MXPA99002122A - Herpesvirus saimiri as viral vector - Google Patents

Abstract

The invention relates to a means to a herpesvirus saimiri that has been genetically modified by mutating and/or deleting specific essential and non-essential genes. The essential genes are required in replication of viral genes and are needed for viral proliferation. The non-essential genes can represent sites for the insertion of heterologous genetic material, namely therapeutic genes.

Description

VIRUS OF HERPES SAIMIRÍ AS VECTOR VECTOR DESCRIPTIVE MEMORY The present invention relates to a method for handling viruses; means for the same and products thereof that have particular, but not exclusive, application in gene therapy. The gene therapy of many diseases is theoretically possible today, as a result of recent advances in human genetics. The main objective is the conversion of the cellular phenotype from a diseased state to a normal state, through the release of genetic material with transdominant action. The conversion of this technology from cell culture systems to experimental models in vivo (and subsequently to the clinic), requires the development of new methods for the efficient release of the gene in a controllable manner. It is now evident that while human genetics is moving at a rapid rate in the identification of disease-specific mutations, there is a relative lack of development of the gene's release system. Currently, there is the choice of systems based on liposomes, DNA aggregates or viruses. The release of liposomes is still very inefficient in the transfer of DNA (1), the aggregates of DNA formed between viral particles and charged materials such as polylysine, increase the uptake of DNA (2), but the standardization of preparations is very difficult . The retrovirus and adenovirus vectors have restrictions on the size of heterologous DNA incorporated in the vector (3,4) and are not reliable for long-term heterologous gene expression. Retroviruses are integrated into the host genome, but are difficult to produce as high-titre supply materials, and have an inherently high rate of mutation through errors introduced during reverse transcription. Despite their broad cellular tropism, adenoviruses induce a cell-mediated immune response, so that nucleic acid is not stable in infected cells in the long term (5). Herpes viruses represent promising candidates for their development as vectors, due in part to their ability to maintain their genome in cells in episomal form which is blocked from replication. Your ability to pack heterologous DNA sequences is potentially > 50Kbp (6), and are easier to handle in vitro. It is likely that vectors derived from herpes simplex have some of the same problems as adenoviruses, since most of the population already has a well-developed immune response to the virus. However, other non-human herpes viruses that are capable of infecting human cells should not suffer this disadvantage. Herpes saimiri virus (HVS) is a lymphotropic radinovirus (herpes gamma 2 virus) of squirrel monkeys (Saimiri sciureus). The virus can usually be isolated from peripheral lymphocytes of healthy monkeys, and does not cause disease apparent in the species. The genome of the virus can be detected in episomal form in T cells, and the transcription of the genome seems to be limited to three non-lytic genes ("latent"). The complete genome sequence of the virus has been determined, which shares many characteristics in common with the human Epstein-Barr virus (EBV). The genetic organization consists of a single unique coding region of DNA of 112,930 bp in length, flanked by a variable number of non-coding repeat sequences. There are 76 open reading frames, 60 of which have similarities with genes present in other herpes viruses (7). The remaining genes share sequence homology (at the protein level) with human genes of known function, including complement control proteins, CD59 cell surface antigen, cyclin D and G protein-coupled receptors (8,9). The virus has been divided into three different strains called A, B and C based on their inability (A and B) or ability (C) to be oncogenic in certain other species of monkeys. C strains have the ability to transform human T cells for limited independent growth in vitro (10). This ability to transform cells is due to a gene called STP (11), which has remarkable variability in the sequence of proteins between strains, so that only STP of strains C is capable of transforming cells (12). The STP gene is not important for the normal lytic cycle of the virus or episomal maintenance, and there are natural deletion mutants for this region of the virus genome (13); these strains are not oncogenic. Viral strains lacking this gene have been constructed that express selectable markers for drug resistance (14). These viruses have been used to demonstrate that they are capable of infecting a broad range of human cell types, transferring heterologous genes with high efficiency and maintaining long-term expression in the absence of selective pressure pressure. There is no evidence that this virus is capable of producing any disease in man, although it is capable of infecting human cells, so it is likely that this virus represents a good starting point for the development of a safe non-replicating vector. For human cells, however, there is a lack of basic knowledge of how HVS replicates, particularly with respect to the control of transcription and DNA replication of all the herpes viruses whose sequence has been determined so far, HVS has the highest homology with EBV, however, the coding region is significantly smaller, different gene blocks seem to be closely related between these two viruses, and also herpes viruses in general.HVS differs from other herpes viruses due to the presence of certain genes which to date have not been identified in other herpes viruses. to date it has been disabled by the suppression of genes which are not essential for the growth in culture, or the suppression of essential genes and their provision in the trans position from auxiliary cell lines. The extrapolation of well-studied herpes viruses allows predicting that the suppression of certain HVS membrane proteins will prevent cell-to-cell diffusion. In addition, the inactivation of proteins that control switches essential for transcription, such as EIA in adenovirus (17) and IE 175 in herpes simplex (18), will inevitably make the replication of said viruses incompetent. Thus, an important objective of this application is focused on the construction of mutant viruses that are incapable of activating early and late gene expression. The target genes are the two transcription control proteins that are the products of ORF 50 and 57, and which are probably essential for growth in tissue culture. The published data (14) indicate that viral vectors derived from strain 11 / S4 are only able to show limited growth in certain cell lines. Thus, the need to suppress, block or manipulate genes for protein for the control of transcription should only be necessary in cell lines that support viral replication. However, it may be desirable, to produce a virus for the purpose of releasing genes that can be used confidentially, to produce a virus that is unable to produce, or produce, non-functional proteins for the control of transcription. It is also another important objective of this application to identify genes that are not essential for growth, and then to suppress at least a part of at least one of those genes to facilitate the insertion of heterologous genetic material into the viral genome. There is presently a plasmid designed for recombination with herpes saimiri virus, whose plasmid is designed to insert heterologous genetic material into the viral genome at a predetermined site, the site being the junction between the single coding region of individual DNA and a repeat sequence not coding for the DNA of the herpes virus. However, the plasmid is relatively inflexible in terms of what can be cloned in the viral genome. For example, there are a few suitable restriction sites and, therefore, the plasmid is not suitable for commercial use. Therefore, it has been sought in this application to identify genes essential for growth for the purpose of suppressing at least a portion of at least one of said genes for the purpose of providing artificial cloning sites for the insertion of large amounts of any heterologous genetic material selected. It will be evident that such suppression of non-essential genes, and the subsequent insertion of heterologous genetic material, will be carried out more advantageously, when large quantities of heterologous genetic material are inserted into the viral genome. In another aspect of the present application, it is intended to provide herpes saimiri viruses that have been manipulated in order to suppress at least a part of at least one gene for the control of transcription, and ideally, also at least a part of at least one gene that codes for a protein not essential for growth. It is in favor of this aspect, because the greater the number of manipulations of the viral genome, the greater the security of the manipulated virus. In view of this fact, one is also in favor of the manipulation of the genome of the herpes saimiri virus, to produce the suppression, partial or total, of the STP gene. It is in favor of this last manipulation, even in the case where strains A or B will be used, because it is considered that such manipulation increases the safe probability of the resulting manipulated virus. It will be evident from the foregoing that there is a need to provide a suitable gene delivery system to allow the intracellular release of genetic material, whose release is carried out safely and thus without cytopathological consequences, at least on the target cell. Therefore, a first objective of the invention is to provide a gene delivery system that is safe and controllable. In addition, in view of the amount of genetic material that will likely be released, it is also an objective of the invention to provide a gene delivery system that is adapted to accommodate large amounts of genetic material, such as DNA sequences of 4 Kpb and up to 20 Kpb and ideally, more than 50 Kpb. A further object of the invention is to provide a gene delivery system that allows the selective recombination of at least one given gene, or part thereof, therein to release at least said selected gene, or part thereof, towards a target cell. In its broadest aspect, the invention relates to the provision of mutant viruses that are incapable of activating early and late gene expression. In other words, it refers to the provision of a virus that is unable to replicate in a target cell, and more preferably in human cells, and / or the provision of mutant viruses that are adapted to accommodate relatively large amounts of heterologous genetic material. According to a first aspect of the invention, therefore, a herpes saimiri virus is provided which has at least one mutation in a gene involved in the replication of the virus, whereby the mutation is such that it prevents the replication of the virus in a target human cell.

In a preferred embodiment of the invention, said gene is any of the genes for protein for the control of transcription, ORF 50 and / or ORF 57, or both. Even more preferably, said mutation comprises the partial or complete deletion of one or both of said genes. In a further embodiment of the invention, said herpes saimiri virus is a strain that lacks or has a mutation in the STP gene, so that the virus is unable to transform a target cell, and is thus unable to produce an oncogenic phenotype . Preferably, said virus is further manipulated, so that at least a part of at least one gene encoding a protein not essential for growth is deleted. Ideally, said gene is ORF4, 0RF14, 0RF15, ORF16 or 0RF51. In an even more preferred embodiment of the invention, said virus is provided with an insertion site into which selected heterologous material can be inserted. Preferably, the virus is engineered so that the insertion occurs within, adjacent to, or away from, a deletion site for the deletion of at least a portion of a gene for protein not essential for growth; or in, or adjacent to, at least one non-coding repeat sequence, and more preferably at the junction between the individual single coding region of DNA and a non-coding repeat sequence. More preferably still, said virus is manipulated so that only one of said non-coding repeat sequences is present at one or both ends of the single unique coding region. In the case where the insertion occurs within, or adjacent to, said deletion site AND, said deletion refers to the partial or total deletion of one or more of the following genes: 0RF4, ORF14, 0RF15, ORF16 or 0RF51. According to a further aspect of the invention, there is provided a herpes saimiri virus having at least one mutation in at least one gene coding for a protein not essential for growth. In a preferred embodiment of the invention, said gene is one or more of ORF4, 0RF14, 0RF15, 0RF16 or 0RF51. Even more preferably, said mutation comprises the partial or complete deletion of one or more of said genes. In a more preferred embodiment of the invention, said herpes saimiri virus is a strain that lacks or has a mutation in the STP gene, so that the virus is unable to transform a target cell and is thus unable to produce an oncogenic phenotype. . Preferably, said virus is further manipulated, so that at least a part of at least one gene that is involved in the replication of the virus is deleted. Ideally, said gene is ORF50 and / or 0RF57. In a more preferred embodiment of the invention, said virus is provided with an insertion site into which selected heterologous material can be inserted. Preferably, the insertion site is within, adjacent to, or far from, the site of said deletion of one or more of said genes. In accordance with a further aspect of the invention, there is provided a herpes saimiri virus which has therein or is adapted to have inserted therein, at least one preselected heterologous gene fragment adjacent to a suppression site, whose site of deletion represents a site for the partial or total deletion of at least one gene encoding a protein not essential for growth. In a preferred embodiment of the invention, said virus is also provided with a mutation in a gene that intervenes in viral replication, in order to prevent viral replication after inserting said virus into a target cell. More preferably, said virus is a strain that lacks or has a mutation in the STP gene, so that the virus is unable to transform a target cell and is thus unable to produce an oncogenic phenotype. In accordance with a further aspect of the invention, a herpes saimiri virus is provided that has in the same, or adapted to have inserted therein, at least one preselected heterologous genetic fragment at the junction of the individual coding region and a non-coding region, and further wherein said virus has been manipulated, so that only a small number of Non-coding repeat sequences are present at one or both ends of the individual coding region, and a mutation in a gene involved in viral replisation is also provided, to prevent viral replication after inserting said virus into a target cell. Preferably, said number of non-coding repeat sequences is 5 or less, and ideally 1. In accordance with a further aspect of the invention, a transfer vector is provided that allows the insertion of a heterologous genetic fragment into the DNA of the virus of herpes saimiri. Preferably, said insert encompasses any of one or more of the insertion methods described above. In a preferred embodiment of this aspect of the invention, said vector includes a plurality of unique restriction sites, and more preferably three unique restriction sites. In addition, said vector includes a gene for beta-galactosidase that is preferably under the control of the IE 3 promoter of HCMV. More preferably, said vector is derived from pRUNeo (16) and is ideally prupoly. In accordance with a further aspect of the invention, a herpes saimiri virus is provided that has at least one mutation in a gene involved in viral replication, whereby the mutation is such that it prevents the replication of the virus in a cell target, and also at least one mutation in a gene that codes for a protein not essential for growth. In a preferred embodiment of the invention, said herpes saimiri virus also has a mutation in the STP gene. Preferably, said mutations comprise the partial or complete deletion of said genes. Even more preferably, said gene involved in viral replication comprises one of the genes for protein for the control of transcription, ORF50 and / or ORF57, or both; and said gene coding for a protein not essential for growth is one or more of the following genes: ORF4, ORF14, ORF15, 0RF16 or 0RF51. It will be evident from the foregoing that the preferred virus of the invention comprises a plurality of advantageous combinations of genetic mutations, whose combinations serve to disable and enable the virus to make it safe and controllable. By the term "disable" is meant the prevention of viral replication in a target cell, and by the term "capacitate" is meant the ability to accommodate the insertion of a relatively large amount of heterologous genetic material. More conveniently, said advantageous combination also provides a virus incapable of transforming a target cell and is thus unable to produce an oncogenic phenotype. According to a further aspect of the invention, there is provided a target cell that includes at least a part of the vector for gene therapy by herpes saimiri virus. In accordance with a further aspect of the invention, a cell transformed with a herpes saimiri virus vector is provided as described above. In accordance with a further aspect of the invention, there is provided a method for delivering selected heterologous genetic material to a target cell, comprising exposing at least said target cell to a herpes saimiri virus, including at least said preselected heterologous material under conditions that favor the infection of said cell with said virus. An embodiment of the invention will now be described by way of example only in relation to the following materials and methods.

Isolation and characterization of viral mutants The manipulated virus is a modified form of strain 11, which does not contain 0RF1 (STP gene). Although a "wild-type" strain would normally have been selected, vectors will inevitably have to be based on a virus that has had this gene removed. The modified strain can have deleted essential genes and, therefore, helper cell lines (described below) can be produced. These were established by cotransfection with a convenient genomic clone of HVS plus pSV2Neo, and clones of isolated cells that are resistant to G418. These cell clones were first screened by PCR for the presence of the appropriate gene sequences, and those that proved to be positive were analyzed by RT-PCR for the presence of RNA copies of the gene provided in the trans position. The appropriate clones were expanded and used for co-transfection with virus DNA and construction for suppression. Viruses expressing β-galactosidase (measured by the metabolism of X-gal) were tested for their ability to replicate in helper cells and normal Vero cells, and subsequently in human cell types of different lineages. The published data indicate that vectors derived from strain 11 are capable of showing limited growth in certain cell lines originating from B cells (Raji cells) and human fetal fibroblasts (HFF). Raji cells (transformed with EBV), are not representative of normal human cells; therefore, the growth characteristics of these viruses were evaluated in lymphoid cells isolated from fresh peripheral blood of adult human taken from healthy volunteers, and primary human embryo fibroblasts and epithelial cells which are available from commercial sources. Replication was assessed by β-galactosidase expression (evidence of infection and cell-to-cell diffusion), presence of episomal DNA, and expression of "typical" early and late genes detected by RT-PCR. The persistence of the genome in these cells was evaluated by measuring the percentage of cells capable of expressing the reporter gene through several generations of cells in conjunction with the test for the presence of episomal viral DNA (19).

Production of recombinant virus with suppressed genes Extracellular viruses released from cells were harvested by centrifugation at 30,000 g for 2 hours at 4 ° C. The semi-purified virus pellet was resuspended in 10 mM Tris / HCl, 1 mM EDTA (TE), pH 8.0. SDS at 1% in p: v was added, and proteinase K was added at lOOμg / ml. The sample was incubated at 50 ° C for 16 hours, and then treated with a 50:50 (p: v) mixture of phenol / chloroform (5 extractions). The aqueous phase was removed, adjusted to 0.2 M with sodium acetate, pH 5.0, and 3 volumes of absolute ethanol were added. The DNA precipitate was poured out of the tube, dried with air and then redissolved in an appropriate volume of TE buffer. The DNA concentration was measured by the absorbance of the sample at 254 nm in a spectrophotometer. The purified DNA of the virus was cotransfected into OMK cells (ATCC CRL1556) with the respective plasmid construct using DOTAP reagent. After 24 hours, the culture medium was removed, and replaced with medium containing 2% FCS inactivated with heat. Monolayers of cells were then observed until the development of an extensive cytopathic effect was apparent. In this step, the virus released from the cells was harvested and used to infect new subconfluent monolayers of OMK cells. These were covered after 24 hours with a bath of 1% agar in DMEM free of phenol red / FCS at 2% inactivated with heat. After 48 hours, X-gal was added to a final concentration of 100 μg / ml, to identify virus plaques that were expressing β-galactosidase. The blue plates were then chosen and subjected to two additional rounds of plaque purification, or until the virus population was homogeneous. These viruses were then tested for the correct events of homologous recombination using PCR and Southern blotting.

Production of recombinant viruses eme contain heterologous genes DNA purified from the virus, prepared as described above, was cotransfected into OMK cells with plasmid vectors (pJG101-105 and / or pAW 201, 202, 203, 205, 207 or 209) containing the suitable heterologous gene replacing the ß-galactosidase sequence for recombination in essential or non-essential genes, or intergenic regions. The recombinant virus that no longer expresses ß-galactosidase, was selected and purified in plates in the same way as described in the previous section.

In vitro cell infection with HVS High titer virus supply materials produced by low multiplicity of infection of OMK or Vero cells were produced. The virus released from the cells was titrated in OMK or Vero cells and stored at -70 ° C. The amount of virus required to infect any specific cell type with 100% efficiency was evaluated by infection of a defined number of cells at several multiplicities of infection with a virus expressing figalactosidase. The adherent cells were infected by adding the virus in a minimum volume of culture medium, and incubated at 37 ° C for 2 hours with gentle agitation. This medium was then removed and replaced with an appropriate amount of fresh medium. The non-adherent cells were harvested, counted, and resuspended between 10 6 and 10 cells per 1 ml of virus at an appropriate concentration until an infection efficiency of 100% was achieved. After 2 hours of incubation with gentle agitation, the cells were treated in the same manner as described for the adherent cells.

Production of auxiliary cell lines Viral genes that had to be expressed in a stable cell line, in the trans position, were cloned into a suitable plasmid vector under the control of their own sequences, or heterologous control sequences 5p and 3p. This plasmid may also contain a selectable marker, for example, the gene for neomycin phosphotransferase that confers resistance in eukaryotic cells to the drug G418. Alternatively, this gene can be provided in a separate plasmid, again under the control of heterologous eukaryotic control sequences, for example the SV40 early promoter and appropriate polyadenylation signals. In all cases, the cell lines were thus established. 5 × 10 5 cells (or a sufficient number to give a confluence of 40 to 50%), such as Vero or OMK cells on 10 cm diameter tissue culture plates in 10 ml of DMEM / fetal calf serum were plated out 10%, and incubated for 12 to 18 hours at 37 ° C in a humidified atmosphere containing 5% CO2 in air. After this period, 2 μg of plasmid was transfected into the cells using DOTAP reagent, as described above for transfection of virus DNA. This can be a single plasmid containing the appropriate gene and the selectable marker gene, or a mixture of 2μg of each plasmid. The cells were then incubated at 37 ° C in a humidified atmosphere containing 5% CO 2 in air for another 48 hours. In this stage, the now confluent monolayers were separated from the plastic plate by removing the medium, washing the 2xl0ml of saline regulated at its pH with phosphate (PBS, Life Technologies Inc., cat number 20012) and treatment with 2 ml of trypsin solution (0.25% in p: v) / EDTA (0.2% in p: v) in PBS. Fresh medium was then added to the cell suspension, and the cells were counted and then plated in 96 well plates for cloning at limiting dilution or dispensed to IO cells per 10 cm dish. The culture medium (DMEM / 10% FCS) was supplemented with an appropriate concentration of G418, which is sufficient to cause 100% death of non-transfected cells. The concentration depends on the number of cell passages and the cell type. A typical concentration of Vero cells in passage 150 is 800 μg / ml. The cells were then placed in the growth environment described above and observed at regular intervals to detect their death. The culture medium was replaced approximately every 3 to "4 days, depending on the death / growth rate of the cells. After 7 to 14 days, individual clones of cells have been developed, and these were then selected, developed to appropriate numbers, and tested for the expression of the transfected HVS gene. This can be achieved by the use of immunofluorescence, Northern Blotting or RT-PCR, using methods well known in the art.

Virus safety assessment The ability of the modified virus to replicate by measuring the expression of the viral gene was evaluated using RT-PCR for the selection of immediate-early, early and late genes. Additionally, tissue culture supernatants from transduced cells were incubated with indicator OMK cells to detect any possible release of the infectious virus.

Vector dβ recombination for insertion This strategy produces a recombination vector to allow the insertion of heterologous genes at the 3p end of the HVS DNA L. pSJNeo (by R. Grassman) contains 9.4 kb of HVS DNA containing the DNA binding of HL. A Smal cut site located 35 bp within the first repeat unit H was changed to a SalI site to allow insertion of the new gene. However, this vector is a large vector of low copy number and is therefore inconvenient for the insertion of large heterologous genes. An expression vector, pSA91, was selected to obtain the new recombination vector. This vector is produced with a high copy number and contains the HCMV IE promoter to direct gene expression. To produce an efficient expression vector that allows recombination, the HVS DNA sequence was cut from pSIneo, and inserted into a unique NarI site located at the 5p end towards the promoter, using linker adapters. This vector is designated pJGlOl.

Deletion of ORF06 ORF06 (located between base pairs 12584 and 15967) codes for the major DNA binding protein; thus, the suppression of this gene makes the replication of the virus deficient. To obtain a recombination cassette for the deletion of ORF06, flanking DNA regions of pSS54 containing the HVS DNA region from 11507 to 18013 (the KpnlF fragment) were cut. The Kpnl (11507) -Haell fragment (12613) of 1106 bp 5b towards the coding region of ORF06, and the Sphl fragment (15258) -BglIII (16407) of 1149 bp, were separated and ligated together by synthetic oligomers. The oligomers also contain restriction sites EcoRI and BamHI, as shown below, to allow the insertion of heterologous genes. It is necessary to keep part of the 3p end of ORF06, since it contains the promoter for ORF07. The ligated Kpnl-BglII fragment was inserted into the pBluescript KS cloning vector to create the recombination cassette pJG102.

Sequence of oligomers to join the fragments TGAATTCGGATCCGCATG CGCGACTTAAGCCTAGGC HaelII EcoRI BamlII Sphl Construction of ORF06 to generate the helper cell line To produce deleted HVS for the coding region ORF06, it is necessary to provide the ORF06 gene product in the trans position. This was achieved by producing a line of stable helper cells. The ORF06 gene was separated from pSS54 as a Haell fragment (12613) -PstI (15998). Synthetic oligomers (as shown below) were used to precisely create the start of the coding region of ORF06 and allow insertion into the expression vector pSVK3 (Pharmacia). After binding of the synthetic oligomers towards the 5b end of ORF06, the EcoRI-Psl fragment was ligated to pSVK3 to create pJG103. This directs the expression of the SV40 early promoter; the use of an alternative promoter minimizes the recombination events in the auxiliary cell line.

Oligomer sequence: AATTCATGGCAACGAAGACAGCGCAACCTAGCGC GTACCGTTGCTTCTGTCGCGTTGGAT EcoRl Start of 0RF06 Haell Deletion of ORF51 ORF51 codes for the membrane protein potential binding to the HVS receptor; therefore, the suppression of this gene makes the virus non-infectious. 0RF51 is located between 72626 and 73432 of the HVS genome. To produce flanking sequences of 0RF51 for the recombination cassette, the 5p BamHI (71692) -pal fragment (72602) of 910 bp was separated to the coding region 0RF51 and the fragment 3p Bstl 1071 (73395) -Pstl (73998) of 601 pb to 0RF51 from pKK104 containing the EcoRI D fragment of HVS from 63020 to 77574, and ligated together by synthetic oligomers. These oligomers also contain EcoRI and BamHl restriction sites to allow insertion of heterologous genes and, in addition, the sequence that is required to maintain poly-A for 0RF52. After ligation, the BamHl -PstI fragment was ligated to the cloning vector pSP73 (Promega) to create the recombination cassette pJG104.

Synthetic sequences of oligomers AACGAATTCGGATCCTTAATAATAATGAGCTGTA TTGCTTAAGCCTAGGAATTATTATTACTCGACAT Hpal EcoRI BamHI ORF52 poliA Bst11071 Construction of ORF51 to generate helper cell lines The 0RF51 gene was separated from pKK104 as a Hpal (72602) -Stul (73495) fragment of 806 bp, and cloned into the SV40 expression vector pSVK3. EcoRI linkers were ligated to the ends 5]? and 3]? of 0RF51 to facilitate this cloning reaction. The resulting 0RF51 expression vector was designated pJG105.

Deletion of ORF57 ORF57 codes for a transcriptional activator with homology with UL54 of HSV-1, an essential immediate early gene. To generate a virus containing a complete deletion of 0RF57, regions adjacent to the coding region of 0RF57 were amplified to allow homologous recombination with viral DNA. The initiators have been designated as: '-d GGC GAA TTC GTC TAT AAC TGA CTG GGT TGC TG, 5'-d GCC CTG CAG GCA GTT ACT CAC CAT AGC TTG AG, 5'-d GCC CTG CAG CAA GTG TCC AAG CTC TAC TTG TGC, 5 ' -d GGG GCA TCC CTATTGATG TGC CAÁ GCAATAGGGT, These amplify two regions of HVS, respectively: 77850 to 78260 and 79530 to 80120, and suitable restriction sites have been incorporated into the primers to facilitate cloning. Triple ligation was carried out using these fragments and pUC18, previously digested with EcoRI and Sphl, to derive pA lOl. This plasmid was then linearized using PstI and SalI, and ligated with the lacZ gene under the control of the hCMV IE promoter, to generate PdeltaORF57, which has been deposited in the National Collection of Industrial and Marine Bacteria Ltd (NCIMB), 23 St Machan Drive, Aberdeen, AB2 1RY; deposit number 40894. To generate an auxiliary cell line, a fragment containing the coding region of ORF57 was amplified using PCR, and ligated with a T vector, pCRII, to derive pA 103. This was then cloned into the plasmid pBKCMV to generate ORF57 under the control of the HCMV 1E PBKCMVORF57 promoter, which has been deposited in the NCIMB, as mentioned above, deposit number 40895.

Constructions of inactivation of HVS insertion Inactivation of insertion is a less preferred method to prevent a gene from functioning, since it depends on placing the β-galactosidase indicator gene within the coding sequence of the appropriate gene, without removal of part. some of the open reading frame. There is a risk that recombination events will occur, which leads to the suppression of the ß-gal sequence and the lack of ligation of the open reading frame that allows the reactivation of the gene. To generate an insertionally inactivated gene, a transfer vector was constructed that inactivated each respective gene by inserting the lacZ gene under the control of a CMV IE promoter in the 5p coding region of ORF. This inactivated gene was then inserted into the viral genome by cotransfection of the plasmid and the HVS viral DNA to derive a recombinant virus, which will then be plaque purified.

PLASMID CONSTRUCTIONS ORF 4 / COMPLEMENT CONTROL PROTEIN pJC81-KpnB was digested with BglII and PstI to generate an 1152 bp fragment containing the coding region of ORF4. This fragment was ligated to PUC18, to derive pUCORF4. This plasmid was linearized using BglII, shaved at its ends using T4 DNA polymerase, and ligated with a shaved fragment at its ends containing the lacZ gene under the control of a CMV IE promoter, to generate pA 201.

ORF14 / GEN IE SMALL pACYC184-EcoF was digested with EcoRI and PstI to generate a fragment of 3189 bp containing the coding region of 0RF14. This fragment was ligated to pUC18, to derive pUCORF14. This plasmid was linearized using Kpnl, shaved at its ends using T4 DNA polymerase, and ligated with a shaved fragment at its ends containing the lacZ gene under the control of a CMV IE promoter, to generate pA 202.

ORF15 / HOMOLOGO DE CD59 pACYC184-EcoF was digested with Sstl and PstI to generate a 2415 bp fragment containing the coding region of ORF15. This fragment was ligated to pUC18, to derive pUC0RF15. This fragment was linearized using Muñí, shaved at its ends using T4 DNA polymerase, and ligated with a shaved fragment at its ends containing the lacZ gene under the control of a CMV IE promoter, to generate pAW203.

ORF50 / MAIN ACTIVATOR OF THE TRANSCRIPTION pACYC184-EcoD was digested with BglII and PstI to generate a 4149 bp fragment containing the coding region of ORF50. This fragment was ligated to pUCld, to derive pA 204. This fragment was digested with PstI and ligated with a DNA fragment containing the lacZ gene under the control of a CMV IE promoter, to generate PdeltaORF50, which has been deposited at NCIMB, as described above, deposit number 40892. An auxiliary cell line was constructed using PUCPST deposited in the NCIMB, as described above, deposit number 40893, which is pUC18 containing a PstI fragment of HVS DNA which covers both exons of the gene.

ORF57 / GEN IE pACYC184-EcoJ was linearized using BglII, shaved at its ends using T4 DNA polymerase, and ligated with a shaved fragment at its ends containing the lacZ gene under the control of a CMV IE promoter, to generate pA 206. To construct a Auxiliary cell line, the coding sequence of ORF 57 was amplified using PCR using the following primers: '-d CGC GGTACC CAC ATGTCTATAATC GAC TGG GTT, 5'-dCGG GGTACC CTGAGTCAT TAG TAG TAG CTC ATG.

This PCR fragment was ligated to a TA cloning vector pCRII, and designated as pA 207.

ORF 16 / SUPPRESSOR OF APOPTOSIS Due to the lack of convenient restriction sites, the coding region was amplified using PCR, incorporating a PstI site in the 5 'coding region to allow subsequent cloning, using the following primers: 5'-d GCC GAA TCC CAC AGT GCC AAG CTT GCC AGT T, 5'-d CGC CTG CAG GGT GTA TAA CTG AGT GTT ACA GC, 5'-d GGG CTG CAG GCT GTA CAC TCA GTT ATA CAC C, 5'd -CCC GCA TGC ACT TGA TCC AGG ACA TGC TTC This PCR product was ligated with pUC18 to derive pA 208. This plasmid was linearized using PstI, and ligated with the low lacZ gene or the control of a CMV IE promoter, to generate pA 209. An auxiliary cell line was constructed using pA 208.

REFERENCES 1 Ledley, F.D. (1994) Non-viral gene therapy. Curr. Opinion Biotech 5, 626-636. 2 Wagner, E., Cotten, M., Foisner, R. and Birnsteil, M. (1991) Transferrin-polycation complexes: the effect of polycations on the structure of the complex and DNA delivery to cells. Proc. Nati Acad. Sci. USA 88: 4255-4529. 3 Rich, D.P., Couture, L.A. , Cardoza, L.M. Guiggio, V.M. Armentano, D., Espino, P.C., Hehir, K., Welsh, M.J., Smith, A.E. and Gregory, R. J. (1993) Development and analysis of recombinant adenoviruses for gene therapy of cystic fibrosis. Hum. Gene Ther. 4: 461-476. 4 Gordon, E.M. and Anderson, W.F. (1994) Gene therapy using retroviral vectors. Curr. Opinion Biotech. 5: 611-616. 5 Crystal, R.G., McElvaney, N.G., Rosenfeld, M.A., Chu, C., Mastrangeli, A., Hay, J.G., Brody, S.L., Jaffe, HE HAS. , Eissa, N.T. and Danel, C. (1994) Administration for an adenovirus containing the human CFTR cDNA to the respiratory tract of individuáis with cystic fibrosis. Nature Genet 8: 42-51. 6 Locker, H. and Frenkel, N. (1979). Structure and origin of defective genomes contained in serially passaged herpes simplex virus type 1 (Justin) J. Virol. 29: 1065-1077. 7 Davison, A.J. (1993) Herpesvirus genes. Rev. Med. Virol. 3: 237-24. 8 Albrecht, JC, Nicholas, J., Biller, D., Cameron, K.R. , Biesinger, B., Newman, C, Wittmann, S., Craxton, M.A., Coleman, H., Fleckenstein, B. and Honess, R.W. (1992) Primary structure of the Herpesvirus saimiri genome. J. Virol. 66: 5047-5048. 9 Jung, J.U., Stager, M. and Desrosiers, R.C. (1994) Virus-encoded cyclin. Mol. Cell Biol. 14: 7235-7244. 10 Biesinger, B., Muller-Fleckenstein, I., Simmer, B., Lang, G., Wittmann, S., Platzer, E., Desrosiers, RC and Fleckenstein, B (1992) Stable growth transformation of human T lymphocytes by herpesvirus saimiri. Proc. Nati Acad. Sci. USA 89: 3116-3119. 11 Murthy, S.C. S., Trimble, J.J. and Destrosiers, R. C. (1989) Deletion mutants of herpesvirus saimiri defines an open reading frame necessary for transformation. J. Virol. 63: 3307-3314. 12 Grassmann, R., Fleckenstein B. and Desrosiers, R.

C. (1994) Viral transformation of human T lymphocytes. Adv. Cancer Res. 63: 211-244. 13 Desrosiers, R.C., Burghoff, R.L. Bakker, A. and Kamine, J. (1984) Construction of replication-competent herpesvirus saimiri deletion mutants. J. Virol. 49: 343-348. 14 Simmer, B., Alt, M., Buckreus, I., Berthold, S., Fleckenstein, B., Platzer, E. and Grassmann, R. (1991). Persistence of selectable herpesvirus saimiri in various human haemopoietic and epithelial cell lines. J. Gen. Virol. 72: 1953-1958. 15 Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M. and Moore, P.S. (1994). Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266: 1865-1871. 16 Grassmann, R. and Fleckenstein, B. (1989) Selectable recombinant herpesvirus saimiri is capable of persisting in a human T-cell line. J. Virol. 63: 1818-1821. 17 Berkner, K.L. (1988) Development of Adenoviruses vectors for the expression of heterologous genes. "BioTechniques, 6, 616-629, 18 Glorioso, J., Goins, W.F. and Fink, D.J. (1992) Herpes simplex virus-based vectors. Semin. Virol. 3: 265-276. 19 Gardella, T., Medveczky, P., Sairenji, T. and Mulder, C. (1984) Detection of circular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis. J. Virol. 50: 248-254.

Claims (24)

1. NOVELTY OF THE INVENTION CLAIMS 1. - A herpes saimiri virus having at least one mutation in at least one gene coding for a protein required for virus replication, characterized in that said mutation prevents viral replication in a human cell. 2. - Herpes saimiri virus according to claim 1, further characterized in that said mutated gene is any of ORF 50 and / or ORF 57. 3. - The herpes saimiri virus according to any of the preceding claims, characterized in addition because said virus further has a mutation in a transforming gene, such as an STP gene. 4. The herpes saimiri virus according to any of the preceding claims, further characterized in that said virus is further mutated in at least one gene selected from the group comprising ORF 4, ORF 14, ORF 15, ORF 16 or ORF 51. 5. The herpes saimiri virus according to any of the preceding claims, further characterized in that said mutation is a complete or partial suppression of said gene. 6. - The herpes saimiri virus according to any of the preceding claims, further characterized in that said virus is provided with an insertion site for the insertion of heterologous genetic material. 7. The herpes saimiri virus according to claim 6, further characterized in that said site is located within, or adjacent to, at least one non-coding repeat sequence, and preferably at the junction between a unique coding region and a non-coding sequence. 8. - The herpes saimiri virus according to claim 6 or 7 dependent on claim 5, further characterized in that said insertion site is provided at a site of said suppression. 9. - Herpes saimiri virus according to claim 6, further characterized in that said insertion site is provided in, or adjacent to, at least one gene selected from the group comprising ORF 4, ORF 14, ORF 15, ORF 16 or 0RF51. 10. - Herpes saimiri virus that has at least one mutation in at least one gene, further characterized because said gene is at least one of the following genes: ORF 4, OFR 14, ORF 15, ORF 16 or 0RF51 . 11. The herpes saimiri virus according to claim 10, further characterized in that said mutation is a complete or partial suppression of said gene. 12. - Herpes saimiri virus according to claims 10 or 11, further characterized in that said virus further has a mutation in a transforming gene, such as an STP gene. 13. - The herpes saimiri virus according to claims 10 to 12, further characterized in that said virus is further manipulated, whereby at least part of the gene coding for ORF 50 and / or ORF 57 is mutated and / or suppressed 14. - Herpes saimiri virus according to claims 10 to 13, further characterized in that said virus is provided with an insertion site into which heterologous DNA can be inserted. 15. - The herpes saimiri virus according to claim 10, further characterized in that it has in it or is adapted to have inserted therein, at least one fragment of pre-selected heterologous DNA adjacent to a suppression site, whose site represents a site for the partial or complete deletion of at least one gene encoding a non-essential gene, and whose virus is further mutated or deleted for a gene encoding a protein required for viral replication. 16. The herpes saimiri virus according to claim 15, further characterized in that said virus further has a mutation in a transforming gene, such as an STP gene. 17.- The herpes saimiri virus that has in it or is adapted to have inserted therein, at least one fragment of heterologous DNA preselected at the junction of an individual coding reaction and a non-coding region.; and wherein said virus further comprises a reduced number of repetitive non-coding sequences at one or both ends of the individual coding region; and the virus also comprises at least one mutation in at least one gene that codes for a protein that is involved in viral replication. 18. - The herpes saimiri virus according to claim 17, further characterized in that the number of said repetitive non-coding sequences is 5 or less, and ideally 1. 19. - The herpes saimiri virus according to claim 1 , further characterized in that it has at least one mutation in a gene that codes for a protein that is involved in viral replication, and a mutation in a gene that codes for a non-essential protein. 20. The herpes saimiri virus according to claim 19, further characterized in that said virus further has a mutation in a transforming gene, such as an STP gene. 21. The herpes saimiri virus according to claims 19 or 20, further characterized in that said mutations comprise the partial or complete suppression of said gene. 22. - Herpes saimiri virus according to claims 19 to 21, further characterized in that said gene coding for a protein involved in viral replication comprises ORF 50 or ORF 57. 23. - Herpes saimiri virus in accordance with claims 19 to 22, further characterized in that said gene encoding a non-essential protein comprises a gene selected from the group comprising ORF 4, ORF 14, ORF 15, ORF 16 or ORF 51. 24. - A method for releasing selected heterologous DNA to a target cell, said cell exposing to a herpes saimiri virus according to claims 6 to 9 and 14 to 18, characterized in that it includes at least one pre-selected heterologous DNA under conditions that favor viral inf ction.