NZ517190A - Fatty acid desaturase gene from plants - Google Patents

Abstract

An isolated nucleic acid sequence encodes a polypeptide with desaturase activity. The nucleic acid selected from: a) a nucleic acid sequence with the sequence shown in SEQ ID NO:1; b) nucleic acid sequence which as a result of the degeneracy of the genetic code are derived from the nucleic acid sequence of SEQ ID NO:1 and c) derivates of the nucleic acid sequence shown SEQ IDNO: 1 which encodes polypeptides with the amino acid sequences shown in SEQ ID NO:2 and which have at least 75 % homology at the amino acid level without substantially reducing the enzymatic activity of the polypeptides. Described are and transgenic plants and vector comprising the nucleic acid sequences. The sequences can be used in a process for the preparation of triglycerides with an increased content of unsaturated fatty acids or an increased content of saturated fatty acids and the preparation of saturated fatty acids by introducing the sequence into an oil-producing organism and isolating the oil produced.

Description

0050/50669 517190 Fatty acid desaturase gene from plants The present invention relates to a process for the preparation of 5 unsaturated or saturated fatty acids and a process for the preparation of triglycerides with an increased content of ■unsaturated or saturated fatty acids.

Moreover, the invention relates to a nucleic acid sequence; a 10 nucleic acid construct, a vector and organisms comprising at least one nucleic acid sequence or one nucleic acid construct. Furthermore, the invention relates to saturated or unsaturated fatty acids and triglycerides with an increased content of unsaturated or saturated fatty acids and their use.

Fatty acids and triglycerides have a multiplicity of applications in the food industry, animal nutrition, cosmetics and in the pharmaceutical sector. Depending on whether they are free saturated or unsaturated fatty acids or triglycerides with an 20 increased content of saturated or unsaturated fatty acids, they are suitable for a very wide range of applications; thus, for example, polyunsaturated fatty acids are added to baby formula to increase the nutritional value. The various fatty acids and triglycerides are obtained mainly from microorganisms such as 25 Mortierella or from oil-producing plants such as soya, oilseed rape, sunflowers and others, where they are usually obtained in the form of their triacyl glycerides. Alternatively, they are obtained advantageously from animals, such as fish. The free fatty acids are prepared advantageously by hydrolysis.

Whether oils with unsaturated or with saturated fatty acids are preferred depends on the intended purpose; thus, for example, lipids with unsaturated fatty acids, specifically polyunsaturated fatty acids, are preferred in human nutrition since they have a 35 positive effect on the cholesterol level in the blood and thus on the possibility of heart disease. They are used in a variety of dietetic foodstuffs or medicaments.

Especially valuable and sought-after unsaturated fatty acids are 40 the so-called conjugated unsaturated fatty acids, such as conjugated linoleic acid. A series of positive effects have been found for conjugated fatty acids; thus, the administration of conjugated linoleic acid reduces body fat in humans and animals, and increases the conversion of feed into body weight in the case 45 of animals (WO 94/16690, WO 96/06605, WO 97/46230, WO 97/46118). By administering conjugated linoleic acid, it is also possible to positively affect, for example, allergies (WO 97/32008) or cancer 0050/50669 2 (Banni et al., Carcinogenesis, Vol. 20, 1999: 1019 - 1024, Thompson et al.. Cancer, Res., Vol. 57, 1997: 5067 - 5072).

The chemical preparation of conjugated fatty acids, for example 5 calendulic acid or conjugated linoleic acid, is described in US 3,356,699 and US 4,164,505. Calendulic acid occurs naturally in Calendula officinalis (Ul'chenko et al., Chemistry of Natural Compounds, 34, 1998: 272 - 274). Conjugated linoleic acid is found, for example, in beef (Chin et al., Journal of Food 10 Composition and Analysis, 5, 1992: 185 - 197). Biochemical studies into the synthesis of calendulic acid can be found in Crombie et al., J. Chem. Soc. Chem. Commun., 15, 1984: 953 - 955 and J. Chem. Soc. Perkin Trans., 1, 1985: 2425 - 2434. ^2 Owing to their positive properties, there has been no lack of attempts in the past to make available genes which participate in the fatty acid or triglyceride synthesis for the production, in various organisms, of oils with an altered content of unsaturated fatty acids. Thus, WO 91/13972 and its US equivalent describe a 2Q A-9-desaturase. WO 93/11245 claims a A-15-desaturase, WO 94/11516 a A-12-desaturase. A-6-Desaturases are described in WO 93/06712 and WO 96/21022. Other desaturases are described, for example, in EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al., J. Biol. Chem., 265, 1990: 20144 - 20149, Wada et al., Nature 347, 1990: 200-203 or Huang et al., Lipids 34, 1999: 649 - 659. However, the biochemical characterization of the various desaturases is as yet only insufficient since the enzymes, being the membrane-bound proteins, can only be isolated and characterized with great difficulty (McKeon et al.. Methods in Enzymol. 71, 1981: 12141 -12147, Wang et al., Plant Physiol. Biochem. , 26, 1988: 777 -792) .

In yeasts, both a shift of the fatty acid spectrum toward unsaturated fatty acids and an increase in productivity were 35 found (see Huang et al., Lipids 34, 1999: 649 - 659, Napier et al., Biochem. J., Vol. 330, 1998: 611 - 614). However, the expression of the various desaturases in transgenic plants did not show the desired success. While it was possible to demonstrate a shift of the fatty acid spectrum toward unsaturated 40 fatty acids, it emerged, simultaneously, that the synthetic productivity of the transgenic plants suffered greatly, viz. lesser amounts of oils were isolated compared with the starting plants. 45 Thus, there remains a great need for new genes which encode enzymes which participate in the biosynthesis of unsaturated fatty acids and which allow the latter, specifically conjugated 0050/50669 517190 3 unsaturated fatty acids, to be synthesized and produced on an industrial scale.

It is an object of the present invention to provide other 5 desaturases for the synthesis of unsaturated conjugated fatty acids, or at least to provide the public with a useful alternative.

We have found that this object is achieved by an isolated nucleic acid sequence which encodes a polypeptide with desaturase 10 activity, selected from the following group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1, b) nucleic acid sequences which, as a result of the degeneracy of the genetic code, are derived from the nucleic acid sequence shown in SEQ ID NO: 1, c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 20 1 which encode polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and which have at least 75% homology at amino acid level without substantially reducing the enzymatic activity of the polypeptides.

A derivative (or derivatives) is/are to be understood as meaning, for example, functional homologs of the enzyme encoded by SEQ ID NO: 1 or its enzymatic activity, viz. enzymes which catalyze the same enzymatic reactions as the enzyme encoded by SEQ ID N0:1.

These genes also allow an advantageous preparation of unsaturated 30 conjugated fatty acids. Unsaturated fatty acids are to be understood, in the following text, as meaning mono- and polyunsaturated fatty acids whose double bonds may be conjugated or not conjugated. The sequence given in SEQ ID NO-.l encodes a novel, unknown desaturase which participates in the synthesis of 35 calendulic acid in Calendula officinalis. The enzyme converts (9Z,12Z)octadecadienoic/linoleic acid to (8E,10E,12Z) octadecaconjutrienoic/calendulic acid. This is termed calendulic acid desaturase hereinbelow. 40 The nucleic acid sequence according to the invention or its fragments can be used advantageously for isolating further genomic sequences by means of homology screening. 0050/50669 The abovementioned derivatives can be isolated, for example, from other eukaryotic organisms such as plants like Calendula stellata, Osteospermum spinescens or Osteospermum hyoseroides, algae, protozoans such as dinoflagellates, or fungi.

Derivatives or functional derivatives of the sequence given in SEQ ID No.1 are furthermore to be understood as meaning, for example, allelic variants which have at least 75% homology at the derived amino acid level, preferably at least 80% homology, 10 especially preferably at least 85% homology, very especially preferably 90% homology. The homology was calculated over the entire amino acid range. The program used was PileUp (J. Mol. Evolution., 25 (1987), 351-360, Higgins et al., CABIOS, 5 1989: 151 - 153). The amino acid sequence derived from the 15 abovementioned nucleic acid can be seen from the sequence SEQ ID No.2. Allelic variants encompass, in particular, functional variants which can be obtained from the sequence shown in SEQ ID No.l by means of deletion, insertion or substitution of nucleotides, the enzymatic activity of the derived synthetic 20 proteins being retained.

Such DNA sequences can be isolated from other eukaryotes as mentioned above, starting from the DNA sequence described in SEQ ID No. 1 or parts of these sequences, for example using customary hybridization methods or the PCR technique. These DNA sequences hybridize with the sequences mentioned under standard conditions. It is advantageous to use, for the hybridization, short oligonucleotides, for exanple from the conserved regions, which can be determined by the skilled worker by comparison with other desaturase genes.

Alternatively, it is possible to use longer fragments of the nucleic acids according to the invention or the full sequences for the hybridization. Depending on which nucleic acid: oligonucleotide, longer fragment or full sequence, or depending ^ on which nucleic acid type, viz. DNA or RNA, is used for the hybridization, these standard conditions vary. Thus, for example, the melt temperatures for DNA:DNA hybrids are approximately 10°C lower than those of equally long DNA:RNA hybrids.

Depending on the nucleic acid, standard conditions are understood as meaning, for example, temperatures between 42 and 58°C in an aqueous buffer solution with a concentration of between 0.1 and 5 x SSC (1 x SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50% formamide such as, for ^5 example, 42°C in 5 x SSC, 50% formamide. The hybridization conditions for DNA:DNA hybrids are advantageously 0.1 x SSC and temperatures between approximately 2 0°C and 45°C, preferably 0050/50669 between approximately 30°C and 45°C. The hybridization conditions for DNA:RNA hybrids are advantageously 0.1 x SSC and temperatures between approximately 30°C and 55°C, preferably between approximately 45°C and 55°C. These temperatures which are 5 indicated for the hybridization are examples of calculated melting point data for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for the DNA hybridization are described in relevant genetics textbooks such as, for 10 example, by Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989 and can be calculated using formulae known to the skilled worker, for example as a function of the length of the nucleic acids, the type of hybrid or the G + C content. The skilled worker can find further information on hybridization in the following textbooks: Ausubel et al. (eds) , 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Hames and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular 2Q Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

Derivatives are furthermore to be understood as meaning homologs of the sequence SEQ ID No.l, for example eukaryotic homologs, truncated sequences, simplex DNA of the coding and noncoding DNA sequence or RNA of the coding and noncoding DNA sequence.

Homologs of the sequence SEQ ID No.l are also to be understood as meaning derivatives such as, for example, promoter variants.

These variants can be altered by one or more nucleotide exchanges, by insertion(s) and/or deletion(s), without, however, adversely affecting the functionality or efficacy of the promoters. Moreover, it is possible to increase the efficacy of the promoters by altering their sequence or to exchange them completely by more efficient promoters from other organisms, including other species.

Derivatives are also advantageously to be understood as meaning variants whose nucleotide sequence in the region -1 to -2 000 upstream of the start codon was altered in such a way that gene expression and/or protein expression is altered, preferably increased. Moreover, derivatives are also to be understood as meaning variants whose 3' end was altered.

To achieve optimal expression of heterologous genes in organisms, it is advantageous to alter the nucleic acid sequences in accordance with the specific codon usage used in the organism. 0050/50669 6 The codon usage can be determined readily by using computer evaluations of other, known genes of the organism in question.

The calendulic acid desaturase gene can be combined 5 advantageously in the process according to the invention with other fatty acid biosynthesis genes.

The amino acid sequences according to the invention are to be understood as meaning proteins which contain an amino acid 10 sequence shown in SEQ ID NO: 2 or a sequence obtainable therefrom by the substitution, inversion, insertion or deletion of one or more amino acid residues, the enzymatic activity of the protein shown in SEQ ID NO: 2 being retained or not reduced substantially. The term not reduced substantially is to be 15 understood as meaning all enzymes which still have at least 10%, preferably 20%, especially preferably 30% of the enzymatic activity of the starting enzyme. For example, certain amino acids may be replaced by others with similar physico-chemical properties (spatial dimension, basicity, hydrophobicity and the 20 like). For example, arginine residues are exchanged for lysine residues, valine residues for isoleucine residues or aspartic acid residues for glutamic acid residues. Alternatively, it is possible to exchange the sequence of, add or remove one or more amino acids, or two or more of these measures may be combined 25 with each other.

The nucleic acid construct or nucleic acid fragment according to the invention is to be understood as meaning the sequence given in SEQ ID NO: 1, sequences which are the result of the genetic 30 code and/or their functional or nonfunctional derivatives, all of which have been linked functionally to one or more regulatory signals, advantageously for increasing gene expression. These regulatory sequences are, for example, sequences to which inductors or repressors bind and thus regulate the expression of 35 the nucleic acid. In addition to these novel regulatory sequences, or instead of these sequences, the natural regulation of these sequences upstream of the actual structural genes may still be present and, if desired, may have been genetically altered in such a way that the natural regulation has been 40 switched off and the expression of the genes increased. However, the expression of the gene construct may also have a simpler structure, viz. no additional regulatory signals have been inserted upstream of the sequence or its derivatives and the natural promoter with its regulation has not been removed. Instead, the natural regulatory sequence has been mutated in such a way that regulation no longer takes place and gene expression is increased. These altered promoters may also be placed upstream of the natural gene on their own, in order to increase activity. 0050/50669 7 In addition, the gene construct can also advantageously contain one or more so-called enhancer sequences functionally linked to the promoter, and these allow an increased expression of the nucleic acid sequence. It is also possible to insert, at the 3' 5 end of the DNA sequences, additional advantageous sequences such as further regulatory elements or terminators. One or more copies of the calendulic acid desaturase gene may be contained in the gene construct.

Advantageous regulatory sequences for the process according to the invention are contained, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacl^- T7, T5, T3, gal, trc, ara, SP6, X-PR or in the X-PL promoter, all of which are advantageously used in Gram-negative bacteria. Other 25 advantageous regulatory sequences are contained, for example, in the Gram-positive promoters amy and SP02, in the yeast or fungal promoters ADC1, MFa , AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, or in the plant promoters such as CaMV/35S [Franck et al., Cell 21(1980) 285-294], PRP1 [Ward et al., Plant.Mol. Biol.22 (1993)], 20 SSU, OCS, lib4, STLS1, B33, nos or in the Ubiquitin promoter. Other advantageous plant promoters are, for example, a benzenesulfonamide-inducible (EP 388186), a tetracyclin-inducible (Gatz et al., (1992) Plant J. 2,397-404), an abscisic-acid-inducible (EP335528) and an ethanol- or cyclohexanone-inducible (W09321334) promoter. Other plant promoters are, for example, the potato cytosolic FBPase promoter, the potato ST-LSI promoter (Stockhaus et al. , EMBO J. 8 (1989) 2445-245) , the Glycine max phosphoribosyl pyrophosphate amido transferase promoter (see also gene bank accession number U87999) or a node-specific promoter as described in EP 249676. Advantageous plant promoters are, in particular, those which ensure expression in tissues or parts of the plants in which the biosynthesis of fats or their precursors takes place. Promoters which must be mentioned in particular are those which ensure seed-specific expression such as, for example, the USP promoter, 35 the LEB4 promoter, the phaseolin promoter or the napin promoter.

In principle, all natural promoters with their regulatory sequences as those mentioned above may be used for the process according to the invention. In addition, synthetic promoters may 40 also advantageously be used.

The nucleic acid fragment (= gene construct, nucleic acid construct) may also contain further genes to be introduced into organisms, as this has been described above. These genes can be 45 under separate regulation or under the same regulatory region as the desaturase gene according to the invention. These genes are, for example, other biosynthesis genes, advantageously of the " h J-.,,. ± 0050/50669 8 fatty acid and lipid biosynthesis, which allow increased synthesis. Examples which may be mentioned are the genes for A15-, A12-, A9-, A6-, A5-desaturase, the various hydroxylases, acetylenase, the acyl-ACP thioesterases, the (3-ketoacyl-ACP 5 synthases, the acyltransferases such as diacylglycerol acyltransferase, glycerol-3-phosphate acyltransferase or lysophosphatidic acid acyltransferase or (3-ketoacyl-ACP reductases. It is advantageous to use the desaturase genes in the nucleic acid construct, especially the A12-desaturase gene.

For expression in a host organism, for example a microorganism such as fungus or a plant, the nucleic acid fragment is advantageously inserted into a vector such as, for example, a plasmid, a phage or other DNA, which vector allows optimal 25 expression of the genes in the host. Examples of suitable plasmids are, in E. coli, pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHSl, pHS2, pPLc236, pMBL24, pLG2 00, pUR290, pIN-III113-Bl, A,gtll or pBdCI, in Streptomyces pIJlOl, pIJ364, pIJ702 or pIJ361, in Bacillus pUBllO, pC194 or pBD214, in 2Q Corynebacterium pSA77 or pAJ667, in fungi pALSl, pIL2 or pBB116, in yeasts 2jiM, pAG-1, YEp6, YEpl3 or pEMBLYe23, or, in plants, pLGV23, pGHlac+, pBIN19, pAK2004, pVKH or pDH51, or derivatives of the abovementioned plasmids. The plasmids mentioned represent a small selection of the plasmids which are possible. Other plasmids are well known to the skilled worker and can be found, for example, m the book Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985 , ISBN 0 444 9 04018) . Suitable plant vectors are described, inter alia, in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chapter 6/7, pp.71-119.

In addition to plasmids, vectors are also to be understood as meaning all the other vectors which are known to the skilled worker, such as, for example, phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, 35 phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally. Chromosomal replication is preferred.

The vector advantageously contains at least one copy of the nucleic acid sequence according to the invention and/or of the nucleic acid fragment according to the invention.

To increase the gene copy number, the nucleic acid sequences or homologous genes can be introduced, for example, into a nucleic acid fragment or into a vector which preferably contains the regulatory gene sequences assigned to the genes in question, or 0050/50669 9 analogously acting promoter activity. Regulatory sequences which are used in particular are those which increase gene expression.

To express the other genes contained, the nucleic acid fragment 5 advantageously additionally contains 3'- and/or 5'-terminal regulatory sequences to increase expression, these sequences being selected for optimal expression, depending on the host organism chosen and the gene or genes.

These regulatory sequences should allow the targeted expression of the genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is expressed and/or overexpressed only after induction, or that it is expressed and/or overexpressed immediately.

The regulatory sequences or factors can preferably have a positive effect on, and thus increase, the gene expression of the genes introduced. Thus, strengthening of the regulatory elements can advantageously take place at the transcriptional level by 20 using strong transcription signals such as promoters and/or enhancers. In addition, however, strengthening of translation is also possible, for example by improving mRNA stability.

In a further embodiment of the vector, the gene construct 25 according to the invention can advantageously also be introduced into the organisms in the form of a linear DNA and integrated into the genome of the host organism by means of heterologous or homologous recombination. This linear DNA may consist of a linearized plasmid or only of the nucleic acid fragment as vector 30 or of the nucleic acid sequence according to the invention.

The nucleic acid sequence according to the invention is advantageously cloned into a nucleic acid construct together with at least one reporter gene, and the nucleic acid construct is 35 introduced into the genome. This reporter gene should allow easy detectability via a growth assay, a fluorescence assay, a chemo assay, a bioluminescence assay or a resistance assay, or via a photometric measurement. Examples of reporter genes which may be mentioned are genes for resistance to antibiotics or herbicides, 40 hydrolase genes, fluorescence protein genes, bioluminescence genes, sugar metabolism genes or nucleotide metabolism genes, or biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the luciferase gene, the p-galactosidase gene, the gfp gene, the 2-deoxyglucose-6-phosphate phosphatase gene, the ^-glucuronidase 45 gene, the (3-lactamase gene, the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the BASTA (= gluphosinate) resistance gene. These genes allow the 0050/50669 transcriptional activity, and thus gene expression, to be measured and quantified easily. In this way, genome sites which show different productivity can be identified.

In a further advantageous embodiment, the nucleic acid sequence according to the invention may also be introduced into an organism on its own.

If it is intended to introduce, into the organism, other genes in addition to the nucleic acid sequence according to the invention, all can be introduced into the organism in a single vector with a reporter gene, or each individual gene with a reporter gene per vector, it being possible for the various vectors to be introduced simultaneously or in succession.

The host organism advantageously contains at least one copy of the nucleic acid according to the invention and/or of the nucleic acid construct according to the invention.

In principle, the nucleic acid according to the invention, the nucleic acid construct or the vector can be introduced into organisms, for example plants, by all methods known to the skilled worker.

In the case of microorganisms, the skilled worker can find suitable methods in the textbooks by Sambrook, J. et al. (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, by F.M. Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D.M. Glover et al., DNA Cloning Vol.1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press or by Guthrie et al. Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, 1994, Academic Press.

The transfer of foreign genes into the genome of a plant is termed transformation. The described methods for the transformation and regeneration of plants from plant tissues or plant cells are used for transient or stable transformation. 40 Suitable methods are protoplast transformation by polyethylene-glycol-induced DNA uptake, the use of a gene gun, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the agrobacterium-mediated gene transfer. The methods mentioned are described, for example, in B. 45 Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung and R. Wu, Academic Press (1993) 128-143 and by Potrykus, Annu. r 0050/50669 11 Rev. Plant Physiol.Plant Molec.Biol. 42 (1991) 205-225). The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBinl9 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711).

The transformation of plants with Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acid Res. 16 (1988) 9877.

Agrobacteria which have been transformed with an expression 10 vector according to the invention can also be used in the known manner to transform plants such as test plants like Arabidopsis or crop plants, in particular oil-containing crop plants such as soya, peanuts, castor, sunflowers, corn, cotton, flax, oilseed rape, coconut palms, oil palms, safflower (Carthamus tinctorius) 15 or cacao, for example by bathing wounded leaves or leaf sections in agrobacterial solution and subsequently culturing them in suitable media.

The genetically altered plant cells can be regenerated by all 20 methods known to the skilled worker. Suitable methods can be found in the abovementioned publications by S.D. Kung and R. Wu, Potrykus or Hofgen and Willmitzer.

Suitable organisms or host organisms for the nucleic acid 25 according to the invention, the nucleic acid construct or the vector are, in principle, all organisms which are capable of synthesizing fatty acids, specifically unsaturated fatty acids, and which are suitable for the expression of recombinant genes. Examples which may be mentioned are plants such as Arabidopsis, 30 Asteraceae such as Calendula or crop plants such as soya, peanuts, castor, sunflowers, corn, cotton, flax, oilseed rape, coconut palms, oil palms, safflower (Carthamus tinctorius) or cacao, microorganisms such as fungi, for example the genus Mortierella, Saprolegnia or Pythium, bacteria such as the genus 35 Escherichia, yeasts such as the genus Saccharomyces, algae or protozoans such as dinoflagellates such as Crypthecodinium. Preferred organisms are those which are naturally capable of synthesizing oils in substantial amounts, like fungi such as Mortierella alpina, Pythium insidiosum or plants such as soya, 40 oilseed rape, flax, coconut palms, oil palms, safflower, castor, Calendula, peanuts, cacao or sunflowers, or yeasts such as Saccharomyces cerevisiae, with soya, oilseed rape, flax, sunflowers. Calendula or Saccharomyces cerevisiae being especially preferred. In principle, transgenic animals, for 45 example Caenorhabditis elegans, are also suitable as host organisms. 0050/50669 12 Another embodiment according to the invention are, as described above, transgenic plants which contain a functional or a nonfunctional nucleic acid or a functional or nonfunctional nucleic acid construct. The term nonfunctional is to be 5 understood as meaning that an enzymatically active protein is no longer synthesized since the natural gene has been inactivated. In addition, the term nonfunctional nucleic acids or nucleic acid constructs is also to be understood as meaning a so-called antisense DNA which leads to transgenic plants which show a 10 reduction in, or lack, enzymatic activity. The antisense technology, specifically when combining, in the antisense DNA, the nucleic acid sequence according to the invention with other fatty acid synthesis genes, allows the synthesis of triglycerides with an elevated content of saturated fatty acids, or saturated 15 fatty acids. Transgenic plants are to be understood as meaning single plant cells and their cultures on solid media or in liquid culture, parts of plants and entire plants.

The use of the nucleic acid sequence according to the invention 20 or of the nucleic acid construct according to the invention for the generation of transgenic plants is therefore also subject matter of the invention.

The invention furthermore relates to an enzyme which converts a 25 fatty acid of the structure I, CH =77 COOR" (I) which has two double bonds separated from each other by a methylene group, to give a triunsaturated fatty acid of the structure II, 40 the three double bonds of the fatty acid being conjugated and the substituents and variables in the compounds of the structures I and II having the following meanings: 45 0050/50669 13 R1 = hydrogen, substituted or unsubstituted, unsaturated or saturated, branched or unbranched Ci-Cio-alkyl-, -cnn—j 0 o '3 1 4 R R r2 = substituted or unsubstituted, unsaturated or saturated Ci-Cg-Alkyl- R3 and R4 independently of one another are hydrogen, substituted or unsubstituted, saturated or unsaturated, branched or unbranched Ci-C22-alkylcarbonyl or phospho-, n = 1 to 14, preferably 1 to 8, especially preferably 4 to 6, 15 very especially preferably 6.

R1 in the compounds of the formula I and II is hydrogen, substituted or unsubstituted, unsaturated or saturated, branched or unbranched Ci-Cio-alkyl-, or -CHj-j 1 ' 0 0 '3 1 i R R Alkyl radicals which may be mentioned are substituted or unsubstituted, branched or unbranched Ci-Cio-alkyl chains such as, 25 for example, methyl, ethyl, n-propyl, 1-methylethyl, n-butyl, 1-methylpropyl—, 2-methylpropyl, 1,1-dimethylethyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 2,2-dimethylpropyl, 1-ethylpropyl, n-hexyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 30 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2-ethylbutyl, 1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1-ethyl-l-methylpropyl, l-ethyl-2-methylpropyl, n-heptyl, n-octyl, n-nonyl or n-decyl.

Preferred radicals for R1 are hydrogen and -CH: 2 | | 0 0 '3 14 R R 40 P.2 in the compounds of the formula I and II denotes substituted or unsubstituted, unsaturated or saturated Ci-Cg-alkyl-.

Alkyl radicals which may be mentioned are substituted or unsubstituted, branched or unbranched Ci-Co-alkyl chains such as, 45 for example, methyl, ethyl, n-propyl, 1-methylethyl, n-butyl, 1-methylpropyl-, 2-methylpropyl, 1,1-dimethylethyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 2,2-dimethylpropyl, 0050/50669 14 1-ethylpropvl, n-hexyl, 1,1-dimethylpropyl, 1,2 -dimethylpropyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1.1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2.2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 5 1-ethylbutyl, 2-ethylbutyl, 1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1-ethyl-l-methylpropyl, l-ethyl-2-methylpropyl, n-heptyl, n-octyl or n-nonyl. Ci-Cs-alkyl is preferred, C5-alkyl is especially preferred.

R3 and R4 independently of one another are hydrogen, substituted or unsubstituted, saturated or unsaturated, branched or unbranched Ci-C22_alkylcarbonyl- or phospho-.

C1-C22-alkyl carbonyl such as me thy 1 car bony 1, ethyl carbonyl, 15 n-propyl carbonyl, 1-methylethylcarbonyl, n-butylcarbonyl, 1-methylpropylcarbonyl, 2-methylpropylcarbonyl, 1,1-dimethylethylcarbonyl, n-pentylcarbonyl, 1-methylbutyl carbonyl, 2 -methylbutylcarbonyl, 3-methylbutyl carbonyl, 1,1-dimethylpropyl carbonyl, 1, 2-dimethylpropylcarbonyl, 2, 2-dimethylpropylcarbonyl, 1-ethylpropylcarbonyl, n-hexylcarbonyl, 1-methylpentylcarbonyl, 2-methylpentylcarbonyl, 3 -methylpentylcarbonyl, 4-methylpentylcarbonyl, 1,1-dimethylbutylcarbonyl, 1, 2-dimethylbutylcarbonyl, 1, 3-dimethylbutylcarbonyl, 25 2 ,2-dimethylbutylcarbonyl, 2, 3-dimethylbutylcarbonyl, 3.3-dimethylbutylcarbonyl, 1-ethylbutylcarbonyl, 2-ethylbutyl carbonyl, 1,1,2-trimethylpropyl carbonyl, 1,2,2-trimethylpropylcarbonyl, 1-ethyl-l-methylpropylcarbonyl and l-ethyl-2-methylpropylcarbonyl, heptylcarbonyl, nonylcarbonyl, 30 decylcarbonyl, undecylcarbony1, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl or n-eicosylcarbonyl.

Preferred substituents for R3 and R4 are saturated or unsaturated Ci6-C22-alkylcarbonyl.

Examples of substituents of the abovementioned radicals which may be mentioned are halogen such as fluorine or chlorine, alkyl or 40 hydroxyl.

In the conversion with the enzyme according to the invention, one double bond is introduced into the fatty acid and one double bond is shifted so that the three double bonds which participate in 45 the reaction are conjugated. Furthermore, one double bond is isomerized (from cis to trans). 0050/50669 The enzyme (= calendulic acid desaturase) advantageously catalyzes the conversion of linoleic acid (18:2, 9Z,12Z) to calendulic acid (18:3, SE,10E,12Z). The enzyme introduces a trans double bond at position C8 and causes the specific shift of a cis 5 double bond in position C9 to a trans double bond in position CIO, the isomerization being effected regiospecifically. A possible hypothetical reaction mechanism is shown in Fig. 1.

After deprotonation at C8 of the linoleic acid and a rearrangement of the free radical to CIO, the elimination of 10 water leads to a deprotonation at Cll and thus to the formation of calendulic acid. Simultaneously, bound FelV is reduced to Felll. Fig. 1 shows the hypothetical mechanism for (8,11)-linoleoyl desaturase (calendulic acid desaturase), modified after Svatos, A et al. (Insect Biochemistry and 15 Molecular Biology 29,1999:225-232) based on the proposed catalytic mechanism for Ricinus A9 desaturase (Lindqvist, Y et al., EMBO Journal 15, 1996:4081-4092). Suitable substrates are still 6Z,9Z,12Z, 18:3-fatty acid and 9Z,12Z,15Z, 18:3-fatty acid, which, in turn, are then reacted to give 6Z,8E,10E,12Z- and 20 8E,10E,12Z,15Z-fatty acids, respectively.

The invention furthermore relates to a process for the preparation of unsaturated fatty acids, which comprises introducing at least one above-described nucleic acid sequence 25 according to the invention or at least one nucleic acid construct according to the invention into a preferentially oil-producing organism, growing this organism, isolating the oil contained in the organism and liberating the fatty acids contained in the oil.

The invention also includes a process for the preparation of triglycerides with an increased content of unsaturated fatty acids, which comprises introducing at least one above-described nucleic acid sequence according to the invention or at least one nucleic acid construct according to the invention into a 35 preferentially oil-producing organism, growing this organism and isolating the oil contained in the organism.

Both processes advantageously allow the synthesis of fatty acids of triglycerides with an increased content of unsaturated fatty 40 acids such as calendulic acid.

The invention furthermore relates to a process for the preparation of saturated fatty acids, which comprises introducing at least one nonfunctional abovementioned nucleic acid sequence 45 according to the invention or at least one nonfunctional nucleic acid construct according to the invention into an oil-producing organism, growing this organism, isolating the oil contained in 0050/50669 16 the organism and liberating the fatty acids contained in the oil, and to a process for the preparation of triglycerides with an increased content of saturated fatty acids, which comprises introducing at least one nonfunctional abovementioned nucleic 5 acid sequence according to the invention or at least one nonfunctional nucleic acid construct according to the invention into an oil-producing organism, growing this organism and isolating the oil contained in the organism. Both processes involve the use of the so-called antisense technology (see 10 above), or the inactivation of the lateral synthesis genes.

Examples of organisms for the abovementioned processes are plants such as Arabidopsis, soya, peanuts, castor, sunflowers, corn, cotton, flax, oilseed rape, coconut palms, oil palms, safflower 15 (Carthamus tinctorius) or cacao, microorganisms such as the fungi Mortierella, Saprolegnia or Pythium, bacteria such as the genus Escherichia, yeasts such as the genus Saccharomyces, algae or protozoans such as dinoflagellates, for example Crypthecodinium. Preferred organisms are those which can naturally synthesize oils 20 in substantial amounts, such as fungi, for example Mortierella alpina, Pythium insidiosum, or plants such as soya, oilseed rape, flax, coconut palms, oil palms, safflower, castor, Calendula, peanuts, cacao or sunflowers, or yeasts such as Saccharomyces cerevisiae; soya, oilseed rape, flax, sunflowers, Calendula or 25 Saccharomyces cerevisiae are especially preferred.

Depending on the host organism, the organisms used in the processes are grown or cultured in the manner known to those skilled in the art. As a rule, microorganisms are grown in a 30 liquid medium which contains a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of organic nitrogen, sources such as yeast extract or salts such as ammonium sulfate, a phosphate source such as potassium hydrogen phosphate, trace elements such as iron salts, manganese salts, magnesium 35 salts and, if required, vitamins, at temperatures between 0°C and 100°C, preferably between 10°C and 60°C, while gassing in oxygen. The pH of the liquid medium can be maintained at a fixed value, i.e. the pH is regulated while culture takes place. However, the microorganisms may also be cultured without pH regulation. 40 Culturing can be effected by the batch method, the semi-batch method or continuously. Nutrients may be supplied at the beginning of the fermentation or fed in semicontinuously or continuously. 45 Post-transformation, plants are first regenerated as described above and then grown or planted as usual. 0050/50669 17 After the organisms have been grown, the lipids are obtained in the usual manner. To this end, the organisms can first be harvested and then disrupted, or they can be used directly. It is advantageous to extract the lipids with suitable solvents such as 5 apolar solvents, for example hexane, or polar solvents, for example ethanol, isopropanol, or mixtures such as hexane/isopropanol, phenol/chloroform/isoamyl alcohol, at temperatures between 0°C and 80°C, preferably between 20°C and 50°C. As a rule, the biomass is extracted with an excess of 10 solvent, for example with an excess of solvent to biomass of 1:4. The solvent is subsequently removed, for example by distillation. The extraction may also be carried out with supercritical C02-After the extraction, the remainder of the biomass can be removed, for example, by filtration. Standard methods for the 15 extraction of fatty acids from plants and microorganisms are described in Bligh et al. (Can. J. Biochem. Physiol. 37, 1959: 911-917) or Vick et al. (Plant Physiol. 69, 1982: 1103-1108).

The crude oil thus obtained can then be purified further, for 20 example by removing cloudiness by adding polar solvents such as acetone or apolar solvents such as chloroform, followed by filtration or centrifugation. Further purification via columns or other techniques is also possible.

To obtain the free fatty acids from the triglycerides, the latter are hyrolyzed in the customary manner, for example using NaOH or KOH.

The invention furthermore relates to unsaturated or saturated 30 fatty acids and triglycerides with an increased content of saturated or unsaturated fatty acids which have been prepared by the abovementioned processes, and to their use for the preparation of foodstuffs, animal feed, cosmetics or pharmaceuticals. To this end, they are added to the foodstuffs, 35 animal feed, cosmetics or pharmaceuticals in the customary quantities.

The invention is illustrated in greater detail in the examples which follow: 40 Examples A cDNA was cloned from Calendula officinalis mRNA using RT-PCR and RACE techniques. When expressing this cDNA in yeast, linoleic 45 acid is converted into the octadecaconjutriene calendulic acid (8E, 10E, 12Z). As far as we know, this is the first time that a calendulic acid desaturase has been described. The enzyme causes 0050/50669 18 a regiospecific shift of a cis double bond in position C9 to a trans double bond in position CIO and introduces a new trans double bond at position C8.

Transgenic yeasts and plants with an increased expression of calendulic acid desaturase cDNA show calendulic acid in their lipids.

Example 1: Isolation of RNA from Calendula officinalis seeds In order to be able to isolate cDNA clones for calendulic acid desaturase by means of PCR, RNA was isolated from Calendula officinalis seeds. Owing to the high fat content of the seeds, it was impossible to use standard protocols; the following method .15 was used instead: Using a pestle and mortar, 20 g of plant material were ground in liquid nitrogen to give a powder. 100 ml of extraction buffer I [100 mM tris/HCl, pH 7.5, 20 mM EDTA, 2% (w/v) lauryl sarcosyl, 20 4 M guanidinium thiocyanate, 5% (w/v) PVP (= polyvinylpyrrolidone) , 1% (v/v) P-mercaptoethanol] were added, and the batch was mixed immediately and homogenized. The solution was transferred into 50-ml-vessels and shaken for approximately 15 minutes. After centrifugation for 10-15 minutes at 4,000 g, 25 the fatty layer or fat drops which had risen to the top were removed and the supernatant was transferred into fresh vessels. This was followed by extraction with 1 volume of phenol/chloroform/isoamyl alcohol (= PCI, 25:24:1) and one extraction with chloroform; in each case, the mixture was shaken 30 for 15 minutes and then centrifuged. The upper, aqueous phase was removed, placed on an 8-ml-CsCl cushion (5 M CsCl) and centrifuged for 18 hours at 18°C and 100, 000 g. The supernatant was decanted off and the RNA precipitate was dried briefly. After a washing step with 70% ethanol, the RNA was dissolved in a 35 mixture of 7.5 ml extraction buffer II (100 ml tris/HCl, pH 8.8, 100 mM NaCl, 5 mM EDTA, 2% SDS) and 10 ml of PCI, shaken for 15 minutes and centrifuged. The upper, aqueous phase was extracted with chloroform and then an equal volume of 5 M LiCl was added. The RNA was precipitated overnight at 4°C. The mixture 40 was then centrifuged for 60 minutes at 12,000 g and 4°C. The precipitate was washed twice with 7 0% ethanol, dried and finally taken up in 500 fi.1 of H2O. mRNA was isolated from the resulting Calendula total RNA using 45 the Poly-Attract Kit (Promega, Mannheim) following the manufacturer's instructions. 1 fxg of this mRNA was translated into cDNA with the Superscript!! reverse transcriptase by Gibco 0050/50669 19 BRL (Eggenstein) using 200 pmol of oligo-dT primer following the manufacturer's instructions and employed as template in a polymerase chain reaction (PCR).

Example 2 : Isolation and cloning of the Calendula officinalis calendulic acid desaturase In order to isolate, from Calendula officinalis, DNA sequences which encode a calendulic acid desaturase, various degenerate 10 oligonucleotide primers were derived from amino acid sequences of the conserved histidine boxes of various A12 desaturases.

Primer A: 5 * - CCD TAY TTC TCI TGG AAR WWH AGY CAY CG - 3' forward primer, derived from the amino acid sequence 15 P Y F S W K Y/I S H R ;20 ;Primer B: 5N - CCA RTY CCA YTC IGW BGA RTC RTA RTG - 31 reverse primer, derived from the amino acid sequence H Y D S S/T E W D/N W ;The letters in primers A and B have the following meaning: ;R = A/G Y = C/T 25 W = A/T ;H = A/C/T B = C/G/T D = A/G/T I = inositol ;30 ;In a PCR with Calendula simplex cDNA (prepared as described in Example 1) as template, a DNA fragment with a length of 470 bp was amplified using primers A and B. The following PCR program was used: ;35 ;40 ;1. ;2 min ;94 ;°C ;2 . ;30 sec ;94 ;°C ;3 . ;45 sec ;50 ;°C ;4. ;1 min ;72 ;°C ;10 x 2. ;to ;4. ;5. ;0 sec ;94 ;°C ;6. ;45 sec ;50 ;°C ;7. ;1 min ;72 ;°C, ;20 x 5. ;to ;7. ;8. ;2 min ;72 ;°C ;(annealing temperature) ;time increment 5 sec per cycle ;0050/50669 ;20 ;The Tfl DNA polymerase from Biozym (Hess. Oldendorf) was used for the amplification. The 470 bp DNA fragment was cloned into the vector pCR 2.1-TOPO with the aid of the TOPO TA Cloning Kit (Invitrogen, Carlsbad, USA) and sequenced. The sequence of the 5 470 bp fragment corresponded to the sequence of nucleotide 466 to 893 of SEQ ID NO:l. ;Example 3: Obtaining and sequencing complete cDNA clones ;10 In order to obtain a full-length clone, the fragment was extended by means of 5'- and 3'-RACE (rapid amplification of cDNA ends). Starting from 1 jLtg of mRNA (isolated as described in Example 1) , duplex cDNA was prepared using the "Marathon cDNA Amplification Kit" by CLONTECH (Heidelberg). After ligation of the adaptor, 5'-15 and 3'-RACE was carried out using the following primers: ;Specific primers for 5'-RACE: ;Primer C 5' - GTG AGG GAG TGA GAG ATG GGT GTG GTG C - 3' 20 Primer D 5' - AAC ACA CTT ACA CCT AGT ACT GGA ATT G - 3' ;Specific primers for 3'-RACE: ;Primer E 5' - TAT TCC AAA CTT CTT AAC AAT CCA CCC G - 3' 25 Primer F 5'- CAA TTC CAG TAC TAG GTG TAA GTG TGT T - 3' ;First, a PCR was carried out with the adaptor-ligated duplex cDNA and primer C or E; then, a second PCR was carried out with primer D or F and a 1:50 dilution of the PCR product from the reaction 30 with primer C or E as template. ;The RACE-PCR was carried out using the following program: ;1. ;1 min ;94°C ;2. ;3 0 sec ;94°C ;3. ;3 min ;68°C ;10 x 2 . ;- 3. ;4. ;30 sec ;94°C ;5. ;30 sec ;65°C ;6. ;3 min ;68°C ;25 x 4. ;- 6. ;7. ;5 min ;68°C ;The resulting DNA fragments were cloned into pCR 2.1-TOPO with 45 the aid of the TOPO TA Cloning Kit (Invitrogen, Carlsbad, USA) and sequenced. The 5'-RACE product extended over the start codon ;K. A;y, iutiji ;0050/50669 ;21 ;into the 5'-untranslated region (5'-UTR), and the 3'-RACE over the stop codon into the 3'-UTR). ;The composite sequence composed of the first PCR product and the 5 RACE product is shown in SEQ ID NO: 1. The encoding region extends from nucleotide 42 (start codon) to 1175 (stop codon). The 5'- and 3'- UTRs were only sequenced as simplexes, so that individual sequencing mistakes are possible here. ;10 In order to obtain an uninterrupted full-length clone, a PCR was carried out using the Expand High Fidelity System (Boehringer, Mannheim) and the primers G and H, with Calendula cDNA (see Example 1) as template. ;15 Primer G 5' - ATTAGAGCTCATGGGTGCTGGTGGTCGGATGTCG - 3' ;forward primer (with SacI cleavage site) ;Primer H 5' - ATTACTCGAGTGACATACACCTTTTTGATTACATCTTG - 3 4 reverse primer (with Xhol cleavage site) ;20 ;The PCR was carried out using the following program: ;1. ;2 min ;94°C ;2. ;30 sec ;94°C ;25 ;3. ;35 sec ;63°C ;4. ;2 min ;72°C ;10 x 2. ;- 4. ;5. ;30 sec ;94°C ;6. ;35 sec ;63°C ;30 ;7. ;2 min ;72°C, ;15 x 5. ;- 7 ;8. ;2 min ;72 °C ;time increment 5 seconds per cycle ;The 1.2 kb PCR product was cloned into the vector pGEM-T (Promega, Mannheim) and transformed into E. coli DH10B. The 35 insert DNA was sequenced as duplex using a 373 DNA sequencer (Applied Biosystems). To this end, the following sequence-specific primers were used in addition to reverse primer and -21 primer: ;40 Primer I: 5' - CGG TCT TCT CGC TGT ATT - 3' ;Primer J: 5' - ATT ACC CAA GCT GCC C - 3' ;45 ;0050/50669 ;22 ;The complete DNA sequence of calendulic acid desaturase (CalDes) is identical to the section from nucleotide 42 to 1193 of SEQ ID N0:1. The sequence encompasses the encoding region and a short section of the 3'-UTR. ;5 ;A comparison of the derived amino acid sequence of Co-CalDes (SEQ ID NO:2) with annotated protein sequences of the SWISS-PROT and SP-TREMBL databases demonstrated the highest homology to a Crepis alpina A12-acetylenase (SP_PL: 081931, 74% identical amino 10 acids), a Crepis palaestina A12-epoxygenase (SP_PL: 065771, 73% identical amino acids) and a Borago officinalis A12-desaturase (SP_PL: 082729, 62% identical amino acids) over the entire encoding region. The sequence comparisons are shown in Fig. 2. Fig. 2 shows a comparisons of the amino acid sequences of 15 Co-CalDes with Crepis alpina A12-acetylenase (Ca-Acetyl), Crepis palaestina A12-epoxygenase (Cp-Epoxy) and Borago officinalis A12-desaturase (Bo-Des). ;Example 4: Expression of calendulic acid desaturase in yeast ;20 ;In a first approach, the encoding region of the cDNA was cloned in a yeast expression vector and expressed in S. cerevisiae, in order to demonstrate the functionality of CalDes. The calendulic acid desaturase produced in the yeast was meant to convert added 25 linoleic acid into calendulic acid. The latter, in turn, was to be detected by HPLC in hydrolyzed lipid extracts. ;In a second approach, the A. thaliana A12-desaturase FAD2 (Kajiwara et al., Appl. Environ. Microbiol., 62, 1996: 4309 -30 4313) was expressed in yeast in addition to CalDes, so that the yeast cells endogenously produce linoleic acid which, in turn, can be converted into calendulic acid owing to the activity of CalDes. The calendulic acid, in turn, was to be detected by HPLC. ;35 ;All solid and liquid media for yeast were prepared by protocols of Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1995) . ;40 The CalDes cDNA was excised from the vector pGEM-T by restriction digest with Sacl/Xhol and cloned into the SacI/XhoI-cut shuttle vector pYES2 (Invitrogen, Carlsbad, USA) , and the resulting vector pYES2-CalDes was transformed into E. coli XL1 blue. After another plasmid preparation with the aid of the Plasmid Maxi Kit 45 (QIAGEN), pYES2-CalDes was transformed into S. cerevisiae INCSvl (Invitrogen, Carlsbad, USA) with the aid of the polyethylene glycol method (Von Pein M., PhD thesis, Heinrich Heine- ;0050/50669 ;23 ;Universitat Dtisseldorf, 1992), where the expression of the CalDes cDNA was under the control of the GAL1 promoter. ;In order to be able to express, in the second approach, not only 5 CalDes, but also FAD2, in yeast, the encoding region of the FAD2 gene was first amplified via PCR (protocol see Primers G and H) from A. thaliana cDNA with the aid of Tfl polymerase (Biozym) . The following primers were used for this purpose: ;10 Primer K: 5' - AAACTCGAGATGGGTGCAGGTGGAAGAATGCCGG - 3' ;forward primer (Xhol cleavage site) ;Primer L: 5' - AAAAAGCTTTCATAACTTATTGTTGTACCAGTACACACC - 3' reverse primer (HindlXI cleavage site) ;15 ;The resulting PCR product was subjected to a restriction digest with Xhol/Hindlll and then cloned into the XhoI/Hindlll-cut yeast expression vector pESC-Leu (Stratagene), where the FAD2 DNA was under the control of the GAL1 promoter. ;20 ;The expression of CalDes in S. cerevisiae INCSvl was carried out using a modification of the procedure of Avery et al. (Appl. Environ. Microbiol., 62, 1996: 3960 - 3966) and Girke et al. (The Plant Journal, 5, 1998: 39 - 48). To prepare a starter culture, 25 10 ml of YPAD medium were inoculated with a single colony and the culture was incubated for 48 hours at 30°C at 2 00 rpm. Then, the cell culture was washed in 1 x YPA medium without sugar and centrifuged. The pelleted cells were resuspended in 2 ml of minimal medium without supplements and without sugar. 100 ml of 30 minimal medium (dropout powder, 2% raffinose, 1% Tergitol NP40) in 500-ml-Erlenmeyer flasks were inoculated with 1 ml of this cell suspension and the culture was grown at 30°C and 200 rpm. At an ODgoo of 0.5, 2% (w/v) of galactose were added and (in the case of the first batch) 0.003% of linoleic acid (3% stock solution in 35 5% Tergitol NP40). The cells were grown on until the stationary phase had been reached. They were then washed in minimal medium without supplements and stored at -2 0°C. ;Example 5: Lipid extraction and HPLC analysis of the fatty acids 40 from transgenic yeast ;The yeast cells were suspended in 30 ml of HIP solution (0.1 mM 2.6-ai-tert-butyl-4-methylphenol in hexane: isopropanol (3:2 v/v)), acidified with 150 jxl of concentrated HC1 and homogenized 45 in an Ultra-Turrax (1 min, 24,000 rpm). The samples were then shaken for 10 minutes at 4°C and centrifuged for 10 minutes at 5,000 g and 4°C. The supernatant was transferred into a fresh ;0050/50669 ;24 ;container and made up to 47.5 ml with 0.38 M K2SO4. The samples, in turn, were shaken for 10 minutes at 4°C and centrifuged (see above). The hexane phase was withdrawn and evaporated to dryness under a stream of N2. The residue was dissolved in 20 (il of 5 chloroform. For the alkaline hydrolysis of fatty acid esters, 400 fil of methanol and 80 jil of 40% strength (w/v) KOH solution were added and the sample was incubated for 20 minutes at 60°C under argon. The sample was subsequently cooled to room temperature, acidified to pH 3.0 with 35 jxl of concentrated HC1 10 and separated by HPLC. ;The free fatty acids were separated using an ET 250/4 Nucleosil 120-5 C18-column (Macherey & Nagel). The mobile phase used was methanol:H20:glacial acetic acid (85:15:0.1 v/v/v). The separation 15 was carried out at a flow rate of 1 ml/min and 25°C, and the absorption was measured at 268 nm to detect the conjutrienes. ;Fig. 3 shows the elution profiles of the lipid extracts from transformed yeast cells following alkaline hydrolysis (Fig. 3B, 20 elution profile of S. cerevisiae INCSvl transformed with ;A. thaliana FAD2 DNA, and C, elution profile of S. cerevisiae INCSvl transformed with Calendula officinalis pYES2-CalDes), and the elution profile of a calendulic acid standard (Fig. 3A) . Calendulic acid has a retention time of 12 minutes with a strong 25 absorption at 268 nm, which is typical for conjutrienes. The hydrolyzed lipid extracts of yeast cells which were transformed with the blank vector pYES2 and grown with 0.003% of linoleic acid show no fatty acids with a retention time of calendulic acid (not shown). Equally, the hydrolyzed lipid extracts of yeast 30 cells which express the FAD2 gene contain no calendulic acid (Fig. 3B). ;In contrast, the HPLC analysis of the extracts of pYES2-CalDes-transformed yeast cells grown with 0.003% of 35 linoleic acid showed a signal with the retention time of calendulic acid (Fig. 3C), which also showed the same absorption spectrum as the standard with a maximum of 268 nm and secondary maxima of 258 and 282 nm (Fig. 4A, standard, and C, elution profile of S. cerevisiae INCSvl transformed with Calendula 40 officinalis pYES2-CalDes). It was thus demonstrated that the expression of calendulic acid desaturase in yeast results in the biosynthesis of calendulic acid. Calendulic acid from transformed yeast cells was only successfully detected after hydrolysis of the lipids. No calendulic acid was detected in the free fatty 45 acids of these cells, that is to say that, in yeast, calendulic acid is incorporated into lipids. Since yeast contains no ;— K L. ;IPONZ" ;0050/506E9 ;5171 $Wm ;25 ;triacylglycerides, it must be assumed that the detected calendulic acid had been bound in the phospholipids of the yeast. ;In addition, the lipid extracts of transgenic yeast cells which 5 simultaneously express FAD2 and CalDes also contain calendulic acid (not shown). ;Example 6: Expression of calendulic acid desaturase in Arabidopsis thaliana and Linum usitatissimum ;10 ;The expression of Calendula officinalis calendulic acid desaturase in transgenic plants is advantageous for increasing the calendulic acid content in these plants. To this end, the CalDes cDNA was cloned into binary vectors and transferred into 15 A. thaliana and L. usitatissimum via Agrobacterium-mediated DNA transfer. The expression of the CalDes cDNA was under the control of the constitutive CaMV 35S promoter or the seed-specific USP promoter. ;20 The expression vectors used were the vector pBinAR (Hofgen and Willmitzer, Plant Science, 66, 1990: 221 - 230) and the pBinAR derivative pBinAR-USP, in which the CaMV 35S promoter had been exchanged for the V. faba USP promoter. For recloning, the CalDes cDNA had to be excised from the vector pGEM-T. To this end, the 25 latter was first cut with Ncol and filled up with Klenow to provide blunt ends; the insert was subsequently excised with Sail and cloned into the Smal/Sall-cut vectors pBinAR and pBinAR-USP. ;The resulting plasmids pBinAR-CalDes and pBinAR-USP-CalDes were ;30 transformed into Agrobacterium tumefaciens (Hofgen and ;Willmitzer, Nucl. Acids Res., 16, 1988: 9877). A. thaliana was transformed by "floral dip" (Clough and Bent, Plant Journal, 16, 1998: 735 - 743), and L. usitatissimum by coculturing linseed hypocotyl sections with transformed A. tumefaciens cells. ;35 ;The expression of the CalDes gene in transgenic Arabidopsis and Linum plants was studied by Northern Blot analysis. Selected plants were studied for their calendulic acid content in the seed oil. ;40 ;To achieve seed-specific expression of CalDes, it is also possible to use the napin promoter analogously to the USP promoter. ;45 Unless the context clearly requires otherwise, throughout the claims and the description, the term "comprise", "comprising" and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense, that is to say, in the sense of "including, but not limited to". ;0050/50669 ;26 ;SEQUENCE LISTING ;<110> Department of plant biochemistry ;<120> Fatty acid desaturase gene from plants ;<13 0> Sequence_desaturase ;<140> 50669 <141> 1999-08-31 ;<160> 2 ;<170> Patentln Vers. 2.0 ;<210> 1 <211> 1285 <212> DNA ;<213> Calendula officinalis ;<220> ;<221> CDS ;<222> (42)..(1175) ;<400> 1 ;aaaagctcac ttctctgtga gggtaattat atatcaacaa c atg ggt get ggt ggt 56 ;Met Gly Ala Gly Gly 1 5 ;egg atg teg gat cca tct gag gga aaa aac ate ctt gaa cgt gtg cca 104 Arg Met Ser Asp Pro Ser Glu Gly Lys Asn lie Leu Glu Arg Val Pro ;10 15 20 ;gtc gat cca ccg ttc acg tta age gat ctg aag aaa gcg att cct acc 152 Val Asp Pro Pro Phe Thr Leu Ser Asp Leu Lys Lys Ala lie Pro Thr 25 30 35 ;cat tgc ttt gag cga tct gtc ate egg tea tea tac tat gtt gtt cat 200 His Cys Phe Glu Arg Ser Val lie Arg Ser Ser Tyr Tyr Val Val His 40 45 50 ;gat etc att gtt gcc tat gtc ttc tac tac ctt gca aac acg tat ate 248 Asp Leu lie Val Ala Tyr Val Phe Tyr Tyr Leu Ala Asn Thr Tyr lie 55 60 65 ;cct ctt att cct aca cct ctg get tac eta gca tgg ccc gtt tac tgg 296 Pro Leu lie Pro Thr Pro Leu Ala Tyr Leu Ala Trp Pro Val Tyr Trp 70 75 80 85 ;ttt tgt caa get age ate ctc acc ggc ctc tgg gtc ate ggt cac gaa 344 Phe Cys Gin Ala Ser lie Leu Thr Gly Leu Trp Val lie Gly His Glu ;*"■ i1-. ■ 0050/50669 27 90 95 100 tgt ggt cac cat gca ttt age gac tac cag ttg att gat gac att gtt 392 Cys Gly His His Ala Phe Ser Asp Tyr Gin Leu lie Asp Asp lie Val 105 110 115 gga ttc gtg ctc cat teg get ctc ctc acc ceg tat ttc tct tgg aaa 440 Gly Phe Val Leu His Ser Ala Leu Leu Thr Pro Tyr Phe Ser Trp Lys 120 125 130 tat age cac agg aat cac cac gcc aac aca aat tea ctc gat aac gat 488 Tyr Ser His Arg Asn His His Ala Asn Thr Asn Ser Leu Asp Asn Asp 135 140 145 gaa gtt tac att cct aaa cgt aag teg aag gtc aag att tat tcc aaa 53 6 Glu Val Tyr lie Pro Lys Arg Lys Ser Lys Val Lys lie Tyr Ser Lys 150 155 160 165 ctt ctt aac aat cca ccc ggg cga gtg ttc act ttg gtg ttt egg ttg 584 Leu Leu Asn Asn Pro Pro Gly Arg Val Phe Thr Leu Val Phe Arg Leu 170 175 180 act tta gga ttt ccg tta tac ctc tta act aat ate teg ggc aag aaa 632 Thr Leu Gly Phe Pro Leu Tyr Leu Leu Thr Asn lie Ser Gly Lys Lys 185 190 195 tac ggg agg ttt gcc aac cac ttt gat ccc atg agt cca att ttc aac 680 Tyr Gly Arg Phe Ala Asn His Phe Asp Pro Met Ser Pro lie Phe Asn 200 205 210 gat cgt gaa cgc gtt caa gtt ttg eta tcc gat ttc ggt ctt ctc get 728 Asp Arg Glu Arg Val Gin Val Leu Leu Ser Asp Phe Gly Leu Leu Ala 215 220 225 gta ttt tat gca ate aag ctt ctt gta gca gca aaa ggg gca get tgg 77 6 Val Phe Tyr Ala lie Lys Leu Leu Val Ala Ala Lys Gly Ala Ala Trp 230 235 240 245 gta ate aac atg tac gca att cca gta eta ggt gta age gtg ttc ttc 824 Val lie Asn Met Tyr Ala lie Pro Val Leu Gly Val Ser Val Phe Phe 250 255 260 gtt ttg ate aca tat ttg cac cac acc cat ctc tea ctc cct cat tat 872 Val Leu lie Thr Tyr Leu Kis His Thr His Leu Ser Leu Pro His Tyr 265 270 275 gat tea acc gaa tgg aac tgg ate aaa ggc gcc tta tea aca ate gat 920 Asp Ser Thr Glu Trp Asn Trp lie Lys Gly Ala Leu Ser Thr lie Asp 280 285 290 agg gat ttc ggg ttc ctg aat egg gtt ttc cac gac gtt aca cac act 968 0050/50669 28 Arg Asp Phe Gly Phe Leu Asn Arg Val Phe His Asp Val Thr His Thr 295 300 305 cac gtc ttg cat cat ttg ate tea tac att cca cat tat cat gca aag 1016 His Val Leu His His Leu lie Ser Tyr lie Pro His Tyr His Ala Lys 310 315 320 325 gaa gca agg gat gca ate aag cca gtg ttg ggc gag tac tat aaa ate 1064 Glu Ala Arg Asp Ala lie Lys Pro Val Leu Gly Glu Tyr Tyr Lys lie 330 335 340 gac agg act cca att ttc aaa gca atg tat aga gag get aag gaa tgc 1112 Asp Arg Thr Pro lie Phe Lys Ala Met Tyr Arg Glu Ala Lys Glu Cys 345 350 355 ate tac ate gag ccc gat gag gat age gag cac aaa ggt gtg ttc tgg 1160 lie Tyr lie Glu Pro Asp Glu Asp Ser Glu His Lys Gly Val Phe Trp 360 365 370 tac cac aag atg taa tcaaaaaggt gtatgtcaat gcaattgtat gcttaattaa 1215 Tyr His Lys Met 375 gttgttaaac tttctattcc gtgtaataaa ttatcattaa gagaaaaaaa aaaaaaaaaa 1275 aaaaaaaaaa 1285 <210> 2 <211> 377 <212> PRT <213> Calendula officinalis <400> 2 Met Gly Ala Gly Gly Arg Met Ser Asp Pro Ser Glu Gly Lys Asn lie 15 10 15 Leu Glu Arg Val Pro Val Asp Pro Pro Phe Thr Leu Ser Asp Leu Lys 20 25 30 Lys Ala lie Pro Thr His Cys Phe Glu Arg Ser Val lie Arg Ser Ser 35 40 45 Tyr Tyr Val Val His Asp Leu lie Val Ala Tyr Val Phe Tyr Tyr Leu 50 55 60 Ala Asn Thr Tyr lie Pro Leu lie Pro Thr Pro Leu Ala Tyr Leu Ala 65 70 75 SO Trp Pro Val Tyr Trp Phe Cys Gin Ala Ser lie Leu Thr Gly Leu Trp 85 90 95 0050/50669 29 Val lie Gly His Glu Cys Gly His His Ala Phe Ser Asp Tyr Gin Leu 100 105 110 lie Asp Asp lie Val Gly Phe Val Leu His Ser Ala Leu Leu Thr Pro 115 120 125 Tyr Phe Ser Trp Lys Tyr Ser His Arg Asn His His Ala Asn Thr Asn 130 135 140 Ser Leu Asp Asn Asp Glu Val Tyr lie Pro Lys Arg Lys Ser Lys Val 145 150 155 160 Lys lie Tyr Ser Lys Leu Leu Asn Asn Pro Pro Gly Arg Val Phe Thr 165 170 175 Leu Val Phe Arg Leu Thr Leu Gly Phe Pro Leu Tyr Leu Leu Thr Asn 180 185 190 lie Ser Gly Lys Lys Tyr Gly Arg Phe Ala Asn His Phe Asp Pro Met 195 200 205 Ser Pro lie Phe Asn Asp Arg Glu Arg Val Gin Val Leu Leu Ser Asp 210 215 220 Phe Gly Leu Leu Ala Val Phe Tyr Ala lie Lys Leu Leu Val Ala Ala 225 230 235 240 Lys Gly Ala Ala Trp Val lie Asn Met Tyr Ala lie Pro Val Leu Gly 245 250 255 Val Ser Val Phe Phe Val Leu lie Thr Tyr Leu His His Thr Kis Leu 260 265 270 Ser Leu Pro His Tyr Asp Ser Thr Glu Trp Asn Trp lie Lys Gly Ala 275 280 285 Leu Ser Thr lie Asp Arg Asp Phe Gly Phe Leu Asn Arg Val Phe His 290 295 300 Asp Val Thr His Thr His Val Leu His His Leu lie Ser Tyr lie Pro 305 310 315 320 His Tyr His Ala Lys Glu Ala Arg Asp Ala lie Lys Pro Val Leu Gly 325 330 335 Glu Tyr Tyr Lys lie Asp Arg Thr Pro lie Phe Lys Ala Met Tyr Arg 340 345 350 Glu Ala Lys Glu Cys lie Tyr lie Glu Pro Asp Glu Asp Ser Glu His 355 360 365 0050/50669 Lys Gly Val Phe Trp Tyr His Lys Met 370 375

Claims (50)

0050/50669 31 We claim:

1. An isolated nucleic acid sequence which encodes a polypeptide 5 with desaturase activity, selected from the following group: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1, 10 b) nucleic acid sequences which, as a result of the degeneracy of the genetic code, are derived from the nucleic acid sequence shown in SEQ ID NO: 1, c) derivatives of the nucleic acid sequence shown in SEQ ID 15 NO: 1 which encode polypeptides with the amino acid sequences shown in SEQ ID NO: 2 and which have at least 75% homology at amino acid level without substantially reducing the enzymatic activity of the polypeptides.

2. An amino acid sequence encoded by a nucleic acid sequence as claimed in claim 1.

3. An amino acid sequence as claimed in claim 2, encoded by the sequence shown in SEQ ID NO: 1.

4. A nucleic acid construct comprising a nucleic acid sequence as claimed in claim 1, where the nucleic acid sequence is linked to one or more regulatory signals.

5. A vector comprising a nucleic acid sequence as claimed in claim 1 or a nucleic acid construct as claimed in claim 4.

6. An organism comprising at least one nucleic acid sequence as claimed in claim 1 or at least one nucleic acid construct as claimed in claim 4.

7. An organism as claimed in claim 6, which is a plant, a microorganism or an animal.

8. A transgenic plant comprising a functional or nonfunctional nucleic acid sequence as claimed in claim 1 or a functional or nonfunctional nucleic acid construct as claimed in claim 4.

9. A process for the preparation of unsaturated fatty acids, which comprises introducing at least one nucleic acid sequence as claimed in claim 1 or at least one nucleic acid INTELLECTUAL PROPERTY OFPinF OP N.Z 15 SEP 2003 received AMENDED SHEET 0050/50669 INTELLECTUAL PROPERTY OF-inr- OF m.7 15 SEP 2003 received 32 construct as claimed in claim 4 into an oil-producing organism, growing this organism, isolating the oil contained in the organism and liberating the fatty acids contained in the oil. 5

10. A process for the preparation of triglycerides with an increased content of unsaturated fatty acids, which comprises introducing at least one nucleic acid sequence as claimed in claim 1 or at least one nucleic acid construct as claimed in 10 claim 4 into an oil-producing organism, growing this organism and isolating the oil contained in the organism.

11. A process for the preparation of saturated fatty acids, which comprises introducing at least one nonfunctional nucleic acid 15 sequence as claimed in claim 1 or at least one nonfunctional nucleic acid construct as claimed in claim 4 into an oil-producing organism, growing this organism, isolating the oil contained in the organism and liberating the fatty acids contained in the oil. 20

12. A process for the preparation of triglycerides with an increased content of saturated fatty acids, which comprises introducing at least one nonfunctional nucleic acid sequence as claimed in claim 1 or at least one nonfunctional nucleic 25 acid construct as claimed in claim 4 into an oil-producing organism, growing this organism and isolating the oil contained in the organism.

13. A process as claimed in claim 9 or 10, wherein the 30 unsaturated fatty acids have an increased calendulic acid content.

14. A method as claimed in any of claims 9 to 12, wherein the organism is a plant or a microorganism. 35

15. An unsaturated fatty acid prepared by a process as claimed in claim 9.

16. A triglyceride with an increased content of unsaturated fatty 40 acids prepared by a process as claimed in claim 10.

17. A saturated fatty acid prepared by a process as claimed in claim 11. 45 18. A triglyceride with an increased content of saturated fatty acids prepared by a process as claimed in claim 12.

AMENDED SHEET 0050/50669 33

19. The use of a nucleic acid sequence as claimed in claim 1 or of a nucleic acid construct as claimed in claim 4 for the generation of transgenic plants. 5

20. The use of a nucleic acid sequence as claimed in claim 1 or of a fragment thereof for isolating a genomic sequence via homology screening.

21. The use of unsaturated or saturated fatty acids as claimed in 10 claim 15 or 17 or triglycerides with an increased content of unsaturated or saturated fatty acids as claimed in claim 16 or 18 for the preparation of foodstuffs, animal feed, cosmetics or pharmaceuticals. 15

22. An enzyme which is encoded by a nucleic acid sequence as claimed in claim 1 and which converts a fatty acid of the structure I, 20 CHjj—COOR (I) which has two double bonds separated from each other by a 25 methylene group, to give a triunsaturated fatty acid of the structure II, 30 COOR (II), 35 the three double bonds of the fatty acid being conjugated and the substituents and variables in the compounds of the structures I and II having the following meanings: 40 R1 = hydrogen, substituted or unsubstituted, unsaturated or saturated, branched or unbranched Ci-Cio-alkyl-, ~CHri 1 o o ' 3 ' 4 R R 45 r2 = substituted or unsubstituted, unsaturated or saturated Ci-Cg-Alkyl- INTELLEOTUAV. PROPERTY OFCiOP OP <\j.7 15 SEP 2003 received AMENDED SHEET 5 10 15 20 25 30 35 40 45 34 R3 and R4 independently of one another are hydrogen, substituted or unsubstituted, saturated or unsaturated, branched or unbranched Ci-;;-alkylcarbonyl or phosphor-, n = 1 to 14

23. A nucleic acid according to claim 1 substantially as herein described.

24. A nucleic acid according to claim 1 substantially as herein described with reference to SEQ ID NO: 1.

25. A nucleic acid substantially as herein described with reference to SEQ ID NO: 1.

26. An amino acid according to claim 2 or claim 3 substantially as herein described.

27. An amino acid according to claim 2 or claim 3 substantially as herein described with reference to SEQ ID NO: 2.

28. An amino acid substantially as herein described with reference to SEQ ID NO: 2.

29. A vector according to claim 5 substantially as herein described.

30. A vector according to claim 5 substantially as herein described with reference to Example 4.

31. A vector substantially as herein described with reference to Example 4.

32. An organism according to claim 6 or claim 7 substantially as herein described.

33. An organism according to claim 6 or claim 7 substantially as herein described with reference to any one of Examples 4 to 6.

34. An organism substantially as herein described with reference to any one of Examples 4 to 6.

35. A plant according to claim 8 substantially as herein described.

36. A plant according to claim 8 substantially as herein described with reference to Example 6. INTELLECTUAL PROPERTY Ofp'CF OF i\J_Z 1 5 SEP 2003 Received 35

37. A transgenic plant substantially as herein described with reference to Example 6.

38. A process according to any one of claims 9 to 13 substantially 5 as herein described.

39. A process according to any one of claims 9 to 13 substantially as herein described with reference to any one of Examples 4 to 6. 10 35 45

40. A method according to claim 14 substantially as herein described.

41. A method according to claim 14 substantially as herein 15 described with reference to any one of Examples 4 to 6.

42. A fatty acid according to claim 15 or claim 17 substantially as herein described. 20

43. A fatty acid according to claim 15 or claim 17 substantially as herein described with reference to Example 5 or Example 6.

44. A triglyceride according to claim 16 or claim 18 substantially as herein described. 25

45. A triglyceride according to claim 16 or claim 18 substantially as herein described with reference to Example 5 or Example 6.

46. A use according to any one of claims 19 to 21 substantially as 30 herein described.

47. A use according to any one of claims 19 to 21 substantially as herein described with reference to any one of SEQ ID NO: 1, SEQ ID NO: 2 or Examples 1 to 6.

48. An enzyme according to claim 22 substantially as herein described.

49. An enzyme according to claim 22 substantially as herein 40 described with reference to SEQ ID NO: 2.

50. An enzyme substantially as herein described with reference to SEQ ID NO: 2. ""INTELLECTUAL HHUWtniT OFpICF: OF N.Z 1 5 SEP 2003 received BASF AKTIENGESELLSCHAFT By its Attorneys BALDWIN SHELSTON WATERS