NZ337906A

NZ337906A - A method to identify and breed corn with increased kernel oil concentration

Info

Publication number: NZ337906A
Application number: NZ337906A
Authority: NZ
Inventors: Robert Stefan Reiter
Original assignee: E
Priority date: 1997-03-24
Filing date: 1998-03-19
Publication date: 2001-08-31
Also published as: JP2001517951A; AU734755B2; KR20010005625A; HUP0001745A2; WO1998042870A1; CA2280933A1; EP0972079A1; AR012152A1; HUP0001745A3; PL335910A1; ZA982250B; BR9815450A; IL131908A0; AU6575198A

Abstract

A method for breeding with high oil corn germplasm involving the use of genetic markers associated with trait loci controlling kernel oil concentration. These genetic markers are used to select for kernel oil concentration in breeding populations and a method for selecting complementary oil parent sources using genetic markers, which are likely to produce superior offspring and the trait loci controlling corn kernel oil concentration are described.

Description

<div class="application article clearfix" id="description"> WO 98/42870 PCT/US98/05550 TITLE A METHOD TO IDENTIFY AND BREED CORN WITH INCREASED KERNEL OIL CONCENTRATION FIELD OF INVENTION 5 The invention is in the fields of plant breeding and molecular biology More specifically, the invention relates to the identification of corn loci conferring increased kernel oil concentration using genetic markers and the use of genetic markers as an aid to the identification and breeding of corn with increased kernel oil concentration 10 BACKGROUND OF INVENTION Corn is a major crop used as a human food source, an animal feed, and as a source of carbohydrate, oil, protein, and fiber It is principally used as an energy source in animal feeds, or as a raw material for the recovery of starch, protein feed fractions, fiber, flaking grits, flour, and oil. 15 Most commercial com produced throughout the United States is produced from hybrid seed. The production of com hybrids requires the development of elite com inbreds that upon mtermating produce agronomically superior hybrids During the development of com inbreds, plant breeders select for a number of different traits affecting agronomic performance. These traits include but are not 20 limited to stalk strength, lodging, disease resistance, grain moisture and grain yield. Agronomic traits tend to be quantitatively measured with continuous rather than discrete distributions. It is theorized that quantitative traits are controlled by several genes with small and generally equivalent effects. Further, the observed phenotype is due partially to this genetic component and an environmental 25 component. The hentability of a trait is defined in the broad sense as the ratio of the genetic variance to the total phenotypic variance. Many agronomic traits display low hentability; i.e., the performance of parent plants is a poor predictor of offspring performance. Thus, traits with low hentability have small genetic 30 vanance components in companson with observed variation The impact on the plant breeder is that m breeding populations, the value of a plant's genetic composition is difficult to determine from agronomic trait measurements In an attempt to maximize their discnminative abilities, breeders collect multiple measurements both from individuals related by descent and from many 35 environments This strategy is resource intensive because it involves the use of extensive tnaling to make even small gains in plant improvement This, coupled with the fact that improved com lines are selected for multiple traits simultaneously, makes the development of superior com inbreds both a time-consuming and an expensive labor 1 Printed from Mimosa WO 98/42870 PCT/US98/05550 The addition of novel traits in a corn breeding program imposes an additional burden upon the plant breeder Depending upon the genetic complexity of the novel trait (i.e , single gene versus many genes), a significant increase in time and effort is required to produce elite lines containing novel traits One such 5 trait is kernel oil concentration. Corn with increased kernel oil concentration is important because it possesses improved feeding value for poultry (Han Y et al (1987) Poultry Sci 66.103-111) and livestock (Nordstrom, J.W. et al. (1972) J An Sci 35(2)-357-361). Grain from conventional corn hybrids typically contains 4% oil. 10 In an effort to increase the kernel oil concentration, a long-term recurrent selection program was lmtiated in the open-pollinated cv Burr's White by C.G Hopkins in 1896 This recurrently-selected population known as Illinois High Oil (IHO), has been selected for increased oil concentration for over ninety generations (Dudley, J.W. and R.J. Lambert (1992) Maydica 37-1-7) using modified mass selection. 15 As a result, oil concentration was increased in the population over 20%. The germplasm was little used because derived materials had yields substantially lower than conventional varieties (Alexander, D.E (1988) In: Proc. 43rd Ann. Com and Sorghum Res. Conf. Am Seed Trade Assoc., Washington, D.C. pp 97-105). 20 Using thirty-eight open-pollinated cultivars and synthetics, Alexander initiated a second recurrent selection program (Alexho synthetic) to increase kernel oil (Alexander, D.E. (1988) In: Corn and Corn Improvement. G.F. Sprague and J.W. Dudley eds. American Society of Agronomy, Madison WI. Pp 869-880). Equivalent oil levels to IHO were achieved in twenty-eight cycles using selection 25 based upon the oil concentration of single ears and in later generations based upon the oil concentration of single kernels Yield performance of Alexho-derived material in single cross hybrids (high oil inbred x conventional inbred) is improved over IHO, presumably due to the greater genetic variability initially available, although performance was not equivalent to conventional hybnds The 30 development of agronomically elite corn germplasm also containing increased kernel oil concentration is clearly a challenge using conventional plant breeding methods Kernel oil concentration can be phenotypicaily measured using a variety of analytical methods Oil concentration displays a non-discrete distribution, 35 common for quantitatively-inherited traits controlled by several loci Kernel oil measurements select those breeding lines with the highest phenotypic expression Unfortunately, the genetic potential for high oil is limited in most of these lines because it is impossible to discriminate between lines based upon their true genetic composition This situation is further aggrevated when simultaneous 2 Printed from Mimosa WO 98/42870 PCT/US98/05550 selection for agronomic performance is practiced. It would therefore be advantageous to base selection upon the genotype of the plants in the population Genetic markers, especially nucleic acid markers, may be used to advantage as an indirect selection method for complex quantitative traits. Genetic markers 5 identifying alleles conferring increased oil would therefore be an advantageous tool for plant breeding programs developing elite high oil corn germplasm There is limited published information on the identification of genetic markers predictive for increased oil yield Kahler (Kahler, A.L. (1985) In: Proc 40th Ann Corn and Sorghum Res. Conf Am Seed Trade Assoc , Washington 10 D.C pp 66-89) measured isozyme allelic frequency changes following twenty-five cycles of selection in Alexho synthetic and found eight significant loci. Most of these allele frequency changes were also significant for tests measuring random genetic drift, making it difficult to conclude that selection based upon these isozyme alleles would be useful More recently Goldman et al (Goldman, I.L., et 15 al. (1994) Crop Sci. 54:908-915) and Berke and Rocheford (Berke, T G. and Rocheford, T R. (1995) Crop Sci 35-1542-1549) used RFLP markers to identify significant marker loci associated with oil concentration in the Illinois long-term selection populations. These studies identified twenty-five and thirty-one markers respectively, in populations derived from Burr's White, which were significantly 20 associated with increased oil. Some of the regions identified by significant RFLP marker loci may be in common between the two studies, however of the fifteen RFLP markers which were used in both studies, six were in disagreement for their effect on oil concentration. In these studies the populations used were derived from common ancestry (Burr's White); however, the populations were selected for 25 different traits (oil and protein) over many generations It is not surprising that many identified oil loci would be unique to each population analyzed It is therefore desirable to identify those genetic markers which are uniquely predictive of germplasm being used in the breeding program. SUMMARY OF INVENTION 30 A method is disclosed for reliably and predictably breeding for corn with increased kernel oil concentration. The method comprises a) using one or more genetic markers to select a corn plant from a corn breeding population by marker-assisted selection, wherein the genetic markers are selected from the group consisting of sl375, sl384, sl394, s 1416, sl422, sl432, sl457, sl480, sl476, 35 sl478, si484, sl500, sl513, sl529, s!544, sl545, sl630, sl633, sl647, sl750, si756, s 1757, sl767, sl772, sl774, sl780, sl797, sl813, sl816, sl817, s!836, sl853, si860, sl870, sl921, sl922, sl925, sl931, sl933, sl939, sl946, sl949, s2054, s2055, s2057, s2058, s2097, s2122, s2125, s2150, s2156 and s2175; and b) crossing the selected com plant with a second com plant wherein the progeny Printed from Mimosa WO 98/42870 PCT/US98/05550 of the cross displays increased kernel oil concentration. A preferred source of high oil corn germplasm is a member of an Alexho synthetic population or a progeny thereof Also disclosed is a method for identifying corn plants or corn lines for use 5 as parents for creation of a breeding population, the method comprising a) genotyping corn plants or corn lines with one or more genetic markers wherein the genetic markers are selected from the group consisting of s 1375, s 1384, sl394, sl416, sl422, sl432, sl457, sl480, sl476, s!478, sl484, sl500, sl513, sl529, si544, sl545, sl630, sl633, sl647, sl750, sl756, sl757, sl767, sl772, sl774, 10 sl780, sl797, sl813, sl816, sl817, sl836, sl853, sl860, sl870, sl921, sl922, si925, s 1931, sl933, sl939, sl946, sl949, s2054, s2055, s2057, s2058, s2097, s2122, s2125, s2150, s2156 and s2175; and b) identifying com plants or com lines which, based upon their genotype, are predicted to produce transgressive segregants for kernel oil concentration 15 The present invention provides a method for the identification of and selection for genes controlling increased com kernel oil concentration These oil alleles were initially identified in materials composed of or derived from the Alexho synthetic breeding populations. Further, the method facilitates the use of this high oil material in breedmg programs with the objective of developing new 20 high oil com germplasm. Specifically, the method uses genetic markers to predict the oil breeding value of lines in a com breedmg program. By indirect selection of oil loci using these markers, those lines with the greatest genetic potential for increased kernel oil concentration are chosen. 25 According to the method, any type of genetic marker may be used to identify an association with kernel oil concentration. The method is only limited by the ability to measure polymorphism at a given marker locus Those skilled in the art will recognize that the various genetic markers which may be used includes but is not limited to restriction fragment length polymorphisms (RFLPs), random 30 amplified polymorphic DNAs (RAPDs), simple sequence repeats (SSRs), AFLPs, various single base pair detection methods, allozymes, and phenotypic markers SSR markers useful in the practice of the instant method include s 1375, si 384, si394, sl416, sl422, sl432, sl457, sl476, sl478, sl480, sl484, sl500, sl513, S1529, si544, sl545, sl630, sl633, sl647, sl750, sl756, sl757, sl767, sl772, 35 S1774, sl780, sl797, sl813, sl816, sl817, sl836, sl853, sl860, sl870, sl921, sl922, s 1925, sl931, sl933, sl939, sl946, sl949, s2054, s2055, s2057, s2058, s2097, s2122, s2125, s2150, s2156 and s2175 4 Printed from Mimosa A further embodiment of the present invention is a plant produced by the method of the invention have a trait loci controlling the expression of corn kernel oil concentration These loci are identified and defined (i e , mapped) by the marker loci of the present invention An additional embodiment of the present invention are corn plants and 5 high oil com germplasm that are produced using the instant breeding method. DETAILED DESCRIPTION OF THE INVENTION Table 1 provides a brief description of the genetic markers that form a part of the instant invention. Each marker is defined by it's constituent nucleic acid primers (forward and reverse) that facilitate amplification of the specific marker 10 locus of the corn genome. Also indicated is the required identifier for each sequence. The identifiers listed in Table 1 correspond to those listed in the Sequence Listing (infra) as required by 37 C.F.R. §1.821 et seq. Table 1 15 Genetic markers useful for defining the location of trait loci controlling corn kernel oil concentration Marker Sequence (5'-3') Primer Type SEQ ID NO. sl375 TTTATGGGTTGGGAGATACTTG forward 1 AGATGTGTGCGTTTTTGAGAG reverse 2 sl384 TTACGGCCTAGACATTTCGAC forward 3 C ACTT GCTTTCAGGT ACCCA reverse 4 sl394 CTGCCCAGTCCGTAATGAA forward 5 TAG ATTTATTTT CT GAACG ATT GG reverse 6 sl416 GATCTCTCTGAGGCTTGTCC forward 7 T GT AGTT G AGGAT GCT CCC reverse 8 si 422 AGGCAAGGCTTTCTTCATAC forward 9 CGGACGACGACTGTGTTC reverse 10 S1432 ACATGAGAAACAAGATAGAACCAG forward 11 AAAATGTAAGAACTTGTTTGGGA reverse 12 sl457 CTGCTTATTGCTTTCGTCATA forward 13 TGCTGCACTACTTGAACCTAG reverse 14 sl476 ACACAGAGATGACAAAAGCAA forward 15 GCAGGCGTGCTATGAGAG reverse 16 s 1478 AGCGGTGAAACCCTTATG forward 17 CTGTGGCTGGTTCCTCTC reverse 18 sl480 GCTCTTGATAAAAAGGCAAGT forward 19 CTTGTTGTAATGGATGAGTGAG reverse 20 si 484 GCTCGT AGT AGGGGTT ACG forward 21 GACAGCCTCACCTCAAGA reverse 22 INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 1 MAY 2001 RECEIVED WO 98/42870 PCT/US98/05550 si 500 ACAGATCTTGACACGTACATACC forward 23 GGACGTGTATCCTCAAATCAT reverse 24 si 513 CAGCGAATACTGAATAACGC forward 25 TGTTGGATGAGCACTGAAC reverse 26 si 529 TGTTCTCAACAACCACCG forward 27 CGTTTAGCGATATCATTTTCC reverse 28 si 544 GATCCTACCAAAATCTTATAGGC forward 29 ACAGCTAGCCAAGATCTGATT reverse 30 si 545 CGATACTAATGGAAGCCCTAA forward 31 ATGGCCCATTAAGTTTATCAC reverse 32 sl630 AAAGCGTAGTCGGAAAGC forward 33 ACCAATGATCTTTACGCAGAT reverse 34 sl633 TAATCAGAGCGTACATCAGGA forward 35 AGGGCATCAATCAAGAATG reverse 36 sl647 GAGACTTTTGAGGAGAAAGCA forward 37 GATCAAAAGAGCAAAAGGAGA reverse 38 si 750 AACTGATGAATACCTTCCCAG forward 39 TGATTAACTTCTCCCTTTGGT reverse 40 sl756 TCGGCACAACATATGAGTTAC forward 41 CCCCCATAGAGAGAGATAGAG reverse 42 sl757 AAGCACGGCCCAATAGAAT forward 43 AGGATGTCCCTAGCTTTATTG reverse 44 si 767 TCATTGCCCAAAGTGTTG forward 45 CTCATCACCCCTCCAGAG reverse 46 si 772 GATCCACGCCATTTAAAC forward 47 TGATACTCTGGTGCATGTTC reverse 48 si 774 GATCGCTCCGATCTATCC forward 49 AGCGGCATCTATGTTCTATG reverse 50 sl780 CCCAGTGCGAAGAGACTC forward 51 ACACCTGCTCTGCACCAC reverse 52 si 797 CTAACCCACGACGACCCT forward 53 GCATGAGTGCATGTGCAT reverse 54 si 813 CTGCC AC AT GCTTTTCTG forward 55 CTGTAAAGAAGCTGGTCTGGA reverse 56 sl816 TTCTCCTCATGGATGCGT forward 57 CTATTTGGAAGTATGGGCTTCA reverse 58 6 Printed from Mimosa WO 98/42870 PCT/US98/05550 s 1817 GAGGGCATCTATGTGCAAC forward 59 GCT C AG AAGTT GCGTTT AT G reverse 60 si 836 TTCCTTCACGTTTCTCTGTTAA forward 61 CACATAAACCTAATGGGGTACA reverse 62 s 1853 CCCAAAGGCGATACCTATT forward 63 CCCACTTTCTCACTCTTTTCT reverse 64 si 860 GAGGTGAGTACTATGCAAATGC forward 65 CAGGCTTACCTAGCCTTCTC reverse 66 si 870 CTATGGATGGCTGCTTGC forward 67 GTCAGGCAGCAGAATGTG reverse 68 si 921 AAACCGTCCAGCGACTAC forward 69 GGAAGAACCAATCCCATATCT reverse 70 si 922 AACATCCTGTCGGAAACAG forward 71 TCATCACGTCTCTCTTTCAAC reverse 72 si 925 TTGTGGCAGAATCTCAAATTA forward 73 CGACTGGTGACATGTGAAG reverse 74 sl931 AGTGAGGAAAGAATATGCTGG forward 75 TGGACTGAGAAACTGATTTGA reverse 76 si 933 CACAAATGTGAAGGTAAACACT forward 77 AATGGTACGGTTCAGGATG reverse 78 sl939 AGATGACGCACGGAACAC forward 79 AGCATCATGTAGCAGGAGG reverse 80 si 946 TTGCAGCACTGTCGTAGTC forward 81 GCGCGAGTGGAGTAGTAAG reverse 82 si 949 AAGATTATGCAGATGAGACACC forward 83 GTTCCATGCTTTCCTTGG reverse 84 s2054 GCCGATACCATGTAAGAGAAT forward 85 CTCTGGGCTCTGTGTTAGAGT reverse 86 s2055 CTGCTTTCTCTGTTCCAGC forward 87 AATCGCTTACTTGTAACCCAC reverse 88 s2057 AAGAACGTACGTCCCATAAAG forward 89 CAAGGTAAAGTGACAAAGCAG reverse 90 s2058 GTTCAGGATGAGGCGGAA forward 91 GT GAT C ATCGC AGG AGACC reverse 92 s2097 GGAGCCTGGAGT GAGAAC forward 93 CATGCTCACCTAACGTGG reverse 94 7 Printed from Mimosa WO 98/42870 PCT/US98/05550 s2122 ATCTGAACACTTGAGCAACAA forward 95 ATAGACCGGACCCATCAC reverse 96 s2125 CGAACAGCGGGTACACCT forward 97 GAGGTCAGCTTCCTCGATCT reverse 98 s2150 GGAATCGTTCCTCCACAC forward 99 CTTCCTCGGTGTCAGACG reverse 100 s2156 ATGGAAACATCAAAGTGGATT forward 101 TGCTACCCTGATGACCTGAT reverse 102 s2175 ACCACTAGTCTCATATGAAGGG forward 103 GGT AGGTGGGT AGGGGTT reverse 104 For the purposes of this invention, we define the following terms-Corn. Any variety, cultivar, or population of Zea mavs L. 5 Elite. This term characterizes a plant or variety possessing favorable traits, such as, but not limited to high yield, good grain quality, and disease resistance. This enables its use in commercial production of seed or grain at a profit. The term also characterizes parents giving nse to such plants or varieties High Oil Corn Germplasm This term characterizes corn plants which, 10 when either self-pollinated or used as either the male or the female parent m a variety of outcrossing combinations, produce kernels with increased oil when compared to kernels produced by non-high oil germplasm Examples of high oil corn germplasm include but are not limited to open-pollinated varieties, hybrids, synthetics, inbred lines, races, and populations or corn plants derived from one of 15 the aforementioned. Variety or cultivar. These terms refer to a group of similar plants that by structural features and performance can be identified from other varieties or cultivars within the same species Line. This term refers to a group of individuals from a common ancestry, 20 a more narrowly defined group than a variety. Synthetic This term refers to a genetically heterogeneous collection of plants of known ancestry created by the intermating of any combination of inbreds, hybrids, varieties, populations, races or other synthetics. Inbred. This term refers to a substantially homozygous individual, variety 25 or line. Recombinant Inbreds. A population of independently derived lines developed by repeated selfing each generation until complete homozygosity is approached. Each recombinant inbred is derived from a single F2 plant using a breeding method commonly referred to as single seed descent Printed from Mimosa WO 98/42870 PCT/US98/05550 Breeding The art and science of improving a species of plant or animal through controlled genetic manipulation Marker-Assisted Selection The use of genetic markers to identify and select plants with superior phenotypic potential. Genetic marker(s) determined 5 previously to be associated with a trait locus or trait loci are used to uncover the genotype at trait loci by virtue of linkage between the marker locus and the trait locus Plants containing desired trait alleles are chosen based upon their genotypes at linked marker loci Alexho Synthetic. Recurrently selected, high oil corn germplasm 10 developed by Denton Alexander at the University of Illinois. Alexho synthetic high oil corn germplasm is composed of multiple synthetic populations defined by their cycle of advancement in the recurrent selection breeding program. Breeding Population. A genetically heterogeneous collection of plants created for the purpose of identifying one or more individuals with desired 15 phenotypic characteristics. Phenotype. The observed expression of one or more plant characteristics. Phenotypic Value. A measure of the expected expression of an allele at a trait locus. The phenotypic value of an allele at a trait locus is dependent upon its expressive strength in comparison to alternative alleles. The phenotypic value of 20 an individual, and hence its phenotypic potential, is based upon its total genotypic composition at all loci for a given trait. Transgressive Segregants. Individuals whose phenotype exceeds the phenotypic variation predicted by the parents. Genetic Marker. Any morphological, biochemical, or nucleic acid based 25 phenotypic difference which reveals a DNA polymorphism. Examples of genetic markers includes but is not limited to RFLPs, RAPDs, allozymes, SSRs, and AFLPs Marker locus The genetically defined location of DNA polymorphisms as revealed by a genetic marker. 30 Trait Locus A genetically defined location for a collection of one or more genes (alleles) which contribute to an observed characteristic Genotype The allelic composition of an individual at genetic loci under study Restriction Fragment Length Polymorphism (RFLP). A DNA-based 35 genetic marker in which size differences in restriction endonuclease generated DNA fragments are observed via hybridization (Botstein, D etal. 1980 Am J Hum Genet 32. 314-331. Random Amplified Polymorphic DNA (RAPD). A DNA amplification-based genetic marker in which short, sequence arbitrary primers are used and the 9 Printed from Mimosa WO 98/42870 PCT/US98/05550 resulting amplification products are size separated and differences in amplification patterns observed (Williams J G K et al 1990 Nucleic Acids Res 18 6531-6535). Simple Sequence Repeat (SSR) A DNA amplification-based genetic marker in which short stretches of tandemly repeated sequence motifs are 5 amplified and the resulting amplification products are size separated and differences in length of the nucleotide repeat are observed (Tautz D 1989. Nucleic Acids Res 112 4127-4138) AFLP A DNA amplification-based genetic marker in which restriction endonuclease generated DNA fragments are ligated to short DNA fragments 10 which facilitate the amplification of the restricted DNA fragments (Vos, P et al. 1995. Nucleic Acids Res 23 4407-4414) The amplified fragments are size separated and differences in amplification patterns observed Allozymes Enzyme variants which are electrophoretically separated and detected via staining for enzymatic activity (Stuber, C.W. and M.M. Goodman. 15 1983. USDA Agric. Res. Results, Southern Ser, No. 16). The present invention relates to the discovery of trait loci controlling kernel oil concentration through the use of genetic markers In populations m which variation for both kernel oil concentration and genetic marker alleles exist, oil measurements and marker-based genotypes were generated for members of the 20 populations. Using least squares methods, the locations of oil concentration loci were determined in relation to markers genetically linked to these trait loci. Indirect selection of preferred oil alleles may now be practiced using the information at one or more linked genetic markers. Selected corn plants compnse one or more alleles encoding a high oil phenotype. 25 It is recogmzed that several different populations and population types could be used to locate trait loci of interest. Some of the population types mclude but are not limited to recombinant inbreds, backcrosses, F2's or their self-pollinated or interrelated derivatives, and synthetics. Further, it is understood that an alternative to measuring phenotypic and genotypic variation within populations 30 is the measurement of genotypes and phenotypes between populations. In this alternative the second population is a selected derivative of the first population, selection being either on the trait of interest (phenotypic selection) or on specific marker alleles (genotypic selection). It is also recognized by those skilled in the art that alternative statistical approaches may be used to determine a linkage 35 relationship between marker loci and trait loci EXAMPLES The present invention is further defined in the following Examples It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only From the 10 Printed from Mimosa WO 98/42870 PCT/US98/055S0 above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions 5 EXAMPLE 1 LOCATION OF LOCI CONFERRING INCREASED KERNEL OIL CONCENTRATION Population development and trait measurement LH119wx and LH51, two inbred corn lines developed by Holden's 10 Foundation Seed Co , Williamsburg, IA were independently intermated with individual plants from the synthetic population ASKC28wx (deposited at the American Type Culture Collection, Rockville, MD; Accession No. ATCC 75105) (waxy kernels are highly represented in ASKC28 and as such I have designated the ASKC28 as bemg waxy) The F1 plants were selfed and resulting F2 15 populations were grown Individual F2 plants were selfed and derived kernels were advanced using single seed decent through six generations of selfing (S6) to produce recombinant inbred lines. Up to twenty kernels from the S6 generation were grown and selfed producing a family of S7 ears representing each recombinant inbred line. Oil values were determined for each ear within a family 20 using near infrared transmitance (Williams, P.C. (1987) In. Near Infrared Technology in the Agncultural and Food Industries; P.C. Williams and C. Norris, eds. American Association of Cereal Chemists). Genotypic determination Ten seeds from single ears representing each of one hundred ninety-four 25 (LH119wx x ASKC28wx) or two hundred and four (LH51 x ASKC28wx) recombinant inbred lines were germinated on moistened filter paper Root segments were excised from germinated seeds, pooled for each ear and extracted using an automated DNA extraction machine. The instrument uses a modification of the Murray and Thompson CTAB procedure (Murray, M.G. and Thompson, 30 W F. (1980) Nucl Acids Res 5-4321-4325) DNA samples were quantified via fluorescence using YoPro-1™ iodide (Molecular Probes, Inc , Eugene, OR) and diluted to 4 (ig/ml SSR regions for each DNA sample were analyzed using the following protocol. 35 1. Ten (il of amplification cocktail (see Table 2) was added to 5 fil (20 ng) of extracted DNA, 2 The DNA fragment flanked by sequences complementary to the primers present in the amplification cocktail was amplified by PCR (U S Patent No. 4,683,202 and U S. Patent No 4,683,195) using the following protocol 11 Printed from Mimosa WO 98/42870 PCT/US98/05550 1) 45 cycles of 50 sec at 95°C, 50 sec at 54°C and 80 sec at 72°C and 2) 1 cycle of 300 sec at 72°C, 3 Approximately 8 p.1 of each sample was loaded onto agarose gels composed of 2% Metaphor (FMC Corp , Rockland, ME), IX TBE, and 0.5 |ig/ml 5 ethidium bromide, and electrophoresed for 2 h at 6 1 V/cm in horizontal electrophoresis units to which IX TBE buffer and 0 5 (ig/ml ethidium bromide was added; and 4 DNA bands were visualized by UV fluorescence. 10 Table 2 Amplification Cocktail Reagent Stock Concentration Final Concentration Buffer* 10X 1.5X dNTPs 2 mM 0.3 mM Forward Primer 40 nM 0 45 |jM Reverse Primer 40 nM 0.45 |iM AmpliTaq Polymerase™ 5U/(il 0 05 U/nl * 1 OX Buffer is a pH 9.0 solution composed of 800 mM Tris-OH, 200 mM (NH4)2S04, and 25 mM MgCl2. 15 Localization of oil loci One hundred thirty three polymorphic SSR marker loci were used to genotype the recombinant inbreds from the LH119wx x ASKC28wx cross and one hundred and three polymorphic SSR marker loci were used to genotype the LH51 x ASKC28wx-denved population. In addition, twenty publicly available 20 polymorphic SSR loci with previously established chromosome locations and covering all ten maize chromosomes (available from Research Genetics, Huntsville, AL) were also mapped in both populations Genetic linkage and distance between marker loci was determined independently for each population using MAPMAKER 3 0 (Lincoln S E., et al. 25 (1993) Whitehead Inst. Biomed. Res , Cambridge, MA) This resulted m the establishment of ten linkage groups for each population corresponding to the ten chromosomes of maize. Each linkage group was assigned to a chromosome based upon linkage to the public SSR markers. Twenty-three and ten markers in the LH119wx x ASKC28wx and LH51 x ASKC28wx populations, respectively, were 30 not assigned chromosome positions because genetic linkage could not be clearly established. Analysis of variance was used to identify marker loci in linkage with trait loci conferring increased oil concentration. Oil concentration was used as a 12 Printed from Mimosa WO 98/42870 PCT/US98/05550 dependent vanable and separate ANOVAs were calculated with SAS Proc GLM (SAS Inst, Cary, NC) using each marker locus as a single independent variable (Edwards, M D., et al. (1987) Genetics 116 113-125) Therefore, for each ANOVA test the mean oil values of marker allele classes were compared. Marker 5 loci were declared significant if p < 0.05 Linkage data for significant marker loci was examined to determine both the number of trait loci present and their probable location Significant marker loci on the same linkage group are either detecting the same trait locus or alternatively different trait loci By careful examination of the phenotypic 10 variation explained by each marker locus along the chromosome, a determination of the number trait loci on a linkage group was made. Significant marker loci, on the same linkage group and uninterrupted by non-significant marker loci, were declared to be detecting the same trait locus on the chromosome If significant marker loci on the same chromosome were interrupted by non-significant marker 15 loci then each significant region was declared to contain a trait locus resulting in multiple trait loci on the same chromosome. To confirm the number of trait loci, marker data assigned to linkage groups and oil data were also analyzed with Mapmaker/QTL 1.0 (Lincoln, S.E. et al. (1990) Whitehead Inst. Biomed. Res., Cambridge, MA). Results with 20 Mapmaker/QTL were in agreement with the initial analysis for the number trait loci on each chromosome. Eleven and twelve loci controlling kernel oil concentration were located in the LHl 19wx x ASKC28wx and LH51 x ASKC28wx recombinant inbred populations, respectively Each oil locus is defined by one or more linked marker 25 loci. In instances where the same marker loci were used in both populations, alignment of linkage groups is possible. It was found that m most instances both populations localized the same oil loci. By considering common marker loci, a total of seventeen loci controlling kernel oil concentration were found Each oil 30 locus was assigned an arbitrary letter designation (Table 3) Table 3 Marker loci genetically linked to and predictive of the location of trait loci conferring increased kernel oil concentration Oil locus Chromosome Marker loci A 1 si 922 B 1 sl478,sl853,sl949 C 1 S1860, sl925, si931, s2150 D 2 s2175 13 Printed from Mimosa WO 98/42870 PCTYUS98/05550 E 3 si 394 F 4 sl476, s 1772, sl816, s2122, sl836 G 4 sl939, sl946 H 4 si 870 I 5 si 529 J 5 s2054, si647, sl500, sl545, sl774, s2097 K 6 sl457, s2055, sl757, s2125, sl780, sl375, sl797, s 1416, sl432, sl921 L 7 sl630, sl422, s2156 M 8 sl817, s2057 N 9 si544, si633, sl384, sl813, sl767, s2058, si933, sl513, sl484 0 10 si 756 P 10 si480 (positive oil allele m LH51) Q N.A.* sl750 *N.A. - chromosome location not known In instances where comparisons could be made, oil loci which were identified in one population were identified at the same location in the second 5 population. In two exceptions, an oil locus was found m one population, but not in the second population. In the first case, the allele with a positive oil effect was found in LH51 and thus it would be unexpected to identify the same locus in the LHl 19wx x ASKC28wx population In the second case, it was found that different ASKC28wx-denved marker alleles were segregating in the populations, 10 therefore, each population was measuring the oil effect of a different ASKC28wx allele at the trait locus. The most abundant ASKC28wx oil allele segregating in LHl 19wx x ASKC28wx had a positive oil effect versus the alternative LHl 19-derived allele, whereas in the LH51 x ASKC28wx population, the abundant ASKC28wx allele had no positive oil effect With the exception of the oil locus 15 linked to marker si480, all alleles with positive effects on oil concentration were derived from ASKC28wx EXAMPLE 2 MARKER-ASSISTED SELECTION OF BREEDING LINES USING GENETIC MARKERS FOR INCREASE KERNEL OIL CONCENTRATION 20 Genetic marker loci in linkage with oil trait loci are highly predictive of oil concentration and as such may be used as an indirect measurement of kernel oil in a marker-assisted selection program Accordingly, genotypic information from linked marker loci would facilitate the selection of breeding lines with increased oil concentration Direct oil measurements cannot differentiate between various 14 Printed from Mimosa WO 98/42870 PCT/US98/05550 genotypic trait locus compositions with equivalent phenotypic effects This is especially problematic in early generation segregating breeding populations where only limited fixation of oil loci has occurred By way of example, an objective of a com breeding program could be the 5 creation of new elite inbred lines which contain trait alleles conferring increased kernel oil concentration These trait alleles would be introduced by the mtermating of high oil germplasm with one or more elite corn inbreds The resultant hybrid could be self-pollinated to produce an F2 population for the purposes of initiating a conventional pedigree breeding program (Allard. R W. 10 (1960) Principles of Plant Breeding. John Wiley & Sons, Inc New York. Pp 115-128). In order to identify those F2 individuals with the desired genotypes, plant tissue would be collected from each F2 individual in the population and genotyped with the SSR marker loci listed m Table 1 Those F2 individuals with the highest 15 frequency of SSR marker alleles derived from the high oil source would be selected and further culled based upon their agronomic fitness With continued inbreeding and segregation, those oil loci in a heterozygous state could become fixed for either the high oil or low oil allele. It is therefore likely that genotyping and selection of later generation materials would be practiced in order to further 20 segregate breeding lines based upon their marker allele and hence oil allele composition Depending upon population size and serendipity, the resulting inbreds from the pedigree breeding program may not demonstrate sufficient agronomic competitiveness or sufficient kernel oil expression because an inadequate number 25 of oil alleles was recovered These new inbreds could therefore be used as parental material and new breeding projects initiated. The SSR markers could again be used for further selection of oil as described. It is obvious to those skilled in the art that many variants to selection methodology may by envisioned. Selection would be based upon the allelic 30 composition of one or more marker loci which identify trait oil loci present in a population. Further selection would be performed by examination and selection of genotypes from individual plants, families, or their progeny Various predictive models could be developed using genotypic information, which could generate various selection indices These models would permit weighting the effect 35 predicted by marker loci This is because the predictive value of an individual marker locus is dependent upon its genetic distance from the corresponding trait locus as well as the expressivity of the trait locus Selection strategies which combine phenotype-based and genotype-based selection may also be envisioned. 15 Printed from Mimosa WO 98/42870 PCT/US98/05550 The marker loci presented here are predictive of oil loci in Alexho synthetic populations Because ASKC28wx represents the 28th oil breeding cycle of a genetically closed population, earlier breeding cycles are composed of the same oil loci. It is expected that cycles differ simply in their allelic frequency at 5 the identified oil loci Therefore, in breeding populations derived from earlier Alexho cycles, the marker loci described in this invention will be useful in identification of oil loci and in prediction of oil concentration EXAMPLE 3 IDENTIFICATION OF CORN PLANTS FOR USE AS PARENTS 10 FOR THE PRODUCTION OF TRANSGRESSIVE SEGREGANTS FOR KERNEL OIL CONCENTRATION It is important to identify corn plants and lines which, when used as parents, have the greatest probability of producing offspring with superior performance. Transgressive segregant offspring of such parents would result from 15 the crossing of parents with complementary sets of alleles conferring the high-oil phenotype. Using the information provided herein, marker alleles which predict desired trait performance (i.e., high oil) at a given marker locus are known. By genotyping lines at those marker loci, the value of those lines as parents is revealed. For example, if one wanted to create an individual containing supenor 20 alleles at 5 separate oil loci (A-E), one could identify and cross a parent composed of desired alleles for locus A, B, and C with a parent composed of desired alleles at B, D, and E. These parents are complementary because they permit the recovery of progeny containing desired alleles at all 5 loci. Ideally, parents would be chosen which when combined ensure maximum complementation of loci, so 25 that a high frequency of desired recombinants are recovered. 16 Printed from Mimosa WO 98/42870 PCT/US98/05550 SEQUENCE LISTING (1) GENERAL INFORMATION: (l) APPLICANT (A) ADDRESSEE: E. I. DU PONT DE NEMOURS AND COMPANY (B) STREET- 1007 MARKET STREET (C) CITY WILMINGTON (D) STATE- DELAWARE (E) COUNTRY: USA (F) ZIP- 19898 (G) TELEPHONE. 302-992-4926 (H) TELEFAX. 302-773-0164 (I) TELEX: 6717325 (li) TITLE OF INVENTION: A METHOD TO IDENTIFY AND BREED CORN WITH INCREASED KERNEL OIL CONCENTRATION (ill) NUMBER OF SEQUENCES: 104 (IV) COMPUTER READABLE FORM: (A) MEDIUM TYPE DISKETTE, 3.50 INCH (B) COMPUTER: IBM PC COMPATIBLE (C) OPERATING SYSTEM: MICROSOFT WINDOWS 95 (D) SOFTWARE: MICROSOFT WORD VERSION 7.OA (v) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (vi) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER- 60/041,515 (B) FILING DATE- MARCH 24, 1997 (C) CLASSIFICATION: (vn) ATTORNEY/AGENT INFORMATION. (A) NAME MAJARIAN, WILLIAM R. (B) REGISTRATION NUMBER: P-41,173 (C) REFERENCE/DOCKET NUMBER: BB-107 6 17 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 1 (l) SEQUENCE CHARACTERISTICS (A) LENGTH 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n) MOLECULE TYPE, other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO:l-TTTATGGGTT GGGAGATACT TG 22 (2) INFORMATION FOR SEQ ID NO:2 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: AGATGTGTGC GTTTTTGAGA G 21 (2) INFORMATION FOR SEQ ID NO:3: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO. 3" TTACGGCCTA GACATTTCGA C 21 (2) INFORMATION FOR SEQ ID NO:4: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH 20 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY- linear (ii) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4. CACTTGCTTT CAGGTACCCA 20 18 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 5. (i) SEQUENCE CHARACTERISTICS (A) LENGTH 19 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO.5: CTGCCCAGTC CGTAATGAA 19 (2) INFORMATION FOR SEQ ID NO: 6- (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE, other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: TAGATTTATT TTCTGAACGA TTGG 24 (2) INFORMATION FOR SEQ ID NO:7: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (11) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:7: GATCTCTCTG AGGCTTGTCC 20 (2) INFORMATION FOR SEQ ID NO. 8- (i) SEQUENCE CHARACTERISTICS. (A) LENGTH. 19 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (ll) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION SEQ ID NO 8 TGTAGTTGAG GATGCTCCC 19 19 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO: 9 (i) SEQUENCE CHARACTERISTICS. (A) LENGTH 20 base pairs (B) TYPE' nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY- linear In] MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:9: AGGCAAGGCT TTCTTCATAC 20 (2) INFORMATION FOR SEQ ID NO:10 (1) SEQUENCE CHARACTERISTICS. (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:10-CGGACGACGA CTGTGTTC 18 (2) INFORMATION FOR SEQ ID NO:11- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH- 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (li) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO:11: ACATGAGAAA CAAGATAGAA CCAG 24 (2) INFORMATION FOR SEQ ID NO:12 (l) SEQUENCE CHARACTERISTICS (A) LENGTH 23 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO. 12 AAAATGTAAG AACTTGTTTG GGA 23 20 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO:13 (1) SEQUENCE CHARACTERISTICS. (A) LENGTH. 21 base pairs (8) TYPE nucleic acid (C) STRANDEDNESS' single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:13 CTGCTTATTG CTTTCGTCAT A (2) INFORMATION FOR SEQ ID NO:14 (i) SEQUENCE CHARACTERISTICS. (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:14: TGCTGCACTA CTTGAACCTA G (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH. 21 base pairs (B) TYPE, nucleic acid (C) STRANDEDNESS' single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO.15: ACACAGAGAT GACAAAAGCA A (2) INFORMATION FOR SEQ ID NO:16. (i) SEQUENCE CHARACTERISTICS. (A) LENGTH: 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS- single (D) TOPOLOGY: linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO 16 GCAGGCGTGC TATGAGAG 21 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 17 (l) SEQUENCE CHARACTERISTICS (A) LENGTH 18 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY- linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO-17 AGCGGTGAAA CCCTTATG 18 (2) INFORMATION FOR SEQ ID NO:18- (i) SEQUENCE CHARACTERISTICS (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: CTGTGGCTGG TTCCTCTC 18 (2) INFORMATION FOR SEQ ID NO:19: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH. 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:19-GCTCTTGATA AAAAGGCAAG T 21 (2) INFORMATION FOR SEQ ID NO.20 (i) SEQUENCE CHARACTERISTICS (A) LENGTH. 22 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO-20-CTTGTTGTAA TGGATGAGTG AG 22 22 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.21' !1) SEQUENCE CHARACTERISTICS (A) LENGTH 19 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY- linear (11) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO 21 GCTCGTAGTA GGGGTTACG (2) INFORMATION FOR SEQ ID NO:22- (I) SEQUENCE CHARACTERISTICS: (A) LENGTH 18 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: GACAGCCTCA CCTCAAGA (2) INFORMATION FOR SEQ ID NO:23: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO-23: ACAGATCTTG ACACGTACAT ACC (2) INFORMATION FOR SEQ ID NO-24" (1) SEQUENCE CHARACTERISTICS. (A) LENGTH 21 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (II) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.24. GGACGTGTAT CCTCAAATCA T 23 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.25 (l) SEQUENCE CHARACTERISTICS. (A) LENGTH 20 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: CAGCGAATAC TGAATAACGC 20 (2) INFORMATION FOR SEQ ID NO:26: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH 19 base pairs (B! TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: TGTTGGATGA GCACTGAAC 19 (2) INFORMATION FOR SEQ ID NO-.27: (l) SEQUENCE CHARACTERISTICS (A) LENGTH 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS- single (D) TOPOLOGY. linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.27: TGTTCTCAAC AACCACCG 18 (2) INFORMATION FOR SEQ ID NO-28: (l) SEQUENCE CHARACTERISTICS (A) LENGTH. 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO 28. CGTTTAGCGA TATCATTTTC C 21 24 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO:29. (l) SEQUENCE CHARACTERISTICS. (A) LENGTH: 23 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY- linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29. GATCCTACCA AAATCTTATA GGC 23 (2) INFORMATION FOR SEQ ID NO:30. (1) SEQUENCE CHARACTERISTICS. (A) LENGTH. 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:30 ACAGCTAGCC AAGATCTGAT T 21 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH- 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31 CGATACTAAT GGAAGCCCTA A 21 (2) INFORMATION FOR SEQ ID NO.32: (l) SEQUENCE CHARACTERISTICS (A) LENGTH 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:32 ATGGCCCATT AAGTTTATCA C 21 25 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.33 (i) SEQUENCE CHARACTERISTICS. (A) LENGTH 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: AAAGCGTAGT CGGAAAGC 18 (2) INFORMATION FOR SEQ ID NO:34. (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: ACCAATGATC TTTACGCAGA T 21 (2) INFORMATION FOR SEQ ID NO:35: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO 35: TAATCAGAGC GTACATCAGG A 21 (2) INFORMATION FOR SEQ ID NO:36. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH- 19 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY- linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO.36: AGGGCATCAA TCAAGAATG 19 26 Printed from Mimosa WO 98/42870 PCT/US98/05S50 12) INFORMATION FOR SEQ ID NO:37 (l) SEQUENCE CHARACTERISTICS- (A) LENGTH 21 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY linear In) MOLECULE TYPE: other nucleic acid |xi) SEQUENCE DESCRIPTION. SEQ ID NO:37-GAGACTTTTG AGGAGAAAGC A 21 (2) INFORMATION FOR SEQ ID NO.38: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE, nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: GATCAAAAGA GCAAAAGGAG A 21 (2) INFORMATION FOR SEQ ID NO.39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH- 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (li) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:39-AACTGATGAA TACCTTCCCA G 21 (2) INFORMATION FOR SEQ ID NO.40: (l) SEQUENCE CHARACTERISTICS (A) LENGTH. 21 base pairs (B) TYPE. nucleic acid CC) STRANDEDNESS: single {D) TOPOLOGY linear In) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO 40 TGATTAACTT CTCCCTTTGG T 21 27 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 41- (i) SEQUENCE CHARACTERISTICS. (A) LENGTH 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear In) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION SEQ ID NO:41: TCGGCACAAC ATATGAGTTA C 21 (2) INFORMATION FOR SEQ ID NO:42. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.42: CCCCCATAGA GAGAGATAGA G 21 (2) INFORMATION FOR SEQ ID NO:43: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ll) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: AAGCACGGCC CAATAGAAT 19 (2) INFORMATION FOR SEQ ID NO:44: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH. 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS- single (D) TOPOLOGY linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44 AGGATGTCCC TAGCTTTATT G 21 28 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.45: (x) SEQUENCE CHARACTERISTICS. (A) LENGTH 18 base pairs (B) TYPE. nucleic acxd (C) STRANDEDNESS- single (D) TOPOLOGY linear (xi) MOLECULE TYPE other nuclexc acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:45. TCATTGCCCA AAGTGTTG 18 (2) INFORMATION FOR SEQ ID NO 46: (x) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acxd (C) STRANDEDNESS: sxngle (D) TOPOLOGY. linear (xi) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:46: CTCATCACCC CTCCAGAG 18 (2) INFORMATION FOR SEQ ID NO:47: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH- 18 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:47: GATCCACGCC ATTTAAAC 18 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 20 base pairs (B) TYPE nucleic acxd (C) STRANDEDNESS- single (D) TOPOLOGY linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO 48 TGATACTCTG GTGCATGTTC 20 29 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.49. (l) SEQUENCE CHARACTERISTICS (A) LENGTH: 18 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY. linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.49: GATCGCTCCG ATCTATCC (2) INFORMATION FOR SEQ ID NO:50 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH. 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50. AGCGGCATCT ATGTTCTATG (2) INFORMATION FOR SEQ ID NO:51: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (11) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:51: CCCAGTGCGA AGAGACTC (2) INFORMATION FOR SEQ ID NO:52 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO.52 ACACCTGCTC TGCACCAC 30 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO'53- (l) SEQUENCE CHARACTERISTICS. (A) LENGTH' 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS single <DJ TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53. CTAACCCACG ACGACCCT 18 (2) INFORMATION FOR SEQ ID NO:54: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ll) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: GCATGAGTGC ATGTGCAT 18 (2) INFORMATION FOR SEQ ID NO:55: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION. SEQ ID NO:55: CTGCCACATG CTTTTCTG 18 (2) INFORMATION FOR SEQ ID NO:56: (l) SEQUENCE CHARACTERISTICS (A) LENGTH: 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO.56 CTGTAAAGAA GCTGGTCTGG A 21 31 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 57. (l) SEQUENCE CHARACTERISTICS (A) LENGTH. 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: TTCTCCTCAT GGATGCGT 18 (2) INFORMATION FOR SEQ ID NO:58 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE, nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n| MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: CTATTTGGAA GTATGGGCTT CA 22 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY- linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: GAGGGCATCT ATGTGCAAC 19 (2) INFORMATION FOR SEQ ID N0:60- (l) SEQUENCE CHARACTERISTICS. (A) LENGTH 20 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO 60. GCTCAGAAGT TGCGTTTATG 20 32 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 61 (l) SEQUENCE CHARACTERISTICS (A) LENGTH 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (11) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO:61: TTCCTTCACG TTTCTCTGTT AA 22 (2) INFORMATION FOR SEQ ID NO:62 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:62: CACATAAACC TAATGGGGTA CA 22 (2) INFORMATION FOR SEQ ID NO:63: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH- 19 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:63: CCCAAAGGCG ATACCTATT 19 (2) INFORMATION FOR SEQ ID NO.64. (l) SEQUENCE CHARACTERISTICS: (A) LENGTH 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (li) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO"64 CCCACTTTCT CACTCTTTTC T 21 33 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO 65 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 22 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY. linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: GAGGTGAGTA CTATGCAAAT GC (2) INFORMATION FOR SEQ ID NO:66: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE, nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (li) MOLECULE TYPE. other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO:66 CAGGCTTACC TAGCCTTCTC (2) INFORMATION FOR SEQ ID NO:67: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:67. CTATGGATGG CTGCTTGC (2) INFORMATION FOR SEQ ID NO 68: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH" 18 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (li) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO-68. GTCAGGCAGC AGAATGTG 34 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO-69" (i) SEQUENCE CHARACTERISTICS. (A) LENGTH 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY. linear (:i) MOLECULE TYPE. otner nucleic acid (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:69: AAACCGTCCA GCGACTAC (2) INFORMATION FOR SEQ ID NO:70 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY linear (ii) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID N0:70: GGAAGAACCA ATCCCATATC T (2) INFORMATION FOR SEQ ID NO:71: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE, other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO.71: AACATCCTGT CGGAAACAG (2) INFORMATION FOR SEQ ID NO:72 (l) SEQUENCE CHARACTERISTICS- (A) LENGTH. 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY- linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO-72. TCATCACGTC TCTCTTTCAA C 35 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.73 (i) SEQUENCE CHARACTERISTICS (A) LENGTH' 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION' SEQ ID NO:73 TTGTGGCAGA ATCTCAAATT A 21 (2) INFORMATION FOR SEQ ID NO:74: (i) SEQUENCE CHARACTERISTICS. (A) LENGTH 19 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: CGACTGGTGA CATGTGAAG 19 (2) INFORMATION FOR SEQ ID NO:75: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.75 AGTGAGGAAA GAATATGCTG G 21 (2) INFORMATION FOR SEQ ID NO:76: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 21 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (li) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO.76. TGGACTGAGA AACTGATTTG A 21 36 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO:77 (l) SEQUENCE CHARACTERISTICS (A) LENGTH: 22 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION: SEQ ID NO 77-CACAAATGTG AAGGTAAACA CT 22 (2) INFORMATION FOR SEQ ID NO:78: (l) SEQUENCE CHARACTERISTICS. (A) LENGTH- 19 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.78: AATGGTACGG TTCAGGATG 19 (2) INFORMATION FOR SEQ ID NO:79: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.79: AGATGACGCA CGGAACAC 18 (2) INFORMATION FOR SEQ ID NO:80. (i) SEQUENCE CHARACTERISTICS. (A) LENGTH: 19 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID N0:80. AGCATCATGT AGCAGGAGG 19 37 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.81 (l) SEQUENCE CHARACTERISTICS (A) LENGTH- 19 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:81-TTGCAGCACT GTCGTAGTC 19 (2) INFORMATION FOR SEQ ID NO:82: (l) SEQUENCE CHARACTERISTICS (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:82: GCGCGAGTGG AGTAGTAAG 19 (2) INFORMATION FOR SEQ ID NO:83: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (li) MOLECULE TYPE: otner nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO-83. AAGATTATGC AGATGAGACA CC 22 (2) INFORMATION FOR SEQ ID NO:84: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH- 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY. linear (li) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION. SEQ ID NO-84 GTTCCATGCT TTCCTTGG 18 38 Printed from Mimosa WO 98/42870 PCMJS98/05550 (2) INFORMATION FOR SEQ ID NO 85- <i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS- single (D) TOPOLOGY. linear (li) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85: CTCTGGGCTC TGTGTTAGAG T 21 (2) INFORMATION FOR SEQ ID NO:86: (i) SEQUENCE CHARACTERISTICS- (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86-CTCTGGGCTC TGTGTTAGAG T 21 (2) INFORMATION FOR SEQ ID NO:87: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION. SEQ ID NO:87: CTGCTTTCTC TGTTCCAGC 19 (2) INFORMATION FOR SEQ ID NO:88: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH. 21 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY: linear (n) MOLECULE TYPE other nucleic acid (XI) SEQUENCE DESCRIPTION- SEQ ID NO:88 AATCGCTTAC TTGTAACCCA C 21 39 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO.89. (l) SEQUENCE CHARACTERISTICS: (A) LENGTH. 21 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:89 AAGAACGTAC GTCCCATAAA G 21 (2) INFORMATION FOR SEQ ID NO:90- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS. single (D) TOPOLOGY, linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90: CAAGGTAAAG TGACAAAGCA G 21 (2) INFORMATION FOR SEQ ID NO:91: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single CD) TOPOLOGY- linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:91: GTTCAGGATG AGGCGGAA 18 (2) INFORMATION FOR SEQ ID NO:92: (i) SEQUENCE CHARACTERISTICS. (A) LENGTH. 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY- linear (n) MOLECULE TYPE: other nucleic acid (XI) SEQUENCE DESCRIPTION- SEQ ID NO:92: GTGATCATCG CAGGAGACC 19 40 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO-93" (i) SEQUENCE CHARACTERISTICS: (A) LENGTH- 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS- single (D) TOPOLOGY: linear (u) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.93: GGAGCCTGGA GTGAGAAC 18 (2) INFORMATION FOR SEQ ID NO-94: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH. 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94: CATGCTCACC TAACGTGG 18 (2) INFORMATION FOR SEQ ID NO:95: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:95 ATCTGAACAC TTGAGCAACA A 21 (2) INFORMATION FOR SEQ ID NO:96: (i) SEQUENCE CHARACTERISTICS. (A) LENGTH. 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:96: ATAGACCGGA CCCATCAC 18 41 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO:97 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH 18 base pairs (B) TYPE. nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97 CGAACAGCGG GTACACCT 18 (2) INFORMATION FOR SEQ ID NO:98: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98: GAGGTCAGCT TCCTCGATCT 20 (2) INFORMATION FOR SEQ ID NO:99: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION- SEQ ID NO:99: GGAATCGTTC CTCCACAC 18 (2) INFORMATION FOR SEQ ID NO:100- (l) SEQUENCE CHARACTERISTICS: (A) LENGTH. 18 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE. other nucleic acid (XI) SEQUENCE DESCRIPTION- SEQ ID NO:100. CTTCCTCGGT GTCAGACG 18 42 Printed from Mimosa WO 98/42870 PCT/US98/05550 (2) INFORMATION FOR SEQ ID NO:101. (l) SEQUENCE CHARACTERISTICS-(A) LENGTH 21 base pairs {B) TYPE- nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (n) MOLECULE TYPE- other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO.101: ATGGAAACAT CAAAGTGGAT T 21 (2) INFORMATION FOR SEQ ID N0-102: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH. 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY. linear (n) MOLECULE TYPE. other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:102: TGCTACCCTG ATGACCTGAT 20 (2) INFORMATION FOR SEQ ID NO:103- (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear In) MOLECULE TYPE: other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103: ACCACTAGTC TCATATGAAG GG 22 (2) INFORMATION FOR SEQ ID NO:104. (l) SEQUENCE CHARACTERISTICS. (A) LENGTH 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY: linear (n) MOLECULE TYPE other nucleic acid (xi) SEQUENCE DESCRIPTION SEQ ID NO:104 GGTAGGTGGG TAGGGGTT 18 43 Printed from Mimosa </div>

Claims

<div class="application article clearfix printTableText" id="claims"> -44- 10 15 20 The claims defining the invention are as follows^- l A method of breeding for corn with increased kernel oil concentration comprising: a) using one or more genetic markers to select a corn plant from a 5 com breeding population by marker-assisted selection, wherein the genetic markers are selected from the group consisting of s 1375. sl384, sl394, sl416, sl422, sl432, sl457, sl480, sl476, sl478,sl484,sl500, sl513,sl529,sl544,sl545,sl630, sl633, si647, si750, si756, si757, si767, si772, si774, si780, si797, sl813, S1816, S1817, sl836, sl853, sl860,sl870,sl921, sl922, si925, s1931,S1933, sl939,sl946,sl949,s2054,s2055, s2057, s2058,s2097,s2122, s2125,s2l50, s2156 and s2175; and b) crossing the selected corn plant with a second corn plant wherein the progeny corn plants of the cross display increased kernel oil concentration.
2. The method of claim 1 wherein the selected com plant is member of an Alexho synthetic population or a progeny thereof.
3. A method for identifying com plants or com lines for use as parents for creation of a breeding population, the method comprising: a) genotyping com plants or com lines with one or more genetic markers wherein the genetic markers are selected from the group consisting of sl375, sl384, sl394, sl416, sl422, sl432, sl457, sl480, sl476, sl478, sl484,sl500,sl513,sl529,sl544, sl545, sl630, sl633, si647, sl750, sl756, sl757, sl767, sl772, sl774, si780, si797, sl813, sl816, sl817,sl836,sl853,sl860, sl870, sl921, si922, sl925, sl931,sl933,sl939,sl946,sl949, s2054, s2055,s2057,s2058, s2097,s2122,s2125,s2150, s2156 and s2175; and b) identifying com plants or com lines which, based upon their genotype, are predicted to produce transgressive segregants for kernel oil concentration.
4 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s2054, s1647, s1500, s1545, s1774 and s2097
5. A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1817 and s2057 . 25 30 -45-
6. A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1860, s1931, s2150 and s1925 5
7 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1457, s2055, s1757, s2125, s1780, s1375, s1797, s1416, s1432 and s1921 10
8 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1544, s1633, s1384, s1813, s1767, s2058, s1933, s1513 and s1484 15
9 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1476, s1772, s1816, s2122 and s1836
10. A plant produced by the method of claim 1, having a trait locus 20 controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1939 and s1946 25 30
11 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1478, s1853 and s1949.
12 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by a genetic marker selected from the group consisting of s1630, s1422 and s2156
13. A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker s1756 50 NO m o m 3> -< m r*o CD CD o 15/05/01 ,cfop845 speci,45 -46-
14 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker of s1922 5
15 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker of S1529
16 A plant produced by the method of claim 1, having a trait locus 10 controlling kernel oil concentration said locus mapped by the genetic marker of S1394
17 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker of 15 s1750
18 A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker of s1870 20
19. A plant produced by the method of claim 1, having a trait locus controlling kernel oil concentration said locus mapped by the genetic marker of S2175 25
20. Corn plants that display increased kernel oil concentration produced by the method of claim 1
21 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s2054, s1647, s1500, s1545, s1774 and s2097 or a 30 functional fragment thereof
22 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1817 and s2057 or a functional fragment thereof. INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 1 MAY 2001 15/05/01 ,cfop845 speci,46 -47-
23 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1860, s1931, s2150 and s1925 or a functional fragment thereof. 5
24 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1457, s2055, s1757, s2125, s1780, s1375, s1797, s1416, s1432 and s 1921 or a functional fragment thereof
25 An isolated nucleic acid comprising a genetic marker selected from 10 the group consisting of s1544, s1633, s1384, s1813, s1767, s2058, s1933, s1513 and s1484 or a functional fragment thereof
26 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1476, s1772, s1816, s2122 and s1836 or a functional 15 fragment thereof
27 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1939 and s1946 or a functional fragment thereof 20
28 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1478, s1853 and s1949 or a functional fragment thereof
29 An isolated nucleic acid comprising a genetic marker selected from the group consisting of s1630, s1422 and s2156 or a functional fragment thereof 25
30 An isolated nucleic acid comprising the genetic marker s1756 or a functional fragment thereof.
31 An isolated nucleic acid comprising the genetic marker s1922 or a 30 functional fragment thereof
32 An isolated nucleic acid comprising the genetic marker s1529 or a functional fragment thereof INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 1 MAY 2001 RECEIVED 15/05/01 ,cfop845 speci,47 -48-
33. An isolated nucleic acid comprising the genetic marker s1394 or a functional fragment thereof
34 An isolated nucleic acid comprising the genetic marker s1750 or a 5 functional fragment thereof
35 An isolated nucleic acid comprising the genetic marker s1870 or a functional fragment thereof 10
36 An isolated nucleic acid comprising the genetic marker s2175 or a functional fragment thereof.
37. A method of claim 1 of breeding for corn with increased kernel concentration which method is substantially as herein described with reference to 15 any one of the Examples 38 A method of claim 3 for identifying corn plants or corn lines for use as parents for creation of a breeding population which method is substantially as herein described with reference to any one of the Examples 20 39 A plant of any one of claim 4 to 20, substantially as herein described with reference to any one of the Examples 40 An isolated nucleic acid of any one of claims 21 to 36, substantially 25 as herein described with reference to any one of the Examples. DATED this 15th day of May 2001. 30 E.I. DU PONT DE NEMOURS AND COMPANY By their Patent Attorneys INTELLECTUAL PROPERTY OFFICE OF N.Z. 2 1 MAY 2001 RECEIVED 15/05/01 ,cfop845 speci,48 END </div>