NZ291984A

NZ291984A - Bleach-containing cleaning composition comprising a mutant alpha-amylase and optionally a mutant protease

Info

Publication number: NZ291984A
Application number: NZ291984A
Authority: NZ
Inventors: Christopher C Barnett; Colin Mitchinson; Scott D Power
Original assignee: Genencor Int
Priority date: 1994-08-11
Filing date: 1995-08-09
Publication date: 1998-04-27
Also published as: CN1158637A; JPH10504197A; AU686007B2; EP0775201A2; KR970704872A; WO1996005295A3; FI970563A0; MX9700776A; NO970609D0; FI970563A; CO4440440A1; CA2197203A1; HUT77748A; AU3366295A; BR9508582A; WO1996005295A2; PL318209A1; NO970609L

Description

<div class="application article clearfix" id="description"> New Zealand No. 291984 International No. PCT/US95/10426 TO BE ENTERED AFTER ACCEPTANCE AND PUBLICATION Priority dates: 11.08.1994; Complete Specification Filed: 09.08.1995 Classification.^) C12N9/28.54; C11D3/386 Publication date: 27 April 1998 Journal No.: 1427 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of Invention: Cleaning composition Name, address and nationality of applicant(s) as in international application form: GENENCOR INTERNATIONAL, INC., 4 Cambridge Place, 1870 South Winton Road, Rochester, New York 14618, United States of America WO 96/05295 PCWttSaS/10426 CLEANING COMPOSITION 1984 " 3 FEB 1996 of New Zealand Field of the Invention The present invention relates to a bleach containing cleaning composition comprising novel alpha-amylase mutants having an amino acid sequence not found in nature, such mutants having an amino acid sequence wherein^ one or more amino acid residue(s) of a precursor alpha-amylase, specifically any oxidizable amino acid, have been substituted with a different amino acid. The mutant enzymes of the present invention exhibit altered stability/activity profiles including but not limited to altered oxidative stability, altered pH performance profile, altered specific activity and/or altered thermostability. Background eg tha Invention Alpha-amylases (alpha-1,4-glucan-4-glucanohydrolase, EC3.2.1.1) hydrolyze internal alpha-1,4-glucosidic linkages in starch largely at random, to produce smaller molecular weight malto-dextrins. Alpha-amylases are of considerable commercial value, being used in the initial stages (liquefaction) of starch processing; in alcohol production; as cleaning agents in detergent matrices; and in the textile industry for starch desizing. Alpha-amylases are produced by a wide variety of microorganisms including Bacillus and Aspergillus, with most commercial amylases being produced from bacterial sources such as B. licheniformis, B. amyloliqruefaciens, B. subcilis, or B. stearothermophilus. In recent years the preferred enrymes in commercial use have been those from B. lichenifozmis because of their heat stability and performance, at least at neutral and mildly alkaline pH's. Previously there have been studies using recombinant DNA techniques to explore which residues are important for the catalytic activity of amylases and/or to explore the effect of modifying certain amino acids within the active site of various amylases (Vihinen, M. et al. (1990) J. Bichem. 107:267-272; Holm, L. et al. (1990) Protein Engineering 3:181-191; Takase, K. et al. (1992) Biochemica et Biophysica Acta, 1120:281-288; Matsui, I. et al. ( ! - 3 PFB 1998 of New Zealand WO 96/05295 PCT/OS95/10426 Vol. 310, No. 3, pp. 236-218); which residues are important for thermal stability (Suzuki, Y. et al. (1989) J. Biol. Chem. 264:18933-18938); and one group has used such methods to introduce mutations at various histidine residues in a £. licheniformis amylase, the rationale for making substitutions at histidine residues was that B. licheniformis amylase (known to be thermostable) when compared to other similar Bacillus amylases, has an excess of histidines and, therefore, it was suggested that replacing a histidine could affect the thermostability of the enzyme (Declerck, N. et al. (1990) J. Biol. Chem. 265:15481-15488; FR 2 665 178-A1; Joyet, P. et al. (1992) Bio/Technology 10:1579-1583). It has been found that alpha-amylase is inactivated by hydrogen peroxide and other oxidants at pH's between 4 and 10.5 as described in the examples herein. Commercially, alpha-amylase enzymes can be used under dramatically different conditions such as both high and low pH conditions, depending on the commercial application. For example, alpha-amylases may be used in the liquefaction of starch, a process preferably performed at a low pH (pH <5.5). On the other hand, amylases may be used in commercial dish care or laundry detergents, which often contain oxidants such as bleach or peracids, and which are used in much more alkaline conditions. In order to alter the stability or activity profile of amylase enzymes under varying conditions, it has been found that selective replacement, substitution or deletion of oxidizable amino acids, such as a methionine, tryptophan, tyrosine, histidine or cysteine, results in an altered profile of the variant enzyme as compared to its precursor. Because currently commercially available amylases are not acceptable (stable) under various conditions, there is a need for an amylase having an altered stability and/or activity profile. This altered stability (oxidative, thermal or pH performance profile) cam be achieved while maintaining adequate enzymatic activity, as compared to the wild-type or precursor enzyme. The characteristic affected by introducing such mutations may be a change in oxidative stability while maintaining thermal stability or vice versa. Additionally, the substitution of different amino acids for an oxidizable amino acids in the alpha-amylase precursor sequence or the deletion of one or more oxidizable amino acid(s) may result in altered enzymatic activity at a pH other than that which is considered optimal for the precursor alpha- 2 WO 96/05295 PCT/US95/10426 amylase. In other words, the mutant enzymes of the present \7 invention may also have altered pH performance profiles, which may be due to the enhanced oxidative stability of the enzyme. Summary of the Invention The present invention provides a bleach-containing cleaning composition, comprising a mutant alpha-amylase that is the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the substitution of a methionine at a position equivalent to M+197 in B. licheniformis alpha-amylase and the substitution of one or more methionine or tryptophan at a position equivalent to M+15 or W+138 in B. licheniformis alpha-amylase. Brief Description of the Invention Described but not claimed are alpha-amylase mutants that are the expression product of a mutated DNA sequenceTencoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the deletion or substitution (replacement) of one or more oxidizable amino acid. substituting a different amino acid for one or more methionine residue(s) in the precursor alpha-amylase. In another embodiment the mutants comprise a substitution of one or more tryptophan residue alone or in combination with the substitution of one or more methionine residue in the precursor alpha-amylase. Such mutant alpha-amylases, in general, are obtained by in vitro modification of a precursor DNA sequence encoding a naturally occurring or recombinant alpha-amylase to encode the substitution or deletion of one or more amino acid residues in a precursor amino acid sequence. Preferably the substitution or deletion of one or more amino acid in the amino acid sequence is due to the replacement or deletion of one or more methionine, tryptophan, cysteine, histidine or tyrosine residues in such sequence, most preferably the residue which is changed is a methionine residue. The oxidizable amino acid residues may be replaced by any of the other 20 naturally oqcttjarimo Jaaino In one embodiment the mutant result from '«•(«! |5ri^ Office " 3 m 1998 3 of New Zealand **1984 acids. If the desired effect is to alter the oxidative stability of the precursor, the amino acid residue may be substituted with a non-oxidizable amino acid (such as alanine, arginine, asparagine, aspartic acid, glutamic acid, glutamine, glycine, isoleucine, -leucine, lysine, phenylalanine, proline, serine, threonine, or valine) or another oxidizable amino acid (such as cysteine, methionine, tryptophan, tyrosine or histidine, listed in order of most easily oxidizable to less readily oxidizable). Likewise, if the desired effect is to alter thermostability, any of the other 20 naturally occurring amino acids may be substituted (i.e., cysteine may be substituted for methionine). (followed by page 4) ~ 3 ppp jggg of New Zealand Preferred mutants comprise the substitution of a methionine' r« equivalent to any of the methionine residues found in B. licheniformis alpha-amylase (+8, +15, +197, +256, +304, +3 66 and +438) . In preferred mutants useful in the present invention, the methionine to be replaced is a methionine at a position equivalent to position +197 or +15 in B. licheniformis alpha-amylase. Preferred substitute amino acids to replace the methionine at position +197 are alanine (A), isoleucine (.1), threonine (T) or cysteine (C). The preferred substitute amino acids at position +15 are leucine (L), threonine (T), asparagine (N) , aspartate (D), serine (S), valine (V) and isoleucine (I), although other substitute .amino acids not specified above may be useful. TV/o specifically preferred mutants of use in the present invention are M197T and M15L. Also described for use in this invention are mutants comprising the substitution of a tryptophan residue equivalent to any of the tryptophan residues found in B. licheniformis alpha-amylase (see Fig. 2). Preferably the tryptophan to be replaced is at a position equivalent to +138 in B. licheniformis alpha-amylase. A mutation (substitution) at a tryptophan residue may be made alone or in combination with mutations at other oxidizable amino acid residues. Specifically, it may be advantageous to modify by substitution at least one tryptophan in combination with at least one methionine (for example, the double mutant +138/+197). The alpha-amylase mutants useful in the present invention, in general, exhibit altered oxidative stability in the presence pf hydrogen peroxide and other oxidants such as bleach or peracids, or, more specific, milder oxidants such as chloramine-T. Mutant enzymes having enhanced oxidative stability will be useful in extending the shelf life and bleach, perborate, percarbonate or peracid compatibility of amylasos used in cleaning products. Similarly, reduced oxidative stability may be useful in industrial processes that require the rapid and efficient quenching' of enzymatic activity. The mutant enzymes may also demonstrate a broadened pH performance profile whereby mutants such as M15L show stability for low pH starch liquefaction and mutants such as M197T show stability at high pH cleaning product conditions. The mutants may also have altered thermal stability whereby the mutant may have enhanced stability at either high or low temperatures. It is understood that any chance» > , u _ . 4 ~ 3 FFR 1998 of New Zealand WO 96/05295 P (increase or decrease) in the mutant's enzymatic characteristic(s), as compared to its precursor, may be beneficial depending on the desired end use of the mutant alpha-amylase. In addition to starch processing and cleaning applications, variant amylases described may be used in any application in which known amylases are used, for example, variant amylases can be used in textile processing, food processing, etc. Specifically, it is contemplated that a variant enzyme such as M197C, which is easily inactivated by oxidation, would be useful in a process where it is desirable to completely remove amylase activity at the end of the process, for example, in frozen food processing applications. The preferred alpha-amylase mutants of use in the present invention are derived from a Bacillus strain such as B. licheniformis, B. amyloliguefaciens, and B. stearothermophilus, and most preferably from Bacillus licheniformis. form of the alpha-amylase normally produced by B. licheniformis. This novel form, designated as the A4 form, has an additional four alanine residues at the N-terminus of the secreted amylase. (Fig. 4b.) Derivatives or mutants of the A4 form of alpha-amylase are encompassed for use within the present invention. By derivatives or mutants of the A4 form, it is meant the A4 form alpha-amylase containing one or more additional mutations such as, for example, mutation (substitution, replacement or deletion) of one or more oxidizable amino acid(s). In a composition embodiment of the present invention there is provided a bleach-containing cleaning composition, comprising a mutant alpha-amylase that is the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived f^rom a precursor alpha-amylase by the substitution of a methionine at a position equivalent to M+197 in B. licheniformis alpha-amylase and the substitution of one or more methionine or tryptophan at a position equivalent to M+15 or W+138 in B. licheniformis alpha-amylase. Also described is a novel 5 (followed by page 5a) , RECEIVED Intellaotual Property Office " 3 FFR 1998 of Naw Zealand 19*A The compositions may be liquid, gel or granular. Particularly preferred are detergent coinpositions comprising a +197 position mutant either alone or in combination with other enzymes such as endoglycosidases, cellulases, proteases, lipases or other amylase enzymes. Additionally, it is contemplated that the compositions of the present invention may include an alpha-amylase mutant having more than one site-specific mutation. 53 iM.iF E C E I V E D (followed by page 6) wteneotual Property Office " 3 FEB 1998 of New Zealand WO 96/05295 PCT/OS95/10426 Also described are compositions useful in starch processing anu particularly starch liquefaction. The starch liquefaction compositions preferably comprise an alpha-amylase mutant having a substitution or deletion at positi^£s5 Additionally, it is contemplated that such compositions may comp additional components as known to those skilled in the art, including, for example, antioxidants, calcium,-ions, etc. Also described but not claimed are methods for liquefying starch, and particularly granular starch slurries, from either a wet or dry milled process. Generally, in the first step of. the starch degradation process, the starch slurry is gelatinized by heating at e relatively high temperature (up to about 110°C). After the starch slurry is gelatinized it is liquefied and dextrinized using an alpha-amylase. The conditions for such liquefaction are described in commonly assigned US patent application 07/785,623 published as WO 93/09244 and US Patents 5,180,669 and 5,322,778, the disclosure of which are incorporated herein by reference. The method for liquefying starch comprises adding to a starch slurry an effective amount of an alpha-amylase described herein, alone or in combination with additional excipients such as an antioxidant, and reacting the slurry for an appropriate time and temperature to liquefy the starch. Also described is the DNA encoding the mutant alpha-amylases useful in the present invention (including A4 form and mutants thereof) and expression vectors encoding the DNA as well as host cells transformed with such expression vectors. Briaf DMBcrlofclon of fch« Drawing* Fig. 1 shows the DNA sequence of the gene for alpha-amvlase from B. licheniformis (NCIB8061), Seq ID No 31, and deduced translation product as described in Gray, G. et al. (1986) J. Bacter. 166:635-643 . Fig. 2 shows the amino acid sequence of the mature alpha-amylase enzyme from B. licheniformis (NCIB8061), Seq ID No 32. Fig. 3 shows an alignment of primary structures of Bacillus alpha-amylases. The B. licheniformis amylase (Am-Lich), Seq ID No 33, is described by Gray, G. et al.'(1986) J. Bact. 166:635-643; the B. amyloliquefaciens amylase (Am-Amylo) , Seq ID No 34, is q e "3 rra 1998 of New Zealand WO 96/05295 PCT/US95/10426 Takkinen, K. et al. (1983) J. Biol. Chem. 258:1007-1013; and the B. stearo thermophilics (Am-Stearo) , Seq ID No 35, is described by Ihara, H. et al. (1985) J. Biochem. 98:95-103. Fig. 4a shows the amino acid sequence of the mature alpha-amylase variant M197T, Seq ID No 36. Fig. 4b shows the amino acid sequence of the A4 form of alpha-amylase from B. licheniformis NCIB8061, Seq ID No 37. Numbering is from the N-terminus, starting with the four additional alanines. Fig. 5 shows plasmid pA4BL wherein BLAA refers to B. licheniformis alpha-amylase gene, PstI to SstI; Amp* refers to the ampicillin-resistant gene from pBR322; and CAT refers to the Chloramphenicol-resistant gene from pC194. Fig. € shows the signal sequence-mature protein junctions for B. licheniformis (Seq ID No 38), B. siibtilis (Seq ID No 39), B. licheniformis in pA4BL (Seq ID No 40) and B. licheniformis in pBLapr (Seq ID No 41). Fig. 7a shows inactivation of certain alpha-amylases (Spezyme® AA20 and M197L (A4 form) with 0.88M H202 at pH 5.0, 25°C. Fig. 7b shows inactivation of certain alpha-amylases (Spezyme® AA20, M197T) with 0.88M H202 at pH 10.0, 25°C. Fig. 7c shows inactivation of certain alpha-amylases (Spezyme® AA20, M15L) with 0.88M H202 at pH 5.0, 25°C. Fig. 8 shows a schematic for the production of M197X cassette mutants. Fig. 9 shows expression of M197X variants. Fig. 10 shows thermal stability of M197X variants at pH 5.0, 5mM CaCl2 at 95°C for 5 mins. Figs. 11a and lib show inactivation of certain amylases in automatic dish care detergents. Fig. 11a shows the stability of certain amylases in Cascade™ (a commercially available dish care product) at WO 96/05295 PCT/US95/10426 65°C in the presence or absence of starch. Fig. lib shows the stability of certain amylases in Sunlight1" (a commercially available dish care product) at 65°C in the presence or absence of starch. Fig. 12 shows a schematic for the production of M15X cassette mutants. Fig. 13 shows expression of M15X variants. Fig. 14 shows specific activity of M15X variants on soluble starch. Fig. 15 shows heat stability of M15X variants at 90°C, pH 5.0, 5mM CaClj, 5 mins. Fig. 16 shows specific activity on starch and soluble substrate, and performance in jet liquefaction at pH 5.5, of M15 variants as a function of percent activity of B. licheniformis wild-type. Fig. 17 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.65 mg/ml) with chloramine-T at pH 8.0 as compared to variants M197A (1.7 mg/ml) and M197L (1.7 mg/ml). Fig. 18 shows the inactivation of B. licheniformis alpha-amylase (AA20 at 0.22 mg/ml) with chloramine-T at pH 4.0 as compared to variants M197A (4.3 mg/ml) and M197L (0.53 mg/ml). Fig. 19 shows the reaction of B. licheniformis alpha-amylase (AA20 at 0.75 mg/ml) with chloramine-T at pH 5.0 as compared to double variants M197T/W138F (0.64 mg/ml) and M197T/W138Y (0.60 mg/ml). Fig. 20 shows the stability testing results of various alpha-amylase multiple mutants incorporated in automatic dish detergent (ADD) formulations at temperatures from room temperature increased to 65°C. Fig. 21 shows the stability of certain amylase mutants (compared to wild-type) in an automatic dish detergent at room temperature over 0-30 days, as determined by percent activity remaining over time. 8 WO 96/05295 PCT/US95/10426 Fig. 22 shows the stability of certain amylase mutants (compared to wild-type) in an automatic dish detergent at 38°C (100°F) with 80% relative humidity over 0-30 days. Pafcallad DMcrlptlon of fch« Iwmtlon It is believed that amylases used in starch liquefaction may be ^ Cf A subject to some form of inactivation due to some activity present in the starch slurry (see commonly owned US application 07/785,623 published as WO 93/09244 and US Patents 5,180,669, issued January 19, 1993, and US 5,322,778 incorporated herein by reference). Furthermore, use of an amylase in the presence of oxidants, such as in bleach- or peracid-containing detergents, may result in partial or complete inactivation of the amylase. Therefore, the present invention focuses on the use of amylases with altered oxidative sensitivity. The mutant enzymes may also have an altered pH profile and/or altered thermal stability which may be due to the enhanced oxidative stability of the enzyme at low or high pH's. Alpha-amylase as used herein includes naturally occurring amylases as well as recombinant amylases. Preferred amylases for use in the present invention are alpha-amylases derived from B. licheniformis or B. stearothermophilics, including the A4 form of alpha-amylase derived from B. licheniformis as described herein, as well as fungal alpha-amylases such as those derived from Aspergillus (i.e., A. oryzae and A. niger) . Recombinant alpha-amylases refers to an alpha-amylase in which the DNA sequence encoding the naturally occurring alpha-amylase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the alpha-amylase sequence. Suitable modification methods are disclosed herein, and also in commonly owned US Patents 4,760,025 and 5,185,258, the disclosure of which are incorporated herein by reference. Homologies have been found between almost all endo-amylases sequenced to date, ranging from plants, mammals, and bacteria (Nakajima, R.T. et al. (1986) Appl. Microbiol. Biotechnol. 23:355-360; Rogers, J.C. (1985) Biochem. Biophys. Res. Commun. 128:470-476). There are four areas of particularly high homology in certain Bacillus amylases, as shown in Fig. 3, wherein the underlined RECEIVED g Intellectual Property Office " 3 PFR 1998 of New Zealand 29 WO 96/05295 PCT/US95/10426 sections designate the areas of high homology. Further, sequence alignments have been used to map the relationship between Bacillus endo-amylases (Feng, D.F. and Doolittle, R.F. (1987) J. Molec. Evol. 35:351-360). The relative sequence homology between B. Qq stearothermophilus and B. licheniformis amylase is aboutSsi3r, determined by Holm, L. et al. (1990) Protein Engineering 2 (3) 181-191. The sequence homology between B. licheniformis and B. * amyloliquefaciens amylases is about 81%, as per Holm, L. et al., supra. While sequence homology is important, it is generally recognized that structural homology is also important in comparing amylases or other enzymes. For example, structural homology between fungal amylases and bacterla'l (Bacillus) amylase have been suggested and, therefore, fungal amylases are encompassed for use within the present invention. An alpha-amylase mutant has an amino acid sequence which is derived from the amino acid sequence of a precursor alpha-amylase. The precursor alpha-amylases include naturally occurring alpha-amylases and recombinant alpha-amylases (as defined). The amino acid sequence of an alpha-amylase mutant is generally derived from the precursor alpha-amylase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence. More specifically, by the substitution of one or more methionine or tryptophan in the precursor amino acid sequence. Such modification is of the precursor DNA sequence which encodes the amino acid sequence of the precursor alpha-amylase rather than manipulation of the precursor alpha-amylase enzyme per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein and in commonly owned US patent 4,760,025 and 5,185,258. Specific residues corresponding to positions M197, Ml5 and W138 of Bacillus licheniformis alpha-amylase are identified herein for substitution or deletion, as are all methionine, histidine, tryptophan, cysteine and tyrosine positions. The amino acid position number (i.e., +197) refers to the number assigned to the mature Bacillus licheniformis alpha-amylase sequence presented in Fig. 2. The alpha-amylases are not however limited to the mutation of this particular mature alpha-amylase (B. licheniformis) but extend to precursor alpha-amylases containing amino acid residues at positions which are equivalent to the particular identified residue in B. licheniformis alpha-amylase. A residue (amino acidhhi&Jj^t IVf £> precursor alpha-amylase is equivalent to a residue of B. ... '^Office 3 fffi 1398 10 " WO 96/05295 PCT/US95/10426 licheniformis alpha-amylase if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in B. licheniformis alpha-amylase (i.e., having the same or similar functional capacity to combine, react, or interact chemically or structurally). In order to establish homology to primary structure, the amino acid sequence of a precursor alpha-amylase is directly compared to the B. licheniformis alpha-amylase primary sequence and particularly to a set of residues known to be invariant to all alpha-amylases for which sequence is known, as seen in Fig. 3. It is possible also to determine equivalent residues by tertiary structure: crystal structures have been reported for porcine pancreatic alpha-amylase (Buisson, G. et al. (1987) EMBO J.6:3909-3916); Taka-amylase A from Aspergillus oryzae (Matsuura, Y. et al. (1984) J. Biochem. (Tokyo) 95:697-702); and an acid alpha-amylase from A. niger (Boel, E. et al. (1990) Biochemistry 29:6244-6249), with the former two structures being similar. There are no published structures for Bacillus alpha-amylases, although there are predicted to be common super-secondary structures between glucanases (MacGregor, E.A. & Svensson, B. (1989) Biochem. J. 259:145-152) and a structure for the B. stearothermophilus enzyme has been modeled on that of Taka-amylase A (Holm, L. et al. (1990) Protein Engineering 3:181-191). The four highly conserved regions shown in Fig. 3 contain many residues thought to be part of the active-site (Matsuura, Y. et al. (1984) J. Biochem. (Tokyo) 95:697-702; Buisson, G. et al. (1987) EMBO J. 6:3909-3916; Vihinen, M. et al. (1S90) J. Biochem. 107:267-272) including, in the licheniformis numbering, Hisl05; Arg229; Asp231; His235; Glu261 and Asp328. Expression vector as used herein refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the* expression of said DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome-binding sites, and sequences which control termination of transcription and translation. A preferred promoter is the £. subtilis aprE promoter. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector 11 WO 96/05295 PCT/US95/10426 may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, plasmid and vector are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art are useful herein. 29 Host strains (or cells) useful herein generally ^ are procaryotic or eucaryotic hosts and include any transformaLKLej microorganism in .whach the expression of alpha-amylase can be achieved. Specifically, host strains of the same species or genus from which the alpha-amylase is derived are suitable, such as a Bacillus strain. Preferably 2m alpha-amylase negative Bacillus strain (genes deleted) and/or an alpha-amylase and protease deleted Bacillus strain such as Bacillus subtilis strain BG2473 (LamyE, Lapr, Lnpr) is used. Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the alpha-amylase and its variants (mutants) or expressing the desired alpha-any 1ase. Preferably the mutants useful in the present invention are secreted into the culture medium during fermentation. Any suitable signal sequence, such as the aprE signal peptide, can be used to achieve secretion. Many of the alpha-amylase mutants of the present invention are useful in formulating various detergent compositions, particularly certain dish care cleaning compositions, especially those cleaning compositions containing known oxidants. Alpha-amylase mutants useful in the invention can be formulated into known powdered, liquid or gel detergents having pH between 6.5 to 12.0. Suitable granular composition may be made as described in commonly owned US patent applications 07/429,881 published as WO 91/06638 and AU 90/67190, 07/533,721 published as WO 93/07260 and US Patent No. 5,324,649, all of which are incorporated herein by reference. These detergent cleaning compositions can also contain other enzymes, such as known proteases, lipases, cellulases, endoglycosidases or other amylases, as well as builders, stabilizers or other excipients known to those skilled in the art. These enzymes can be present as co-granules or as blended mixes or in any other manner known to those skillflcfc in. 12 , 0ff 3 1998 0f 2091, 'and the art. Furthermore, it is contemplated by the present invention that multiple mutants may be useful in cleaning or other applications. For example, a mutant enzyme having changes at both +15 and +197 may exhibit enhanced performance useful in a cleaning product or a multiple mutant comprising changes at +197 and +138 may have improved performance. Specifically preferred mutant enzymes for use in cleaning products, and particularly dish care formulations, include but are not limited to M15T/M197T; M15S/M197T; W138Y/M197T; M15S/W138Y/M197T; and M15T/W138Y/M197T. ^ 2s 19g 1 Wl-l/J The mutant alpha-amylase enzymes described herein may also be combined with other enzymes (i.e., proteases, lipases, cellulases, etc.), and preferably oxidatively stable proteases. Suitable oxidatively stable proteases include genetically engineered proteases such as those described in US Re 34606, incorporated herein by reference, as well as commercially available enzymes such as DURAZYM (Novo Nordisk), MAXAPEM (Gist-brocades) and PURAFECT OXP (Genencor International, Inc.). Suitable methods for making such protease mutants (oxidatively stable proteases), and particularly such mutants having a substitution for the methionine at a position equivalent to M222 in B. amyloliquefaciens, are described in US Re 34606. Preferred protease mutants contemplated for use herein are those wherein the protease comprises a substitution selected from the group of amino acids consisting of alanine, cysteine and serine. For example, M22C, M222S and M222A. Suitable methods for determining "equivalent" positions in other subtilisins are provided in Re 34606 and EP 257,446, which are incorporated herein by reference. As described above, alpha-amylase mutants described herein may also be useful in the liquefaction of starch. Starch liquefaction, particularly granular starch slurry liquefaction, is typically carried out at near neutral pH's and high temperatures. As described in commonly owned US application 07/785,623 published as WO 93/09244 and US Patents 5,180,669 and 5,322,778 it appears that an oxidizing agent or inactivating agent of some sort is also present in typical liquefaction processes, which may affect the enzyme activity; thus, in these related patent applications an antioxidant is added to the process to protect the enzyme. Based on the conditions of a preferred liquefaction process, as described in commonly owned US application 07/785,623 published as WO 93/09244 and US Patents 5, 180, 669 and 5, 322,778, namely j^igh temperature Intelleotual Property Office 13 ~ 3 feu 1998 of New Zealand WO 96/05295 PCT/US95/10426 and potential oxidation conditions, preferred mutants for use in liquefaction processes comprise mutants exhibiting altered pH performance profiles (i.e., low pH profile, pH <6 and preferably pH <5.5), and/or altered thermal stability (i.e., high temperature, about 90°-110°C), and/or altered oxidative stability (i.e., enhanced oxidative stability). Thus, an improved method for liquefying starch is taught the method comprising liquefying a granular starch slurry from either a wet or dry milling process at a pH from about 4 to 6 by adding an effective amount of an alpha-amylase adding an effective amount of an antioxidant or other excipient to the slurry; and reacting the slurry for an appropriate time and temperature to liquefy the starch. The following is presented by way of example and is not to be construed as a limitation to the scope of the claims. Abbreviations used herein, particularly three letter or one letter notations for amino acids are described in Dale, J.W., Molecular Genetics of Bacteria, John Wiley & Sons, (1989) Appendix B. Bxp«riawatftl The alpha-amylase gene (Fig. 1) was cloned from B. licheniformis NCIB8051 obtained from the National Collection of Industrial Bacteria, Aberdeen, Scotland (Gray, G. et al. (1986) J. Bacteriology 166:635-643). The 1.72kb Pstl-SstI fragment, encoding the last three residues of the signal sequence; the entire mature protein and the terminator region was subcloned into M13MP18. A synthetic terminator was added between the Bell and SstI sites using a synthetic oligonucleotide cassette of the form: Bell SstZ 5' GATCAAAACATAAAAAACCGGCCTTGGCCCCGCCGGTTTTTTATTATTTTTGAGCT 3' 3' TTTTGTATTTTTTGGCCGGAACCGGGGCGGCCAAAAAATAATAAAAAC 5' mutant described herein to the starch slurry; optionally Example 1 Substitutions for the Methionine Residues in 5. licheniformis Aloha-Amvlase 14 Seq ID No 1 Intellectual Property Office ~ 3 FCP 1998 of New Zealand WO 96/05295 PCT/US95/10426 designed to contain the B. amyloliquefaciens subtilisin transcriptional terminator (Wells et al. (1983) Nucleic Acid Research 11:7911-7925). Site-directed mutagenesis by oligonucleotides used essentially the i protocol of Zoller, M. et al. (1983) Meth. Enzymol. 100:468-500: briefly, 5'-phosphorylated oligonucleotide primers were used to introduce the desired mutations on the M13 single-stranded DNA template using the oligonucleotides listed in Table I to substitute for each of the seven methionines found in B. licheniformis alpha-amylase. Each mutagenic oligonucleotide also introduced a restriction endonuclease site to use as a screen for the linked mutation. 15 WO 96/05295 PCT/US95/10426 ( ZABL£_1 Mutagenic: Oligonucleotides for the Substitution of the Methionine Residues in B. licheniformis Alpha-Amvlase MBA 5' -T GGG ACG CTG OCG CAG TAG TTT GAA TGG T-3' Seq ID No 2 Scal+ H15L 5 ' -TG ATG CAG TAG TTT GAA TGG TAP CTG CCC AAT GA-3 ' Seq ID No 3 Scal+ Kpnl+ M197L 5' -GAT TAT TTG TTG TAT GCC GAT ATC GAC TAT GAC CAT-3 1 Seq ID No 4 ECORV+ H256A 5' -CG GGG AAG GAG GCC TTT ACG GTA GCT-3' Seq ID No 5 Stul+ M304L 5 ' -GC GGC TAT GAC TTA AGG AAA TTG C-3 ' Seq ID No 6 AfIII+ M366A 5' -C TAC GGG GAT OCA TAC GGG ACG A-3 ' Seq ID No 7 Nsil+ M366Y 5'-C TAC GGG GAT TAC TAC GGG ACC AAQ GGA GAC TCC C-3' Seq ID No 8 Styl+ M438A 5'-CC GGT GGG GCC AAG CGG OCC TAT GTT GGC CGG CAA A-3' Seq ID No 9 Sf il+ Bold letter indicate base changes introduced by oligonucleotide. Codon changes indicated in the form M8A, where methionine (M) at position +8 has been changed to alanine (A). Underlining indicates restriction endonuclease site introduced by oligonucleotide. The heteroduplex was used to transfect E. coli mutL cells (Kramer et al. (1984) Cell 38:879) and, after plaque-purification, clones were atnalyzed by restriction analysis of the RFl's. Positives were confirmed by dideoxy sequencing (Sanger et al. (1977) Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467) and the Pstl-SstI fragments for each subcloned into an E. coli vector, plasmid pA4BL. 16 WO 96/05295 PCT/US95/10426 Plasmid pMBL Following the methods described in US application B'i0,468 (Power et al.)» which is incorporated herein by reference, a silent PstI site was introduced at codon +1 (the first amino-acid following the signal cleavage site) of the aprE gene from pS168-l (Stahl, M.L. and Ferrari, E. (1984) J. Bacter. 158:411-418). The aprE promoter and signal peptide region was then cloned out of a pJHIOl plasmid (Ferrari, F.A. et al. (1983) J. Bacter. 154:1513-1515) as a Hindlll-Pstl fragment and subcloned into the pUC18-derived plasmid JM102 (Ferrari, E. and Hoch, J.A. (1989) Bacillus, ed. C.R. Harwood, Plenum Pub., pp. 57-72). Addition of the Pstl-SstI fragment from B. licheniformis alpha-amylase gave pA4BL (Fig. 5) having the resulting aprE signal peptide-amylase junction as shown in Fig. 6. Transformation Into 5. subtilis pA4BL is a plasmid able to replicate in E. coli and integrate into the B. subtilis chromosome. Plasmids containing different variants were transformed into JB. subtilis (Anagnostopoulos, C. and Spizizen, J. (1961) J. Bacter. 81:741-746) and integrated into the chromosome at the aprE locus by a Campbell-type mechanism (Young, M. (1984) J. Gen. Microbiol. 130:1613-1621). The Bacillus subtilis strain BG2473 was a derivative of 1168 which had been deleted for amylase (LamyE) and two proteases (Aapr, Lnpr) (Stahl, M.L. and Ferrari, E., J. Bacter. 158:411-418 and US Patent 5,264,366, incorporated herein by reference). After transformation the sacU32(Hy) (Henner, D.J. et al. (1988) J. Bacter. 170:296-300) mutation was introduced by PBS-1 mediated transduction (Hoch, J.A. (1983) 154:1513-1515). N-terminal analysis of the amylase expressed from pA4BL in B. subtilis showed it to be processed having four extra alanines at the N-terminus of the secreted amylase protein ("A4 form"). These extra residues had no significant, deleterious effect on the activity or thermal stability of the A4 form and in some applications may enhance performance. In subsequent experiments the correctly processed forms of the licheniformis amylase and the variant M197T were made from a very similar construction (see Fig. 6) . Specifically, the 5" end of the A4 construction was subcloned on an EcoRI-Sstll fragment, from pA4BL (Fig. 5) into M13BM20 (Boehringer 17 WO 96/05295 PCT/US95/10426 Mannheim) in order to obtain a coding-strand template for the mutagenic oligonucleotide below: 5'-CAT CAG CGT CCC ATT AAG ATT TGC AGC CTG CGC AGA CAT GTT GCT-3* Seg ID No 10 This primer eliminated the codons for the extra four N-terminal alanines, correct forms being screened for by the absence of the PstI site. Subcloning the EcoRI-Sstll fragment back into the pA4BL vector (Fig. 5) gave plasmid pBLapr. The M197T substitution could then be moved, on a Sstll-SstI fragment, out of pA4BL (M197T) into the complementary pBLapr vector to give plasmid pBLapr (M197T). N-terminal analysis of the amylase expressed from pBLapr in B. subtilis showed it to be processed with the same N-terminus found in B. licheniformis alpha-amylase. Example 2 Oxidative Sensitivity of Methionine Variants B. licheniformis alpha-amylase, such as Spezyme® AA20 (commercially available from Genencor International, Inc.), is inactivated rapidly in the presence of hydrogen peroxide (Fig. 7). Various methionine variants were expressed in shake-flask cultures of B. subtilis and the crude supernatants purified by ammonium sulphate cuts. The amylase was precipitated from a 20% saturated ammonium sulphate supernatant by raising the ammonium sulphate to 70% saturated, and then resuspended. The variants were then exposed to 0.88M hydrogen peroxide at pH 5.0, at 25°C. Variants at six of the methionine positions in B. licheniformis alpha-amylase were still subject to oxidation by peroxide while the substitution at position +197 (M197L) showed resistance to peroxide oxidation. (See Fig. 7.) However, subsequent analysis described in further detail below showed that while a variant may be susceptible to oxidation at pH 5.0, 25°C, it may exhibit altered/enhanced properties under different conditions (i.e., liquefaction). Example 3 Construction of All Possible Variants at Position HT7 All of the M197 variants (M197X) were produced in the A4 form by cassette mutagenesis, as outlined in Fig. 8: 18 WO 96/05295 PCT/US95/10426 1) Site directed mutagenesis (via primer extension in M13) was used to make M197A using the mutagenic oligonucleotide below: M197A 5' -GAT TAT TTG OCG TAT GCC GAT ATC GAC TAT GAC CAT-3 ' EcoRV+ clal- Seq ID No 11 which also inserted an EcoRV site (codons 200-201) to replace the Clal site (codons 201-202). 2) Then primer LAAM12 (Table II) was used to introduce smother silent restriction site (BstBI) over codons 186-188. 3) The resultant M197A (BstBI+, EcoRV+) variant was then subcloned (Pstl-SstI fragment) into plasmid pA4BL and the resultant plasmid digested;, ;»ith BstBI and EcoRV and the large vector-containing fragment isolated by electroelution from agarose gel. 4) Synthetic primers LAAM14-30 (Table II> were each annealed with the largely complementary common primer LAAM13 (Table II). The resulting cassettes encoded for all the remaining naturally occurring amino acids at position +197 and were ligated, individually, into the vector .fragment prepared above. 19 • • no o TAPLg U Synthetic Oligonucleotides Used for Cassette Mutagenesis to Produce M197X Variants ZAAM12 GG GAA GTT TCG AAT GAA AAC G IAAM13 X197bs (EcoRV) GTC GGC ATA TG CAT ATA ATC ATA GTT GCC GTT TTC ATT (BstBI) LAMUL4 I1S7 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG &TC TAT GCC GAC (EcoRV-IAAM15 F197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG 3CC£ TAT GCC GAQ (EcoRV-ZJUIM16 V197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG £TX TAT GCC GAC (EcoRV-XJULM17 S197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG AGC TAT GCC GA£ (EcoRV-LAJVM18 P197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG CCT TAT GCC GAC (EcoRV-IAAM19 T197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG &£& TAT GCC GAC (EcoRV-XJUtM20 Y197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG T&C TAT GCC GAC (EcoRV-ZAAM21 H197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG CAC TAT GCC GAC (EcoRV-IAAM22 G197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG SSC TAT GCC GAC (EcoRV- Seq ID No 12 Seq ID No 13 Seq ID No 14 Seq ID No 15 Seq ID No 16 Seq ID No 17 Seq ID No 18 Seq ID No 19 Seq ID No 20 Seq ID No 21 Seq ID No 22 vo o Ul K» >0 Iff 1 Cfl NO in et ro IAAM23 LAAM24 IAAM25 XAAM26 LAAM27 IAAM28 IAAM29 IAAM30 Q197 (BstBI) N197 (BstBI) K197 (BstBI) D197 (BstBI) E197 (BstBI) C197 (BstBI) W197 (BstBI) R197 (BstBI) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG CM TAT GCC GA£ (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG AAC TAT GCC GA£ (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG TAT GCC GA£ (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG ££1 TAT GCC GA£ (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG SM TAT GCC GAC (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG TEE TAT GCC GAC (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG IGG TAT GCC GA£ (EcoRV-) CG AAT GAA AAC GGC AAC TAT GAT TAT TTG &GA TAT GCC GA£ (EcoRV-) Seq ID No 23 Seq ID No 24 Seq ID No 25 Seq ID No 26 Seq ID No 27 Seq ID No 28 Seq ID No 29 Seq ID No 30 vo 0\ 3 Ul K> VO Ul u> vo tft M e\ WO 96/05295 PCT/US95/10426 The cassettes were designed to destroy the EcoRV site upon ligation, thus plasmids from E. coli transformants were screened for loss of this unique site. In addition, the common bottom strand of the cassette contained a frame-shift and encoded a Nsil site, thus transformants derived from this strand could be eliminated by screening for the presence of the unique Nsil site and would not be expected, in any case, to lead to expression of active ^'1984 Positives by restriction analysis were confirmed by sequencing and transformed in B. subtilis for expression in shake-flask cultures (Fig. 9). The specific actiyity of certain of the M197X mutants was then determined using a soluble substrate assay. The data generated using the following assay methods are presented below in Table III. Soluble Substrate Assay: A rate assay was developed based on an end-point assay kit supplied by Megazyme (Aust.) Pty. Ltd.: Each vial of substrate (E-nitrophenyl maltoheptaoside, BPNPG7) was dissolved in 10ml of sterile water, followed by a 1 to 4 dilution in assay buffer (50mM maleate buffer, pH 6.7, 5mM calcium chloride, 0.002% Tween20) . Assays were performed by adding 10ia( of amylase to 790p.fi of the substrate in a cuvette at 25°C. Rates of hydrolysis were measured as the rate of change of absorbance at 410nm, • after a delay of 75 seconds. The assay was linear up to rates of 0.4 absorption units/min. The amylase protein concentration was measured using the standard Bio-Rad assay (Bio-Rad Laboratories) based on the method of Bradford, M. (1976) Anal. Biochem. 72:248) using bovine serum albumin standards. Starch Hydrolysis Assay: The standard method for assaying the alpha-amylase activity of Spezyme® AA20 was used. This method is described in detail in Example 1 of us Patent No. 5, 322,778, incorporated herein by reference. Native starch forms a blue color with iodine but fails to do so when it is hydrolyzed into shorter dextrin molecules. The substrate is soluble Lintner starch 5gm/liter in phosphate buffer, pH 6.2 (42.5gm/liter potassium dihydrogen phosphate, 3.16gm/liter sodium hydroxide). The sample is added in 25mM calcium chloride and activity is measured as the time taken to give a negative iodine test upon incubaticii at 30°C. Activity is , jjlOllVBD lntfII«Qtu«l Property Office 22 " 3 FEB 1998 of New Zealand WO 96/05295 PCT/US95/10426 recorded in liguefons per gram or ml (LU) calculated according to the formula: LU/ml or LU/g = 570 x D V x t Where LU=liquefon unit V=volume of sample (5ml) t=dextrinization time (minutes) D=dilution factor=dilution volume/ml or g of added enzyme. TABLE III SPECIFIC ACTIVITY (as % gf AA2Q value) gn: ALPHA-AMYLASE Sgluble Substrate, Starch Spezyme® AA20 100 100 A4 form 105 115 M15L (A4 form) 93 94 M15L 85 103 M197T (A4 form) 75 83 M197T 62 81 M197A (A4 form) 88 89 M197C 85 85 M197L (A4 form) 51 17 Example 4 Characterizatign gf Variant M15L Variant M15L made as per the prior examples did not show increased amylase activity (Table III) and was still inactivated by hydrogen peroxide (Fig. 7) . It- did,- however, show significantly increased performance in jet-liquefaction of starch, especially at low pH as shown in Table IV below. Starch liquefaction was typically performed using a Hydroheater M 103-M steam jet equipped with a 2.5 liter delay coil behind the mixing chamber and a terminal back pressure valve. Starch was fed to the jet by a Moyno pump and steam was supplied by a 150 psi steam line, reduced to 90-100 psi. Temperature probes were installed just after the Hydroheater jet and just before the back pressure valve. Starch slurry was obtained from a corn wet miller and used within two days. The starch was diluted v.o the desired solids level with deioniZed water and the pH of the starch was adjusted with 2% NaOH or saturated Na2C03. Typical liquefaction conditions'were: 23 WO 96/05295 PCT/US95/10426 Starch 32%-35% solids Calcium 40-50 ppm (30 ppm added) pH 5.0-6.0 Alpha-amylase 12-14 LU/g starch dry basis Starch was introduced into the jet at about 350 ml/min. The jet temperature was held at 105°-107°C. Samples of starch were transferred from the jet cooker to a 95°C second stage liquefaction and held for 90 minutes. The degree of starch liquefaction was measured immediately after the second stage liquefaction by determining the dextrose equivalence (DE) of the sample and by testing for the presence of raw starch, both according to the methods described in the Standard Analytical Methods of the Member Companies of the Corn Refiners Association. Inc.. sixth edition. Starch, when treated generally under the conditions given above and at pH 6.0, will yield a liquefied starch with a DE of about 10 and with no raw starch. Results of starch liquefaction tests using mutants of the present invention are provided in Table IV. TABLE IV Performance of Variants M15L (A4 form) and M15L in Starch Lioupfactinn SH DE after 90 Mins. Spezyme® AA20 5.9 9.9 M15L (A4 form) 5.9 10.4 Spezyme® AA20 5.2 1.2 M15L (A4 form) 5.2 2.2 Spezyme® AA20 5.9 9.3* M15L 5.9 11.3* Spezyme® AA20 5.5 3.25** M15L 5.5 6.7** Spezyme® AA20 5.2 0.7** M15L 5.2 3.65** * average of three experiments ** average of two experiments Example 5 Construction of M15X Variants Following generally the processes described in Example 3 above, all variants at M15 (M15X) were produced in native B. licheniformis by cassette mutagenesis, as outlined in Fig. 12: 24 WO 96/05295 PCT/US95/10426 1) Site directed mutagenesis (via primer extension in M13) was used to introduce unique restriction sites flanking the M15 codon to facilitate insertion of a mutagenesis cassette. Specifically, a BstBI site at codons 11-13 and a Mscl site at codons 18-20 were introduced using the two oligonucleotides shown below: M15XBstBl 5' -G ATG CAG TAT TTC GAA CTGG TAT A-3' BstBI Seq ID No 48 M15XMSC1 5' -TG CCC AAT GAT GGC CAA CAT TGG AAG-3 ' Mscl Seq ID No 49 2) The vector for M15X cassette mutagenesis was then constructed by subcloning the Sfil-Sstll fragment from the mutagenized amylase (BstBl+, Mscl+} into plasmid pBLapr. The resulting pJnsmid was then digested with BstBI and Mscl and the large vector fragment isolated by electroelution from a polyacrylamide gel. 3) Mutagenesis cassettes were created as with the M197X variants. Synthetic oligomers, each encoding a substitution at codon 15, were annealed to a common bottom primer. Upon proper ligation of the cassette to the vector, the Mscl is destroyed allowing for screening of positive transformants by loss of this site. The bottom primer contains an unique SnaBl site allowing for the transformants derived from the bottom strand to be eliminated by screening for the SnaBl site. This primer also contains a frameshift which would also eliminate amylase expression for the mutants derived from the common bottom strand. The synthetic cassettes are listed in Table V and the general cassette mutagenesis strategy is illustrated in Figure 12. 25 WO 96/05295 PCT/US95/10426 C TABLE V Synthetic Oligonucleotides Used for Cassette Mutagenesis to Produce M15X Variants Ml 5 A (BstBI C GAA TGG TAT SCI CCC AAT GAC GG (Mscl) Seg ID No" 50 M15R (BstBI C GAA TGG TAT CGC CCC AAT GAC GG (Mscl) Seq ID No 51 M15N (BstBI c GAA TGG TAT A&I CCC AAT GAC GG (Mscl) Seg ID No 52 M15D (BstBI c GAA TGG TAT GAT CCC AAT GAC GG (Mscl) Seg ID No 53 M15H (BstBI c GAA TGG TAT CAC CCC AAT GAC GG (Mscl) Seg ID No 54 M15K (BstBI c GAA TGG TAT AAA CCC AAT GAC GG (Mscl) Seg ID No 55 M15P (BstBI c GAA TGG TAT CCG CCC AAT GAC GG (Mscl) Seg ID No 56 M15S (BstBI c GAA TGG TAT TCT CCC AAT GAC GG (Mscl) Seg ID No 57 M15T (BstBI c GAA TGG TAC ACT CCC AAT GAC GG (Mscl) Seg ID No 58 M15V (BstBI c GAA TGG TAT SIX CCC AAT GAC GG (Mscl) Seg ID No 59 M15C (BstBI c GAA TGG TAT rar CCC AAT GAC GG (Mscl) Seg ID No 60 M15Q (BstBI c GAA TGG TAT CAA CCC AAT GAC GG (Mscl) Seg ID No 61 M15E (BstBI c GAA TGG TAT GAA CCC AAT GAC GG (Mscl) Seg ID No 62 M15G (BstBI c GAA TGG TAT SSI CCC AAT GAC GG (Mscl) Seg ID No 63 M15I (BstBI c GAA TGG TAT ATT CCC AAT GAC GG (Mscl) Seg ID No 64 M15F (BstBI c GAA TGG TAT TTT CCC AAT GAC GG (Mscl) Seq ID No 65 M15W (BstBI c GAA TGG TAC TGG CCC AAT GAC GG (Mscl) Seq ID No 66 M15Y (BstBI c GAA TGG TAT TAT CCC AAT GAC GG (Mscl)" Seq ID No 67 M15X (Mscl) CC (bottom strand) GTC ATT GGG ACT ACG TAC CAT T (BstBI) Seq ID NO 68 Underline indicates codon changes at amino acid position 15. Conservative substitutions were made in some cases to prevent introduction of new restriction sites. Example "6 Bench Liquefaction with M15X Variants Eleven alpha-amylase variants with substitutions for M15 made as per Example 5 were assayed for activity, as compared to Spezyme® AA20 26 WO 96/05295 PCT/US95/10426 (commercially available from Genencor International, Inc.) in liquefaction at pH 5.5 using a bench liquefaction system. The bench scale liquefaction system consisted of a stainless steel coil (0.25 inch diameter, approximately 350 ml volume) equipped with a 7 inch long static mixing element approximately 12 inches from the anterior end and a 30 psi back pressure valve at the posterior end. The coil, except for each end, was immersed in a glycerol-water bath equipped with thermostatically controlled heating elements that maintained the bath at 105-106°C. Starch slurry containing enzyme, maintained in suspension by stirring, was introduced into the reaction coil by a piston driven metering pump at about 70 ml/min. The starch was recovered from the end of the coil and was transferred to the secondary hold (95°C for 90 minutes) . Immediately after the secondary hold, the DE of the liquefied starch was determined, as described in Example 4. The results are shown in Fig. 16. Example 7 Characterization of M197X Variants As can be seen in Fig. 9, there was a wide range of amylase activity (measured in the soluble substrate assay) expressed by the M197X (A4 form) variants. The amylases were partially purified from the supernatants by precipitation with two volumes of ethanol and resuspension. They were then screened for thermal, stability (Fig. 10) by heating at 95°C for 5 minutes in lOmM acetate buffer pH 5.0, in the presence of 5mM calcium chloride; the A4 wild-type retained 28% of its activity after incubation. For M197W and M197P we were unable to recover active protein from the supernatants. Upon sequencing, the M197H variant was found to contain a second mutation, N190K. M197L was examined in a separate experiment and was one of the lowest thermally stable variants. There appears to be a broad correlation between expression of amylase activity and thermal stability. The licheniformis amylase is restricted in what residues it can accommodate at position 197 in terms of retaining or enhancing thermal stability: cysteine and threonine are preferred for maximal thermal stability under these conditions whereas alanine and isoleucine are of intermediate stability. However, other substitutions at position +197 result in lowered thermal stability which may be useful for other applications. Additionally, different substitutions at +197 may have other beneficial properties, such as 27 WO 96/05295 PCT/US95/10426 altered pH performance profile or altered oxidative stability. For example, the M197C variant was found to inactivate readily by air oxidation but had enhanced thermal stability. Conversely, compared to the M197L variant, both M197T and M197A retained not only high thermal stability (Fig. 10), but also high activity (Table III), while maintaining resistance to inactivation by peroxide at pH 5 to pH 10 (Fig. 7). Example 8 Stability and Performance in Detergent Formulation The stability of the M197T <A4 form) , M197T and M197A (A4 form) was measured in automatic dish care detergent (ADD) matrices. 2ppm Savinase™ (a protease, commercially available from Novo Industries, of the type commonly used in ADD) were added to two commercially available bleach-containing ADD's: Cascade™ (Procter and Gamble, Ltd.) and Sunlight™ (Unilever) and the time course of inactivation of the amylase variants and Termamyl™ (a thermally stable alpha-amylase available from Novo Nordisk, A/S) followed at 65°C. The concentration of ADD product used in both cases was equivalent to 'pre-soak' conditions: 14gm product per liter of water (7 grams per gallon hardness). As can be seen (Figs. 11a and lib), both forms of the M197T variant were much more stable than Termamyl*" and M197A (A4 form), which were inactivated before the first assay could be performed. This stability benefit was seen in the presence or absence of starch as determined by the:following protocol-.- Amylases were added to 5ml of ADD and Savinase™, prewarmed in a test tube and, after vortexing, activities were assayed as a function of time, using the soluble substrate assay. The "■+ starch" tube had spaghetti starch baked onto the sides (140°C, 60 mins.). The results are shown in Figs. 11a and lib. Example 9 Characterization ef M15X Variants All M15X variants were propagated in Bacillus subtilis and the expression level monitored as shown in Fig. 13. The amylase was isolated and partially purified by a 20-70% ammonium sulfate cut. The specific activity of these variants on the soluble substrate was determined as per Example 3 (Fig. 14) . Many of the M15X amyla&ts have specific activities'greater than that of Spezyme® AA20. A benchtop heat stability assay was performed on the variants by heating the amylase at 90°C for 5 min. in 50 mM acetate buffer pH 5 28 WO 96/05295 PCT/US95/10426 in the presence of 5 mM CaCl2 (Fig. 15) . Most of the variants performed as well as Spezyme® AA20 in ..his assay. Those variants that exhibited reasonable stability in this assay (reasonable stability defined as those that retained at least about 60% of Spezyme® AA20's heat stability) were tested for specific activity on starch and for liquefaction performance at pH 5.5. The most interesting of those mutants are shown in Fig. 16. M15D, N and T, along with L, outperformed Spezyme® AA20 in liquefaction at pH 5.5 and have increased specific activities in both the soluble substrate and starch hydrolysis assays. Generally, we have found that by substituting for the methionine at position 15, we can provide variants with increased low pH-liquefaction performance and/or increased specific activity. Example 1Q Tryptophan Sensitivity to Oxidation Chloramine-T (sodium N-chloro-p-toluenesulfonimide) is a selective oxidant, which oxidizes methionine to methionine sulfoxide at neutral or alkaline pH. At acidic pH, chloramine-T will modify both methionine and tryptophan (Schechter, Y., Burstein, Y. and Patchomik, A. (1975) Biochemistry 14 (20) 4497-4503) . Fig. 17 shows the inactivation of B. licheniformis alpha-amylase with chloramine-T at pH 8.0 (AA20 = 0.65 mg/ml, M197A = 1.7 mg/ml, M197L = 1.7 mg/ml). The data shows that by changing the methionine at position 197 to leucine or alanine, the inactivation of alpha-amylase can be prevented. Conversely, as shown in Fig. 18, at pH 4.0 inactivation of the M197A and M197L proceeds, but require more equivalents of chloramine-T (Fig. 18; AA20 = 0.22 mg/ml, M197A =4.3 mg/ml, M197L = 0.53 mg/ml; 200 mM NaAcetate at pH 4.0). This suggests that a tryptophan residue is also implicated in the chloramine-T mediated inactivation event. Furthermore, tryptic mapping and subsequent amino acid sequencing indicated that the tryptophan at position 138 was oxidized by chloramine-T (data not shown) . To prove this, site-directed mutants were made at tryptophan 138 as provided below: Preparation of Alpha-Amvlase Double Mtitants W138 and Ml97 Certain variants of W138 (F, Y and A) were made as double mutants, with M197T (made as per the disclosure of Example 3). The double mutants were made following the methods described in Examples 1 and 29 WO 96/05295 PCT/US95/10426 3. Generally, single negative strands of DNA were prepared from an M13MP18 clone of the 1.72kb coding sequence (Pst I-Sst I) of the B. licheniformis alpha-amylase M197T mutant. Site-directed mutagenesis was done using the primers listed below, essentially by the method of Zoller, M. et al. (1983) except T4 gene 32 protein and T4 polymerase were substituted for klenow. The primers all contained unique sites, as well as the desired mutation, in order to identify those clones with the appropriate mutation. Tryptophan 138 to Phenylalanine 133 134 135 136 137 138 139 140 141 142 143 CAC CTA ATT AAA GCT TTC ACA CAT TTT CAT TTT Seq ID No 42 Hind III Tryptophan 138 to Tyrosine 133 134 135 136 137 138 139 140 141 142 143 • CAC CTA ATT AAA GCT TAC ACA CAT TTT CAT TTT Seq ID No 43 Hind III Tryptophan 138 to Alanine - This primer also engineers unique sites upstream find downstream of the 138 position. 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 C CGC GTA ATT TCC GGA GAA CAC CTA ATT AAA GCC OCA ACA CAT TTT CAT BspE I 143 144 145 146 147 TTT CCC GGG CGC GGC AG Seq ID No 44 Xma I. Mutants were identified by restriction analysis and W138F and W138Y confirmed by DNA sequencing. The W138A sequence revealed a nucleotide deletion between the unique BspE I and Xma I sites, however, the rest of the gene sequenced correctly. The 1.37kb Sstll/SstI fragment containing both W138X and M197T mutations was moved from M13MP18 into the expression vector pBLapr resulting in pBLapr (W138F, Mlr*7T) and pBLapr (W138Y, M197T) . The fragment containing unique £sp~ I and Xma 1 sites was cloned into pBLapr (BspE I, Xma I, M197T} since it is useful for cloning cassettes containing other amino acid substitutions at position 138. Sinole Mutations at Amino Acid Position 138 Following the general methods described in the prior examples, certain single variants of W138 (F, Y, L, H and C) were made. 30 WO 96/05295 PCT/US95/10426 The 1.24kb Asp718-Sstl fragment containing the M197T mutation in plasmid pBLapr (W138X, M197T) of Example 7 was replaced fay the wild-type fragment with methionine at 197, resulting in pBLapr (W138F), pBLapr (W138Y) and pBLapr (BspE I, Xma I). The mutants W138L, W138H and W138C were made by ligating synthetic cassettes into the pBLapr (BspE I, Xma I) vector using the following primers: Tryptophan 138 to Leucine CC GGA GAA CAC CTA ATT AAA GCC CIA ACA CAT TTT CAT TTT C Seg ID No 45 Tryptophan 138 to Histidine CC GGA GAA CAC CTA ATT AAA GCC CAC ACA CAT TTT CAT TTT C Seq ID No 46 Tryptophan 13 8 to Cysteine CC GGA GAA CAC CTA ATT AAA GCC TOC ACA CAT TTT CAT TTT C Seq ID No 47 Reaction of the double mutants M197T/W138F and M197T/W138Y with chloramine-T was compared with wild-type (AA20 « 0.75 mg/ml, M197T/W138F = 0.64 mg/ml, M197T/W138Y = 0.60 mg/ml; 50 mM NaAcetate at pH 5.0)■ The results shown in Fig. 19 show that mutagenesis of tryptophan 138 has caused the variant to be more resistant to chloramine-T. Example 11 Preparation of Multiple Mutants Following the methods of Examples 1, 3, 5 and 10, the following multiple mutants were made: M15T/M197T; M15S/M197T; W138Y/M197T; M15S/W138Y/M197T and M15T/W138Y/M197T. Certain of these multiple mutants were previously exemplified, for example, W138Y/M197T was made and tested in Example 10. The multiple mutants were identified by restriction analysis. Various multiple mutants within the scope of the present invention were further tested for performance as cleaning products (automatic dish care detergent) additives. These tests are detailed below. 31 WO 96/05295 PCT/US95/10426 Stability Testing A 4000 ppm solution of automatic dishwashing detergent (ADD) containing perborate and TAED was prepared in water with a hardness of 7 gpg. Certain amylase mutants described above were added to this ADD solution to yield a rate of 0.4 when assayed by the Ceralpha method (Megazyme (Austr.) Pty. Ltd., Parramatta, NSW, Australia). One set of samples was held at room temperature (21-23°C) for about 30 min. (non-heated). A second set of samples was warmed from room temperature to about 65°C after addition of the enzyme (heated). 30 min. after addition of the enzyme, the activity of the amylase mutants was measured and the activity relative to the activity at the time of addition of the enzyme was calculated (relative activity %). The results shown in Fig. 20 indicate that the methionine at position +197 of B. licheniformis alpha-amylase should be modified for stability in a formulation comprising ADD + perborate + TAED. Starch Hvdrolvsis Assay A 4000 ppm solution of automatic dishwashing detergent (ADD) containing perborate and TAED was prepared in water with a hardness of 7 gpg and three cooked pieces of elbow macaroni were added. The amylase mutants described above were added to this ADD solution to yield a final concentration of 5 ppm active enzyme. The tubes were incubated at 50°C for about 30 min. and the concentration of reducing sugars released was measured against a glucose standard curve using the dinitrosalicylic acid method. Results are shown in Table VI. 32 WO 96/05295 PCT/US95/10426 Table VT Enzyme Reducing Sugar Concentration (g/1) Standard Deviation No Enzyme 1.64 0.12 Wild-Type 4.97 0.30 M15S/M197T 5.40 0.36 M15T/M197T in 00 in 0.38 W138Y/M197T 6.48 0.36 M15S/W138Y/M197T 6.04 0.74 M15T/W138Y/M197T 6.27 0.49 The results shown in Table VI show that M15T/M197T; M15S/M197T; W138Y/M197T; M15S/W138Y/M197T and M15T/W138Y/M197T performed well compared to no enzyme and wild-type alpha-amylase controls. Oatmeal Stains Dishes were evenly soiled with a cooked, blended oatmeal paste and dried overnight at 37°C. Dishes were loaded in an ASKO Model 770 dishwasher and washed at 45°C on the Quick Wash cycle using 10 g of automatic dishwashing detergent containing 5% perborate, 3% TAED and 11 mg of certain amylase enzyme(s). The plates were weighed before soiling, after soiling and after washing, and the average % soil removed from all plates was calculated.' The data are shown below in Table VII. Table VII Enzyme \ Soil Removed (Average of All Siahea) Wild-Type 61 M15S/M197T 66 M15T/M197T 71 W138Y/M197T 68 M15S/W138Y/M197T 62 M15T/W138Y/M197T 72 33 WO 96/05295 PCT/US95/10426 The data show that the mutant enzymes provided a benefit greater than that provided by the wild-type. Wild-type amylase provided a 20% greater cleaning benefit in removing oatmeal than did ADD without amylase. Example 12 Dish Care Cleaning Composition 1% (w/w) granules of wild-type and mutant amylases were formulated with a Korex Automatic Dishwasher Detergent to which 5% (w/w) sodium perborate monohydrate and 3% (w/w) TAED were added. Samples of these formulations were placed at room temperature (21-23°C) or at 38°C and 80% relative humidity for four weeks. Results are shown in Figs. 21 and 22. The data show that the wild-type amylase activity, as measured by the Ceralpha method, decreased with increasing storage time in detergent. At room temperature, the mutant enzymes were completely stable. At 38°C and 80% relative humidity, all mutants were more stable than the wild-type. The advantage of formulating an automatic dishwashing detergent with these mutant amylases is that these mutants are significantly more stable than the wild-type in the presence of perborate and TAED and they provide a significant performance benefit in removing starchy food stains in the wash. Example 13 Oxidatively Stable Protease/Oxidatively Stable Amylase Stability Studies Enzyme granules containing either: 1) wild-type protease and wild-type amylase; or 2) bleach stable protease (GG36-M222S) made by the methods described in US Re 34 606 and bleach stable amylase (AA20-M15T/W138Y/M197T) were dissolved in buffer containing 0.1 M sodium borate pH 10.2 and 0.005% Tween 80 at a concentration of 12.5 mg of each <?r\zyme. To 9 ml of these solutions was added either 1 ml distilled water or 1 ml 30% hydrogen peroxide. After incubation of the solutions at 25°C for 30 minutes, the protease and amylase activity in each solution was measured and is reported as % of the original activity. The data are shown below in Table VIII. '34 WO 96/05295 PCT/US95/10426 Table VIII Vrutatnt SnzyiM \ Activity Aft«r 30 Min Water Water Water Water WT Amylase WT Protease 104 94 119 88 M222S Protease TYT Amylase 3% Peroxide WT Amylase 3% Peroxide . WT Protease 14 7 116 75 3% Peroxide M222S Protease 3 % Peroxide TYT Amylase The data show that the combination of a bleach-stable amylase mutant and a bleach-stable protease mutant, both with mutations at amino acid residues sensitive to oxidation, provides the combined benefits of protease and amylase in a formulation resistant to inactivation by bleach. The combination of a bleach-stable amylase and a bleach-stable protease retains most of its initial activity after 30 minutes in bleach, while the combination of wild-type enzymes loses over 80% of its initial activity in the same period of time. 35 WO 96/05295 PCT/US95/10426 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Bamett, Christopher Mitchinson, Colin Power, Scott D. (ii) TITLE OF INVENTION: An Improved Cleaning Composition (iii) NUMBER OF SEQUENCES: 6B (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Genencor International (B) STREET: 180 Kimball Way (C) CITY: South San Francisco (D) STATE: CA (E) COUNTRY: USA (F) ZIP: 94080 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (viii> ATTORNEY/AGENT INFORMATION: (A) NAME: Horn, Margaret A. (B) REGISTRATION NUMBER: 33,401 (C) REFERENCE/DOCKET NUMBER: GC220-3 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (415) 742-7536 (B) TELEFAX: (415) 742-7217 (2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 56 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: GATCAAAACA TAAAAAACCG GCCTTGGCCC CGCCGGTTTT TTATTATTTT TGAGCT 56 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: -single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TGGGACGCTG GCGCAGTACT TTGAATGGT 29 36 WO 96/05295 PCT/US95/10426 (2) IN*0«MATI0N FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3: TGATGCAGTA CTTTGAATGG TACCTGCCCA ATGA 34 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GATTATTTGT TGTATGCCGA TATCGACTAT GACCAT 36 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs. (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CGGGGAAGGA GGCCTTTACG GTAGCT 26 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GCGGCTATGA CTTAAGGAAA TTGC 24 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sihgle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) 37 WO 96/05295 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7; CTACGGGGAT GCATACGGGA CGA (2) INFORMATION FOR SEQ ID NO:8:. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CTACGGGGAT TACTACGGGA CCAAGGGAGA CTCCC (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CCGGTGGGGC CAAGCGGGCC TATGTTGGCC GGCAAA (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID N0:10: CATCAGCGTC CCATTAAGAT TTGCAGCCTG CGCAGACATG TTGCT (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GATTATTTGG CGTATGCCGA TATCGACTAT GACCAT (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid 38 WO 96/05295 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GGGAAGTTTC GAATGAAAAC G (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GTCGGCATAT GCATATAATC ATAGTTGCCG TTTTCATT (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CGAATGAAAA CGGCAACTAT GATTATTTGA TCTATGCCGA C (2) INFORMATION fOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: CGAATGAAAA CGGCAACTAT GATTATTTGT TCTATGCCGA C (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic 'acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CGAATGAAAA CGGCAACTAT GATTATTTGG TTTATGCCGA C 39 WO 96/05295 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ' (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: CGAATGAAAA CGGCAACTAT GATTATTTGA GCTATGCCGA C (2) INFORMATION FOR SEQ ID NO:i8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base eairs (S) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:IB: CGAATGAAAA CGGCAACTAT GATTATTTGC CTTATGCCGA C (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: CGAATGAAAA CGGCAACTAT GATTATTTGA CATATGCCGA C (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TXPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: CGAATGAAAA CGGCAACTAT GATTATTTGT ACTATGCCGA C (2) INFORMATION FOR SEQ ID N0:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) 40 WO 96/05295 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: CGAATGAAAA CGGCAACTAT GATTATTTGC ACTATGCCGA C (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION:.SEQ ID NO:22: CGAATGAAAA CGGCAACTAT GATTATTTGG GCTATGCCGA C (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: CGAATGAAAA CGGCAACTAT GATTATTTGC AATATGCCGA C (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: CGAATGAAAA CGGCAACTAT GATTATTTGA ACTATGCCGA C (2) INFORMATION FOR SEQ ID NO:25: (i) SFiUENCE CHARACTERISTICS: \\) LENGTH: 41 base pairs (<£) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: GCAATGAAAA CGGCAACTAT GATTATTTGA AATATGCCGA C (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: . (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid PCT/CS95/10426 41 41 41 41 41 WO 96/05295 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: CGAATGAAAA CGGCAACTAT GATTATTTGG ATTATGCCGA C (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: CGAATGAAAA CGGCAACTAT GATTATTTGG AATATGCCGA C (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: CGAATGAAAA CGGCAACTAT GATTATTTGT GTATTGCCGA C (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: CGAATGAAAA CGGCAACTAT GATTATTTGT GGTATGCCGA C (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: CGAATGAAAA CGGCAACTAT GATTATTTGA GATATGCCGA C 42 WO 96/05295 PCT/US95/10426 (7) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1966 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3a.: AGCTTGAAGA AGTGAAGAAG CAGAGAGGCT ATTG AATAAA TGAGTAGAAA GCGCCATATC 60 GGCGCTTTTC TTTTGGAAGA AAATATAGGG AAAATGGTAC TTGTTAAAAA TTCGGAATAT 120 TTATACAACA TCATATGTTT CACATTGAAA GGGGAGGAGA ATCATGAAAC AACAAAAACG 180 GCTTTACGCC CGATTGCTGA CGCTGTTATT TGCGCTCATC TTCTTGCTGC CTCATTCTGC 240 AGCAGCGGCG GCAAATCTTA ATGGGACGCT GATGCAGTAT TTTGAATGGT ACATGCCCAA 300 TGACGGCCAA CATTGGAAGC GTTTGCAAAA CGACTCGGCA TATTTGGCTG AACACGGTAT 360 TACTGCCGTC TGGATTCCCC CGGCATATAA GGGAACGAGC CAAGCGGATG TGGGCTACGG 420 TGCTTACGAC CTTTATGATT TAGGGGAGTT TCATCAAAAA GGGACGGTTC GGACAAAGTA 480 CGGCACAAAA GGAGAGCTGC AATCTGCGAT CAAAAGTCTT CATTCCCGCG ACATTAACGT 540 TTACGGGGAT GTGGTCATCA ACCACAAAGG CGGCGCTGAT GCGACCGAAG ATGTAACCGC 600 GGTTGAAGTC GATCCCGCTG ACCGCAACCG CGTAATTTCA GGAGAACACC TAATTAAAGC 660 CTGGACACAT TTTCATTTTC CGGGGCGCGG CAGCACATAC AGCGATTTTA AATGGCATTG 720 GTACCATTTT GACGGAACCG ATTGGGACGA GTCCCGAAAG CTGAACCGCA TCTATAAGTT 760 TCAAGGAAAG GCTTGGGATT GGGAAGTTTC CAATGAAAAC GGCAACTATG ATTATTTGAT 840 GTATGCCGAC ATCGATTATG ACCATCCTGA TGTCGCAGCA GAAATTAaGA GATGGGGCAC 900 TTGGTATGCC AATGAACTGC AATTGGACGG TTTCCGTCTT GATGCTGTCA AACACATTAA 960 ATTTTCTTTT TTGCGGGATT GGGTTAATCA TGTCAGGGAA AAAACGGGGA AGGAAATGTT 1020 TACGGTAGCT GAATATTGGC AGAATGACTT GGGCGCGCTG GAAAACTATT TGAACAAAAC 1060 AAATTTTAAT CATTCAGTGT TTGACGTGCC GCTTCATTAT CAGTTCCATG CTGCATCGAC 1140 ACAGGGAGGC GGCTATGATA TGAGGAAATT TGAACGGT ACGGTCGTTT CCAAGCATCC 1200 GTTGAAATCG GTTACATTTG TCGATAACCA TGATACACAG CCGGGGCAAT CGCTTGACTC 1260 GACTGTCCAA ACATGGTTTA AGCCGCTTGC TTACGCTTTT ATTCTCACAA GGGAATCTGG 1320 ATACCCTCAG GTTTTCTACG GGGATATGTA CGGGACGAAA GGAGACTCCC AGCGCGAAAT 1380 TCCTGCCTTG AAACACAAAA TTGAACCGAT CTTAAAAGCG AGAAAACAGT ATGCGTACGG 1440 AGCACAGCAT GATTATTTCG ACCACCATGA CATTGTCGGC TGGACAAGGG AAGGCGACAG 1500 CTCGGTTGCA AATTCAGGTT TGGCGGCATT AATAACAGAC GGACCCGGTG GGGCAAAGCG 1560 AATGTATGTC GGCCGGCAAA ACGCCGGTGA GACATGGCAT GACATTACCG GAAACCGTTC 1620 GGAGCCGGTT GTCATCAATT CGGAAGGCTG GGGAGAGTTT CACGTAAACG GCGGGTCGGT 1680 TTCAATTTAT GTTCAAAGAT AGAAGAGCAG AGAGGACGGA TTTCCTGAAG GAAATCCGTT 1740 TTTTTATTTT GCCCGTCTTA TAAATTTCT? TGATTACATT TTATAATTAA TTTTAACAAA 1800 43 WO 96/05295 PCT/US95/10426 GTGTCATCAG CCCTCAGGAA GGACTTGCTG ACAGTTTGAA TCGCATAGGT AAGGCGGGGA TGAAATGGCA ACGTTATCTG ATGTAGCAAA GAAAGCAAAT GTGTCGAAAA TGACGGTATC GCGGGTGATC AATCATCCTG ASACTGTGAC GGATGAATTG AAAAAGCT (2) INFORMATION FOR SEQ ID NO:32! (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 483 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein 1860 1920 1968 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: Ala Asn Leu Asn Gly Thr Leu Met Gin Tyr Phe Glu Trp Tyr Met Pro 15 10 15 Asn Asp Gly Gin His Trp Lys Arg Leu Gin Asn Asp Ser Ala Tyr Leu 20 25 30 Ala Glu His Gly lie Thr Ala Val Trp lie Pro Pro Ala Tyr Lys Gly 35 40 45 Thr Ser Gin Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60 Gly Glu Phe His Gin Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys 65 70 75 80 Gly Glu Leu Gin Ser Ala lie Lys Ser Leu His Ser Arg Asp lie Asn 85 90 95 Val Tyr Gly Asp Val Val lie Asn His Lys Gly Gly Ala Asp Ala Thr 100 105 110 Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp rg Asn Arg Val 115 120 125 lie Ser Gly Glu His Leu He Lys Ala Trp Thr His Phe His Phe Pro 130 135 140 Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp T is Phe 145 150 155 . 160 Asp Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg lie Tyr Lys 165 170 175 Phe Gin Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn 180 185 190 Tyr Asp Tyr Leu Met Tyr Ala Asp lie Asp Tyr Asp His Pro Asp Val 195 200 205 Ala Ala Glu lie Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gin 210 215 220 Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His He. Lys Phe Ser Phe 225 230 235 240 Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met 245 250 255 Phe Thr Val Ala Glu Tyr Trp Gin Asn Asp Leu Gly Ala Leu Glu Asn 260 265 270 Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu 275 280 285 44 WO 96/05295 PCT/US95/10426 His Tyr Gin Phe His Ala Ala Ser Thr Gin Gly Gly Gly Tyr Asp Met 290 295 300 Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser 305 310 315 320 Val Thr Phe Val Asp Asn His Asp Thr Gin Pro Gly Gin Ser Leu Glu 325 330 335 Ser Thr Val Gin Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe lie Leu 340 345 350 Thr Arg Glu Ser Gly Tyr Pro Gin Val Phe Tyr Gly Asp Met Tyr Gly 355 360 365 Thr Lys Gly Asp Ser Gin Arg Glu lie Pro Ala Leu Lys His Lys lie 370 375 380 Glu Pro lie Leu Lys Ala Arg Lys Gin Tyr Ala Tyr Gly Ala Gin His 385 390 395 400 Asp Tyr Phe Asp His His Asp lie Val Gly Trp Thr Arg Glu Gly Asp 405 410 415 Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu lie Thr Asp Gly Pro 420 425 430 Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gin Asn Ala Gly Glu Thr 435 4<0 445 Trp His Asp lie Thr Gly Asn Arg Ser Glu Pro Val Val lie Asn Ser 450 455 460 Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser lie Tyr 465 470 475 480 Val Gin Arg (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 511 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Met Lys Gin Gin Lys Arg Leu Tyr Ala Arg Leu Leu Thr Leu Leu Phe 1 5 10 15 Ala Leu lie Phe Leu Leu Pro His Ser Ala Ala Ala Ala Ala Asn Leu 20 25 30 Asn Gly Thr Luu Met Gin Tyr Phe Glu Trp Tyr Met Pro Asn Asp Gly 35 40 45 His Ti*5? Lys Arg Leu Gin Asn Asp Ser Ala Tyr Leu Ala Glu His Gly 50 55 60 lie Thr Ala Val Trp lie Pro Pro Ala Tyr Lys Gly Thr Ser Gin Ala 65 70 75 80 Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu Gly Glu Phe His 85 90 95 Gin Lys Gly Thr Val Arg Thr Lys'Tyr Gly Thr Lys Gly Glu Leu Gin 100 105 110 45 WO 96/05295 FCT/US95/10426 Ser Ala lie Lys Ser Leu His Ser Arg Asp Zle Asn Val Tyr Gly Asp 115 120 125 Val Val lie Asn His Lys Gly Gly Ala Asp Ala Thr Glu Asp Val Thr 130 135 140 Ala Val Glu Val APro Ala Asp Arg Asn Arg Val lie Ser Gly Glu 145 150 155 160 His l>eu lie Lys Ala Trp Thr His Phe His Phe Pro Gly Arg Gly Ser 165 170 175 Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe Asp Gly Thr Asp 160 185 190 Trp Asp Glu Ser Arg Lys Leu Asn Arg lie Tyr Lys Phe Gin Gly Lys 195 200 205 Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn Tyr Asp Tyr Leu 210 215 220 Met Tyr Ala Asp lie Asp Tyr Asp His Pro Asp Val Ala Ala Glu lie 225 230 235 240 Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gin Leu Asp Gly Phe 245 250 255 Arg Leu Asp Ala Val Lys His lie Lys Phe Ser Phe Leu Arg Asp Trp 260 265 270 Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met Phe Thr Val Ala 275 280 285 Glu Tyr Trp G'n Asn Asp Leu Gly Ala Leu Glu Asn Tyr Leu Asn Lys 290 295 300 Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu His Tyr Gin Phe 305 310 315 320 His Ala Ala Ser Thr Gin Gly Gly Gly Tyr Asp Met Arg Lys Leu Leu 325 330 335 Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser Val Thr Phe Val 340 345 350 Asp Asn His Asp Thr Gin Pro Gly Gin Ser Leu Glu Ser Thr Val Gin 355 360 365 Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe lie Leu Thr Arg Glu Ser 370 375 380 Gly Tyr Pro Gin Val Phe Tyr Gly Asp Met Tyr Gly Thr Lys Gly Asp 385 390 395 400 Ser Gin Arg Glu lie Pro Ala Leu Lys His Lys lie Glu Pro lie Leu 405 410 415 Lys Ala Arg Lys Gin Tyr Ala Tyr Gly Ala Gin His Asp Tyr Phe Asp 420 425 430 His His Asp lie Val Gly Trp Thr Arg Glu Gly Asp Ser Ser Val Ala 435 440 445 Asn Ser Gly Leu Ala AI3 Leu lie Thr Asp Gly Pro Gly Gly Ala Lys 450 455 460 Arg Met Tyr Val Gly Arg Gin Asn Ala Gly Glu Thr Trp His Asp lie 465 470 475 460 Thr Gly Asn Arg Ser Glu Pro Val Val lie Asn Ser Glu Gly Trp Gly 485 490 495 Glu Phe His Val Asn Gly Gly Ser Val Ser lie Tyr Val Gin Arg 500 505 510 46 WO 96/05295 PCT/US95/10426 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 520 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: Met Arg Gly Arg Gly Asn Met lie Gin Lys Arg Lys Arg Thr Val Ser 15 10 15 Phe Arg Leu Val Leu Met Cys Thr Leu Leu Phe Val Ser Leu Pro lie 20 25 30 Thr Lys Thr Ser Ala Val Asn Gly Thr Leu Met Gin Tyr Phe Glu Trp 35 40 45 Tyr Thr Pro Asn Asp Gly Gin His Trp Lys Arg Leu Gin Asn Asp Ala 50 55 60 Glu His Leu Ser Asp lie Gly lie Thr Ala Val Trp lie Pro Pro Ala 65 70 75 80 Tyr Lys Gly Leu Ser Gin Ser Asp Asn Gly Tyr Gly Pro Tyr Asp Leu 85 90 95 Tyr Asp Leu Gly Glu Phe Gin Gin Lys Gly Thr Val Arg Thr Lys Tyr 100 105 110 i Gly Thr Lys Ser Glu Leu Gin Asp Ala lie Gly Ser Leu His Ser Arg 115 120 125 Asn Val Gin Val Tyr Gly Asp Val Val Leu Asn His Lys Ala Gly Ala 130 135 140 Asp Ala Thr Glu Asp Val Thr Ala Val Glu Val Asn Pro Ala Asn Arg 145 150 155 160 Asn Gin Glu Thr Ser Glu Glu Tyr Gin lie Lys Ala Trp Thr Asp Phe 165 170 175 Arg Phe Pro Gly Arg Gly Asn Thr Tyr Ser Asp Phe Lys Trp His Trp 180 185 190 Tyr His Phe Asp Gly Ala Asp Trp Asp Glu Ser Arg Lys lie Ser Arg 195 200 205 lie Phe Lys Phe Arg Gly Glu Gly Lys Ala Trp Asp Trp Glu Val Ser 210 215 220 Ser Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Val Asp Tyr 225 230 235 240 Asp His Pro Asp Val Val Ala Glu Thr Lys Lys* Trp Gly lie Trp Tyr 245 250 255 Ala Asn Glu Leu Ser Leu Asp Gly Phe Arg lie Asp Ala Ala Lys His 260 265 270 lie Lys Phe Ser Phe Leu Arg Asp Trp Val Gin Ala Val Arg Gin Ala 275 280 285 Thr Gly Lys Glu Het Phe Thr Val Ala Glu Tyr Trp Gin Asn Asn Ala 290 295 300 Gly Lys Leu Glu Asn Tyr Leu ASn Lys Thr Ser Phe Asn Gin Ser Val 305 310 315 320 47 WO 96/05295 PCT/US95/10426 Phe Asp Val Pro Leu His Phe Asn Leu Gin Ala Ala Ser Ser Gin Gly 325 330 335 Gly Gly Tyr Asp Met Arg Arg Leu Leu Asp Gly Thr V&l Val Ser Arg 340 345 350 His Pro Glu Lys Ala Val Thr Phe Val Glu Asn Hip Asp Thr Gin Pro 355 360 365 Gly Gin Ser Leu Glu Ser Thr Val Gin Thr Trp Phe Lys Pro Leu Ala 370 375 380 Tyr Ala Phe lie Leu Thr Arg Glu Ser Gly Tyr Pro Gin Val Phe Tyr 385 390 395 400 Gly Asp Met Tyr Gly Thr Lys Gly Thr Ser Pro Lys Glu lie Pro Ser 405 410 415 Leu Lys Asp Asn lie Glu Pr/o lie Leu Lys Ala Arg Lys Glu Tyr Ala 420 425 430 Tyr Gly Pro Gin His Asp Tyr lie Asp His Pro Asp Val lie Gly Trp 435 440 445 Thr Arg Glu Gly Asp Ser Ser Ala Ala Lys Ser Gly Leu Ala Ala Leu 450 455 460 He Thr Asp Gly Pro Gly Gly Ser Lys Arg Met Tyr Ala Gly Leu Lys 465 470 475 480 Asn Ala Gly Glu Thr Trp Tyr Asp lie Thr Gly Asn Arg Ser Asp Thr 485 490 495 Val Lys lie Gly Ser Asp Gly Trp Gly Glu Phe His Val Asn Asp Gly 500 505 510 Ser Val Ser lie Tyr Val Gin Lys (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 548 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: Val Leu Thr Phe His Arg lie lie Arg Lys Gly Trp Met Phe Leu Leu 1 5 10. 15 Ala Phe Leu Leu Thr Ala Ser Leu Phe Cys Pro Thr Gly Arg His Ala 20 25 30 Lys Ala Ala Ala Pro Phe Asn Gly Thr Met Met Gin Tyr Phe Glu Trp 35 40 45 Tyr Leu Pro Asp Asp Gly Thr Leu Trp Thr Lys Val Ala Asn Glu Ala 50 55 60 Asn Asn Leu Ser Ser Leu Gly lie Thr Ala Leu Ser Leu Pro Pro Ala 65 70 75 80 Tyr. Lys Gly Thr Ser Arg Ser Asp Val Gly Tyr Gly Val Tyr Asp Leu 85 90 95 Tyr Asp Leu Gly Glu Phe Asn Gin Lyp Gly Thr Val Arg Thr Lys Tyr 515 520 100 105 110 48 WO 96/05295 PCT/US95/10426 Gly Thr Lys Ala Gin Tyr Leu 115 Gly Met Gin Val Tyr Ala Asp 130 135 Asp Gly Thr Glu Trp Val Asp 145 150 Asn Gin Glu lie Ser Gly Thr 165 Asp Phe Pro Gly Arg Gly Asn 180 Tyr His Phe Asp Gly Val Asp 195 Gin Ala Zle Gin Ala Ala His Ala Ala 120 125 Phe Asp His Lys Gly Gly Ala 140 Val Val Ala Val Glu Val Asn Pro Ser Asp Arg 155 160 Tyr Gin Zle Gin Ala Trp Thr Lys Phe 170 175 Thr Tyr Ser Ser Phe Lys Trp Arg Trp 185 190 Trp Asp Glu Ser Arg Lys Leu Ser Arg 200 205 lie Tyr Lys Phe Arg 210 Thr Glu Asn Gly Asn 225 Asp His Pro Glu Val 245 Val Asn Thr Thr Asn 260 lie Lys Phe Ser Phe 275 Thr Gly Lys Pro Leu 290 Asn Lys Leu His Asn 305 Phe Asp Ala Pro Leu 325 Gly Ala Phe Asp Met 340 Gin Pro Thr Leu Ala 355 Ala Lys Arg Cys Ser 370 Ala Phe lie Leu Thr 385 Asp Tyr Tyr Gly lie 405 lie Asp Pro Leu Leu 420 His Asp Tyr Leu Asp 435 Val Thr Glu Lys Pro 450 Ala Gly Arg Ser Lys 465 Val Phe Tyr Asp Leu 485 Ser Asp Gly Trp Gly 500 Gly lie 215 Ala Trp Asp Trp Glu Val Asp 220 Gly Lys Tyr Leu Met Tyr Ala Asp Leu Asp Met 235 240 Val Thr Glu Leu Lys Asn Trp Gly Lys Trp Tyr Tyr Asp 230 250' 255 lie Asp Gly Phe 265 Phe Pro Asp Trp 280 Phe Thr Val Gly 295 Tyr lie Thr Lys 310 Arg Leu Asp Gly Leu Lys His 270 Leu Ser Tyr Val Arg Ser Gin 285 Glu Tyr Trp Ser Tyr Asp lie 300 Thr Asn Gly Thr Met Ser Leu 315 320 His Asn Lys Phe Tyr Thr Ala Ser Lys Ser Gly 330 335 Arg Thr Leu Met 345 Val Thr Phe Val 360 His Gly Arg Pro 375 Arg Gin Glu Gly 390 Thr Asn Thr Leu Met Lys Asp 350 Asp Asn His Asp Thr Asn Pro 365 Trp Phe Lys Pro Leu Ala Tyr 380 Tyr Pro Cys Val Phe Tyr Gly 395 400 Pro Gin Tyr Asn Zle Pro Ser Leu Lys Ser Lys 410 415 Zle Ala Arg Arg 425 His Ser Asp lie 440 Gly Ser Gly Leu 455 Trp Met Tyr Val 470 Asp Tyr Ala Tyr Gly Thr Gin 430 Zle Gly Trp Thr Arg Glu Gly 445 Ala Ala Leu lie Thr Asp Gly 460 Gly Lys Gin His Ala Gly Lys 475 480 Thr Gly Asn Arg Ser Asp Thr Val Thr Zle Asn 490 495 Glu Phe Lys Val 505 Asn Gly Gly Ser Val Ser Val 510 49 WO 96/05295 PCT/US95/10426 Trp Val Pro Arg Lys Thr Thr Val Ser Thr lie Ala Arg Pro lie Thr 515 520 525 Thr Arg Pro Trp Thr Gly Glu Phe Val Arg Trp His Glu Pro Arg Leu 530 535 540 Val Ala Trp Pro 545 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4B3 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear . (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: Ala Asn Leu Asn Gly Thr Leu Met Gin Tyr Phe Glu Trp Tyr Met Pro 15 10 15 Asn Asp Gly Gin His Trp Lys Arg Leu Gin Asn Asp Ser Ala Tyr Leu 20 25 30 Ala Glu His Gly lie Thr Ala Val Trp lie Pro Pro Ala Tyr Lys Gly 35 40 45 Thr Ser Gin Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60 Gly Glu Phe His Gin Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys 65 70 75 80 Gly Glu Leu Gin Ser Ala lie Lys Ser Leu His Ser Arg Asp lie Asn 85 90 95 Val Tyr Gly Asp Val Val lie Asn His Lys Gly Gly Ala Asp Ala Thr 100 105 110 Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val 115 120 125 lie Ser Gly Glu His Leu lie Lys Ala Trp Thr His Phe His Phe Pro 130 135 140 Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe 145 150 155 160 Ast? Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg lie Tyr Lys 165 170 175 Phe Gin Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn 180 185 190 Tyr Asp Tyr Leu Thr Tyr Ala Asp lie Asp Tyr Asp His Pro Asp Val 195 200 205 Ala Ala Glu lie Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gin 210 215 220 Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His lie Lys Phe Ser Phe 225 230 235 240 Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu Met 245 250 255 Phe Thr Val Ala Glu Tyr Trp Gin Asn Asp Leu Gly Ala Leu Glu Asn 260 265 270 50 WO 96/05295 PCT/US95/10426 Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu 27S 280 285 His Tyr Gin Phe His Ala Ala Ser Thr Gin Gly Gly Gly Tyr Asp Met 290 295 300 Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys Ser 305 310 315 320 Val Thr Phe Val Asp Asn His Asp Thr Gin Pro Gly Gin Ser Leu Glu 325 330 335 Ser Thr Val Gin Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Zle Leu 340 345 350 Thr Arg Glu Ser Gly Tyr Pro Gin Val Phe Tyr Gly Asp Met Tyr Gly 355 360 365 Thr Lys Gly Asp.Ser Gin Arg Glu lie Pro Ala Leu Lys His Lys lie 370 375 380 Glu Pro Zle Leu Lys Ala Arg Lys Gin Tyr Ala Tyr Gly Ala Gin His 385 390 395 400 Asp Tyr Phe Asp His His Asp lie Val Gly Trp Thr Arg Glu Gly Asp 405 410 415 Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Zle Thr Asp Gly Pro 420 425 430 Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gin Asn Ala Gly Glu Thr 435 440 445 Trp His Asp Zle Thr Gly Asn Arg Ser Glu Pro Val Val lie Asn Ser 450 . 455 460 Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser He Tyr 465 470 475 480 Val Gin Arg (2) INFOllMATlON FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 487 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: Ala Ala Ala Ala Ala Asn Leu Asn Gly Thr Leu Met Gin Tyr Phe Glu 15 10 15 Trp Tyr Met Pro Asn Asp Gly Gin His Trp Lys Arg Leu Gin Asn Asp 20 25 30 Ser Ala Tyr Leu Ala Glu His Gly lie Thr Ala Val Trp lie Pro Pro 35 40 45 Ala Tyr Lys Gly Thr Ser Gin Ala Asp Val Gly Tyr Gly Ala Tyr Asp 50 .55 60 Leu Tyr Asp Lev Gly Glu Phe His Gin Lys Gly Thr Val Arg Thr Lys 65 70 75 80 Tyr Gly Thr Lys Gly Glu Leu Gin Ser Ala lie Lys Ser Leu His Ser 85 90 95 51 WO 96/05295 PCT/US95/10426 Arg Asp lie Ala Asp Ala 115 Arg Asn Arg 130 Phe His Phe 145 Trp Tyr His Arg lie Tyr Glu Asn Gly 195 His Pro Asp 210 Asn Glu I.eu 225 Lys Phe Ser Gly Lys Glu Ala Leu Glu 275 Asp Val Pro 290 Gly Tyr Asp 305 Pro Leu Lys Gin Ser Leu Ala Phe lie 355 Asp Met Tyr 370 Lys His Lys 3B5 Gly Ala Gin Arg Glu Gly Thr Asp Gly 435 Ala <31y Glu 450 Val lie Asn 465 Val Ser lie Asn Val 100 Tyr Gly Asp Val Val lie Asn His Lys Gly Gly 105 110 Thr Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp 120 125 Val He Ser Gly Glu His Leu lie Lys Ala Trp Thr His 135 140 Pro Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His 150 155 160 Phe Asp 165 Lys Phe 180 Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn 170 175 Gin Gly Lys Ala Trp Asp Trp Glu Val Ser Asn 185 190 Asn Tyr Asp Tyr Leu Met Tyr Ala Asp lie Asp Tyr Asp 200 205 Val Ala Ala Glu lie Lys Arg Trp Gly Thr Trp Tyr Ala 215 220 Gin Leu Asp Gly Phe Arg Leu Asp Ala Val Lys His He 230 235 240 Phe Leu 245 Met Phe 260 Arg Asp Trp Val Asn His Val Arg Glu Lys Thr 250 255 Thr Val Ala Glu Tyr Trp Gin Asn Asp Leu Gly 265 270 Asn Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val Phe 280 285 Led His Tyr Gin Phe His Ala Ala Ser Thr Gin Gly Gly 295 300 Met Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His 310 315 320 Ser Val 325 Glu Ser 340 Thr Phe Val Asp Asn His Asp Thr Gin Pro Gly 330 335 Thr Val Gin Thr Trp Phe LyB Pro Leu Ala Tyr 345 350 Leu Thr Arg Glu Ser Gly Tyr Pro Gin Val Phe Tyr Gly 360 365 Gly Thr Lys Gly Asp Ser Gin Arg Glu He Pro Ala Leu 375 380 lie Glu Pro Zle Leu Lys Ala Arg Lys Gin Tyr Ala Tyr 390 395 400 His Asp 405 Asp Ser 420 Tyr Phe Asp His His Asp lie Val Gly Trp Thr 410 415 Ser Val Ala Asn Ser Gly Leu Ala Ala Leu lie 425 430 Pro Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gin Asn 440 445 Thr Trp His Asp lie Thr Gly Asn Arg Ser Glu Pro Val 455 460 Ser Glu Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Tyr Val 485 470 Gin Arg 475 480 52 WO 96/05295 PCT/US95/10426 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: Met Lys Gin Gin Lys Arg Leu Thr Ala Arg Leu Leu Thr Leu Leu Phe 15 10 15 Ala Leu He Phe Leu Leu Pro His Ser Ala Ala Al a Ala Ala Asn lieu 20 25 30 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: Met Arg Ser Lys Thr Leu Trp lie Ser Leu Leu Phe Ala Leu Thr Leu 15 10 15 lie Phe Thr Met Ala Phe Ser Asn Net Ser Ala Gin Ala Ala Gly Lys 20 25 30 Ser (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: Met Arg Ser Lys Thr Leu Trp lie Ser Leu Leu Phe Ala Leu Thr Leu 1 5 10-15 lie Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gin Ala Ala Ala Ala 20 25 30 Ala Ala Asn 35 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 amino acids (3) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 53 WO 96/05295 PCT/US95/10426 (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: Met Arg Ser Lys Thr Leu Trp lie Ser Leu Leu Phe Ala Leu Thr Leu 1 5 10 15 lie Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gin Ala Ala Asn Leu 20 25 30 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear . (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: CACCTAATTA AAGCTTTCAC ACATTTTCAT TTT 33 (2) INFORMATION FOR SEQ IDNO:43: (i) SEQUENCE CHARACTERISTICS: (h) LENGTH: 33 base pairs (B) TYPE: nucleic acid 'X) STRANDEDNESS: single (D) TOPOLOGY: linear ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: CACCTAATTA MGCTTACAC ACATTTTCAT TTT 33 (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: CCGCGTAATT TCCGGAGAAC ACCTAATTAA AGCCGCAACA CATTTTCATT TTCCCGGGCG 60 CGGCAG 66 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) 54 WO 96/05295 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: CCGGAGAACA CCTAATTAAA GCCCTAACAC ATTTTCATTT TC (2) INFORMATION FOR SEQ ID NO:46: . (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: CCGGAGAACA CCTAATTAAA GCCCACACAC ATTTTCATTT TC (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: CCGGAGAACA CCTAATTAAA GCCTGCACAC ATTTTCATTT TC (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ;ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: GATGCAGTAT TTCGAACTGG TATA (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: TGCCCAATGA TGGCCAACAT TGGAAG (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: ■ (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single 55 WO 96/05295 CD) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: CGAATGGTAT GCTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: CGAATGGTAT CGCCCCAATG ACGG (2) INFORMATION FOR SKQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SFQUENCE DESCRIPTION: SEQ ID NO:52: CGAATGGTAT AATCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: CGAATGGTAT GATCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: CGAATGGTAT CACCCCAATG ACGG 56 WO 96/05295 (2) INFORMATION FOR SEQ ID NO: 55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:55 CGAATGGTAT AAACCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS; single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:56 CGAATGGTAT CCGCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57 CGAATGGTAT TCTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58 CGAATGGTAC ACTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) 57 WO 96/05295 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59 CGAATGGTAT GTTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60 CGAATGGTAT TGTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61 CGAATGGTAT CAACCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62 CGAATGGTAT GAACCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63 CGAATGGTAT GGTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid 58 WO 96/05295 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64 CGAATGGTAT ATTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucloic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65 CGAATGGTAT TTTCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66 CGAATGGTAC TGGCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:67; (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67 CGAATGGTAT TATCCCAATG ACGG (2) INFORMATION FOR SEQ ID NO:68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ"ID NO:68 CCGTCATTGG GACTACGTAC CATT 59 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> WO 96/05295 PCT/US95/10426 WHA.T XB CZJOMEO I St

1. A bleach-containing cleaning composition, comprising a mutant alpha-amylase that is the expression product of a mutated DNA sequence encoding an alpha-amylase, the mutated DNA sequence being derived from a precursor alpha-amylase by the substitution of a methionine at a position equivalent to M+197 in B. licheniformis alpha-amylase and the substitution of one or more methionine or tryptophan at a position equivalent to M+15 or W+138 in B. licheniformis alpha-amylase. *9 1984

2. ?. cleaning composition of Claim 1 wherein the w r cleaning composition is a dish care cleaning composition.

3 . A cleaning composition of Claim 1 wherein the mutant alpha-amylase is selected from the group consisting of M15T/M197T; M15S/M197T; W138Y/M197T; M15S/W138Y/M197T and M15T/W138Y/M197T.

4. A cleaning composition of Claim 1 further comprising a mutant protease that is the expression product of a mutated DNA sequence encoding a protease, the mutated DNA sequence being derived from a precursor protease by the substitution of a methionine at a position equivalent to M+222 in Bacillus amyloliquefaciens protease.

5. a cleaning composition of Claim 4 wherein the mutant protease comprises a substitution selected from the group of amino acids consisting of alanine, cysteine and serine.

6. A cleaning composition of Claim 4 comprising an alpha-amylase mutant selected from the group consisting of M15T/M197T, M15S/M197T, W138Y/M197T, M15S/W138Y/M197T and M15T/W138Y/M197T, and a protease mutant selected from the group consisting of M222C, M222S and M222A.

7. A cleaning, composition of Claim 6 which is a granular composition. ,n. R E c E I V E D Intellectual Property Office " 3 FFR J998 of New Zealand 60 61

8. A bleach-containing cleaning composition as defined in claim 1 substantially as herein described with reference to any example thereof and with or without reference to the accompanying drawings. ?9 l9g BEHENCOe ,M TF^MA-TTorJA L,.- INC- By the yutfionsed agents A. J Park & Son Par END OF CLAIMS , RECEIVED Intellectual Property Office - 3 FEB 1998 New Zealand </div>