure preparation of the protein.

Once obtained, the protein and/or its active fragments can be formulated into a composition. The composition can be, for example, a therapeutic composition for application as a pharmaceutical, or can be a health or dietary supplement. Again, standard approaches can be taken in formulating such compositions.

Still further, the composition can be a food in which the protein and/or its active fragments are included. This can occur by adding the protein to a pre-prepared foodstuff, or incorporating the protein into a step of the manufacturing process for the food.

The invention will now be described more fully in the following experimental section which is provided for illustrative purposes only. 13 EXPERIMENTAL Section 1 A. Materials and Methods A.1 Shellfish: Perna canaliculus (the New Zealand green-lipped- mussel; the Greenshell™ mussel) were obtained at retail supermarket outlets or from mussel farmers directly; other shellfish species were obtained from retail 10 outlets except for the blue mussel Mytilis edulis which was supplied by Sanford's Fisheries (Havelock, New Zealand).

A.2 Extracts: Mussel extracts were prepared by homogenising whole, shucked mussels (up to 120 mm length) in a commercial food processor with the 15 addition of 0.02 M sodium phosphate buffer, pH 7.2. Dichloromethane (1/2 volume) was mixed with the aqueous extract, centrifuged at low speed (6000 rpm, GSA rotor, Sorvall RC-5B centrifuge at 4 °C). Polyethylene glycol (PEG) (MW 6000) was added to the aqueous phase to a final concentration of 10% (w/v) and NaCl to 0.5 M and stirred at 4-6 °C overnight. Following low speed 20 centrifugation the PEG-precipitate was resuspended in approximately 1/10 volume of sodium phosphate buffer. After another cycle of low-speed centrifugation the supernatant was centrifuged at high speed (50,000 rpm in a Beckman 60Ti rotor at 4 °C for 60-80 minutes). The resultant pellet was resuspended in a small volume of phosphate buffer and clarified by low 25 speed centrifugation.

A.3 Polyacrylamide gel electrophoresis: 12% polyaciylamide gels (8 xlO cm; 1 mm thick) were cast using a prepared stock solution according to the manufacturer's instructions (40% acrylamide/bis solution 37.5:1, Bio-Rad, 30 USA); commercially available 12% gels (Bio-Rad, USA) were also used.

Samples (10 j_l1) were applied to lanes and the gels run at 160 V using a standard Tris/Glycine/SDS buffer (Bio-Rad, catalogue 161-0732) until the bromphenol blue marker reached the bottom of the gel. Gels were stained with BM Fast Stain Coomassie® (Boehringer Mannheim, Germany) and 35 destained as per the manufacturer's instructions. 14 Glycosylation test: Samples were treated with N-glycosidase F (PNGase F from Flavobacterium memngosepticum; Boehringer Mannheim Biochemica, Germany) according to the manufacturer's directions. Treated and untreated samples were run in a standard 12% polyacrylamide gel.

Isopycnic gradients: CsCl (Boehringer Mannhein, Germany) solutions were prepared in 0.1 M sodium phosphate buffer, pH 7.2 and filtered through a 0.22 |im membrane (Acrodisc, Gelman Sciences, USA) to clarify. Two step gradients (1.25 g/cc top layer containing the sample and 1.45 g/cc bottom layer) were prepared as described by Scotti (1985) and centrifuged for approximately 17 hours at 20 °C in a Beckman 70Ti rotor at 30,000 rpm. The resultant gradient was fractionated by inserting a 100 pi glass capillary tube into the gradient and slowly pumping out the contents. UV absorbance was monitored by passing through a Uvicord spectrophotometer (LKB Produkter, Sweden). Fractions were collected and the refractive indices measured using an Abbe refractometer (Bellingham and Stanley, UK) and the density estimated using regression equations according to the method of Scotti (1985).

Porous glass chromatography: Controlled pore glass (CPG 240-80, Sigma Chemical Co., USA) was treated according to the suppliers directions. A 1 cm x 100 cm column (Bio-Rad, USA) was prepared. Samples (1-2 ml) were loaded onto the column and eluted with 0.1 M sodium phosphate buffer, pH 7.2, through a Uvicord spectrophotometer, fractions being collected at regular intervals.

Estimation of protein concentration: Concentrations were estimated using a bovine serum albumin standard (Blot Qualified BSA, Promega, USA) by UV absorption according to the method of Layne (1957) using the equation: mg/ml protein = 1.55*A28o - 0.76*A26o. Alternatively, concentration was estimated by the Bradford reaction using reagent supplied by Bio-Rad (USA) at a wavelength of 620 nm..

A.8 High performance liquid chromatography: Reversed-phase HPLC was performed on an HP 1050 Ti-series HPLC (Hewlett Packard, USA) fitted with an analytical 300 A Vydac C-18 column, 25 cm x 4.6 mm i.d.. The 10 pi sample in water was eluted with a 0-100% acetonitrile in water (v/v) gradient over 60 min and the absorption at 218 and 280 nm was recorded.

B. Results A light-scattering band was seen after centrifugation of extracts of whole 10 Greenshell™ mussels in CsCl gradients (Figures la and lb). The density of this band was estimated at 1.368 g/cc. A minor band was sometimes observed at approximately 1.390 g/cc. If rebanded in CsCl the 1.390 band yielded two bands -one at 1.390 g/cc and a second at 1.368 g/cc. SDS-PAGE analysis of fractions of either density gave similar polypeptide profiles with a single major band. The 15 molecular weight of the protein by PAGE was estimated as 75,000 (75 kDa) (Figure lc). Several minor bands of higher molecular weight and an additional minor band of 45 kDa were also seen. The main band (called pernin) at 75 kDa was always at great excess compared to the minor bands. When material from the light-scattering material from CsCl gradients were examined by electron microscopy, particles 20 resembling those of "empty" small RNA viruses were seen (Figure 2). However a UV wavelength scan (data not shown) indicated that little, if any, nucleic acid was present and that the particles were mainly composed of protein. HPLC showed the CsCl band to be composed almost solely of a single species of protein (Figure 3). Since HPLC indicated a high degree of purity, the higher molecular weight 25 polypeptides are presumed to be multimers of pernin. It is likely that the minor, lower molecular weight band is degraded pernin.

Chromatography, on a CPG 240-80 column, of semi-purified extracts, or of material banded in CsCl, showed that the majority of pernin was eluted in the exclusion 30 volume using low molarity phosphate or Tris buffer as the eluent. In contrast, a protein of similar size, bovine serum albumin (68 kDa), was included in the column matrix. It appears, therefore, that pernin does aggregate into large, particle-like structures under certain conditions as suspected from the particles seen in Figure 2. HPLC confirmed that pernin from P. canaliculus obtained by CPG chromatography 35 was highly purified. Aggregating protein species were also detected in extracts of 16 other shellfish: the blue mussel Mytilis edutis, the oyster Crassostrea gigas, and New Zealand pipis Paphies australis but not in scallops Pecten novaezealandiae. These polypeptides were lower in molecular weight than pemin (Figure 4a). The pernin from P. canaliculus is N-glycosylated as shown by a reduction in molecular 5 weight when treated with endoglycosidase-F before PAGE (Figure 4b).

The yield of pernin from whole mussel extractions averaged about 200 fig/mussel. Improved yields of pernin were obtained by extracting haemolymph directly from live P. canaliculus. A small notch was made in the shell using a triangular file and a 30 10 gauge needle inserted into the posterior adductor muscle. From 1 to 5 ml of haemolymph can be withdrawn easily. The haemolymph was spun at low speed (a1000 g) to remove haemocytes and the resulting supernatant processed by ultracentrifugation, for example at 250,000 g for 40 minutes, followed by either CPG chromatography eluting with 0.1 M sodium phosphate buffer, pH 7.2, or isopycnic 15 banding in CsCl in phosphate buffer. The pernin obtained in this way appeared no different than that purified from whole mussels and had the advantage of a 30-fold average increase in yield from each mussel. Haemolymph contained around 2 mg/ml (average «5-6 mg/mussel) of pernin which is by far the most predominant polypeptide species (Figure 5a). The time to purify pernin was reduced from about 5 20 days to 1 day.

Microsequencing of the N-terminal region and internal fragments generated by chemical and enzymatic cleavage from purified pernin was performed and generated the following sequences of cleavage fragments: (a) DGEQCNDGQN (b) QGGHEVESERVACCVIGRA (c) GQSHPEIVH (d) YHGHDDA (e) WNEVHH.

These sequences code for amino acids as follows: 17 CODE: A alanine C cystine D aspartic acid E glutamic acid F phenylalanine G glycine H histidine I isoleucine K lysine L leucine M methionine N asparagine P proline Q glutamine R arginine S serine T threonine V valine w tryptophan Y tyrosine The sequence data was then compared with amino acid sequences in searchable computer data bases. Some sequences were found to be of particular interest: a) a 10 amino acid residue sequence from the N-terminus of pernin (sequence (a) above) showed only homology with an 8 base anti-thrombin protein sequence from terrestrial leeches (data from US Patent 5,455,181 Oct 3, 1995: sequence 10).

Perna canaliculus pemin 2 GEQCNDGQ 9 matching amino acids G+ CNDGQ leech anti-thrombin 5 GQSCNDGQ 12 identities: 6/8 (75%) positives: 7/8 (87%); "+" indicates an equivalent amino acid; the bolded numerals indicate amino acid position 18 b) An internal cleavage product (sequence (b) above) was shown to be have homology to the Cu-Zn class of proteins known as "SODs" (superoxide dismutases).

Each of fragments (a) to (e) are part of the larger pernin amino acid sequence: 1 DGEQCNDGQN KDDHHDDHHD DHHDDHDDDD ETMHYAQCEM EPNPHMASS L HHHVHGSIEL S QKGHGAVYL E LHLVGFNT S EDHDDHHHGL_ HLHMLGDMSA 0 GCDSIGELYN AHPEKHADPG DLGDLVDDDR GVVNEVHHYA WLDIDGTAPN TEALIGHSMT ILQGSHTDAD TPASRIACCV IGHGKARPET AAALHHELEE DKTEHYAHCD VRSNTHQP KA LHHHVHGTID FKQVGYGDLE VSYHLEGFNV SDDHKDHLHD VQIYANGDLT S GC DNLGAKY DPHEDYHSEL GDLGDIHDDD HGVVNE SHRY SWINIFGDDS VLGRSIAIHQ RDHLHKSAKI ACCVIGRGQS HPEIVHRAKC VVRPNTESTG LHHHVSGSIT FEQTPGGSTH MTADLKGFNV 40 SEDLSHHRHG VQLHEWGDMS HGCHS LGRMY HGHDDAHDPK RPGDLGDVID 45 DSHGIVHSTR T FDHLNVEDL NARS1VIMQG GHEVE SERVA CCVIGRA (Bold characters indicate directly sequenced fragments (a) to (e)).

Section 2 Anti-thrombin Activity The possibility that pernin could function as an anti-thrombin agent was examined 15 in a kinetic assay for thrombin inhibition.

Thrombin inhibition assay Kinetic assays were done using an Accucolor™ Antithrombin III kit (catalogue no. 20 CRS105, Sigma Diagnostics, USA) with the reagents prepared according to the supplier's directions. Standard plasma was supplied by Instrumentation Laboratories (Italy) and used at the recommended dilution of 1/41. Samples of purified mussel protein in water were diluted 9/10 by adding 10X Sigma sample buffer. Heparin was purchased from Instrumentation Laboratories. Thrombin 25 activity was estimated colorimetrically at 405 nm using a chromogenic substrate (H-D-HHT-L-Ala-L-Arg-pNa.2AcOH, catalogue no. A 8058, Sigma, USA) and a Multiskan Biochromatic plate reader (Labsystems, Finland) This verified that pernin had inhibitoiy activity. When a purified preparation of 30 pernin was centrifuged through a 30,000 MW exclusion filter (Figure 5a), all the anti-thrombin activity was in the retentate and no detectable activity was present in 19 the filtrate (Figure 5b). The standard serum was diluted 1/41 as recommended for this assay system; the pernin concentration was not determined directly but was in the 1 mg/ml range. From this kinetic data pernin inhibition was estimated to be about 50% of the level of human plasma (approximately 1 mg/ml pernin diluted 5 9/10 compared with the 1/41 plasma dilution in the standard ATffl assay system). Heparin, a co-factor required for ATIII inhibition of thrombin, was not required for inhibitory action by pernin.

Metal Binding Activity Hi Trap® Chelating affinity columns (Amersham Pharmacia Biotech, 1ml size) were prepared according to the manufacturer's instructions. The columns were then charged with either 0.1M cupric chloride or zinc chloride before equilibrating in a buffer (0.050M sodium phosphate and 0.5M sodium chloride containing 0.5mM 15 imidazole, pH 7.0). Protein samples purified using CsCl centrifugation were suspended in this buffer and applied to the column using a chromatographic system (Econo System, Bio-Rad Laboratories, USA). Following washing of the column for 5 mins with buffer during which no protein appeared in the eluate, a linear gradient over 20 min at 1 ml/min was used to develop the column using buffer with the 20 imidazole concentration at lOOmM from 0-100%. The protein eluted into the gradient being retained longer on the copper chelation column than the zinc. The absorption of the eluate was monitored at 254nM.

Divalent metal ion content of the CsCl purified protein was determined by dissolving 25 the protein in water at 10 mg/ml and analysing metal content by both atomic absorption and plasma emission spectrometry by comparison with a water blank. There was no significant divalent cation content in the protein purified by this method. However, purification by other methods not employing chaotropic agents like CsCl, the high content of histidine coupled with acidic amino acid residues and 30 the likely origin of this protein from a SOD precursor, points to pernin having endogenous metal ions as part of its native structure.

Section 3 Gene Sequencing Method A suite of non-specific primers called pUZ5 was synthesised by Gibco-BRL for the initial sequencing based on the N-terminal sequence of pernin. The general formula was: GAY GGN GAR CAR TGY AAY GAY GGN CAR AA Where Y represents a pyrimidine base, R represents a purine base and N represents any one of the four nucleotide bases. Sequencing was done, initially using pUZ5 and an oligo-dT based "bottom stand" primer from PCR amplified cDNA. Sequencing was done by dye-termination cycle sequencing using "BigDye" prism 15 technology (Applied Biosystems Incorporated, USA) according to their instructions. Products were resolved on an ABI 377 automated sequencer. Following the initial sequencing of approximately 500 base pairs pernin-specific primers were constructed and used to complete the sequencing of the pernin gene.

This provided the following: GAYGGGGAGCAGTGTAACGATGGGCAGAACAAAGATGACCACCATGACGACCACCACGATGATCA CCATGACGACCATGATGATGATGATGAAACAATGCACTATGCCCAGTGTGAAATGGAACCAAACC CTCATATGGCTAGCAGCCTTCACCACCATGTCCATGGCAGCATAGAGTTGTCACAGAAGGGTGAT 25 GGAGCTGTTTATCTAGAACTTCATCTTGTCGGATTCAACACAAGTGAAGACCATGACGACCACCA TCATGGACTTCATCTGCACATGCTTGGTGACATGTCAGCAGGTTGTGATTCTATTGGCGAACTGT ACAATGCTCACCCAGAAAAACATGCTGACCCTGGTGACCTCGGTGACCTGGTTGACGATGATAGG GGCGTGGTTAATGAAGTTCATCATTATGCTTGGTTGGACATTGATGGTACAGCACCAAACACCGA AGCTCTCATTGGACACTCAATGACTATTTTACAAGGGAGTCACACCGATGCTGATACCCCAGCCA 30 GTAGAATCGCCTGTTGTGTTATTGGTCATGGAAAAGCTCGCCCAGAAACAGCAGCTGCTCTACAT C AC GAGCTAGAGGAAGATAAAACTGAGC ATTATGCCC ATTGTGACGTAAGATCT AATAC ACAC C A ACCAAAGGCTCTTCATCATCATGTCCACGGAACCATCGATTTCAAACAAGTTGGTTATGGTGACC TTGAAGTGTCCTACCATTTAGAGGGATTTAATGTAAGTGATGACCACAAAGATCATCTCCATGAC GTACAGATCTACGCCAACGGTGACCTGACCAGTGGATGTGATAACCTCGGTGCTAAATATGATCC 35 TCATGAAGATTACCACAGTGAGTTGGGTGATCTAGGAGATATTCACGATGATGACCATGGCGTTG TCAATGAAAGCCACAGATATTCCTGGATCAATATCTTCGGTGATGACAGTGTCCTGGGACGTTCT ATTGCCATTCACCAAAGAGACCATCTTCATAAAAGTGCCAAAATTGCCTGTTGTGTCATAGGACG TGGACAGAGCCATCCAGAAATTGTTCACAGAGCTAAATGTGTTGTCAGACCTAATACAGAATCTA CTGGTTTACATCACCATGTCTCTGGTTCTATAACATTCGAACAGACCCCTGGAGGATCAACACAT 21 ATGACGGCTGATCTCAAAGGATTTAACGTTAGTGAGGACTTGTCACATCATCGTCATGGTGTGCA GCTCCATGAATGGGGAGATATGTCCCATGGCTGTCACTCCTTAGGCAGAATGTACCATGGTCATG ATGATGCTCATGACCCCAAAAGACCTGGTGACCTTGGTGATGTTATAGATGATTCCCATGGCATC GTTCATTCAACTAGAACCTTTGATCATCTTAATGTTGAAGATCTTAACGCACGTTCCCTTGTGAT 5 TATGCAGGGCGGACATGAGGTCGAGAGTGAGAGGGTTGCTTGCTGTGTTATAGGACGGGCATGAA TAACCTCACTAGAGTGACTTTGTCTAACATGACAATTAACAATTGTATAACTTCGCTAAAAAATA AAAC AATGACACAATGNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

Discussion The present invention is a novel protein obtainable from Perna canaliculus, the New Zealand green-lipped (Greenshell™) mussel. The protein appears to be able to self-aggregate in structures resembling small virus like particles (VLPs) approximately 25 nm in diameter but lacking any nucleic acid. The protein was 15 found in extracts of whole mussels and appears to be the predominant protein in haemolymph. The molecular weight of the protein was estimated to be 75 kDa by PAGE and inferred to be 55 kDa from its polynucleotide encoding sequence but, because of its ability to aggregate, the protein can be sedimented by ultracentrifugation in a short time (e.g. 40 minutes at 250,000 gj whereas the 20 monomelic protein would not. Each ml of haemolymph yields, on the average, about 2 mg of pemin. Haemolymph is easily obtained by withdrawing fluid from the posterior adductor muscle of the shellfish which can yield up to 5 ml without obvious harm; it is not necessary to kill the mussel. The haemolymph obtained not only contains high levels of pernin but is quite free of contaminating materials, 25 particularly compared with whole mussel extracts, so purification of pernin is simple. For highly pure preparations of pernin, ultracentrifugation is followed by isopycnic banding in a suitable density gradient medium such as CsCl.

The sequence of the N-terminus of pernin suggested that the protein might have 30 anti-thrombin activity. This was demonstrated in kinetic assays on purified pernin. Since thrombin is a serine protease, pernin also acts as a serine protease inhibitor.

Comparison of the sequences obtained from several cleavage fragments against amino acid sequences in a computer database suggest that in addition to the anti-35 thrombin activity of pernin, the protein also possesses other activities. One of these is the ability to bind divalent cations such as Zn2+ and Cu2+. 22 INDUSTRIAL APPLICATION The preferred protein of the invention, pernin, has a number of utilities.

Because of its anti-thrombin activity pernin is potentially useful as an anticoagulant agent. Thrombin normally acts as a protease which converts fibrinogen in the blood to fibrin. Blood coagulation is counteracted by inhibitors, normally anti-thrombin III (ATIII); pernin has also been shown to inhibit thrombin activity in an 10 ATIII assay system. In contrast to ATIII, whose action is accelerated by the presence of heparin (a sulphated mucopolysaccharide) pernin does not require heparin as a co-factor.

The pernin protein from P. canaliculus thus has value as a pharmaceutical. Since it 15 is active as an anticoagulant in its native state it may also be useful as a natural therapeutic agent or health supplement. It is readily obtained as a natural product in high concentrations from mussel haemolymph. To obtain a highly pure preparation it is necessary only to remove haemocytes by centrifugation (or any other suitable method) followed by either ultracentrifugation (since pernin forms 20 aggregates which readily sediment) and resuspension, isopycnic banding in a suitable medium such as CsCl, exclusion filtration through a suitable membrane which retains pernin, or chromatography through a medium such as controlled pore glass of suitable porosity. The result is a highly pure preparation of pernin.

The mussel P. canaliculus produces large amounts of the protein naturally, with little cost or effort involved in production, processing or purification.

A further utility of the protein arises from the fact that pernin can be stripped of divalent cations (for example by CsCl isopycnic banding, or pH variation). This 30 allows for the addition of divalent cations of choice (such as Mg++, Cd++, Zn++ or Ca++) to the metal stripped pernin. Such a protein, with a modified and pre-selected divalent cation loading, has application in the food and nutraceutical industries.

The ability to bind divalent metal cations also gives rise to applications of the 35 protein in bioremediation and/or cation recovery processes. The divalent cations 23 can be present as contaminants or pollutants in, for example, a solution, and the solution passed by a substrate to which the protein is bound so that the cations are extracted.

Yet a further utility arises from the fact that the protein is "self-aggregating", and can form into structures resembling empty virus-like particles of approximately 25 nm in diameter. These empty virus-like particles are able to Sequester other molecules inside them, with the consequent ability to function as delivery vehicles for those other molecules. Examples of molecules able to be delivered in this 10 manner include pharmaceutically active compounds.

Those persons skilled in the art will understand that the above description is provided by way of illustration only and that the invention is limited only by the appended claims.

REFERENCES Layne, E. (1957). Spectrophotometry and turbidometric methods for measuring proteins, Methods in Bnzymology. Ill, 447.

Scotti, P.D. (1985). The estimation of virus density in isopycnic cesium chloride gradients. Journal of Virological Methods 12, 149. 24 SEQUENCE LISTING <110> The Horticulture and Food Research Institute of Ne <120> Serine Protease Inhibitor <130> 25409 MRB <140> <141> <150> NZ 336906 <151> 1999-07-23 <160> 8 <170> Patentln Ver. 2.1 <210> 1 <211> 10 <212> PRT <213> Perna canaliculus <400> 1 Asp Gly Glu Gin Cys Asn Asp Gly Gin Asn 15 10 <210> 2 <211> 19 <212> PRT <213> Perna canaliculus <400> 2 Gin Gly Gly His Glu Val Glu Ser Glu Arg Val Ala Cys Cys Val lie 1 5 10 15 .

Gly Arg Ala <210> 3 <211> 9 <212> PRT <213> Perna canaliculus 1 <400> 3 Gly Gin Ser His Pro Glu lie Val His 1 5 <210> 4 <211> 7 <212> PRT <213> Perna canaliculus <400> 4 Tyr His Gly His Asp Asp Ala 1 5 <210> 5 <211> 7 <212> PRT <213> Perna canaliculus <400> 5 Val Val Asn Glu Val His His 1 5 <210> 6 <211> 1491 <212> DNA <213> Perna canaliculus <220> <221> CDS <222> (1)..(1491) <400> 6 gay ggg gag cag tgt aac gat ggg cag aac aaa gat gac cac cat gac 48 Asp Gly Glu Gin Cys Asn Asp Gly Gin Asn Lys Asp Asp His His Asp 15 10 15 gac cac cac gat gat cac cat gac gac cat gat gat gat gat gaa aca 96 Asp His His Asp Asp His His Asp Asp His Asp Asp Asp Asp Glu Thr 20 25 30 atg cac tat gcc cag tgt gaa atg gaa cca aac cct cat atg get age 144 Met His Tyr Ala Gin Cys Glu Met Glu Pro Asn Pro His Met Ala Ser 2 26 40 45 age ctt cac cac cat gtc cat ggc age ata gag ttg tea cag aag ggt 192 Ser Leu His His His Val His Gly Ser lie Glu Leu Ser Gin Lys Gly 50 55 60 cat gga get gtt tat eta gaa ctt cat ctt gtc gga ttc aac aca agt 240 His Gly Ala Val Tyr Leu Glu Leu His Leu Val Gly Phe Asn Thr Ser 65 70 75 80 gaa gac cat gac gac cac cat cat gga ctt cat ctg cac atg ctt ggt " 288 Glu Asp His Asp Asp His His His Gly Leu His Leu His Met Leu Gly 85 90 95 gac atg tea gca ggt tgt gat tct att ggc gaa ctg tac aat get cac 336 Asp Met Ser Ala Gly Cys Asp Ser lie Gly Glu Leu Tyr Asn Ala His 100 105 110 cca gaa aaa cat get gac Pro Glu Lys His Ala Asp 115 gat agg ggc gtg gtt aat Asp Arg Gly Val Val Asn 130 cct ggt gac ctc ggt gac Pro Gly Asp Leu Gly Asp 120 gaa gtt cat cat tat get Glu Val His His Tyr Ala 135 140 ctg gtt gac gat 384 Leu Val Asp Asp 125 tgg ttg gac att 432 Trp Leu Asp lie gat ggt aca gca cca aac acc gaa get ctc att gga cac tea atg act 480 Asp Gly Thr Ala Pro Asn Thr Glu Ala Leu lie Gly His Ser Met Thr 145 150 155 160 att tta caa ggg agt cac acc gat get gat acc cca gcc agt aga ate 528 lie Leu Gin Gly Ser His Thr Asp Ala Asp Thr Pro Ala Ser Arg lie 165 170 175 gcc tgt tgt gtt att ggt cat gga aaa get egc cca gaa aca gca get 57 6 Ala Cys Cys Val lie Gly His Gly Lys Ala Arg Pro Glu Thr Ala Ala 180 185 190 get eta cat cac gag eta gag gaa gat aaa act gag cat tat gcc cat 624 Ala Leu His His Glu Leu Glu Glu Asp Lys Thr Glu His Tyr Ala His 195 200 205 tgt gac gta aga tct aat Cys Asp Val Arg Ser Asn 210 gtc cac gga acc ate gat Val His Gly Thr lie Asp aca cac caa cca aag get Thr His Gin Pro Lys Ala 215 220 ttc aaa caa gtt ggt tat Phe Lys Gin Val Gly Tyr ctt cat cat cat 672 Leu His His His ggt gac ctt gaa 720 Gly Asp Leu Glu 3 27 225 230 235 240 gtg tcc tac cat tta gag gga ttt aat gta agt gat gac cac aaa gat 7 68 Val Ser Tyr His Leu Glu Gly Phe Asn Val Ser Asp Asp His Lys Asp 245 250 255 cat ctc cat gac gta cag ate tac gcc aac ggt gac ctg acc agt gga 816 His Leu His Asp Val Gin lie Tyr Ala Asn Gly Asp Leu Thr Ser Gly 260 265 270 gat aac ctc ggt get Cys Asp Asn Leu Gly Ala 27 5 gag ttg ggt gat eta gga Glu Leu Gly Asp Leu Gly 290 aaa tat gat cct cat gaa Lys Tyr Asp Pro His Glu 280 gat att cac gat gat gac Asp lie His Asp Asp Asp 295 300 gat tac cac agt - 8 64 Asp Tyr His Ser 285 cat ggc gtt gtc 912 His Gly Val Val aat gaa age cac aga tat tcc tgg ate aat ate ttc ggt gat gac agt 960 Asn Glu Ser His Arg Tyr Ser Trp lie Asn lie Phe Gly Asp Asp Ser 305 310 315 320 gtc ctg gga cgt tct att gcc att cac Val Leu Gly Arg Ser lie Ala lie His 325 caa aga gac cat ctt cat aaa 1008 Gin Arg Asp His Leu His Lys 330 335 agt gcc aaa att gcc tgt tgt gtc ata gga cgt gga cag age cat cca 10 56 Ser Ala Lys lie Ala Cys Cys Val lie Gly Arg Gly Gin Ser His Pro 340 345 350 gaa att gtt cac aga get aaa tgt gtt gtc aga cct aat aca gaa tct 1104 Glu lie Val His Arg Ala Lys Cys Val Val Arg Pro Asn Thr Glu Ser 355 360 365 act ggt tta cat cac cat gtc tct ggt tct ata aca ttc gaa cag acc 1152 Thr Gly Leu His His His Val Ser Gly Ser lie Thr Phe Glu Gin Thr 370 375 380 cct gga gga tea aca cat atg acg get gat ctc aaa gga ttt aac gtt 1200 Pro Gly Gly Ser Thr His Met Thr Ala Asp Leu Lys Gly Phe Asn Val 385 390 395 400 agt gag gac ttg tea cat cat cgt cat Ser Glu Asp Leu Ser His His Arg His 405 gga gat atg tcc cat ggc tgt cac tcc Gly Asp Met Ser His Gly Cys His Ser ggt gtg cag ctc cat gaa tgg 1248 Gly Val Gin Leu His Glu Trp 410 415 tta ggc aga atg tac cat ggt 12 9 6 Leu Gly Arg Met Tyr His Gly 4 28 420 425 430 cat gat gat get cat gac ccc aaa aga cct ggt gac ctt ggt gat gtt 1344 His Asp Asp Ala His Asp Pro Lys Arg Pro Gly Asp Leu Gly Asp Val 435 440 445 ata gat gat tcc cat ggc ate gtt cat tea act aga acc ttt gat cat 1392 He Asp Asp Ser His Gly lie Val His Ser Thr Arg Thr Phe Asp His 450 455 460 ctt aat gtt gaa gat ctt aac gca cgt tcc ctt gtg att atg cag ggc ~ 1440 Leu Asn Val Glu Asp Leu Asn Ala Arg Ser Leu Val lie Met Gin Gly 465 470 475 480 gga cat gag gtc gag agt gag agg gtt get tgc tgt gtt ata gga egg 1488 Gly His Glu Val Glu Ser Glu Arg Val Ala Cys Cys Val lie Gly Arg 485 490 495 gca 1491 Ala <210> 7 <211> 497 <212> PRT <213> Perna canaliculus <400> 7 Asp Gly Glu Gin Cys Asn Asp Gly Gin Asn Lys Asp Asp His His Asp 1 5 10 15 Asp His His Asp Asp His His Asp Asp His Asp Asp Asp Asp Glu Thr 20 25 30 Met His Tyr Ala Gin Cys Glu Met Glu Pro Asn Pro His Met Ala Ser 35 40 45 Ser Leu His His His Val His Gly Ser lie Glu Leu Ser Gin Lys Gly 50 55 60 His Gly Ala Val Tyr Leu Glu Leu His Leu Val Gly Phe Asn Thr Ser 65 70 75 80 Glu Asp His Asp Asp His His His Gly Leu His Leu His Met Leu Gly 85 90 95 Asp Met Ser Ala Gly Cys Asp Ser lie Gly Glu Leu Tyr Asn Ala His 100 105 110 29 Pro Glu Lys His Ala Asp Pro Gly Asp Leu Gly Asp Leu Val Asp Asp 115 120 125 Asp Arg Gly Val Val Asn Glu Val His His Tyr Ala Trp Leu Asp lie 130 135 140 Asp Gly Thr Ala Pro Asn Thr Glu Ala Leu lie Gly His Ser Met Thr 145 150 155 160 lie Leu Gin Gly Ser His Thr Asp Ala Asp Thr Pro Ala Ser Arg lie 165 170 175 Ala Cys Cys Val lie Gly His Gly Lys Ala Arg Pro Glu Thr Ala Ala 180 185 190 Ala Leu His His Glu Leu Glu Glu Asp Lys Thr Glu His Tyr Ala His 195 200 205 Cys Asp Val Arg Ser Asn Thr His Gin Pro Lys Ala Leu His His His 210 215 220 Val His Gly Thr lie Asp Phe Lys Gin Val Gly Tyr Gly Asp Leu Glu 225 230 235 240 Val Ser Tyr His Leu Glu Gly Phe Asn Val Ser Asp Asp His Lys Asp 245 250 255 His Leu His Asp 260 Cys Asp Asn Leu 275 Val Gin lie Tyr Gly Ala Lys Tyr 280 Ala Asn Gly Asp 265 Asp Pro His Glu Leu Thr Ser Gly 270 Asp Tyr His Ser 285 Glu Leu Gly Asp Leu Gly Asp lie His Asp Asp Asp His Gly Val Val 290 295 300 Asn Glu Ser His Arg Tyr Ser Trp lie Asn lie Phe Gly Asp Asp Ser 305 310 315 320 Val Leu Gly Arg Ser lie Ala lie 325 Ser Ala Lys lie Ala Cys Cys Val 340 Glu lie Val His Arg Ala Lys Cys 355 360 His Gin Arg Asp His Leu His Lys 330 335 lie Gly Arg Gly Gin Ser His Pro 345 350 Val Val Arg Pro Asn Thr Glu Ser 365 6 Thr Gly Leu His His His Val Ser Gly Ser lie Thr Phe Glu Gin Thr 370 375 380 Pro Gly Gly Ser Thr His Met Thr Ala Asp Leu Lys Gly Phe Asn Val 385 390 395 400 Ser Glu Asp Leu Ser His His Arg His Gly Val Gin Leu His Glu Trp 405 410 415 Gly Asp Met Ser His Gly Cys His Ser Leu Gly Arg Met Tyr His Gly 420 425 430 His Asp Asp Ala His Asp Pro Lys Arg Pro Gly Asp Leu Gly Asp Val 435 * 440 445 lie Asp Asp Ser His Gly lie Val His Ser Thr Arg Thr Phe Asp His 450 455 460 Leu Asn Val Glu Asp Leu Asn Ala Arg Ser Leu Val lie Met Gin Gly 465 470 475 480 Gly His Glu Val Glu Ser Glu Arg Val Ala Cys Cys Val lie Gly Arg 485 490 495 Ala <210> 8 <211> 1611 <212> DNA <213> Perna canaliculus <220> <221> polyA_signal <222> (1557)..(1563) <220> <221> misc_feature <222> (1492)..(1494) <223> Opal stop codon <400> 8 gayggggagc agtgtaacga tgggcagaac aaagatgacc accatgacga ccaccacgat 60 gatcaccatg acgaccatga tgatgatgat gaaacaatgc actatgccca gtgtgaaatg 12 0 gaaccaaacc ctcatatggc tagcagcctt caccaccatg tccatggcag catagagttg 180 7 31 tcacagaagg gtcatggagc tgtttatcta gaagaccatg acgaccacca tcatggactt ggttgtgatt ctattggcga actgtacaat gacctcggtg acctggttga cgatgatagg tggttggaca ttgatggtac agcaccaaac attttacaag ggagtcacac cgatgctgat attggtcatg gaaaagctcg cccagaaaca gataaaactg agcattatgc ccattgtgac cttcatcatc atgtccacgg aaccatcgat gtgtcctacc atttagaggg atttaatgta gtacagatct acgccaacgg tgacctgacc gatcctcatg aagattacca cagtgagttg catggcgttg tcaatgaaag ccacagatat gtcctgggac gttctattgc cattcaccaa gcctgttgtg tcataggacg tggacagagc gttgtcagac ctaatacaga atctactggt ttcgaacaga cccctggagg atcaacacat agtgaggact tgtcacatca tcgtcatggt catggctgtc actccttagg cagaatgtac agacctggtg accttggtga tgttatagat acctttgatc atcttaatgt tgaagatctt ggacatgagg tcgagagtga gagggttgct tcactagagt gactttgtct aacatgacaa aaacaatgac acaatgnaaa aaaaaaaaaa gaacttcatc ttgtcggatt caacacaagt 240 catctgcaca tgcttggtga catgtcagca 300 gctcacccag aaaaacatgc tgaccctggt 360 ggcgtggtta atgaagttca tcattatgct 420 accgaagctc tcattggaca ctcaatgact 480 accccagcca gtagaatcgc ctgttgtgtt 540 gcagctgctc tacatcacga gctagaggaa 600 gtaagatcta atacacacca accaaaggct 660 ttcaaacaag ttggttatgg tgaccttgaa 720 agtgatgacc acaaagatca tctccatgac 780 agtggatgtg ataacctcgg tgctaaatatr 840 ggtgatctag gagatattca cgatgatgac 900 tcctggatca atatcttcgg tgatgacagt 960 agagaccatc ttcataaaag tgccaaaatt 1020 catccagaaa ttgttcacag agctaaatgt 1080 ttacatcacc atgtctctgg ttctataaca 1140 atgacggctg atctcaaagg atttaacgtt 1200 gtgcagctcc atgaatgggg agatatgtcc 1260 catggtcatg atgatgctca tgaccccaaa 1320 gattcccatg gcatcgttca ttcaactaga 1380 aacgcacgtt cccttgtgat tatgcagggc 1440 tgctgtgtta taggacgggc atgaataacc 1500 ttaacaattg tataacttcg ctaaaaaata 1560 aaaaaaaaaa aaaaaaaaaa a 1611 32

Claims (28)

WHAT WE CLAIM IS:

1. An isolated protein which has a molecular weight of about 55 kDa and an amino acid sequence which includes one or more of the following: (a) SEQ ID NO. 1; (b) SEQ ID NO. 2; (c) SEQ ID NO. 3; (d) SEQ ID NO. 4; (e) SEQ ID NO. 5; or an active fragment thereof.

2. An isolated protein which comprises the amino acid sequence of SEQ ID NO. 7, or an active fragment thereof.

3. An isolated protein which is obtainable from the haemolymph of Perna canaliculus which has an apparent molecular weight of 75 kDa determined by PAGE and which has activity as a serine protease inhibitor and/or a divalent cation binding agent, or an active fragment thereof.

4. A protein or fragment as claimed in claim 1 or claim 2 which has activity as: (i) a serine protease inhibitor; or (ii) a divalent cation binding agent.

5. A protein which is obtainable from Perna canaliculus or a shellfish other than Perna canaliculus and is a functionally equivalent variant of a protein or fragment as claimed in claim 3 or claim 4 in that it is immunologically cross-reactive with a protein or fragment as claimed in any one of claims 3 to 6 and has at least the same serine protease inhibitor and/or divalent cation binding activity as a protein or fragment as claimed in claim 3 or claim 4.

6. A protein or fragment as claimed in any one of claims 3 to 5 which has activity as a serine protease inhibitor. * intellectual property office of n.z -9 JUL 2004

7.

8.

9.

10

11

12.

13.

14.

15.

16.

17.

18.

19.

20.

21. 33 A protein or fragment as claimed in any one of claims 3 to 5 which has activity as a divalent cation binding agent. A polynucleotide encoding a protein or fragment as claimed in any one of claims 1 to 7. A polynucleotide as claimed in claim 8 which comprises the nucleotide sequence of SEQ ID NO. 6 or a variant thereof. A polynucleotide which has the nucleotide sequence of SEQ ID NO. 8. A polynucleotide which hybridises under stringent conditions to a polynucleotide as claimed in any one of claims 8 to 10. A vector which includes a polynucleotide as claimed in any one of claims 8 to 11. A host cell which expresses a polynucleotide as claimed in any one of claims 8 to 11. A composition which comprises a protein or fragment as claimed in any one of claims 1 to 7. A composition as claimed in claim 14 which is a medicament. A composition as claimed in claim 14 which is a food. A composition as claimed in claim 14 which is a dietary supplement. A dietary supplement as claimed in claim 17 in which said protein or fragment is associated with or bound to at least one divalent cation of dietary significance. A dietary supplement as claimed in claim 18 wherein saicf divalent metal cation is calcium, magnesium or zinc. A composition as claimed in claim 14 which is a bioremediation agent. An isolated protein or an active fragment thereof as defined in any one of claims 1 to 3 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. i intellectual property office of n.z - 9 JUL 2004 34

22. A protein as claimed in claim 5 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

23. A polynucleotide as defined in claim 8 substantially as herein described 5 with reference to any example thereof and with or without reference to the accompanying drawings.

24. A polynucleotide as claimed in claim 10 or claim 11 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. 10

25. A vector as claimed in claim 12 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

26. A host cell as claimed in claim 13 substantially as herein described with reference to any example thereof and with or without reference to the 15 accompanying drawings.

27. A composition as defined in claim 14 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings.

28. A dietary supplement as claimed in claim 18 or claim 19 substantially as 20 herein described with reference to any example thereof and with or without reference to the accompanying drawings. INTELLECTUAL PROPERTY OFFICE OF N.Z - 9 JUL 2004