NZ503452A - Herpesvirus saimiri having mutation in ORF4, ORF14, ORF15, ORF16 or ORF51 genes resulting in non-replicating, safe vehicle for treatments involving gene therapy - Google Patents

Abstract

A herpesvirus saimiri having at least one functional mutation in at least one of the following genes; ORF4, ORF14, ORF15, ORF16 or ORF51. The vector includes a beta-galactosidase gene which is preferably under the control of the HCMV IE 3 promoter. The combination of mutations provides for a virus that is incapable of replicating in a target cell and has the capacity of accommodating insertions of a relatively large amount of heterologous genetic material.

Description

PATENTS FORM 5 Number PATENTS ACT 1953 Dated COMPLETE SPECIFICATION Divided out of application no. 334323 filed 4 September 1997 HERPESVIRUS SAIMIRI AS VIRAL VECTOR We, THE UNIVERSITY OF LEEDS of Leeds LS2 9JT, England, do hereby declare the invention for which we pray that a patent may be granted to us, and the method by which it is to be performed, to be particularly described in and by the following statement. 1 168498 vl WGN * 2 HERPESVIRUS SAIMIRI AS VIRAL VECTOR This specification is a divisional of NZ patent specification 334323. This invention and the invention of NZ 334323 relate to a method of virus manipulation; means therefor and products thereof which have particular, but not exclusive, application in gene therapy.

Gene therapy of many diseases is now theoretically possible, as a result of recent advances in human genetics The primary goal is the conversion of cell phenotype from a diseased to a normal state, through the delivery of trans-dominant acting genetic material. The conversion of this technology from cell 5 culture systems to in vivo experimental models (and subsequently to the clinic) requires the development of new methods for efficient gene delivery in a controllable manner. It is becoming evident that whilst human genetics is moving at a rapid rate in the identification of disease-specific mutations, there is a relative lack of gene delivery system development. At present, there is a choice 10 of either liposome, DNA aggregate or virus-based systems.

Liposome delivery is still very inefficient in DNA transfer (1), DNA aggregates formed between virus particles and charged materials such as polylysine do enhance DNA uptake (2) but standardisation of preparations is very difficult. Retrovirus and adenovirus vectors both have constraints in the size of 15 heterologous DNA incorporated in the vector (3,4) and are unreliable in achieving long-term heterologous gene expression Retroviruses integrate into the host genome but are difficult to produce as high titre stocks and have an inherently high rate of mutation through errors introduced during reverse transcription. Despite their broad cell tropism, adenoviruses induce a cell-mediated immune 20 response and the nucleic acid is not stable long-term in infected cells (5).

Herpesviruses represent promising candidates for development as vectors, in part due to their ability to maintain their genome in cells in an episomal form which is blocked from replication Their capacity for packaging heterologous DNA sequences is potentially >50Kbp (6) and most are easy to manipulate in 25 vitro. Herpes simplex derived vectors are likely to have some of the same problems as adenoviruses, in that the majority of the population already have a well-developed immune response to the virus Other non-human herpesviruses 168502 vl WGN* 3 which are capable of infecting human cells, however, should not suffer this disadvantage.

Herpesvirus saimiri (HVS) is a lymphotropic rhadinowrus (v 2 herpesvirus) of squirrel monkeys (Saimiri sciureus). The virus may be routinely isolated from 5 peripheral lymphocytes of healthy monkeys and causes no apparent disease in the species. The virus genome may be detected in an episomal form in T cells and genome transcription appears limited to three genes in the non-lytic ("latent") state. The complete virus genome has been sequenced and shares many features in common with the human Epstein-Barr virus (EBV) The 10 genetic organisation consists of a single unique coding region of DNA, 112,930bp in length, flanked by a variable number of non-coding repeat sequences. There are 76 open reading frames, 60 of which have similarities with genes found in other herpesviruses (7) The remaining genes share sequence homology (at the level of protein) with human genes of known function, including complement 15 control proteins, cell surface antigen CD59, cyclin D and G protein-coupled receptors (8, 9) The virus has been divided into three distinct strains termed A, B and C based on their inability (A and B) or ability (C) to be oncogenic in certain other monkey species. C strains have the ability to transform human T cells to limited 20 independent growth in vitro (10). This ability to transform cells is due to a gene termed STP (11) which has marked variability in protein sequence between strains such that only STP from C strains is able to transform cells (12). STP is not important for the normal lytic cycle of the virus or episomal maintenance and natural deletion mutants for this region of the virus genome exist (13); these 25 strains are not oncogenic Virus strains which lack this gene have been constructed which express selectable drug resistant markers (14) These viruses have been used to demonstrate that they are capable of infecting a wide range of human cell types, transferring heterologous genes with high efficiency and maintaining long-term expression in the absence of selective pressure. There is 30 no evidence that this virus is able to produce any disease in man, although it is capable of infecting human cells. Thus it is likely that this virus represents a good starting point for the development of a non-replicating, safe vector for human cells. There is however a lack of basic understanding of how HVS replicates, particularly regarding transcriptional control and DNA replication. 168502 vl WGN* 4 Of all herpesviruses sequenced so far, HVS has the most homology with EBV However the coding region is significantly smaller. Distinct gene blocks appear to be closely related between these two viruses, and indeed the herpesviruses in general HVS differs from other herpesviruses due to the presence of certain 5 genes which have not been identified in any other herpesvirus to date. Every virus vector in human trials to date has been disabled either through the deletion of genes which are non-essential for growth in culture or the deletion of essential genes and their provision in trans from helper cell lines. Extrapolation from the well studied herpesviruses allows us to predict that deletion of certain 10 HVS membrane proteins will prevent cell-cell spread. Furthermore, the inactivation of proteins which control essential transcriptional switches, such as E1A in adenoviruses (17) and IE 175 in herpes simplex (18) will inevitably make such viruses replication incompetent. Thus, a major aim of this application is focussed on the construction of mutant viruses which are unable to activate 15 early and late gene expression. The target genes are the two transcriptional control proteins which are the products of ORF 50 and 57, and likely to be essential for growth in tissue culture Publish data (14) indicates that Strain 11/S4-derived viral vectors are only capable of limited growth in certain cell lines Thus the need to delete, block or 20 manipulate transcriptional control protein genes should only be necessary in cell lines that support viral replication. However, it may be desirable, in order to produce a virus for the purpose of gene delivery which one can use confidently, to produce a virus which is either unable to produce or which produces non functional transcriptional control proteins.

It is also another major aim of this application to identify genes which are non essential for growth and then delete at least a part of at least one of these genes in order to facilitate the insertion of heterologous genetic material into the viral genome.

There currently exists a plasmid designed for recombination with herpesvirus 30 saimiri which plasmid is designed to insert heterologous genetic material into the viral genome at a predetermined location, the location being the junction between the single unique coding region of DNA and a non-coding repeat sequence of herpesvirus DNA. However the plasmid is relatively inflexible in terms of what can be cloned into the viral genome. For example, there are few 168502 vl WGN* suitable restrictions sites and therefore the plasmid is not suitable for use commercially We have therefore aimed in this application to identify nonessential genes for growth with a view to deleting at least a part of at least one of said genes with a view to providing artificial cloning sites for the insertion of 5 large amounts of any selected heterologous genetic material. It will be apparent that the said deletion of non-essential genes and the subsequent insertion of heterologous genetic material will most advantageously be undertaken when large amounts of heterologous genetic material are to be inserted into the viral genome.

We aim in another aspect of our application to provide herpesvirus saimiri which has been manipulated so as to delete at least a part of at least one transcriptional control gene and, ideally, also at least a part of at least one gene that encodes a non-essential growth protein We favour this aspect because the greater the number of viral genome manipulations the greater the safety of the manipulated virus. In view of this fact we also favour manipulation of the herpesvirus saimiri genome to bring about deletion, partially or wholly, of the STP gene. We favour this latter manipulation even in the instance where Strains A or B are to be utilised because we consider such a manipulation to increase the likely safety of the resultant manipulated virus.

It will be apparent from the above that there is a need to provide a suitable gene delivery system to enable intra-cellular delivery of genetic material which delivery is undertaken safely and thus without any cytopathological consequences at least on the target cell.

It is therefore a first object of the invention to provide a gene delivery system which is safe and controllable, or at least to provide the public with a useful choice.

Furthermore, in view of the amount of genetic material likely to be delivered it is also an object of the invention to provide a gene delivery system which is adapted to accommodate large amounts of genetic material such as DNA sequences of 4Kbp and up to 20Kbp and, ideally, >50Kbp, or at least to provide the public with a useful choice. 168502 vl WGN * 6 It is a further object of the invention to provide a gene delivery system which allows selective recombination of at least a given gene, or part thereof, into same so as to deliver at least said selected gene, or part thereof, to a target cell, or at least to provide the public with a useful choice.

In its broadest aspect the invention concerns the provision of mutant viruses which are unable to activate early and late gene expression. In other words it concerns the provision of a virus which is unable to replicate in a target cell and more preferably in human cells and/or the provision of mutant viruses which are adapted to accommodate relatively large amounts of heterologous genetic 10 material.

According to a first aspect of the invention of NZ 334323 there is therefore provided a herpesvirus saimiri which has at least one functional mutation in a gene involved in virus replication whereby the functional mutation is such to prevent the virus replicating in a target human cell. The gene is either one or 15 both of the transcriptional control protein genes ORF 50 and/or ORF 57.

Preferably further still said mutation comprises partial or complete functional deletion of one or both of said genes In yet a further embodiment of the invention the said herpesvirus saimiri is a strain either lacking or having a functional mutation in the STP gene so that the 20 virus is unable to transform a target cell and so is unable to produce an oncogenic phenotype.

Preferably said virus is further manipulated so that at least a part of at least one gene encoding a non-essential growth protein is deleted. Ideally said gene is ORF4, ORF14, ORF15, ORF16 or ORF51.

In yet a still further preferred embodiment of the invention said virus is provided with a restriction enzyme insertion site into which selected heterologous material can be inserted. Preferably the virus is manipulated so that insertion occurs either within, adjacent, or remote from, a deletion site for the deletion of at least a part of a non-essential growth protein gene, or in or adjacent at least one non-30 coding repeat sequence and more preferably at the junction between the single unique coding region of DNA and a non-coding repeat sequence. More preferably 168502 vl WGN* 7 still, said virus is manipulated so that only one of said non-coding repeat sequences is present at one or both ends of the single unique coding region.

In the instance where insertion occurs within or adjacent said deletion site AND said deletion concerns either partial or whole deletion of one or more of the 5 following genes ORF4, ORF14, ORF15, ORF16 or ORF51.

According to one aspect of the present invention there is provided a herpesvirus saimiri which has at least one functional mutation in at least one gene encoding a non-essential growth protein. The gene is either one or more of ORF4, ORF14, ORF15, ORF 16 or ORF51.

Preferably further still said mutation comprises partial or complete deletion of one or more of said genes.

In yet a further preferred embodiment of the invention the said herpesvirus saimiri is a strain either lacking or having a functional mutation in the STP gene such that the virus is unable to transform a target cell and so is unable to 15 produce an oncogenic phenotype.

Preferably said virus is further manipulated so that at least a part of at least one gene involved in virus replication is deleted. Ideally said gene is ORF50 and/ or ORF 57 In yet a further preferred embodiment of the invention said virus is provided with 20 a restriction enzyme insertion site into which selected heterologous material can be inserted. Preferably the insertion site is within, adjacent, or remote from, the site of said deletion of one or more of said genes In another preferred embodiment the herpesvirus saimiri comprises at least one preselected heterologous DNA fragment adjacent a deletion site, which deletion 25 site represents a functional site for partial or whole deletion of at least one gene encoding a non-essential protein In a preferred embodiment of the invention said virus is also provided with a mutation in a gene involved in viral replication so as to prevent viral replication following insertion of said virus into a target cell. 168502 vl WGN * 8 More preferably said virus is a strain either lacking or having a functional mutation in the STP gene such that the virus is unable to transform a target cell and so is unable to produce an oncogenic phenotype.

In one embodiment of the invention the herpesvirus saimiri has at least one 5 preselected heterologous DNA fragment at the junction of a single coding region and a non-coding region; and wherein said virus comprises a reduced number of repetitive non-coding sequences compared with wild type virus, at one or both ends of the single coding region, and the virus also comprises at least one functional mutation in at least one gene encoding a protein involved in viral 10 replication, so as to prevent viral replication following insertion of said virus into a target cell.

Preferably said number of non-coding repeat sequences is 5 or less and ideally one.

Also described herein is a transfer vector which enables insertion of a 15 heterologous genetic fragment into herpes saimiri virus DNA.

Preferably said insertion involves any one or more of the afore described methods of insertion. In a preferred embodiment said vector includes a plurality of unique restriction sites and more preferably three unique restriction sites. In addition, said vector includes a beta-galactosidase gene which is preferably 20 under the control of the HCMV IE 3 promoter. More preferably the said vector is derived from pRUNeo (16) and ideally is prupoly.

It will be apparent from the above that the preferred virus of the invention comprises a number of advantageous combinations of genetic mutations which combinations serve to disable and enable the virus so as to make it safe and 25 controllable. By the term disable we mean the prevention of viral replication in a target cell and by the term enable we mean the capacity to accommodate the insertion of a relatively large amount of heterologous genetic material. More desirably still, said advantageous combination also provides for a virus unable to transform a target cell and so unable to produce an oncogenic phenotype. 168502 vl WGN* ,503452 9 Also described herein is a target cell including at least a part of the herpesvirus saimiri gene therapy vector According to a yet further aspect of the invention there is provided a cell transformed with a herpesvirus saimiri vector as afore described.

Also described herein is a method of delivering selected heterologous genetic material to a target cell comprising exposing at least said target cell to a herpesvirus saimiri which includes at least said preselected heterologous material under conditions which favour infection of said cell with said virus In yet a further aspect the present invention also provides the use, in the manufacture of a medicament for delivering selected heterologous DNA to a target cell, of a herpesvirus saimiri of the invention which includes pre-selected heterologous DNA. An embodiment of the invention will now be described by way of example only with reference to the following materials and methods.

Isolation and Characterisation Of Viral Mutants The manipulated virus is a modified from of strain 11, which does not contain ORF1 (STP gene). Although we would normally have chosen a "wild-type" strain, vectors will inevitably have to be based on a virus which has had this gene removed. The modified strain may have essential genes deleted and therefore Helper Cell Lines may be produced (detailed later). These were established through co-transfection with a suitable HVS genomic clone plus pSV2Neo, and cell clones isolated which are G418 resistant. These cell clones were first screened by PCR for the presence of the appropriate gene sequences and those testing positive were analysed by RT-PCR for the presence of RNA transcripts of the gene provided in trans. Appropriate clones were expanded and used for co-transfection with virus DNA and deletion construct. Viruses which express (J-galactosidase (as measured by the metabolism of X-gal) were tested for their ability to replicate in helper cells and normal Vero cells, and subsequently in human cell types of differing lineages. Published data indicates that strain II-derived vectors are capable of limited growth in certain cell-lines of B cell (Raji) and human foetal fibroblast (HFF) origin. Raji cells (EBV transformed) are not representative of normal human cells, therefore we assessed the growth characteristics of these viruses in lymphoid cells isolated from fresh adult human peripheral blood taken from healthy volunteers and primary human embryo fibroblasts and epithelial cells which are available from commercial sources. Replication was assessed through expression of (i-galactosidase 168502 vl WGN * (evidence of infection and cell-cell spread), presence of episomal DNA, and expression of "typical" early and late genes detected by RT-PCR. Genome persistence in these cells was assessed through measuring the percentage of cells capable of expressing the reporter gene through several cell generations in 5 conjunction with assaying for the presence of episomal virus DNA (19).

Production of Recombinant Viruses with Deleted Genes Extracellular, cell-released virus was harvested by centrifugation at 30,000g for 2h at 4°C The semi-purified virus pellet was resuspended in lOmM Tris/HCl, 10 ImM EDTA (TE) pH 8.0 SDS was added to 1% w:v and Proteinase K added at 100 pg/ml. The sample was incubated at 50°C for 16 hours and then treated with 50:50 (w v) phenol/chloroform mix (5 extractions). The aqueous phase was removed, adjusted to 0 2M with sodium acetate pH 5.0 and 3 volumes of absolute ethanol added. The DNA precipitate was spooled from the tube, air 15 dried and then redissolved in an appropriate volume of TE buffer. DNA concentration was measured by the absorbance of the sample at 254 nm in a spectrophotometer. Purified virus DNA was cotransfected into OMK (ATCC CRL1556) cells with the respective plasmid construct using DOTAP reagent. After 24 hours the culture medium was removed and replaced with medium 20 containing 2% heat inactivated FCS. The cell monolayers were then observed until the development of an extensive cytopathic effect was apparent. At this stage, cell-released virus was harvested and used to infect new subconfluent monolayers of OMK cells. These were overlaid after 24 hours with a 1% agar overlay in phenol red-free DMEM/2% heat inactivated FCS. After 48 hours, X-25 gal was added to a final concentration of 100ng/ml, in order to identify virus plaques which were expressing beta galactosidase. Blue plaques were then picked and were subjected to two further rounds of plaque purification, or until the virus population was homogenous These viruses were then tested for the correct homologous recombination events using PCR and Southern blotting.

Production of Recombinant Viruses which Contain Heterologous Genes Purified virus DNA, prepared as described above, was co-transfected into OMK cells with plasmid vectors (pJG 101-105 and/or pAW 201, 202, 203, 205, 207 or 168502 vl WGN* 11 209) which contain the appropriate heterologous gene replacing the beta-galactosidase sequence for recombination into either non-essential or essential genes, or intergenic regions. Recombinant virus which no longer expresses beta galactosidase was selected and plaque purified in the same manner as that 5 described in the previous section.

Infection of Cells in vitro with HVS High titre virus stocks were produced by low multiplicity of infection of either OMK or Vero cells. Cell-released virus was titrated in either OMK or Vero cells and stored at -70°C. The amount of virus required to infect any specific cell type 10 at 100% efficiency was assessed by infection of a defined number of cells at various multiplicities of infection with a beta-galactosidase expressing virus. Adherent cells were infected by the addition of virus in a minimum volume of culture medium and incubated at 37°C for 2 hours with gentle agitation. This medium was then removed and replaced with an appropriate quantity of fresh 15 medium Non-adherent cells were harvested, counted and between 106 and 107 cells resuspended per 1ml of virus at an appropriate concentration to achieve 100% infection efficiency. After 2 hours incubation with gentle agitation the cells were treated in the same manner as described for adherent cells Production of Helper Cell Lines The virus genes which were to be expressed in a stable cell line, in trans, were cloned in a suitable plasmid vector under control of their own, or heterologous 5' and 3' control sequences This plasmid may also contain a selectable marker, eg the neomycin phosphotransferase gene which confers resistance of eukaryotic 25 cells to the drug G418. Alternatively this gene may be provided on a separate plasmid, again under the control of heterologous eukaryotic control sequences, for instance the SV40 early promoter and appropriate polyadenylation signals In all cases, cell lines were established thus. 5xl05 cells (or sufficient to give 40-50% confluence) such as Vero or OMK were plated out onto 10 cm diameter 30 tissue culture dishes in 10ml of DMEM/10% foetal calf serum and incubated for 12-18h at 37°C in an humidified atmosphere containing 5% CO2 in air. After this period 2]\g plasmid was transfected into the cells using DOTAP reagent as described previously for transfection of virus DNA. This may be either a single 168502 vl WGN* 12 plasmid which contains the appropriate gene and the selectable marker gene, or a mixture of 2jag of each plasmid. Cells were then incubated at 37°C in a humidified atmosphere containing 5% CO2 in air for a further 48 hours. At this stage, the now confluent monolayers were detached from the plastic dish 5 through removal of the medium, washing the 2x1 Oml of phosphate buffered saline (PBS, Life Technologies inc, cat no. 20012) and treatment with 2ml trypsin (0 25% w:v)/EDTA(0.2% w.v) solution in PBS. Fresh medium was then added to the cell suspension, the cells counted and then plated out into 96 well plates for cloning at limiting dilution or dispensed at 104 cells per 10cm dish The culture 10 medium (DMEM/ 10%FCS) was supplemented with an appropriate concentration of G418 which is sufficient to cause 100% kill of non-transfected cells. The concentration is dependent both on cell passage number and cell type. A typical concentration for Vero cells at passage 150 is 800pg/ml. Cells were then replaced in the previously described growth environment and observed at regular 15 intervals for cell killing. Culture medium was replaced approximately every 3-4 days depending on cell death/growth rate. After 7-14 days individual clones of cells have grown and were then picked, grown to appropriate numbers and tested for the expression of the HVS gene transfected. This can either be achieved through use of either immunofluoresence, Northern Blotting or RT-PCR 20 using methods well known to the art Assessing Virus Safety The ability of the modified virus to replicate was assessed by measurement of virus gene expression using RT-PCR for a selection of immediate-early, early and late genes. Additionally, tissue culture supernatants from transduced cells were 25 incubated with indicator OMK cells, to detect any possible infectious virus release. 3 Insertion Recombination Vector This strategy produces a recombination vector to allow insertion of heterologous genes at the 3' end of the HVS L DNA. pSJNeo (from R. Grassman) contains 30 9.4kb of HVS DNA which contains the H-L DNA junction. A Smal cleavage site located 35bp within the first H repeat unit was changed to a Sail site to allow insertion of the neo gene. This vector, however, is a large, low copy vector and is therefore unsuitable for insertion of large heterologous genes. An expression 168502 vl WGN* 13 vector, pSA91, was chosen to make the new recombination vector. This vector is produced at high copy number and contains the hCMV IE promoter to drive gene expression. To produce an efficient expression vector that allows recombination, the HVS DNA sequence was excised from pSIneo and inserted into a unique Narl 5 site located 5' to the promoter, using linker adapters. This vector is designated pJGlOl.

QRF06 Deletion ORFO6 (located between bp 12584 and 15967) encodes the major DNA binding protein, thus deletion of this gene makes the virus replication deficient To make 10 a recombination cassette for deletion of ORFO6 flanking DNA regions were excised from pSS54 which contains the region of HVS DNA from 11507 to 18013 (the KpnlF fragment). The Kpnl (11507)-Haell (12613) 1106 bp fragment 5' to the ORFO6 coding region and the SphI (15258)-BglIII (16407) 1149 bp fragment were excised and ligated together via synthetic oligomers. The oligomers also contain 15 EcoRI and BamHI restriction sites, as shown below, to allow insertion of heterologous genes. It is necessary to maintain part of the 3' end of ORFO6 as this contains the promoter for ORF07. The ligated KpnI-Bglll fragment was inserted into the pBluescript KS cloning vector to create the recombination cassette pJG102.

Sequence of oligomers to link the fragments- TGAATTCGGATCCGCATG CGCGACTTAAGCCTAGGC Haelll EcoRI BamHI SphI QRF06 Construction to Generate Helper Cell Line To produce HVS deleted for the ORFO6 coding region, it is necessary to provide the ORFO6 gene product in trans. This was achieved by producing a stable helper cell line. The ORFO6 gene was excised from pSS54 as a Haell (12613)-PstI (15998) fragment. Synthetic oligomers (as shown below) were used to precisely 30 create the start of the coding region of ORFO6 and to allow insertion into the expression vector pSVK3 (Pharmacia). Following ligation of the synthetic oligomers to the 5' end of the ORFO6, the EcoRl-Psl fragment was ligated to pSVK3 to create pJG103. This drives expression from the SV40 early promoter, 168502 vl WGN * 14 use of an alternative promoter minimises recombination events in the helper cell line.

Oligomer sequences- AATTCATGGCAACGAAGACAGCGCAACCTAGCGC 5 GTACCGTTGCTTCTGTCGCGTTGGAT EcoRI ORFO6 Start Haell ORF51 Deletion ORF51 encodes the potential receptor binding membrane protein of HVS, therefore deletion of this gene renders the virus non-infectious. ORF51 is 10 located between 72626 and 73432 of the HVS genome. To produce ORF51 flanking sequences for the recombination cassette, the BamHI (71692)-HpaI (72602) 910bp fragment 5' to the ORF51 coding region and the Bst 11071 (73395)-PstI(73998) 601 bp fragment 3' to ORF51 were excised from pKK104 which contains the HVS EcoRI D fragment from 63020 to 77574, and ligated 15 together via synthetic oligomers These oligomers also contain EcoRI and BamHI restriction sites to enable insertion of heterologous genes and in addition the sequence required to maintain the polyA for ORF52. Following ligation the BamHI-PstI fragment was ligated to the cloning vector pSP73 (Promega) to create the recombination cassette pJG104.

Synthetic oligomer sequences- AACGAATTCGGATCCTTAATAATAATGAGCTGTA TTGCTTAAGCCTAGGAATTATTATTACTCGACAT Hpal EcoRI BamHI ORF52 polyA Bst 11071 ORF51 Construction to Generate Helper Cell Line The ORF51 gene was excised from pKK104 as a Hpal (72602)-StuI (73495) 806bp fragment and cloned into the SV40 expression vector pSVK3. EcoRI linkers were ligated to the 5' and 3' ends of ORF51 to facilitate this cloning reaction. The resulting ORF51 expression vector was designated pJG105.

ORF 57 Deletion 168502 vl WGN* Orf 57 encodes a transcription activator with homology to HSV-1 UL54, an essential immediate early gene. To generate a virus containing a complete deletion of ORF 57, regions adjacent to the coding region of ORF57 were amplified to allow homologous recombination with viral DNA. Primers have been 5 designed; 5'-d GGC GAA TTC GTC TAT AAC TGA CTG GGT TGC TG, 5'-d GCC CTG CAG GCA GTT ACT CAC CAT AGC TTG AG, 5'-d GCC CTG CAG CAA GTG TCC AAG CTC TAC TTG TGC, 5'-d GGG GCA TCC CTA TTG ATG TGC CAA GCA ATA GGG T, these amplify two regions of HVS respectively; 77850 to 78260 and 79530 to 80120, suitable restriction sites have been incorporated into the 10 primers to assist in cloning. A triple ligation was performed using these fragments and pUC18, previously digested with EcoRI and SphI, to derive pAWlOl. This plasmid was then linearised using PstI and Sail and ligated with the lacZ gene under the control of the hCMV IE promoter, to generate PdeltaORF57 which has been deposited with the National Collection of Industrial 15 and Marine Bacteria Ltd (NCIMB), 23 St Machan Drive, Aberdeen, AB2 1RY; Deposition Number 40894 To generate a helper cell line, a fragment containing the coding region of ORF57 was amplified using PCR, and ligated with a T vector, pCRII, to derive pAW103 This was then cloned into the plasmid pBKCMV to generate ORF57 under the 20 control of the HCMV IE promoter PBKCMVORF57 which has been depositied with the NCIMB, as above, Deposition Number 40895.

HVS Insertional Inactivation Constructs Insertional inactivation is a less preferred method of preventing a gene from functioning, as it relies upon the placing of the indicator (i-galactosidase gene 25 within the coding sequence of the appropriate gene, without removal of any part of the open reading frame. There is a risk of recombination events occurring which lead to deletion of the p-gal sequence and no ligation of the open reading frame enabling reactivating of the gene.

To generate an insertionally inactivated gene, a transfer vector was constructed 30 which inactivated each respective gene by inserting the lac Z gene under the control of a I.E. CMV promoter into the 5' coding region of the ORF. This inactivated gene was then inserted into the viral genome by cotransfection of the 168502 vl WGN * 16 plasmid and HVS viral DNA to derive a recombinant virus, which will then be plaque purified.

Plasmid Constructions ORF 4/COMPLEMENT CONTROL PROTEIN pJC81-KpnB was digested with Bglll and PstI to generate 1152 bp fragment containing the coding region of ORF4 This fragment was ligated to pUC18, to derive pUCORF4. This plasmid was linearised using Bglll, blunt ended using T4 DNA polymerase, and ligated with a blunt ended fragment containing the lacZ gene under the control of an IE CMV promoter, to generate pAW201.

ORF 14/SMALL IE GENE pACYC184-EcoF was digested with EcoRI and PstI to generate 3189 bp fragment containing the coding region of ORF 14 This fragment was ligated to pUC18, to derive pUCORF14. This plasmid was linearised using Kpnl, blunt ended using T4 DNA polymerase, and ligated with a blunt ended fragment containing the lacZ 15 gene under the control of an IE CMV promoter, to generate pAW202.

ORF 15/CD59 HOMOLOGUE pACYC184-EcoF was digested with SstI and PstI to generate 2415 bp fragment containing the coding region of ORF 15. This fragment was ligated to pUC18, to derive pUCORF15. This plasmid was linearised using Muni, blunt ended using 20 T4 DNA polymerase, and ligated with a blunt ended fragment containing the lacZ gene under the control of an IE CMV promoter, to generate pAW203 ORF 50 /MAJOR TRANSCRIPTIONAL ACTIVATOR pACYC184-EcoD was digested with Bglll and PstI to generate 4149 bp fragment containing the coding region of ORF 50. This fragment was ligated to pUC18, to 25 derive pAW204. This plasmid was digested with PstI and ligated with a DNA fragment containing the lacZ gene under the control of an IE CMV promoter, to generate PdeltaORF50 which has been deposited with the NCIMB, as above, Deposition Number 40892 A helper cell line was constructed using PUCPST 168502 vl WGN* 17 deposited with the NCIMB, as above, Deposition Number 40893 which is pUC18 containing a PstI fragment of HVS DNA encompassing both exons of the gene.

ORF 57/IE GENE pACYC184-EcoJ was linearised using Bglll, blunt ended using T4 DNA 5 polymerase, and ligated with a blunt ended fragment containing the lacZ gene under the control of an IE CMV promoter, to generate pAW206.

In order to construct a helper cell line, the coding sequence of ORF 57 was amplified using PCR using the following primers: 5'-d CGC GGT ACC CAC ATG TCT ATA ATC GAC TGG GTT, 5'-d CGG GGT ACC CTG AGT CAT TAG TAG TAG 10 CTC ATG. This PCR fragment was ligated to a TA cloning vector pCRII and designated pAW207 ORF 16 /APOPTOSIS SUPPRESSOR Due to a lack of convenient restriction sites the coding region was amplified using PCR, incorporating a PstI site in the 5' coding region, to allow subsequent 15 cloning, using the following primers; 5'-d GCC GAA TCC CAC AGT GCC AAG CTT GCC AGT T, 5'-d CGC CTG CAG GGT GTA TAA CTG AGT GTT ACA GC, 5'-d GGG CTG CAG GCT GTA CAC TCA GTT ATA CAC C, 5'd -CCC GCA TGC ACT TGA TCC AGG ACA TGC TTC. This PCR product was ligated with pUC18 to derive pAW208. This plasmid was linearised using PstI and ligated with the lacZ gene 20 under the control of an IE CMV promoter, to generate pAW2-09. A helper cell was constructed using pAW208. 168502 vl WGN* 18 REFERENCES 1 Ledley, F. D. (1994) Non-viral gene therapy Curr Opinion Biotech 5, 626-636. 2 Wagner, E., Cotten, M., Foisner, R., and Birnsteil, M., (1991) Transferrin-polycation complexes: the effect of polycations on the structure of the complex and DNA delivery to cells. Proc Natl Acad Sci. USA 88:4255-4259. 3 Rich, D.P., Couture, L.A., Cardoza, L M. Guiggio, V. M., Armentano, D., Espino, P. C., Hehir, K., Welsh, M. J., Smith, A. E and Gregory, R. J. (1993) Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis. Hum. Gene Ther. 4 461-476. 4 Gordon, E. M. and Anderson, W. F. (1994) Gene therapy using retroviral vectors. Curr Opinion Biotech. 5.611-616.

Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C., Mastrangeli, A , Hay, J. G , Brody, S. L., Jaffe, H A., Eissa, N. T. and Danel, C. (1994) Administration of ail adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis Nature Genet. 8:42-51. 6 Locker, H. and Frenkel, N. (1979) Structure and origin of defective genomes contained in serially passaged herpes simplex virus type 1 (Justin) J. Virol. 29:1065-1077. 7 Davison, A. J. (1993) Herpesvirus genes Rev. Med Virol. 3:237-24 8 Albrecht, J-C., Nicholas, J., Biller, D., Cameron, K. R., Biesinger, B., Newman, C., Wittmann, S., Craxton, M. A., Coleman, H., Fleckenstein, B. and Honess, R. W. (1992) Primary structure of the Herpesvirus saimiri genome. J. Virol. 66:5047-5048. 9 Jung, J. U , Stager, M , and Desrosiers, R. C (1994) Virus-encoded cyclin Mol. Cell Biol. 14:7235-7244. 168502 vl WGN* 19 Biesinger, B , Muller-Fleckenstein, I., Simmer, B., Lang, G , Wittmann, S., Platzer, E., Desrosiers, R. C. and Fleckenstein, B (1992) Stable growth transformation of human T lymphocytes by herpesvirus saimiri. Proc. Natl. Acad. Sci. USA 89:3116-3119. 11 Murthy, S. C. S., Trimble, J. J, and Desrosiers, R. C. (1989) Deletion mutants of herpesvirus saimiri define an open reading frame necessary for transformation. J. Virol 63-3307-3314. 12 Grassmann, R., Fleckenstein B. and Desrosiers, R. C. (1994) Viral transformation of human T lymphocytes. Adv. Cancer Res. 63 211-244 13 Desroisers, R. C., Burghoff, R. L Bakker, A. and Kamine, J. (1984) Construction of replication-competent herpesvirus saimiri deletion mutants J. Virol 49:343-348. 14 Simmer, B., Alt, M., Buckreus, I , Berthold, S., Fleckenstein, B., Platzer, E. and Grassmann, R. (1991) Persistence of selectable herpesvirus saimiri in various human haemopoietic and epithelial cell lines J. Gen Virol 72:1953-1958.

Chang, Y , Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J , Knowles, D. M. and Moore, P S. (1994) Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1871. 16 Grassmann, R. and Fleckenstein, B. (1989) Selectable recombinant herpesvirus saimiri is capable of persisting in a human T-cell line. J Virol 63-1818-1821. 17. Berkner, K. L. (1988) Development of Adenovirus vectors for the expression of heterologous genes. BioTechniques, 6, 616-629. 18. Glorioso, J., Goins, W. F , and Fink, D J. (1992) Herpes simplex virus-based vectors Semin. Virol. 3:265-276. 19. Gardella, T., Medveczky, P , Sairenji, T. and Mulder, C. (1984) Detection of circular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis. J Virol. 50' 248-254 168502 vl WGN * 2°50 ^ 5 c.

Claims (9)

WHAT WE CLAIM IS.

1 A herpesvirus saimiri having at least one functional mutation in at least one gene wherein said gene is at least one of the following genes, ORF4, ORF 14, ORF15, ORF 16 or ORF51.

2. A herpesvirus saimiri according to Claim 1 wherein said functional mutation is a complete or partial deletion of said gene

3. A herpesvirus saimiri according to either preceding claim wherein said virus further has a functional mutation in a transforming gene.

4. A herpesvirus saimiri according to Claim 3 wherein the transforming gene is a STP gene

5. A herpesvirus saimiri according to any preceding claim wherein said virus is provided with a restriction enzyme insertion site for the insertion of heterologous genetic material.

6. A herpesvirus saimiri according to Claim 5 wherein said restriction enzyme insertion site is located within or adjacent at least one non-coding repeat sequence, i.e. at the junction between a unique coding region and a non-coding sequence.

7. A herpesvirus saimiri according to Claim 5 or 6,, wherein said virus is further manipulated whereby at least part of the gene encoding ORF 50 and/or ORF 57 is functionally mutated and/or deleted, and wherein said restriction enzyme insertion site is provided at the site of said complete or partial functional deletion.

8. A herpesvirus saimiri according to Claim 7 wherein a restriction enzyme insertion site is provided in, or adjacent ORF 50 and/or ORF 57. 168502 vl WGN *;intellectual property office of n.z.;- 5 JUN 2001 received;21;50, V ^;v ^ &if ii;9 A herpesvirus saimiri according to any preceding claim having therein at least one pre-selected heterologous DNA fragment at the junction of a single coding region and a non-coding region, and further wherein said virus comprises a reduced number of repetitive non-coding sequences compared with wild type virus, at one or both ends of the single coding region; and the virus also comprises at least one functional mutation in at least one gene encoding a protein involved in viral replication.;10. A herpesvirus saimiri according to Claim 9 wherein the number of said non-coding repetitive sequence is about 5-1.;11. A herpesvirus saimiri according to Claim 1 having at least one functional mutation in a gene encoding a protein involved in viral replication and a further functional mutation in a gene encoding a non-essential protein.;12. A herpesvirus saimiri according to Claim 11 wherein said virus further has a functioned mutation in a transforming gene.;13. A herpesvirus saimiri according to Claim 12 wherein the transforming gene is a STP gene.;14. A herpesvirus saimiri according to any preceding claim wherein said virus is provided with a restriction enzyme insertion site in to which heterologous DNA can be inserted.;15 A herpesvirus saimiri according to Claim 1 comprising at least one preselected heterologous DNA fragment positioned adjacent to a deletion site, which site represents a functional site for partial or whole deletion of at least one gene encoding a non-essential protein and which virus is additionally functionally mutated or deleted for a gene encoding a protein required for viral replication.;16. A herpesvirus saimiri according to Claim 15 wherein said virus further has a functional mutation in a transforming gene., such as a STP gene.;17. A herpesvirus saimiri according to Claim 16 wherein the transforming gene is a STP gene.;168502 vl WGN •;- 5 JUN 200);Received;18. A herpesvirus saimiri according to any preceding claim for use as a pharmaceutical.;1

9. A herpesvirus saimiri as defined in any one of the preceding claims substantially as herein described with reference to any example thereof.;20. The use, in the manufacture of a medicament for delivering selected heterologous DNA to a target cell, of a herpesvirus saimiri according to any one of claims 5 to 10 which includes at least the pre-selected heterologous DNA.;21. A cell transformed with a herpesvirus saimiri vector according to any one of claims 1 to 19.;END OF CLAIMS;intellectual property office of nz.;- 5 JUN 2001 received;168502 vl WGN * > END