NZ249600A - Antigenic polypeptides, their production and vaccines containing them, useful against echinococcus (tapeworm) and taenii parasite infections - Google Patents

Description

2 If «r 6 0 0 New Zealand No. 249600 International No. PCT/NZ93/00007 TO BE ENTERED AFTER ACCEPTANCE AND PUBLICATION Priority dates: International fifing date: Classification: CcnK\4-j4^CJStNI^ Publication date: _ 2 6 NOV 1996 Journal No.: |^q t . , i NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of invention: Antigens protective against echinococcus granulosus infection and vaccines containing such antigens Name, address and nationality of applicants) as in international application form: NEW ZEALAND PASTORAL AGRICULTURE RESEARCH INSTITUTE LIMITED, a company incorporated under the Companies Act 1955 pursuant to the Crown Research Institutes Act 1992 and having its registered office at Peat Marwick Tower, 85 Alexandra Street, Hamilton, New Zealand; and UNIVERSITY OF MELBOURNE, a body corporation organised and existing under the laws of the State of Victoria, of Grattan Street, Parkville, Victoria 3052, Australia. 2M600 «VO 93/16722 PCT/NZ93/00007 ANTIGENS PROTECTIVE AGAINST ECHINOCOCCUS GRANULOSUS INFECTION AND VACCINES CONTAINING SUCH ANTIGENS FIELD OF THE INVENTION 5 This invention relates to antigens which are protective against, inter alia, Echinococcus granulosus infection, to vaccines containing such antigens and to methods of protecting hosts susceptible to Echinococcus and Taenii parasite infection.

BACKGROUND OF THE INVENTION Hydatid disease is caused by infection with the larval (metacestode stage) of tapeworms belonging to the genus Echinococcus. Transmission occurs in predator-prey mammalian cycles between carnivorous definitive hosts and herbivorous or omnivorous intermediate hosts.

Of Echinococcus tapeworms, Echinococcus granulosus is the most significant E.granulosus is the cause of cystic hydatid disease (CHD) and is typified by transmission between the domestic dog and domestic herbivores such as sheep and cattle, with humans also being intermediate hosts, but not normally contributing to the life cycle. As a consequence, E.granulosus is geographically widespread and its 20 distribution closely parallels the areas of the world where pastoralism is the main occupation. Therefore, it will be appreciated that CHD is an important endemic disease over large parts of South America, Africa, Australasia, Central Europe, Central Asia and the Mediterranean littoral including North Africa.

Some countries are now attempting control of CHD through education of 25 the dog owner and regular anthelmintic treatment of the dog as definitive host. However, while such programmes have generally been partially successful, eradication has proved more difficult to achieve.

A further desirable approach to control of CHD involves the use of a vaccine against acquisition of the cystic stage of the life cycle of E. granulosus by 30 the intermediate host. This approach has the considerable advantage that transmission of the infection to dogs through consumption of cyst-containing offal from the intermediate host is prevented. As a consequence, eradication of the disease becomes a realistic possibility.

It is broadly to the vaccine approach that the present invention is directed. 35 However, for a commercial vaccine to be developed, it is essential for specific protective antigens against E. granulosus to be identified. While investigations to date (Gemmell M A. Immunology 11 325-335 (1966); Heath et r*i i DPTlTI I TP SHEET 2 i*q 6 0 0 iWO 93/16722 PCT/NZ93/00007' aL. J Parasitol 67 (6) 797-799 (1981)) have clearly shown that the oncosphere of E. granulosus is a potent source of such antigens, no specific E. granulosus oncosphere antigens have been identified as conferring protection.

International Patent Application No. PCT/FR91/00563 (published as WO 5 92/01051) discloses an immunogenic E. granulosus peptide together with the DNA sequence coding for this peptide and methods of both diagnosis and treatment of E. granulosus infection using this peptide. However, the disclosed E. granulosus antigen (known as "antigen 5") is unrelated to the oncosphere antigens investigated by the applicants. Further, the applicants have shown in their published research 10 that the presence of antibodies to antigen 5 does not protect lambs against challenge infection with E. granulosus eggs (Heath et aL, Intl Journal of for use in a vaccine which is protective against E. granulosus infection or at least to provide the public with a useful choice.

Accordingly, in one aspect the present invention provides, in substantially pure form, an antigenic polypeptide which has a molecular weight in the range of 20 from 23-25 kD calculated by SDS-PAGE, which includes amino acids 4 to 77 from the sequence of Figure 4, and which is capable of generating a protective immunological response against E, granulosus infection in a susceptible host; or a peptide fragment or variant having substantially equivalent protective immunological activity thereto.

In a preferred embodiment, the polypeptide includes amino acids 1 to 154 from the sequence of Figure 4.

In still a more preferred embodiment, the invention consists of a peptide fragment having part or all the amino acid sequence of Figure 4. expression of a nucleotide sequence coding therefor in a host cell.

In a further aspec^ the invention consists in a composition of matter capable of generating a protective immunological response to E. granulosus infection in a susceptible host which essentially consists of a component selected from the group consisting of: (a) the polypeptide defined above; (b) a peptide fragment of (a) having equivalent protective immunological activity thereto; and Parasitology 22 1017-1021 (1992)).

SUMMARY OF THE INVENTION It is therefore an object of the present invention to provide a specific antigen Conveniently, the polypeptide or peptide fragment is the product of SUBSTITUTE SHEET 2 uq 6 0 0 ^WO 93/16722 ^ PCT/NZ93/00007 (c) a variant of (a) or (b) which has been modified by the insertion, substitution or deletion of one or more amino acids and which has at least equivalent immunological activity thereto.

In still a further aspect, the invention provides a DNA molecule which is 5 selected from the group consisting of: (a) a nucleotide sequence encoding the antigenic polypeptide defined above; (b) a nucleotide sequence encoding a peptide fragment of the antigenic polypeptide of (a), which fragment has equivalent protective immunological activity to the polypeptide of (a); and (c) a nucleotide sequence encoding a variant of the polypeptide of (a) or the peptide of (b) in which the amino acid sequence has been modified by the insertion, substitution or deletion of one or more amino acids, which variant has equivalent protective immunological activity to the polypeptide of (a) or the peptide of fragment (b).

In a preferred embodiment, the DNA molecule includes at least nucleotides to 233 of the Figure 4 sequence, more preferably nucleotides 3 to 461 of the sequence of Figure 4, and most preferably nucleotides 1 to 461 of the sequence of Figure 4.

In yet further aspects, the invention provides recombinant expression vectors 20 which contain a DNA molecule as defined above, host cells transformed with such vectors and capable of expressing the polypeptide or peptide fragment or variant thereof which is encoded, and methods of producing an antigenic polypeptide or a peptide fragment or variant thereof comprising culturing a host cell as defined above and recovering the expressed product.

In another aspect, the present invention provides a vaccine against E. granulosus infection comprising the E. granulosus polypeptide, peptide fragment or variant defined above, together with an immunologically appropriate adjuvant or carrier.

In still another aspect, the present invention provides a method of protecting 30 a susceptible host against Echinococcus or Taertiid parasite infection comprising the step of administering to said host an amount of polypeptide, peptide fragment or variant defined above which is protective against such infection.

Conveniently, the polypeptide, peptide fragment or variant is administered to said host in the form of a vaccine as defined above.

In a further aspect, the invention provides an antibody specific for the antigenic polypeptide or peptide fragment or variant thereof as defined above.

CUCCT £WO 93/16722 2 U<* 6 Other embodiments of the invention will become apparent from the description which follows.

DESCRIPTION OF THE FIGURES 5 While the invention is broadly as defined above, it will be appreciated by those persons skilled in the art that the present invention is not limited thereto but that it also includes embodiments of which the following description provides examples. In particular, a better understanding of the present invention will be gained by reference to the accompanying drawings in which: Figure 1 shows IgGj and IgG2 sheep antibody responses to vaccination with preparative SDS-PAGE fractions of oncospheres. Groups of sheep were vaccinated with fractions of oncospheres comprising SDS-PAGE fractions which include antigens of estimated molecular weight: Group 1: All molecules below 21 kD; Group 2: 23 + 25 kD; Group 3: 30 kD; Group 4: 34 kD; Group 5: 40 kD 15 doublet; Group 6: 43 kD; Group 7: All molecules above 43 kD; Group 8: A mix of all molecules; Group 9: Adjuvant only; Group 10 sheep were vaccinated with un-fractionated oncospheres otherwise treated in a similar manner to groups 1 to 9, and Group 21 were vaccinated with a Freeze-Thaw sonicate of activated oncospheres of E. granulosus. Figure 1 shows analysis of the antibody responses of 20 sheep in each of these groups reacted against whole oncosphere extracts in SDS-PAGE.

Figure 2 shows IgGj and IgG2 sheep antibody responses to vaccination with cloned antigens. Groups: 11. Clone S2; 12. Clone S3; 13. Clone 48; 14. Qone 95; 15. Clone 101; 16. Qone 119; 17. Clone 123; 18. Mix of all clones; 19. 25 Clones 33, 42 and 85; 20. GST-control; 21. Pooled serum from 5 sheep immunised with a Freeze-Thaw sonicate of activated oncospheres of E. granulosus. The immunisation procedure was identical to that following for the antigens of groups 11 to 20.

Figure 3 shows sheep IgG2 responses to vaccination with preparative SDS-30 PAGE fractions of oncosphere antigens or with cloned antigens. Groups as above.

Figure 4 shows the nucleotide sequence and deduced amino acid sequence of a peptide fragment of the protective antigen of the invention. Numbers to the left hand side indicate nucleotide number from 5' to 3'; numbers to the right hand side indicate amino acid number. The translation stop codon is underlined. ciirqtitute SHEET ^ WO 93/16722 2 (*4 6 0 0 DETAILED DESCRIPTION OF THE INVENTION As defined above, in its primary aspect, the present invention is directed to the provision of an antigen which is host-protective against E. granulosus infection irrespective of whether this is the worm or cystic stage of such infection. Hosts 5 which are susceptible to E. granulosus infection are mammals including humans. Accordingly, examples of hosts to which the invention has potential application are ovine, bovine, porcine, caprine, equine and human hosts.

From their investigations, the applicants have identified an E. granulosus polypeptide as being involved in protection against E. granulosus infection in a 10 susceptible host. This E. granulosus polypeptide is that having a molecular weight in the range of approximately 23-25 kD.

The present invention also includes within its scope antigens derived from the native E. granulosus polypeptide identified above where such derivatives have host-protective activity. These derivatives will normally be peptide fragments of 15 the native polypeptide which include the protective epitope, but can also be functionally equivalent variants of the native polypeptide modified by well known techniques such as site-specific mutagenesis (see Adelman et ah. DNA 2 183 (1983)). For example, it is possible by such techniques to substitute amino acids in a sequence with equivalent amino acids. Groups of amino acids known 20 normally to be equivalent are: Gly; (a) Ala Ser Thr Pro <b) Asa Asp Glu Gin; (c) His Arg Lys; (d) Met Leu Be Val; and (e) Fhe Tyr Trp.

In a preferred embodiment, the antigen is a peptide fragment having pari: or all of the amino acid sequence of Figure 4. More preferably, the peptide fragment will comprise amino acids 4 to 77 from the Figure 4 sequence. Still more preferably, the peptide fragment will comprise amino acids 1 to 77 from the 30 Figure 4 sequence. Most preferably, however, the peptide fragment will comprise amino acids 1 to 153 from the Figure 4 sequence.

The protective antigen of the invention can be produced by isolation from the native E. granulosus oncosphere complement using conventional purification techniques. However, it is recognised that for production of the antigen in 35 commercial quantities, production by synthetic routes is desirable. Such routes include the stepwise solid phase approach described by Merryfield (J Amer Chem i-rr- our-rr -6 Soc 85 2149-2156 (1963)) and production using recombinant DNA techniques. The latter route in particular is being employed by the applicants.

In a further aspect, the invention accordingly relates to the recombinant production of the antigenic polypeptide or peptide defined above. 5 Stated generally, the production of the protective antigen of the invention by recombinant DNA techniques involves the transformation of a suitable host organism or cell with an expression vector including a DNA sequence coding for the antigen, followed by the culturing of the transformed host and subsequent recovery of the expressed antigen. Such techniques are described generally in 10 Sambrook et aL, "Molecular Cloning", Second Edition, Cold Spring Harbour Press (1987).

An initial step in the method of recombinantly producing the antigen involves the ligation of a DNA sequence encoding the antigen into a suitable expression vector containing a promoter and ribosome binding site operable in the 15 host cell in which the coding sequence will be transformed. The most common examples of such expression vectors are plasmids which are double stranded DNA loops that replicate autonomously in the host cell. However, it will be understood that suitable vectors other than plasmids can be used in performing the invention.

Preferably, the host cell in which the DNA sequence encoding the 20 polypeptide is cloned and expressed is a prokaryote such as E.coli. For example, E.coli DH5 (Raleigh E Aet aL, Nucleic Acid Research 16 (4) 1563-1575 (1988)), E. coli K12 strain 294 (ATCC 31446), E. coliB, E. coli X1776 (ATCC 31537), E. coli strain ST9 or E. coli JM 101 can be employed. Other prokaryotes can also be used, for example bacilli such as Bacillus subtilis and enterobacteriaceae such as 25 Salmonella typhimurium, Serratia marcesans or the attenuated strain Bacille Calmette-Guerin (BCG) of Mycobacterium bovis.

In general, where the host cell is a prokaryote, expression or cloning vectors containing replication and control sequences which are derived from species compatible with the host cell are used. The vector may also cany marking 30 sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli has commonly been transformed using pBR322, a plasmid derived from an E. coli species (Bolivar et aL, Gene 2 95 (1977)). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.

For use in expression, the plasmid including the DNA to be expressed contains a promoter. Those promoters most commonly used in recombinant DNA construction for use with prokaryotic hosts include the B-lactamase (penicillinase) 2 6 0 0 2^600 and lactose promoter systems (Chang et aL, Nature 275 615 (1978); Itakura et aL, Science 198 1056 (1977); Goeddel et aL, Nature 281 544 (1979)) and a tryptophan (trp) promoter system (Goeddel et aL, Nucleic Acids Res J 4057 (1980); EPO Publ No. 0036776). While these are the most commonly used, other microbial 5 promoters such as the tac promoter (Amann et aL. Gene 25 167-178 (1983)) have been constructed and utilised, and details concerning their nucleotide sequences have been published, enabling a skilled worker to ligate them functionally in operable relationship to genes in vectors (Siebenlist et aL. Cell 20: 269 (1980)).

In addition to prokaryotes, eukaryotic microbes, such as yeast may also be 10 used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et aL.. Nature 282. 39 (1979); Kingsman et aL.. Gene 7. 141 (1979); Tschemper et aL.. Gene 10. 157 (1980)) is commonly used. This plasmid 15 already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tiyptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics 85. 12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. 20 Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase (Hitzeman et aL. J Biol Chem 255. 2073 (1980)) or other glycolytic enzymes (Hess et aL. J Adv Enzvme Reg 7 149 (1968); Holland et aL. Biochemistry \14900 (1978). Other promoters, which have the additional advantage of transcription controlled by growth conditions, are the promoter 25 region for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilisation. Any plasmid vector containing yeast-compatible promoter, origin of replication and termination sequences is suitable. 30 In addition to microorganisms, cultures of cells derived from multicellular organisms such as mammals and insects may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in 35 recent years (Tissue Culture. Academic Press, Kruse and Patterson, editors (1973)). Examples of such useful host cell lines are VERO and HeLa cells and Chinese hamster ovaiy (CHO) cells. Expression vectors for such cells ordinarily t* I IDCTITI ITC CHPPT 2 <ri 6 0 0 | WO 93/16722 PCT/NZ93/00007 include (if necessary) an origin of replication, a promoter located upstream from the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences.

For use in mammalian cells, the control functions on the expression vectors 5 are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40(SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et aL. Nature 273.113, (1978)). Smaller or larger 10 SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hindin site toward the Bgll site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell 15 systems.

An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g. Polyoma, Adeno, VSV, BPV) source, or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell 20 chromosome, the latter is often sufficient.

Upon transformation of the selected host with an appropriate vector, the antigenic polypeptide or peptide encoded can be produced by culturing the host cells. The fusion protein is then recovered.

Following recovery of the antigenic polypeptide or peptide it is purified as 25 desired. The purification procedure adopted will of course depend upon the degree of purity required for the use to which the polypeptide or peptide is to be put. For most vaccination purposes, separation of the fusion protein from most of the remaining components of the cell culture is sufficient as the antigen can be incorporated into a vaccine in a relatively crude form. However, in cases where a 30 greater degree of purity is desired, the carrier component of the fusion protein can be cleaved from the antigenic component. As will again be apparent from the specific examples provided, this can be easily achieved through the provision of an appropriate enzyme cleavage site between the carrier component and the antigen.

Where as is preferred, recombinant techniques are used to produce the 35 antigenic peptide, the first step is to obtain DNA encoding the desired product. Such DNA molecules comprise still a further aspect of this invention. c.iinqTiTllTP 5HPPT 21+** 6 0 G » . WO 93/16722 PCT/NZ93/00007 1 -9- The DNA molecule of the invention preferably includes at least part of or all of the nucleotide sequence of Figure 4. In one embodiment, the DNA molecule mil include at least nucleotides 10 to 233 of the Figure 4 sequence. In a more preferred embodiment, the DNA molecule will include at least nucleotides 3 5 to 233 of the Figure 4 sequence. It is, however, most preferred that the DNA molecule comprise at least nucleotides 3 to 461 of the Figure 4 sequence if not the entire nucleotide sequence of Figure 4.

The DNA molecule of the invention can be obtained contained within a DNA molecule isolated from an appropriate natural source or can be produced as 10 intron-free cDNA using conventional techniques such as those used in the specific description set out hereinafter. cDNA is preferred.

However, as indicated above, the invention also contemplates variants of the polypeptide which differ from the native amino acid sequences by the insertion, substitution or deletion of one or more amino acids. Where such a variant is 15 desired, the nucleotide sequence of the native DNA molecule is altered appropriately. This alteration can be made through elective synthesis of the DNA using an appropriate synthesizer such as the Applied Biosystems DNA Synthesizer or by modification of the native DNA by, for example, site specific or cassette mutagenesis.

Once obtained, the DNA molecule is treated to be suitable for insertion together with the selected control sequence into the appropriate cloning and/or expression vector. To this end the DNA is cleaved, tailored and religated as required.

Geavage is performed by treating with restriction enzyme(s) in a suitable 25 buffer. Any of the large number of commercially available restriction enzymes can be used as specified by the manufacturer. After cleavage, the nucleic acid is recovered by, for example, precipitation with ethanol.

Tailoring of the cleaved DNA is performed using conventional techniques. For example, if blunt ends are required, the DNA may be treated with DNA 30 polymerase I (Klenow), phenol and chloroform extracted, and precipitated by ethanol.

Re-ligation can be performed by providing approximately equimolar amounts of the desired components, appropriately tailored for correct matching, and treatment with an appropriate ligase (eg T4 DNA ligase).

In addition to the protective antigens of the invention and the method of producing these, the present invention provides a vaccine against E. granulosus infection. Such a vaccine includes as the essential component a host protective iitc eurcT 2 M 6 0 0 \ WO 93/16722 PCT/NZ9J/00007 amount of the E. granulosus polypeptide, peptide fragment or variant referred to above, together with a suitable adjuvant or carrier.

Examples of suitable adjuvants known to those skilled in the art are saponins (or derivative or related material), muramyldipeptide, trehalose dimycollate, 5 Freund's complete adjuvant, Freund's incomplete adjuvant, other water in oil emulsions, double emulsions, dextran, diethylaminoethyl-dextran, potassium alum, aluminium phosphate, aluminium hydroxide, bentonite, zymosan, polyelectrolytes, retinol, calcium phosphate, protamine, sarcosine, glycerol, sorbitol, propylene glycol, fixed oils and synthetic esters of higher fatty acids. Saponins in particular 10 have been found to be effective adjuvants.

In still further embodiments, the vaccine may also be formulated to further include other host-therapeutic agents. Such therapeutic agents include anthelmintics or other vaccines, or immunostimulants such as interferons or interleukins.

The vaccine can be administered to the host by any of those methods known in the art. However, the preferred mode of administration of the vaccine is parenteral. The term "parenteral" is used herein to mean intravenous, intramuscular, intradermal and subcutaneous injection. Most conveniently, the administration is by subcutaneous injection.

The amount of the vaccine administered to the host to be treated will depend on the type, size and body-weight of the host as well as on the immunogenicity of the vaccine. Conveniently, the vaccine is formulated such that relatively small dosages of vaccine (1-5 ml) are sufficient to be protective.

The vaccine may also be in the form of a live recombinant viral vaccine 25 including nucleic acid encoding the polypeptide, peptide fragment or variant. The vaccine is administered to the host in this form and once within the host expresses the encoded polypeptide, peptide fragment or variant to induce a host-protective response.

A number of such live recombinant viral vaccine systems are known. An 30 example of such a system is the Vaccinia virus system (US Patent 4603112; Brochier et aL, Nature 354 520 (1991)).

In still a further aspect, the invention provides a method of protecting a host susceptible to infection by an Echinococcus or Taeniid parasite. The method of invention includes as its essential step the administration to the host of either the 35 antigenic polypeptide or peptide fragment or variant per se, or of a vaccine as described above.

SUBSTITUTE SHEET 2 it* 6 0 WO 93/16722 PCT/NZ93/00007 While the specific examples provided hereinafter describe only the use of the antigens of the invention in protecting against E. granulosus infection, those persons skilled in the art will appreciate that cross-species protection can be achieved by the use of antigens derived from one parasite species (see, for 5 example, Lightowlers, Acta Leidensia 57 135-142 (1989)). It will therefore be understood that the antigens of the invention are candidate protective antigens against at least the following Echinococcus or Taeniid parasites other than E. granulosus: K multilocularis, E. vogelii, T. ovis, T. saginata, T. solium, T. multiceps and T. hydatigena.

As yet a further aspect of the invention, the use of the DNA molecule described above or a subsequence thereof as a probe is contemplated. In this aspect, the DNA molecule is used to identify by hybridisation DNA of an Echinococcus or Taeniid parasite such as T. saginata, T. hydatigena or E. muMocularis which encodes an immunogenic antigen of that parasite. In this way, 15 further parasite antigens suitable for use in a vaccine can be identified.

The method of use of the DNA molecule of the invention as a probe will be well understood by those persons skilled in the art. For example, those techniques set out in Maniatis et aL, "Molecular Cloning: A Laboratory Manual", Cold Spring Harbour (1982) could be used.

Alternatively, DNA amplification techniques such as the polymerase chain reaction (Saiki et aL, Science 239 487 (1988)) can be employed to detect homologous DNA of other parasites, with the PCR primers being based upon the nucleotide sequence of Figure 4.

Similarly to the use of the DNA molecules of the invention to identify DNA 25 encoding the corresponding protective antigen of other parasites, antibody probes specific for the protective antigens of the invention can be used to screen the antigens expressed by organisms transformed by the DNA of the parasite in question. The location of a positive clone (one expressing an antigen recognised by the antibody) will allow identification of both the protective antigen itself and 30 the DNA which encodes it. Such antibody probes can be either polyclonal or monoclonal and can be prepared by any of those techniques known in the art. In particular, monoclonal antibodies can be prepared in accordance with the procedure of Kohler and Milstein (Kohler G and Milstein C, "Continuous cultures of fused cells secreting antibody of predifined specificity", Nature 256 495-497 35 (1975)).

QIIOCtitiitc cueer kWO 93/16722 2 6 0 0 PCT/NZ93/00007 t The immunogenicity of the antigenic polypeptide of the invention and of peptide fragments of this polypeptide will be appreciated from the following non-limiting tramples.

Previous unreported investigations by the applicants resulted in the identification of a number of candidate protective antigens from E. granulosus. These candidate antigens had the following molecular weights as determined by SDS-PAGE: - 23-25 kD - 30 kD - 34 kD - 40 kD This experiment was conducted by the applicants to identify the host-protective ai>tigen(s) from amongst the above candidates.

MATERIALS AND METHODS Preparative Gel: Using a Biorad SDS Preparative Cell, 50 ml of a 15% polyacrylamide solution was poured into a 32 mm holder to a height of 5.5 cm. After setting, 8 ml of stacking gel was poured on top, and allowed to set Antigen: Nine million hatched oncospheres were prepared as follows: E. granulosus eggs with fully-developed embryophores were counted, and the required number of eggs, assuming a 20% yield of activated oncospheres, were placed in 15 ml disposable plastic centrifuge tubes (Falcon Plastics). No more than 500,000 were placed in each tube. Eggs were centrifuged at 200 g for 2 minutes, the supernatant discarded, and 10 ml of artificial gastric fluid (AIF), at 37 C (Heath D D and Smyth J D, In vitro cultivation of Echinococcus granulosus, Taenia hydatigena, T. ovis, T. pisiformis and T. serialis from oncosphere to cystic larva. Parasitology 61 329-343 (1970)) which had been passed through a 0.2 micron membrane, was added. Tubes were mixed on a rotator at 37 C for 1 h.

Eggs were centrifuged at 200 g for 2 min, the supernatant withdrawn, and replaced by 10 ml of artificial intestinal fluid (AIF) at 37 C (Heath & Smyth, 1970, supra), which had been passed through a 0.2 micron membrane. Eggs were mixed on a rotator at 37 C for 30 min, followed by centrifugation at 1000 g for 2 min. The supernatant was discarded, and replaced by 15 ml of Percoll EXAMPLE 1: TESTING OF ANTIGENS PREPARED FROM ECHINOCOCCUS GRANULOSUS ONCOSPHERES BY PREPARATIVE SDS/PAGE ciidot'thtc ourrT 2ufii 6 0 fc»VO 93/16722 PCT/NZ93/00007 w -13- (Pharmacia, Sweden) diluted aseptically 9:1 (v/v) with 10 x concentrated NCTC135 (GIBCO, NY). The embryopboric blocks, and activated and unactivated oncospheres, which all constituted the pellet, were mixed with the Percoll by inversion. The tubes were then centrifuged at 1000 g for 10 min, and 5 each supernatant, which contained the oncospheres, was tipped into a new sterile 15 ml centrifuge tube. Half of the supernatant (75 ml) was then tipped into another sterile centrifuge tube, and to each of the two tubes was added 75 ml of NCTC 135. The tubes were mixed by inversion, and centrifuged at 1000 g for 5 min. The supernatants were removed, and the pellet containing oncospheres 10 was washed 2 x with 10 ml of NCTC 135, centrifuging for 2 min at 1000 g each time. The pellet was finally suspended in an appropriate volume of NCTC135 that would give 10 microlitre samples containing between 40 and 200 oncospheres. The number of activated and unactivated oncospheres was then estimated by counting the entire volume of 4 x 10 microlitre samples dispensed onto both sides 15 of two haemocytometer slides (Improved Neubauer), using 200 x magnification to distinguish unactivated oncospheres from those free of their oncospheral membranes (activated oncospheres).

Separation of oncosphere proteins: The oncospheres (50% unactivated and 50% activated approx.) were boiled in SDS sample buffer (Laemmli U K, 20 Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature (London") 277 680-685 (1970) (containing Dithiothreitol (DTT), Sigma [10 mg/ml] instead of mercaptoethanol), and loaded onto the Biorad SDS Preparative Cell column. When the bromophenyl blue dye-front had almost reached the bottom of the column, successive 2.5 ml fractions were collected for 25 24 h.

Enzyme inhibitors: All were obtained from Sigma. They were made up in 20 mM Tris/HCl, pH 8.0, so that when diluted v/v, the final concentrations were: lodoacetamide, 20 mM; Aprotinin, 10 /d/ml; Pepstatin, 2 ^g/ml; N-tosyl-l-phenylalanine chlor methyl ketone (TPCK); 50 ^g/ml; 30 Na-p-tosyl-l-lysine-chloro methyl ketone (TLCK), 50 ^g/ml; Ethylene diamine tetra-acetic acid (EDTA), 2 mM: Phenyl methyl sulphonyl fluoride (PMSF), 1 mM). They were added to all fractions. A sample from each fraction was run on a 5-25% gel using SDS/PAGE, and the gel was silver-stained to identify molecules of relevant molecular weights. Selected fractions were concentrated in 35 a stirred cell on an Amicon UM3 membrane, to 10 ml. They were then centrifuged at 2200 rpm for 30 m at 1C. The supernatant was removed from the SUBSTITUTE SHFFT 2 tf) 6 0 0 | WO 93/16722 PCT/NZ93/00007 " -14- deposit of SDS, and each was then dialysed against 4 changes of 20 mm Tris-buffered saline containing enzyme inhibitors, pH 15, over 3 days.

The molecular weights to be tested were selected according to molecular weight fractions as follows: 1. (all molecules below 21 kD); 2. (23 + 25 kD); 3. (30 5 kD); 4. (34 kD); 5. (40 kD doublet); 6. (43 kD); 7. (all molecules above 43kD); 8. (a mix of all molecules); 9. (adjuvant only); 10. (a sample of the antigen before it was loaded onto the gel. This sample was also treated by cold centrifugation and extensive dialysis).

Immunisation Procedure: Each antigen existed as 10 ml of supernatant. 10 Each fraction represented the particular molecule(s) from 5 million oncospheres, while the mix of all consisted of all the molecules from 2 million, as did the antigen prior to loading (group 10). For the first injection, 1 ml of antigen was homogenised with 1 ml of STM adjuvant (Bokhout et aL, Veterinary Immunology and Immunopathologv 2 491-500 (1981)), and half injected subcutaneously over 15 the left ribs, while the other half was injected intramuscularly into the left rear leg. For the second injection, which was given 1 month later, the formulation and route of injection was the same, except that 2 mg of freeze-dried Mycobacterium phlei was included with each injection. Injections were given on the right side.

Challenge with eggs: One month after the second injection, all lambs were 20 given 1000 E. granulosus eggs orally. The eggs had been stored at 4°C for 6 weeks. They had been extracted from worms harvested from experimentally-infected dogs, following the method of Heath D D and Lawrence S B, Daily egg-production of dogs infected with Echinococcus granulosus, Archivos de la Hidatidosis 30 321-328 (1991).

Experimental animals: Lambs were both Romney and Dorset breeds, randomised through all groups. They had been reared free of infection with E. granulosus, and were given their first injection when 8 months old. 10 ml of blood was collected for serum from each animal, using vacutainers, at the time of the first and second injections, and again when the animals were challenged. Serum 30 was removed aseptically, and stored at -20°C until required for testing by in vitro culture of oncospheres, or immunoblotting.

Necropsy: Six months after the challenge infection, another blood sample was taken, and then iambs were exsanguinated after stunning with a captive-bolt pistol. The liver and lungs of each animal were removed, and finely sliced to 35 assess the number and condition of cysts present. The liver was sliced at 2-3 mm intervals, and each slice carefully inspected by eye. The lungs were sliced at 4 mm intervals, and cysts were palpated as well as being inspected by eye.

SURRTITIITF SHFFT 2 H* 6 0 0 PCT/N Z93/00007 Immunoblotting: Echinococcus granulosus oncosphere antigens were separated by SDS PAGE according to published methods (Laemmli (1970) supra; Hames B D and Rickwood D, Gel electrophoresis of Proteins: a practical approach, IRL Press, Oxford (1981)). Samples were solubilised by boiling for 3 5 min in 60 mM Tris/HQ pH 6.8, 10% glycerol, 2% SDS, 1 % DTT and 0.05% bromophenol blue. The separation took place on a gradient gel (T = 5-25%) using a vertical electrophoresis system (BioRad Protean 11), following the manufacturer's instructions. Separated antigens were transferred electrophoretically (Towbin H, Staehelin T and Gordon J, Electrophoretic transfer 10 of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proceedings of the National Academy of Sciences USA 76 4350-4354 (1979)) to nitrocellulose paper (0.45 ftm, Schleicher & Schull, Dassell, Germany) in a cooled Transblot cell with plate electrodes (BioRad, Richmond, USA) at 50 v for 2 h in 10 mM carbonate buffer pH 9.0 containing 20% methanol (Dunn S D, 15 Effects of the modification of transfer buffer composition and the renaturation of proteins in gels on the recognition of proteins on Western blots by monoclonal antibodies. Analytical Biochemistry 157 144-153 (1986)). After transfer, nitrocellulose sheets were placed in 0.5% Ponceau S (BDH) in 1% acetic acid for j min, then rinsed with distilled water until protein bands were clearly visible. 20 Molecular weight markers (Pharmacia) were marked with pencil. Individual strips of nitrocellulose containing antigen were cut and placed in incubation trays (Schleicher & Schull, Germany). Strips were blocked with 5% fat-free milk powder and 0.1% Tween 20 (BDH) dissolved in 20 mM Tris/HCl pH 7J, 0.5% NaCl, for 1 h at 37 C. Test sera were diluted 1:100 in the blocking buffer. Strips 25 were incubated in the diluted sera overnight at room temperature on a rocking platform. Strips were then washed with 4 x 10 min changes of 20 mM Tris/HCl pH 7.5 containing 0.5 M NaCl and 0.1% Tween 20.

An extra step was included in the immunoassay to delineate the immunoglobulin classes, IgGj and IgG2. After the first antibody, the strips were 30 probed with mouse monoclonal antibodies to sheep IgGj or IgGj, obtained from Dr Ken Beh, CSIRO McMaster Laboratory, Sydney. The strips were then probed with Goat anti-mouse IgG (whole molecule) labelled with peroxidase [Cappel], diluted 1:1000 in the blocking buffer. The strips were then washed 3 x with the blocking buffer without milk powder or Tween 20. Peroxidase activity was 35 visualised with 3-amino-9-ethylcarbazole (Sigma). Development was stopped on all strips at the same time, so that comparisons could be made of the intensity of the stains, thus reflecting the amount of the specific immunoglobulin in each sera. 2 6 0 WO 93/16722 PCT/NZ93/00007; Killinp of oncospheres in vitro: The pooled prechallenge sera from each of the 10 groups of sheep was tested for oncosphere-killing capacity.

For foetal lamb serum complement, foetal lambs close to term were bled with a sterile syringe, and blood was immediately transferred to 50 ml sterile 5 polypropylene tubes (Falcon Plastics). After clotting for 2 h at ambient temperature, clots were separated from the walls with sterile applicator sticks in a laminar-flow sterile cabinet. Tubes were then centrifuged in a Beckman refrigerated centrifuge at 4°C for 30 min. Tubes were stored in ice while serum was removed. Foetal lamb serum was stored in 2 ml aliquots at -70°C until 10 required for culture.

Cultures were established in 96 well flat-bottomed culture plates (Falcon Microtest HI). To each well was added 150 ft\ of test serum (inactivated at 56 C for 30 min), plus 150 fj. 1 of NCTC135 containing 50 activated oncospheres, plus 20 fi\ of foetal lamb serum complement All cultures were established in duplicate or 15 triplicate. Plates were kept in a humidified C02 incubator at 37°C, and results were assessed at 24 h and at 7 days, using a Leitz Labovert inverted microscope. Wherever NCTC135 is mentioned, it was supplemented with 300 mg/1 of cysteine hydrochloride (Sigma) and 50 fig/ml of gentamicin sulphate (Schering).

RESULTS The antibody profiles against oncosphere antigen that were generated by each group are shown in Figure 1. It is clear that the various groups produced antibodies that predominantly recognised the molecular weight range with which they were immunised. In some groups, such as groups 1 and 5, there were 25 epitopes on the immunising molecules that were shared with molecules of other molecular weights.

The results of necropsy are shown in Table 1, groups 1-10, and indicate that, while the other candidate antigens do reduce the number of cysts relative to the control, it is only the 23-25 kD molecular weight range which induces a significant 30 degree of protection (P = 0.012, F = 10.62, 8DF).

The results of the in vitro killing of oncospheres by the sera of groups of sheep immunised with the various molecular weight fractions are shown in Table SUBSTITUTE SHEET tVO 93/16722 2 uq 6 0 0 PCT/ N293/00007 2, As can be clearly seen, these results corroborate that it is only the 23-25 kD molecular weight antigen from E. granulosus which is host-protective.

Table 1: Necropsy results of sheep challenged with 1000 K granulosus eggs after immunisation with native antigens eluted from polyacrylamide gels (groups 1-8), adjuvant controls (group 9) or SDS treated oncospheres (group 10) Table 2: The in vitro killing of E. granulosus oncospheres by pooled group sera 25 collected on the day of challenge with E. granulosus eggs.

Group Immunising Antigen Sheep Tag Numbers Number of Cysts Average 1 <20 62,47,12^0,65 7539,19,101,47 562 2 23 + 25 05,24,67,45,95 039,10,2,4 11 3 17,19,13,57,03 0,42,17,148,197 80.8 4 34 1137,14,77,43 167,9,48,85,126 87 40 5139,06,41,82 109,86,156,276,97 144.8 6 43 08,64,04,88,63 57,67,1653,52 68.8 7 >43 86,45,40,72,01 84,75,2,17,78 51.2 8 MIX ,23,92,48^7 0,0,104,133,79 63 2 9 CONTROL 96,0938,9033 27,137,170,242,86 132.4 SDS ONCS 6030,44,20,18 247,49,175,25,54 110 Group Number Treatment % Killed 1 <20 kD 0% 2 23-25 kD 91% 3 kD 0% 4 34 kD 0% 40 kD 0% 6 43 kD 0% 7 >43 kD 0% 8 Mix of all molecules 0% 9 Adjuvant only 0% SDS-oncospheres 0 % CUbctitiitc out-rT 2 u«j 6 0 WO 93/16722 PCT/NZ93/00007 EXAMPLE 2: AFFINITY-PURIFICATION OF ANTIBODY PROBES Affinity-purified antibody from the immobilised 23-25 kD molecule was prepared as follows: Lambs 1488 and 1489 were each injected subcutaneously and intramuscularly with 100,000 activated oncospheres of E. granulosus on four 5 occasions. The first two injections were 2 weeks apart, then 1 month later and then 3 months later. One week after the last injection, the lambs were oled, 300 ml of blood yielding 150 ml of sterile "hyperimmune" antiserum each. Lambs were challenged with 3000 freshly collected E. granulosus eggs on the day that serum was collected as were two control lambs. At necropsy 6 months later, 10 immunised lambs only had cysts growing at the site of the first injections, whereas controls had large numbers of cysts in their livers and lungs.

Serum from lamb 1488 was used for affinity-purification of antibodies, because it had a higher titre of oncosphere-killing capacity than 1489. Antibodies specific to E. granulosus oncosphere Freeze-Thaw-Sonicate antigen, oncosphere 15 SDS/PAGE whole-lane, or to antigens with relative mobilities of 0-20, 20-25, 25-30,30-36, 36-67 kD, or to antigens of relative mobilities of 0-20,20-30,30-43, 43-67, 67-90, 90-180 and > 180 kD, were affinity-purified from nitrocellulose strips containing the above antigens, using the method of Beall J A and Mitchell G F, Identification of a particular antigen from a parasite cDNA library using 20 antibodies affinity purified from selected portions of Western blots, Journal of Immunological Methods 86 217-223 (1986). The carrier protein was 1% foetal lamb serum. Affinity-purified antibodies were washed, and then concentrated 10 x using an Amicon stirred cell and PM10 membrane.

EXAMPLE 3: RECOMBINANT DNA CLONING AND EXPRESSION OF ECHINOCOCCUS GRANULOSUS ONCOSPHERE ANTIGENS 1. Isolation and verification of mRNA (a) Preparation of reagents All solutions used in the isolation and handling of mRNA, except solutions containing Tris [Tris (hydroxymethyl)aminomethane Sigma, St Louis, MO USA], were treated with 0.1% diethylpyrocarbonate (DEPC, Sigma) overnight and subsequently autoclaved prior to use. All glassware was baked at a temperature of 200°C or greater overnight. Tris stock solutions were prepared with DEPC-35 treated water and autoclaved. (b) Oncosphere SUBSTITUTE SHEET 2 6 0 0 Mature E. granulosus eggs were obtained and hatch/activated as detailed in Example 1. Approximately 4 x 106 oncospheres were solubilised on ice in nuclease-free 6M guanidine hydrochloride (BRL Ultrapure, Bethesda Research Laboratories, USA), 0.1 M sodium acetate, pH 5.2, using a glass/teflon tissue 5 homogeniser. Solubilised oncospheres were stored at -70°C prior to isolation of RNA. (c) Isolation of RNA The solubilised oncospheres were thawed on ice and insoluble material was pelleted by centrifugation at 10,000 rpm, 30 minutes, 4°C in a Type 50 H rotor 10 and Beckman L8 ultracentrifuge (Beckman, Palo Alto CA USA). The supernatant was layered over a solution containing 4.8 M caesium chloride (CsCl - BRL Ultrapure, Bethesda Research Laboratories, Gaithersburg, MD USA), 10 mM EDTA (Ethylenediaminetetra-acetic acid, disodium), 65 ml guanidine/5.5 ml CsCl per Beckman SW40 polyallomer tube. Tubes were centrifuged at 35,000 rpm, 18 15 hr, 15°C in a SW40 rotor, Beckman L8 ultracentrifuge. The supernatant was discarded and the base of the tube rinsed briefly and gently with 200 fx 1 of T10Ej (10 mM Tris, 1 mM EDTA, pH 8.0). Pelleted RNA was dissolved in 200 fil T^Ej and precipitated by the addition of 1:10 volume 3M sodium acetate and 23 volumes 100% ice cold ethanol and incubated at 20°C overnight. Precipitated 20 RNA was pelleted by centrifugation in a microcentrifuge for 15 min at 4°C, the pellet rinsed with 70% ethanol, centrifugation repeated and the subsequent pellet air dried. RNA was resuspended in 50 fil T10Ej and the quantity assessed by absorbence at a wavelength of 260 nm to be 23 fig total RNA. One microgram was examined in a 1.2% formaldehyde agarose gel (Sambrook J, Fritsch E F and 25 Maniatis T, Molecular cloning. A laboratory manual. Cold Spring Harbour Laboratory Press (1989)) and the RNA found to include intact ribosomal RNA. (d) Purification of polv A* RNA Poly A+ messenger RNA was purified on oligo (dT) cellulose Type 7 (Pharmacia LKB Biotechnology, Uppsala, Sweden) according to the 30 manufacturer's instructions, especially as described by Aviv H and Leder P, Purification of biologically active globin messenger RNA was by chromatography on oligothymidylic acid-cellulose, Proc Nat Acad Sci 69 1408-1412 (1972). Eluted poly A+ mRNA was precipitated as above and the pellet redissolved in 50 fil T10Er (e) In vitro translation The mRNA in a 5 p\ aliquot was in vitro translated using Rabbit Reticulocyte Lysate (Amersham, UK) in a total reaction volume of 25 fil according to the manufacturer's instructions. The products were radiolabeled 2 i^C). 6 0 using 375 fid ^S-methionine (Amersham International, Amersham UK) and examined by polyaciylamide gel electrophoresis in a 10% aciylamide gel under reducing condition (Laemmli U K, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 680-685 (1970)) and 5 detected using fluorography following impregnation of the gel with Amplify (Amersham, UK). Translation products were abundant and of heterogeneous size, including products of more than 94 kD. 2. Synthesis and cloning of cDNA 10 (a) Synthesis of cDNA Thirty-seven microlitres of the mRNA solution in T10E1 was reverse transcribed in the presence of a ^P-dATP (Amersham) using Moloney-Murine Leukemia Virus Reverse Transcriptase using the reagents and protocol contained in the ZAP-cDNA Synthesis Kit (Lot #UC106, Catalog #200400, Stratagene, La 15 Jolla, USA). Following second strand synthesis, an aliquot was assessed in 1% alkaline agarose gel electrophoresis according to the ZAP-cDNA Synthesis Kit instructions. The cDNA was heterogeneous in size and, in comparison with Lambda Hind m DNA markers (Promega Corporation, Madison, WI USA), included detectable transcripts greater than 2000bp. (b) Cloning of cDNA cDNA was cloned into the bacteriophage vector Uni-ZAP XR (XZAP) (Stratagene) according to the conditions detailed in the UNI-ZAP XR Cloning Kit manufacturer's instructions (Lot #18D, Catalog #237211, Stratagene). The cDNA was ligated to the vector without any selection as to the size of the cDNA. The 25 entire cDNA sample was ligated to 1 fig vector DNA. (c) In vitro packaging of bacteriophage Two microlitres of the vector ligated cDNA were packaged into infective phage using a single Gigapack II Gold packaging reaction (Lot #1535, Catalog #200216, Stratagene) according to the manufacturer's instructions. The resultant 30 phage was titred on E. coli PLK-F. The remaining ligated cDNA was subsequently packaged in two equal reactions and the products from the three reactions pooled and titred. The resultant library of cDNA clones (cDNA library) in XZAP was titred in£. coli PLK-F and assessed to comprise approximately 100,000 primary clones (methods as described in the UNI-ZAP XR Cloning Kit, 35 Stratagene). 3. Amplification of the cDNA library .WO 93/16722 ' -20- C;!IRC;TIT! IT" 5HPPT 2^600 WO 93/16722 PCT/NZ93/D0007 The entire cDNA library was amplified on E. coli PLK-F cells at a density of 5,000 plaque forming units (pfu) per 150 mm diameter agar plate. Amplified phage was harvested overnight into 10 ml SM (100 mM NaCl, 8 mM Mg S04, 50 mM Tris pH 7.5, 0.01% w/v gelatin). The amplified library was pooled and 5 titred on E. coli XLl-Blue cells (Stratagene) in the presence of isopropylthiogalactoside (IPTG) and 5-bromo-4-chloro-3-indolyl-fl-D-galactoside (Xgal), according to the instructions in the UNI-ZAP XR Cloning Kit (Stratagene). The amplified library titre was assessed to be 1.7 x 109 pfu per ml. 4. Immunoscreeninp of cDNA library (al Preparation of antibody probes Two types of antibody probes were used in plaque immunoassay; sera and affinity purified antibodies prepared in accordance with Example 2. Serum samples were depleted of "background" reactivity to either E. coli and/or 15 B-galactosidase as follows. Non-recombinant Xgtll or A. ZAP were plated at near-confluence on suitable host E. coli (generally XL-1 Blue, Stratagene). Nitrocellulose filters (Schleicher & Schuell, Dassel, Germany) were impregnated with 10 mM IPTG, dried and, following incubation of the plates at 42°C for 4 hours, one filter was overlayed onto each plate surface. Plates were incubated 20 subsequently at 37°C overnight, followed by incubation at 4°C for 30 min. The filters were removed and rinsed in TNT (150 mM NaCl, 0.05% Tween 20, 10 mM Tris, pH 8.0) and incubated in 5% skim milk powder/TNT (BLOTTO) for 1 hour. All immunoassay incubations were at room temperature (RT°) on a rocking platform. Each serum sample to be used in immimoassay was diluted in TNT plus 25 20% foetal calf serum (FTNT) and incubated in a petri dish containing 20 ml diluted sera plus two nitrocellulose filters prepared as above. Following incubation for 2 hr the nitrocellulose filters were removed and the affinity depleted sera were ready for use in plaque immunoassay.

Antibody probes which had been derived from sera by affinity purification 30 (detailed in Example 2) were not affinity depleted with non-recombinant Xgtll or A. ZAP and were used in immunoassay without dilution. (b) Immunoassay of cDNA library clones Two sources of antibody were used in primary screening of the amplified cDNA library. Sera from Sheep 1488, obtained as described in Example 2, was 35 prepared as above and used to identify cDNA clones expressing E. granulosus oncosphere antigens. The cDNA library was plated and immunoassayed using standard procedures as described in Sambrook et aL (supra). In brief: Plaques SUBSTITUTE SHEET AVO 93/16722 2 U3. 6 0 PCT/NZ93/00007I were plated on 150 mm petri dishes at 5000 pfu per LG agarose plate and NZY top agar (0.9% agar). K coli strains were BB4 or XL1 Blue (Stratagene). Clones binding antibody in the test sheep sera were detected using rabbit anti-sheep IgG (heavy and light chain) antibody conjugated with alkaline phosphatase (catalogue 5 No. 313 055 003, Jackson ImmunoResearch Laboratories, West Grove, USA).

The antibody conjugate was diluted 1:2000 in BLOTTO and incubated at 5 ml per filter, each filter separately for 2 hr. Filters were subsequently washed separately, with six changes of TNT over a period of 1 hr, with rocking between changes. Positive plaques were detected with the chromogenic substrate bromochloroindolyl 10 phosphate/nitro blue tetrazolium (BCIP/NBT) as described by Harlow E and Lane D, Antibodies. A laboratory manual. Cold Spring Harbour Laboratory Press (1988). A total of 129 clone plaques were identified as showing putatively positive signals with the serum. Each associated plaque was picked from the agar plate using a sterile pasteur pipette and placed into 0.5 ml SM. The SM 15 supernatant from each clone containing the passively eluted clone bacteriophage were titred using standard techniques (Sambrook et aL, supra) and re-screened on 75 mm plates and filters at a low density (estimated 50 plaques per plate). Of the 129 original clones, 80 clones were confirmed positive when reacted as above with Sheep 1488 serum.

The library was screened in a similar manner also with antibodies affinity purified from sheep 1488 as also described in Example 2. A single positive clone was detected with serum fraction 2 (corresponds to antibodies to 20-25 kD oncosphere antigens), designated clone S2, and one clone was picked as reacting with serum Fraction 3 (25-30 kD antigens), designated S3. Both clones were 25 confirmed positive in secondary plaque immunoassays as above.

Each clone phage was plated on a single 150 mm plate at 20,000 pfu/plate, and phage stocks collected as described for library amplification above, (c) Selection of clones From the clone library, on the basis of the immimoassay results, clones s2, 30 s3, 48, 95, 101, 119 and 123 were selected for further analysis as to whether the antigens they express were host-protective. Clones 33, 42 and 86 (which previous unreported investigations by the applicants had shown were not able to induce statistically significant protection) were also selected to be used as controls. 5. Sub-cloning and expression of cDNA (a) Production of pBluescript 2 a* 6 0 0 ^ WO 93/16722 PCT7NZ93/00007 f -23- The plasmid pBluescript was generated by phagemid rescue from A. ZAP stocks selected for each cDNA clone as described by in the UNI-ZAP XR Qoning Kit manufacturer's instructions (Stratagene). (b) Sub-cloning into pGEX-3EX 5 The vector system chosen for expression of the E. granulosus antigens for vaccine trials was the pGEX series of plasmids (AMRAD Corporation, Melbourne, Australia) which express the parasite-encoded portion of the molecule as a fusion protein at the carboxyl terminus of the Schistosoma japonicum glutathione S-transferase (Smith D B and Johnson K S, Single-step purification of 10 polypeptides expressed in Escherichia coli as fusion proteins with glutathione S-transferase. Gene 67 31-40, (1988)). In order to be able to sub-clone the directionally cloned cDNA's from the XZAP XR vector, it was necessary to modify the pGEX 3X vector in order to insert a Xho 1 restriction site downstream from the Eco R1 restriction site in the pGEX polylinker. This was achieved by 15 insertion of annealed oligonucleotides having the following sequence: ' AAT TCA TAC TCG AGT 3' 3' GT ATG AGC TCA TTA A 5' In addition to incorporation of the Xho 1 site, this construct preserved the unidirectional cloning of cDNA's as generated in the A ZAP XR vector. The modified vector was designated pGEX 3EX. Routine methods were used in this modification of the pGEX vector as detailed in Sambrook et aL (supra); briefly, annealed oligonucleotides were treated with T4 Polynucleotide kinase (New 25 England Biolabs, Beverly, CA, USA); pGEX 3X DNA was digested with Eco R1 (New England Biolabs), phosphatased and ligated to the kinased, annealed oligonucleotides. E. co//JM101 were transformed with the ligated plasmid using the calcium chloride method. Bacterial clones transformed with the plasmid were selected, plasmid DNA isolated and the modification confirmed by sequencing the 30 relevant section of DNA using the dideoxy chain-termination method after sub-cloning of a Bam HI (position 914)/P.sf 1 (position 1885) into bacteriophage M13. The pGEX 3EX vector has the following DNA sequence and predicted translated amino acid sequence across the polylinker region: SUBSTITUTE SHEET 2^600 WO 93/16722 PCI /NZ93/00007 BamHl pGEXr3EX CCA AAA TCG GAT CTG ATC GAA GGT CGT GGG ATC Pro Lys Ser Asp Leu He Glu GIv Arg Gly He Factor X Smal EcoRl CCC GGG AAT TCA TAC TCG AGT AAT TCA TCG TGA Pro Gly Asn Ser Tyr Ser Ser Asn Ser Ser "* Plasmid pBluescript DNA was purified by centrifugation in CsCl (Sambrook et a£, supra) and insert cDNA excised as follows. Approximately 2 ng of each pBluescript DNA clone was digested with 10 units each of iscoRl and Xhol (Amersham, UK) in 20 fi 1 high salt buffer. Insert DNA was purified in 1% agarose, the DNA bands excised and purified using Geneclean (BIO 101 Inc., La 15 Jolla, USA). Following quantitation by absorbance at 260 nm, approximately 100 ng of insert DNA was ligated (2 units T4 DNA ligase, Boehringer Mannheim) to approximately 50 ng of CsCl purified, phosphatased pGEX-3EX DNA digest with both iscoRl and Xhol.

The ligated cDNA in pGEX-3EX (see below) was transformed into E. coli 20 strain BB4 (Stratagene Qoning Systems, La Jolla, California, USA, catalogue # 200269) by electroporation using a BioRad Gene Pulser according to the manufacturer's instructions (BioRad, Richmond, USA).

EXAMPLE 4: PRODUCTION OF E. GRANULOSUS FUSION PROTEIN 25 Selected E. granulosus oncosphere cDNA clones were subcloned into the expression plasmid pGEX-3EX and transformed into E. coli strain BB4 as described above.

Expression yields a parasite protein fused with glutathione S-transferase (GST). Such fusion proteins are frequently soluble and able to be purified from 30 lysed cells under non-denaturing conditions by absorption with glutathione-agarose beads.

METHOD AND MATERIALS GST fusion proteins were induced and purified essentially as described by 35 Smith and Johnson, Gene 67 31-40 (1988) using the specific steps detailed below: 1. A colony of pGEX transform ant was inoculated into 4 x 100 ml LB/ampicillin medium, incubated overnight at 37°C in a shaking incubator. 2. Cultures were diluted 1:10 into fresh LB/ampicillin medium, incubated 90 mins at 30°C.

SUBSTITUTE SHE£T 2 4*3 6 0 0 WO 93/16722 PCT/NZ93/00007 Expression was induced by the addition of 100 mM IPTG to 0.1 mM. Incubation was continued an additional 4Vi hours.

Cells were harvested by centrifugation at 5000 x g, 4°C, 10 mins.

The cell pellet from each 1 litre was resuspended in 15 ml cold PBS pH 72 and stored at -20°C/-70°C until required.

Pellets were thawed and lysozyme added to 0.25 mg/ml, incubated room temperature, 10 mins.

Triton X-100 was added to 0.5%.

Cell suspensions were sonicated on ice 3 x 12 sec burst, with 15 sec recovery periods.

Insoluble material was removed by centrifugation at 10,000 x g, 4°C, 15 mins. The supernatant from 1 litre starting culture was added to 15 ml 50% glutathione agarose beads and mixed gently at room temperature, 3 hours. Agarose beads were pelleted by centrifugation at 2000 g, 5 min, at room temperature.

Agarose beads were washed 5 x with the bed volume of cold PBS by centrifugation at 2000 g, 5 min, room temperature.

GST fusion protein attached to agarose recovered.

Fusion protein concentration on the agarose beads was determined by the Bradford protein assay (Biorad).

EXAMPLES: DEMONSTRATION OF IMMUNOGENICITY OF E.

GRANULOSUS FUSION PROTEIN IMMUNISATION OF SHEEP 25 The sheep were 8 months old at the time of the initial vaccination, and had been reared on pasture free of K granulosus eggs. They were a mix of Romney and Dorset breeds, and were randomised into 9 groups of 5 treated sheep and 1 group of 8 controls. Each animal received 50 ng fusion protein attached to agarose (prepared in accordance with Example 4), made up 1 saline: 1 STM 30 adjuvant (Bokhout B A, van Gaalen C and Van der Heijden Ph J, A selected water-in-oil emulsion: Composition and usefulness as an immunological adjuvant, Veterinary Immunology and Immunopathology 2 491-500 (1981)). The total injection volume, of 2 ml/sheep was administered half subcutaneously and half intramuscularly on the left side, and was repeated 1 month later on the right side. 35 Controls received the expressed glutathione S-transferase from non-recombinant pGEX. 3. 4. . 6. 7. 8. 9. . 11. 12. 13. 14. . ci iDCTjriiTr CUCCT 2u1600 PCT/NZ93/00007.

Two weeks after the second injection, the sheep were bled and serum prepared for in vitro culture and for immunoblotting against oncosphere antigen as described in Example 1. The same day, the sheep were challenged with 1000 E. granulosus eggs orally, as described for Example 1.

NECROPSY Six months after challenge, sheep were exsanguinated after stunning with a captive bolt, and their liver and lungs removed for examination. Livers were sliced at 2 mm intervals and inspected closely by eye for the presence of cysts.

Lungs were sliced at 4 mm intervals and the slices palpated to determine the presence of cysts. All questionable lesions were sliced open to confirm whether they were E. granulosus cysts.

RESULTS Necropsy results are shown in Table 3, and oncosphere-killing in vitro in Table 4. A significant degree of immunity to challenge was stimulated by clone S2 (97%. P< 0.001. F=24.04, 11DF); clone 48 (83%. P=0.002. F=16.51, 11DF); clone 95 (96%. P<0.001. F=23.41, 11DF); clone 119 (83%. P=0.002, 11DF).

In vitro killing of oncospheres was only observed in pooled sera from these four clones, and the mix of all clones.

All these clones produced antibody that reacted with the 23-25 kD native protein, while two clones (101 and 123) that did not induce statistically significant protection reacted with the native 34 kD molecule. Another clone that did not induce statistically significant protection (S3), reacted with the 30 kD molecule (Figure 2).

Clones S2 and 95 both induced a strong IgG2 response to the 23-25 kD molecule, compared to the less-effective clones 48 and 119. Individual sheep in these groups of five also reinforced the hypothesis that a strong IgG2 response is helpful in inducing protective immunity (Figure 3).

The small variability in the results of the 10 sheep immunised with clone S2 or 95 indicates that this sequence may be recognised by a wide range of genotypes.

SUBSTITUTE SHEET 2 6 0 0 27- Table 3: Necropsy results of sheep challenged with E. granulosus eggs after immunisation with recombinant antigens Table 4: The in vitro killing of E. granulosus oncospheres by pooled group sera collected on the day of challenge with E. granulosus eggs.

, WO 93/16722 Group Immunising Antigen Sheep Tag Numbers Number of Cysts Average 11 CLONE S2 2833,46,29,16 23,0,163 4.8 12 CLONE S3 56,54,36,26,71 0,68,7233,99 58.4 13 CLONE 48 31,49,25,22,66 1738,12,0,46 266 14 CLONE 95 76,80,10,4232 13,143,0^ 6.8 CLONE 101 58,02,93,79,83 64,7930,108,100 76 2 16 CLONE 119 84,73,91,8545 53,29,0,13,40 27 17 CLONE 123 21,07,34,81,63 305,8,10020,40 94.6 18 MIX of 7 CLONES 89,61,75,74,70 8,7427,0,105 418 19 CLONES 33,42,86 32,87,69,78,59 6,130,136,5,200 95.4 GST-CONTROL 94,97,99,00,01,02,04, 05 70,105270,180, 122,227,108,171 156.6 Group Number Treatment % Killed 11 Clone S2 94% 12 Clone S3 0% 13 Qone 48 97% 14 Clone 95 100% Clone 101 0% 16 Qone 119 89% 17 Clone 123 0% 18 Mix of all clones 89% 19 Mix of clones 33,42,86 0% Adjuvant controls 0% 21 Oncosphere controls 0% SUBSTITUTE SHEET 2 6 0 0 l WO 93/16722 PCT/NZ93/00007 ' -28- EXAMPLE 6: PARTIAL DNA SEQUENCING OF CLONES S2. 48. 95. 119 Production of pBluescript The Phagemid pBluescript was generated by phagemid rescue from Lambda-Zap stocks for each cDNA as described in the UNI-ZAP XR Qoning Kit 5 manufacturer's instructions (Stratagene).

Preparation of single-stranded DNA Single-stranded DNA was prepared from the plasmid pBluescript (Stratagene) using techniques described by Ausubel et aL, Eds, "Current Protocols 10 in Molecular Biology", Green Publishing Associates and Wiley Interscience, New York (1987). cDNA Sequencing cDNA's were partially sequenced by chain termination (Sanger F, Nicklen S 15 and Coulson A R, DNA sequencing with chain-terminating inhibitors, Proc Natl Acad Sci USA 14 5463 (1977)) using Sequenase, Version 2.0 (United States Biochemical). The primer was T3 (Albert Einstein College of Medicine, Oligonucleotide Synthesis Unit). Termination reactions were resolved on a 6% polyacrylamide gel and visualised by autoradiography (X-Omat, Kodak).

Results The results are presented in Table 5.

SUBSTITUTE SHEET 2i|«l 6 0 WO 93/16722 PCT/NZ93/00007 > -29- Table 5: Name: 95 Name: S2 Name: 48 Name: 119 Len: 224 Len: 224 Len: 224 Len: 224 i 95 TCCAGTTAT GTCTCATTTT S2 TCCAGTTAT GTCTCATTTT 48 GTCTCATTTT 119 GTCTCATTTT Check: 7088 Check: 7088 Check: 7088 Check: 7088 Weight: 1.00 Weight: 1.00 Weight: 1.00 Weight: 1.00 59 GTTTGCGACT TCAGTTTTGG CTCAGGAATA CAAAOGAATG GTTTGCGACT TCAGTnTGG CTCAGGAATA CAAAGGAATG GTTTGCGACT TCAGTTTTGG CTCAGGAATA CAAAGGAATG GTTTGCGACT TCAGTnTGG CTCAGGAATA CAAAGGAATG 95 S2 48 119 95 S2 48 119 95 S2 48 119 60 109 GGCGTAGAGA CAAGGACAAC AGAGACTCCG CTCCGTAAAC ACTTCAATTT GGCGTAGAGA CAAGGACAAC AGAGACTCCG CTCCGTAAAC ACTTCAATTT GGCGTAGAGA CAAGGACAAC AGAGACTCCG CTCCGTAAAC ACTTCAATTT GGCGTAGAGA CAAGGACAAC AGAGACTCCG CTCCGTAAAC ACTTCAATTT 110 159 GACTCCTGTG GGTTCTCAGG GCATTCGCIT AAGTTGGGAA GTCCAACACT GACTCCTGTG GGTTCTCAGG GCATTCGCIT AAGTTGGGAA GTCCAACACT GACTCCTGTG GGTTCTCAGG GCATTCGCTT AAGTTGGGAA GTCCAACACT GACTCCTGTG GGTTCTCAGG GCATTCGCIT AAGTTGGGAA GTCCAACACT 160 209 TGTCTGACCT CAAAGGAACA GATATTTCTC TAAAAGCGGT GAATCCTTCT TGTCTGACCr CAAAGGAACA GATATTTCTC TAAAAGCGGT GAATCCTTCT TGTCTGACCT CAAAGGAACA GATATTTCTC TAAAAGCGGT GAATCCTTCT TGTCTGACCT CAAAGGAACA GATATTTCTC TAAAAGCGGT GAATCCTTCT 95 S2 48 119 210 GACCCGTTAG GACCCGTTAG GACCCGTTAG GACCCGTTAG 233 TCTACAAAAG ACAA TCTACAAAAG ACAA TCTACAAAAG ACAA TCTACAAAAG ACAA 40 As can be seen from Table 5, each of the clones shown to express antigens protective against E. granulosus includes an identical 224 bp DNA molecule (nucleotides 10-233 above).

EXAMPLE 7: DNA SEQUENCING OF CLONE 95 cDNA's were sequenced using the ^Sequencing Kit (Pharmacia) with CsCl-purified plasmid DNA and oligonucleotide primers derived from the pGEX 45 sequence approximately 30bp up- and down-stream from the Eco R1 cloning site.

Oligonucleotides were manufactured using a PCR-MATE 391 DNA Synthesizer (Applied Biosystems, Foster City, CA USA) and chemicals from Applied CIIRQTITIITP SHEET 2 6 0 0 PCT/ N Z93/00007 Biosystems. Internal sequence was obtained through the use of forward and reverse oligonucleotide primers designed from the internal cDNA sequence.

The full sequence of clone 95 and the predicted amino acid sequence of the translated protein is shown in Figure 4. Clone 95 cDNA comprises a 715 bp 5 insert (excluding nucleotides derived as part of the cloning strategy into A ZAP). This cDNA comprises an open reading frame of 461 bp encoding a predicted protein having a molecular weight of 16592 Da.

The following DNA sequence is included in the full sequence of clone 95 and was derived from the strategy used in production of the cDNA and cloned 10 into the A. ZAP XR vector.

At the 5' end of the cDNA: ' GAATTCGGCACGAG T At the 3' end of the cDNA: * AAAAAAAAAAAAAAAAAACTCGAG *' The sequence of Figure 4 was independently confirmed using the procedure of Example 6.

INDUSTRIAL APPLICATION 20 In accordance with the present invention there is provided an antigenic polypeptide together with active peptide fragments and variants of such a polypeptide which are effective in generating a protective immunological response against E. granulosus infection in a susceptible host. It has been established that vaccination with this polypeptide and/or its peptide fragments 25 stimulates almost complete immunity against challenge infection with E. granulosus eggs. The invention also provides a recombinant method for expression of the antigen by which commercial quantities can be obtained.

It will be appreciated that the above description is provided by way of example only and that variations in both the materials and the techniques used 30 which are known to those persons skilled in the art are contemplated.

SUBSTITUTE SHEET WO 93/16722 PCT/1^93/000^7 ^ , -31-SEQUENCE LISTING (1) GENERAL INFORMATION: (1) APPLICANT: NEW ZEALAND PASTORAL AGRICULTURAL INSTITUTE LIMITED, a company incorporated under the Companies Act 1955 pursuant to the Crown Research Institutes Act 1992 and having its registered office at Peat Marwick Tower, 85 Alexandra Street, Hamilton, New Zealand, THE UNIVERSITY OF MELBOURNE, a body corporate organised and existing under the laws of the State of Victoria, of Grattan Street, Parkville, Victoria 3052, Australia. (2)TITLE OF INVENTION: Antigens protective against Echinococcus granulosus infection and vaccines containing such antigens. (3)NUMBER OF SEQUENCES: 4 (4)CORRESPONDENCE ADDRESS: (A) ADDRESSEE:A J PARK & SON (B) STREET: HUDDART PARKER BUILDING, POST OFFICE SQUARE (c) CITY: P 0 BOX 949, WELLINGTON (D) COUNTRY". NEW ZEALAND (5 ^COMPUTER READABLE FORM: (A) MEDIUM TYPE: 3.5,DS,HD FLOPPY DISC• (B) COMPUTER: IBM PC COMPATIBLE (C) OPERATING SYSTEM: MS-DOS (D) SOFTWARE: WORP PERFECT 5.1 FOR WINDOWS (6)CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: 22—FEBRUARY—1993 (C) CLASSIFICATION: (7)ATTORNEY/AGENT INFORMATION: (A) NAME: BENNETT, MICHAEL R. (8)TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (64 4) 473 8278 (B) TELEFAX: (64 4) 472 3358 472 3351 (2) INFORMATION FOR SEQUENCE ID NO. 1: (1 )SEQUENCE CHARACTERISTICS: (A) LENGTH: 224 BASE PAIRS (B) TYPE: NUCLEIC ACID (C) STRANDEDNESS: SINGLE (D) TOPOLOGY: LINEAR (2)MOLECULE TYPE: cDNA (3 JSEQUENCE DESCRIPTION: SEQ ID NO. 1: GT CTC ATT TTG TTT GCG ACT TCA GTT TTG GCT CAG GAA TAC AAA GGA Leu lie Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly 47 48 ATG GGC GTA GAG ACA AGG ACA ACA GAG ACT CCG CTC CGT AAA CAC 92 Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His 93 TTC AAT TTG ACT CCT GTG GGT TCT CAG GGC ATT CGC TTA AGT TGG Phe Asn Leu Thr Pro Val Gly Ser Gin Gly lie Arg Leu Ser Trp 137 SUBSTITUTE SHEET 2 6 0 0 WO 93/16722 PCT/NZ93/00007 138 GAA GTC CAA CAC TTG TCT GAC CTC AAA GGA ACA GAT ATT TCT CTA 182 Glu val Gin His Leu Ser Asp Leu Lys Gly Thr Asp lie Ser Leu 1 83 AAA GCG GTG AAT CCT TCT GAC CCG TTA GTC TAC AAA AGA CAA • 224 Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin SIIRSTITUTP SH* JtiMLfi o 0 (3) INFORMATION FOR SEQ ID NO. 2: (1)SEQUENCE CHARACTERISTICS (A) LENGTH: 74 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (2)MOLECULE TYPE: PROTEIN (3)SEQUENCE DESCRIPTION: SEQ ID NO. 2: 1 Leu lie Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly 15 16 Met Gly Val Glu Thr Thr Thr Glu Thr Pro Leu Arg Lys His 30 31 Phe Asn Leu Thr Pro Val Gly Ser Gin Gly lie Arg Leu Ser Trp 45 46 Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp lie Ser Leu 60 61 Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin 74 2 i»«* 6 0 PCT/Nz.yj/00007 (4)INFORMATION FOR SEQ ID NO. 3: (1)SEQUENCE CHARACTERISTICS: (A) 1ENGTH: 715 BASE PAIRS (B) TYPE: NUCLEIC ACID (C) STRANDEDNESS: SINGLE (D) TOPOLOGY: LINEAR (2)MOLECULE TYPE: cDNA (3)SEQUENCE DESCRIPTION: SEQ ID NO. 3: 1 TC CAG TTA TGT CTC ATT TTG TTT GCG ACT TCA GTT TTG GCT CAG GAA 47 Gin Leu Cys Leu lie Leu Phe Ala Thr ser Val Leu Ala Gin Glu 48 TAC AAA GGA ATG GGC GTA GAG ACA AGG ACA ACA GAG ACT CCG CTC 92 Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu 93 CGT AAA CAC TTC AAT TTG ACT CCT GTG GGT TCT CAG GGC ATT CGC 137 Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly lie Arg 138 TTA AGT TGG GAA GTC CAA CAC TTG TCT GAC CTC AAA GGA ACA GAT 182 Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp 183 ATT TCT CTA AAA GCG GTG AAT CCT TCT GAC CCG TTA GTC TAC AAA 227 lie Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys 228 AGA CAA ACT GCA AAA TTC TCA GAT GGA CAA CTC ACT ATC GGC GAA 272 Arg Gin Thr Ala Lys Phe Ser Asp Gly Gin Leu Thr lie Gly Glu 273 CTG AAG CCC TCC ACA TTA TAC AAA ATG ACT GTG GAA GCA GTG AAA 317 Leu Lys Pro Ser Thr Leu Tyr Lys Met Thr Val Glu Ala Val Lys 318 GCG AAA AAG ACC ATT TTG GGA TTC ACC GTA GAC ATT GAG ACA CCG 362 Ala Lys Lys Thr lie Leu Gly Phe Thr Val Asp lie Glu Thr Pro SUBSTITUTE SHEET 2(f1 6 I -35- ■ 363 CGC GCT GGC AAG AAG GAA AGC ACT GTA ATG ACT AGT GGA TCC GCC 407 Arg Ala Gly Lys Lys Glu Ser Thr Val Met Thr Ser Gly Ser Ala 408 TTA ACA TCC GCA ATC GCT GGT TTT GTA TTC AGC TGC ATA GTG GTT 452 Leu Thr Ser Ala lie Ala Gly Phe Val Phe Ser Cys He Val Val 453 GTC CTT ACT TGA ACT CTC ATG TAA GTC AAT GCA AAT TAT CCA CTG 497 Val Leu Thr 498 CTT CTA TAC TGA GTA GCA CGA CCC ATA ACT TGC ATT TTT CAA ATA 542 543 ACT CTT CTT CCA CAT CAG GCT TCC TTG GTG CCG AAG ATG CAC AAA 587 588 TCA CCA TTT ATT TTC GCT TTA TTA ACA TTT GTA TGA CCT CTC ATT 632 633 GTG GAT TAC TCC CGA ATG ACA AAT ACG GGA CTT TGT CAT ATT TGC 677 678 TTC ATT GTT ATC ACC CTT AAT TCC AAT TCA CTG ACT CG 715 SUBSTITUTE SHEET 2M« 6 WO 93/16722 PCT/NZ93/00007 (5) INFORMATION FOR SEQ NO. 4: (1) SEQUENCE CHARACTERISTICS: (A) 1ENGTH: 153 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (2) MOLECULE TYPE: PROTEIN (3) SEQUENCE DESCRIPTION: SEQ ID NO. 4: 1 Gin Leu Cys Leu lie Leu Phe Ala Thr Ser Val Leu Ala Gin Glu 15 « 16 Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu 30 31 Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly lie Arg 45 46 Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp 60 61 lie Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys 75 76 Arg Gin Thr Ala Lys Phe Ser Asp Gly Gin Leu Thr lie Gly Glu 90 91 Leu Lys Pro Ser Thr Leu Tyr Lys Met Thr val Glu Ala Val Lys 105 106 Ala Lys Lys Thr lie Leu Gly Phe Thr Val Asp lie Glu Thr Pro 120 121 Arg Ala Gly Lys Lys Glu Ser Thr Val Met Thr Ser Gly Ser Ala 135 136 Leu Thr Ser Ala lie Ala Gly Phe Val Phe Ser Cys lie Val Val 150 151 Val Leu Thr 153 qiirrtitiite SHEET 93/16722 -37

Claims (44)

CLAIMS:

1. A purified antigenic polypeptide which has a molecular weight in the range of from 23 to 25 kD calculated by SDS-PAGE, which includes the amino acid sequence Leu He Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp He Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin and which is capable of generating a protective immunological response to E. granulosus infection in a susceptible host; or a peptide fragment or variant thereof having substantially equivalent protective immunological activity thereto.

2. A peptide fragment according to claim 1 including the amino acid sequence Leu He Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Tip Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp He Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin .

3. A peptide fragment according to claim 1 consisting of the amino acid sequence Leu He Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp He Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin . 6 0 0 PCT/NZ93/00007 SUBSTITUTE SHEET WO 93/16722 -38- 2M 6 00 PCT/NZ93/00007

4. A peptide fragment according to claim 1 consisting of the amino acid sequence Gin Leu Cys Leu lie Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp lie Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin .

5. A polypeptide or peptide fragment according to claim 1 including the amino acid sequence Gin Leu Cys Leu He Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp He Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin Thr Ala Lys Phe Ser Asp Gly Gin Leu Thr He Gly Glu Leu Lys Pro Ser Thr Leu Tyr Lys Met Thr Val Glu Ala Val Lys Ala Lys Lys Thr He Leu Gly Phe Thr Val Asp He Glu Thr Pro Arg Ala Gly Lys Lys Glu Ser Thr Val Met Thr Ser Gly Ser Ala Leu Thr Ser Ala He Ala Gly Phe Val Phe Ser Cys He Val Val Val Leu Thr .

6. A peptide fragment according to claim 1 consisting of the amino acid sequence Gin Leu Cys Leu He Leu Phe Ala Thr Ser Val Leu Ala Gin Glu Tyr Lys Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lys His Phe Asn Leu Thr Pro Val Gly Ser Gin Gly He Arg Leu Ser Trp Glu Val Gin His Leu Ser Asp Leu Lys Gly Thr Asp He Ser Leu Lys Ala Val Asn Pro Ser Asp Pro Leu Val Tyr Lys Arg Gin Thr Ala Lys Phe Ser Asp Gly Gin Leu Thr He Gly Glu Leu Lys Pro Ser Thr Leu Tyr Lys Met Thr Val Glu Ala Val Lys Ala Lys Lys Thr He Leu Gly Phe Thr Val Asp ne Glu Thr Pro Arg Ala Gly Lys Lys Glu Ser Thr Val Met Thr Ser Gly Ser Ala Leu Thr Ser Ala He Ala Gly Phe Val Phe Ser Cys lie Val Val Val Leu Thr . ClinCTITIITC CUrCT 24 9 6 0

7. A polypeptide or peptide fragment or variant thereof as claimed in any one of claims 1 to 6 which is the product of expression of a nucleotide sequence coding therefor in a host cell.

8. A polypeptide or peptide fragment or variant thereof as claimed in claim 7 which is expressed in the host cell as a fusion protein.

9. A polypeptide or peptide as claimed in claim 8 which is expressed as a fusion protein with the enzyme glutathione s-transferase (E.C 2.5.18).

10. A composition of matter capable of generating a protective immunological response to E. granulosus infection in a susceptible host which essentially consists of a component selected from the group consisting of: (a) the polypeptide of claim 1; (b) a peptide fragment of (a) having equivalent protective immunological activity thereto; and (c) a variant of (a) or (b) which has been modified by the insertion, substitution or deletion of one or more amino acids and which has at least equivalent protective immunological activity thereto.

11. An isolated DNA molecule which is selected from the group consisting of: (a) a nucleotide sequence encoding the antigenic polypeptide of claim 1; (b) a nucleotide sequence encoding a peptide fragment of the antigenic peptide of (a), which fragment has equivalent protective immunological activity to the polypeptide of (a); and (c) a nucleotide sequence encoding a variant of the polypeptide of (a) or the peptide of (b) in which the amino acid sequence has been modified by the insertion, substitution or deletion of one or more amino acids, which variant has equivalent protective immunological activity to the polypeptide of (a) or the peptide fragment of (b). N.Z. PAiTNT crrtciT1 - 9 SEP 1996 -40- 24 9 60 0

12. An isolated DNA molecule having the DNA sequence GT CTC ATT TTG TTT GCG ACT TCA GTT TTG GCT CAG GAA TAC AAA GGA ATG GGC GTA GAG ACA AGG ACA ACA GAG ACT CCG CTC CGT AAA CAC TTC AAT TTG ACT CCT GTG GGT TCT CAG GGC ATT CGC TTA AGT TGG GAA GTC CAA CAC TTG TCT GAC CTC AAA GGA ACA GAT ATT TCT CTA AAA GCG GTG AAT CCT TCT GAC CCG TTA GTC TAC AAA AGA CAA .

13. An isolated DNA molecule having the DNA sequence CAG TTA TGT CTC ATT TTG TTT GCG ACT TCA GTT TTG GCT CAG GAA TAC AAA Gin Leu Cya Leu lie Leu Che Ala Thr Ser Val Leu Ala Gin Glu Tyr Lya GGA ATG GGC GTA GAG ACA AGG ACA ACA GAG ACT CCG CTC CGT AAA CAC TTC Gly Met Gly Val Clu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lya Hi a She AAT TTG ACT CCT GTG GGT TCT CAS GGC ATT CGC TTA AGT TGG GAA GTC CAA Asn Leu Thr Pro Val Gly Ser Gin Gly Xle Arg Leu Ser Trp Olu Val Gin CAC TTG TCT GAC CTC AAA GGA ACA GAT ATT TCT CTA AAA GCG GTG AAT CCT His Leu Ser Asp Leu Lys Gly Thr Asp lie Ser Leu Lya Ala Val Asn Pro TCT CAC CCG TTA CTC TAC AAA AGA CAA ACT GCA AAA TTC TCA GAT GGA CAA Ser Asp Pro Leu Val Tyr Lya Arg Gin Thr Ala Lya Phe Ser Asp Gly Gin CTC ACT ATC GGC GAA CTG AAG CCC TCC ACA TTA TAC AAA ATO ACT GTG GAA Leu Thr Xle Gly Clu Leu Lys Pro Sar Thr Leu Tyr Lya Met Thr Val Glu GCA GTG AAA GCG AAA AAG ACC ATT TTG GGA TTC ACC GTA GAC ATT GAG ACA Ala Val Lys Ala Lys Lys Thr Xle Leu Gly Phe Thr Val Asp Xle Glu Thr CCG CGC GCT GGC AAG AAG GAA AGC ACT CTA ATG ACT AGT GGA TCC CCC TTA Pro Arg Ala Gly Lys Lys Glu Ser Thr Val Met Thr Ser Gly Ser Ala Leu ACA TCC GCA ATC GCT GGT TTT GTA TTC AGC TGC ATA TTO GTT GTC CTT ACT Thr S«r Ala He Ala Gly Phe Val Phe Ser Cya Xle Val Ve.1 Val Leu Thr N.Z. l-'ATC.M O"' " rvp - 9 SEP 1996 nL'..,L IVLD -41- 24 9 60 0

14. An isolated DNA molecule having the DNA sequence TC CAG TTA TOT CTC ATT TTG TTT OCO ACT TCA GTT TTO GCT CAO GAA TAC AAA Oln Leu Cya L«u Xle Ltu Phe Ala Ttar Ser Val Leu Ala Gin Olu Tyr Lya GGA ATG GGC GTA GAG ACA AGG ACA ACA GAG ACT CCG CTC CGT AAA CAC TTC Gly Met Gly Val Glu Thr Arg Thr Thr Glu Thr Pro Leu Arg Lya Hi. a Phe AAT TTG ACT CCT QTO GGT TCT CAG GGC ATT CGC TTA AGT TOG GAA GTC CAA Aan Leu Thr Pro Val Gly Ser Gin Gly lie Arg Leu Ser Trp Glu Val Gin CAC TTG TCT GAC CTC AAA GGA ACA GAT ATT TCT CTA AAA GCG CTG AAT CCT HI* Leu Ser Asp Leu Lya Gly Thr Asp lie Ser Leu Lya Ala Val Aan Pro;TCT GAC CCG TTA GTC TAC AAA AGA CAA ACT GCA AAA TTC TCA GAT GGA CAA Ser Asp Pro Leu Val Tyr Lya Arg Gin Thr Ala Lya Phe Ser Aap Gly Gin;CTC ACT ATC GGC GAA CTG AAG CCC TCC ACA TTA TAC AAA ATG ACT GTG GAA Ltu Thr lie Gly Glu Leu Lya Pro Ser Thr Leu Tyr Lya Met Thr Val Glu;GCA GTG AAA GCG AAA AAG ACC ATT TTG GGA TTC ACC GTA GAC ATT GAG ACA Ala Val Lya Ala Lya Lya Thr lie Leu Gly Phe Thr Val Asp lie Glu Thr;CCG CGC GCT GGC AAG AAG GAA AGC ACT GTA ATG ACT AGT GGA TCC GCC TTA Pro Arg Ala Gly Lya Lya Glu Ser Thr Val Met Thr Ser Gly Ser Ala Leu;ACA TCC GCA ATC GCT GGT TTT GTA TTC AGC TGC ATA GTG GTT GTC CTT ACT Thr Ser Ala lie Ala Gly Phe Val Phe Ser Cya lie Val Val Val Leu Thr';TOAACTCTCATGTAACTCAATOCAAATTATCCACTGCTTCTATACTGAOTAGCACOACCCATAACTT;GCATTTTTCAAATAACTCTTCTTCCACATCAGGCTTCCTTGGTGCCGAAGATGCACAAATCACCATT;TATTTTCGCTTTATTAACATTTaTATGACCTCTCATTGTGGATTACTCCCGAATGACAAATACGGGA;CTTTGTCATATTTGCTTCATTGTTATCACCCTTAATTCCAATTCACTGACTCO;2 u* 6 0 0 WO 93/J 6722 PCT/NZ93/00007 -42-

15. • A DNA molecule as claimed in any one of claims 11 to 14 which has been isolated from a natural source.

16. A DNA molecule as claimed in any one of claims 11 to 14 which is cDNA

17. A recombinant expression vector which contains a DNA molecule as claimed in any one of claims 11 to 16.

18. A host cell transformed with a vector as claimed in claim 17 and capable of expressing the polypeptide or peptide fragment or variant thereof which is encoded.

19. A host cell as claimed in claim 18 which is a prokaryote.

20. A host cell as claimed in claim 19 wherein the prokaryote host is E. coli.

21. A host cell as claimed in claim 18 which is a eukaiyote.

22. A method of producing an antigenic polypeptide or a peptide fragment or variant thereof, which comprises culturing a cell as claimed in any one of claims 18 to 21 and recovering the expressed product

23. An antigenic polypeptide, peptide fragment or variant produced by the method of claim 22.

24. A vaccine comprising an immunologically-effective amount of a polypeptide, peptide fragment or variant as claimed in any one of claims 1 to 9 and 23 in combination with a pharmaceutical^ acceptable adjuvant, carrier or diluent therefor.

25. A vaccine as claimed in claim 24 which further includes an effective amount of one or more E. granulosus polypeptide(s) having a molecular weight determined by SDS-PAGE selected from 30 kD, 34 kD and 40 kD, or of one or more fragments or variants of said polypeptides having equivalent immunological activity thereto. PiioeriTHTC CUCCT -43- 24 9 60 0

26. A recombinant viral vaccine which includes nucleic acid encoding an antigenic polypeptide or peptide fragment or variant thereof as claimed in claim 1 and which is capable of expressing said encoded polypeptide or peptide fragment or variant.

27. A method of protecting a non-human host susceptible to infection by an Echinococcus or Taeniid parasite against such infection comprising administering to a said host an immunologically effective amount of a polypeptide, peptide fragment or variant as claimed in any one of claims 1 to 8 and 22.

28. A method of protecting a non-human host susceptible to infection by an Echinococcus or Taeniid parasite against such infection comprising administering to a said host an immunologically effective amount of a composition as claimed in claim 10.

29. A method of protecting a non-human host suscepiible to infection by an Echinococcus or Taeniid parasite against such infection comprising administering to a said host an immunologically effective amount of a vaccine as claimed in any one of claims 24 to 26.

30. A method as claimed in any one of claims 27 to 29 wherein said parasite is E. granulosus.

31. A method as claimed in any one of claims 27 to 29 wherein said parasite is E. multilocularis, E. vogelii, T. ovis, T. saginata, T. solium, T. multiceps or T. hydatigena.

32. A purified antibody or binding fragment thereof specific for an antigenic polypeptide, peptide fragment or variant as claimed in claim 1.

33. An optionally-labelled DNA molecule comprising part or all of the nucleotide sequence of Figure 4 suitable for use as a probe for identifying nucleic acid coding for a protective antigen of an Echinococcus or Taeniid parasite other than E. granulosus.

34. The use of an antibody or binding fragment thereof as claimed in claim 32 to identify a protective antigen of an Echinococcus or Taeniid parasite other than E. granulosus. -44- 249600

35. The use of a DNA molecule as claimed in claim 33 to identify DNA encoding a protective antigen of an Echinococcus or Taeniid parasite other than E. granulosus.

36. The use of claim 34 or claim 35 wherein the parasite other than E. granulosus is E. multilocidaris, E. vogelii, T. ovis, T. saginata, T. solium, T. multiceps or T. hydatigena.

37. A method of identifying a protective antigen of an Echinococcus or Taeniid parasite other than E. granulosus which comprises the step of identifying a gene of said parasite having a nucleotide sequence which is at least substantially homologous to part or all of the nucleotide sequence of Figure 4.

38. An antigenic polypeptide, peptide fragment or variant as claimed in claim 1 substantially as herein described with reference to any example thereof or to the accompanying drawings.

39. A DNA molecule as claimed in claim 11 substantially as herein described having part of all of the sequence of Figure 4.

40. A recombinant expression vector as defined in claim 17 substantially as herein described.

41. A host cell as defined in claim 18 substantially as herein described.

42. A method of producing an antigenic polypeptide, peptide fragment or variant as claimed in claim 22 substantially as herein described.

43. A vaccine as defined in claim 24 substantially as herein described.

44. A method of protecting a non-human host susceptible to infection by Echinococcus or Taeniid parasite against such infection as claimed in any one of claims 27 to 29 substantially as herein described with reference to any example thereof or to the accompanying drawings. By the authorised agents A J PARK & SON KJ£x>^i "2£ZA£_'Vru"D ,4<3^1CU LST^ejr <2£S>£}<V2CH "JSTiTUTe CimiTCj) UAoiut^Siry oC