MXPA97002529A - Novedosas proteins of saliva of ectoparasito, yaparato for the obtaining of such protei - Google Patents

Abstract

The present invention relates to a novel product and method for isolating ectoparasite saliva proteins, and a novel product and method for detecting and / or treating allergic dermatitis in an animal. The present invention includes a collection apparatus for saliva proteins capable of collecting ectoparasite saliva proteins substantially free of contaminating material. The present invention also relates to ectoparasite saliva proteins, nucleic acid molecules having sequences encoding such proteins and antibodies raised against such proteins. The present invention also includes methods for obtaining such proteins, and for using such proteins to identify susceptible animals, or, having allergic dermatitis. The present invention also includes therapeutic compositions comprising such proteins, and their use for treating susceptible animals or having allergic dermatitis.

Description

NEW PROTEINS OF ECTOPARASIUM SALIVA, AND APPARATUS FOR THE OBTAINING OF SUCH PROTE FIELD OF THE INVENTION The present invention relates to a novel method and product for isolating ectoparasite saliva proteins, and a novel method and product for detecting and / or treating dermatitis in animals.

BACKGROUND OF THE INVENTION Ectoparasite bites, - in particular fleas, can cause a hypersensitive response in animals. In particular, hypersensitive responses to flea bites manifest themselves in a disease called flea allergy dermatitis (FAD). Hypersensitivity refers to the state of altered reactivity in which an animal, having Tj previously exposed to the compound, exhibits an allergic response to the compound at subsequent exposures. Hypersensitive responses include Type I hypersensitivities, Type II, Type III and Type IV. Type I hypersensitivity is described as IgE-mediated hypersensitivity, in which a The allergen induces an IgE cross-linkage bound to Fc receptors on the surface of mast cells. This cross-linking results in the degranulation of mast cells. Type II hypersensitivity is described as cytotoxic hypersensitivity mediated by an antibody, in which antibodies bind to cell surface allergens, resulting in cell destruction through complement activation. Type III hypersensitivity is described as hypersensitivity mediated by the immune complex, in which allergen-antibody complexes are deposited in various tissues, and induce inflammatory responses. A delayed hypersensitive reaction includes Type IV hypersensitivity that is described as a cell-mediated hypersensitivity, in which T lymphocytes (e.g., T cells) release cytokines that activate macrophages or cytotoxic T cells that cause cell destruction. Type I hypersensitive response commonly occurs within 2 to 30 minutes after exposure to an allergen compound, which is commonly a soluble allergen. Types II and III of responses can occur between 2 to 8 hours after exposure to an allergen compound. Alternatively, in a delayed hypersensitivity response, the allergic response by an animal to an allergen compound is typically manifest from 24 to about 72 hours after exposure to the compound. During the 24-hour delay, mononuclear cells infiltrate the area where the agent is located. Infiltration may include lymphocytes, monocytes, macrophages and basophils. Lymphokines (eg, interferon-?) That activate monocytes or macrophages are produced to secrete enzymes (eg, proteases) that cause tissue damage. Compounds foreign to the organism that induce symptoms of immediate and / or delayed hypersensitivity are referred to herein as allergens. The term "allergen" refers primarily to foreign compounds capable of causing an allergic response. The term can be used interchangeably with the term "antigen", especially with respect to compounds foreign to the organism that induce symptoms of immediate and / or delayed hypersensitivity. Factors that influence the susceptibility of an animal to the allergen may include genetic component and / or environmental exposure to the allergen. Animals can be desensitized to the allergen by repeated injections of the allergen to which an animal is hypersensitive. FAD can have manifestations of both types of hypersensitivity, immediate or delayed. Typically, an immediate hypersensitive response in an animal susceptible to FAD includes the formation of a welt at the site of the flea bite. Such hives can develop in a scaly papule, representative of a delayed type of hypersensitivity. Hypersensitive reactions to flea bites may occur in genetically predisposed animals, as well as in animals sensitized by previous exposure to flea bites. The effective treatment of FAD has been difficult, if not impossible to achieve. FAD afflicts approximately 15% of cats and dogs in endemic areas of fleas, and the frequency increases every year. Effective control of fleas in a geographic area requires treatment of all animals. A treatment that some researchers have proposed includes the desensitization of animals, using flea allergens.

However, for such treatments reliable defined preparations of flea allergens are needed. Until the discovery of the novel formulas of the present invention, the flea allergens responsible for FAD have not been clearly defined. Preparations of whole flea antigens have been used to diagnose and desensitize animals with FAD (Benjamin et al., 1960, pages 214-222, Experimental Parasitology, Volume 10, Keep et al., 1967, pages 425-426, Australian Veterinary Journal, Volume 43; Kristensen et al., 1978, pages 414-423, Nord Vet-Med, Volume 30; Van in Le, 1981, pages 343-354, J. Amer. Animal Hosp. Assoc., Volume 17; Haliwell et al. 1987, pages 203-213, Veterinary Immunology and Immunopathology, Volume 15, Greene et al., 1993, pages 69-74, Parasite Immunology, Volume 15); PCT Publication No. WO 93/18788 by Opdebeeck et al., And Van Winkle, pages 343-354, 1981, J. Am. Anim. Hosp. Assoc. , Volume 32. The commercially available whole extracts of flea, however, are unpredictable and, therefore, have limited utility. Previous researchers have suggested that the products contained in flea saliva could be involved in FAD, and have also suggested methods for isolating such products: Benjamin et al., 1963, pages 143-154, Experimental Parasitology, Volume 13; Young et al., 1963, pages 155-166, Experimental Parasitology 13, Volume 13; Michaeli et al., 1965, pages 162-170, J. Immunol. , Volume 95; and Michaeli et al., 1966, pages 402-406, J. Immunol. , Volume 97. These investigators, however, have characterized the allergic factors of flea saliva as haptens of molecular weight less than 6 kilodaltons (kD). The fact that they are not proteins is also supported by the finding that they are not susceptible to degradation when exposed to strong acids (eg, 6 N hydrochloric acid) or heat. Some of the particular low molecular weight allergic factors have also been characterized as highly fluorescent aromatic fractions (Young et al., Ijid.). In addition, studies of such researchers have indicated that to be allergenic, such factors need to be associated with adjuvants and / or transporters, such as collagen or portions of the membrane used to obtain oral secretions. In addition, the described methods for obtaining flea saliva factors were difficult and unpredictable. Moreover, the factors isolated by these methods were typically contaminated with flea material, their culture media or skin-based membranes used to feed the fleas. Thus, a need remains to more clearly define flea saliva allergens capable of inducing a hypersensitive response in animals. Furthermore, a need remains here to develop a method for obtaining substantially pure flea saliva allergens that provide predictable and less expensive preparations of allergens useful for desensitizing animals subject to, or having FAD.

COMPENDIUM OF THE INVENTION The present invention relates to, in one embodiment, a formulation comprising at least one isolated ectoparasite salivary protein, wherein the ectoparasite salivary protein comprises at least a portion of an amino acid sequence, wherein the portion is encoded by a nucleic acid molecule capable of hybridizing under strict conditions with a nucleic acid molecule encoding a flea saliva protein present in the flea saliva extract FS-1, FS-2 and / or FS-3. Preferred flea saliva proteins include fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3 fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspn3. In addition, the flea salivary protein of the formula can include at least a portion of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NOM, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO : 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54. Another aspect of the present invention includes a formula comprising at least one isolated ectoparasite saliva protein, in which the salivary protein The ectoparasite comprises at least a portion of an amino acid sequence, wherein the portion is encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule encoding a flea salivary protein represented as a peak. of the protein in Figure 2. An aspect of the present invention includes a formula comprising an ectoparasite saliva product, in which formulation, when subjected to SDS-PAGE Tris-glycine, consists of a fractionation profile, such as illustrated in Figure IB, lane 13 and / or Figure IB, lane 14. Yet another aspect of The present invention includes a formulation comprising at least one ectoparasite saliva product isolated substantially free of contaminating material, the formulation being produced by a process consisting of: (a) obtaining ectoparasite saliva products by means of harvesters within a saliva collection apparatus containing ectoparasites, the apparatus comprising (i) a structure operatively connected to a chamber, said chamber having a warmer ambient temperature than the structure, by means of it forming a temperature differential between the structure and the camera, the structure being able to retain ectoparasites, and (ii) an interface between the structure and the camera, the interface comprising ((a)) means capable of collecting by a portion of the saliva products deposited by ectoparasites retained in the apparatus (b)) a barrier means capable of substantially preventing the contaminating material from coming into contact with the means of collection, in which the temperature differential attracts the ectoparasites retained in the structure to try to feed through the means of collection; and (b) extracting the saliva products from the collection means to obtain the formulation. Also included in the present invention is such apparatus and use such an apparatus for producing formulations consisting of flea saliva products substantially free of contaminating material. Another aspect of the present invention includes an isolated nucleic acid molecule, capable of hybridizing under strict conditions with a gene encoding a flea salivary protein present in the flea saliva extract FS-1, FS-2 and / or FS- 3, including, but not limited to fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3. In particular, the nucleic acid molecule that is capable of hybridizing under stringent conditions to the nucleic acid sequence SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50 and / or SEQ ID NO: 51. Also included in the present invention are recombinant molecules, and recombinant cells having a nucleic acid molecule of the present invention. Also included in the present invention is the method for producing at least one ectoparasite salivary protein, comprising: (a) culturing cells transformed with at least one nucleic acid capable of hybridizing under stringent conditions with a gene encoding a protein of flea saliva present in the flea saliva extract FS-1, FS-2, and / or FS-3 to produce the protein; and (b) recovery of ectoparasite saliva proteins.

Another aspect of the present invention includes an antibody capable of selectively binding to an ectoparasite saliva product, or mimetic thereof. Yet another aspect of the present invention includes a therapeutic composition for treating allergic dermatitis comprising any of the formulations described herein. In particular, the therapeutic composition is useful for treating flea allergy dermatitis, mosquito allergy dermatitis and / or Culicoides allergy dermatitis. In addition, particular flea saliva proteins for inclusion in a therapeutic composition include at least a portion of at least one of the following flea saliva proteins: fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3. The present invention also includes a method for desensitizing an animal to allergic dermatitis, comprising administering to the animal a therapeutic composition. The present invention is further related to a test kit for testing whether an animal is susceptible or has allergic dermatitis, the kit consists of: (a) a formulation as described herein; and (b) means for determining whether the animal is susceptible or has allergic dermatitis, wherein the means comprise the use of the formulation to identify animals susceptible to allergic dermatitis or having allergic dermatitis. According to the present invention, a method can be used to identify an animal susceptible or having allergic dermatitis, such method consists of: (a) administering the formulation of the present invention to a site of the animal and administering it in a different site of the animal a control solution selected from the group of positive control solutions and negative control solutions; and (b) comparing the reaction resulting from the administration of the formulation with a reaction resulting from the administration of the control solution. It is determined that the animal is susceptible or has allergic dermatitis if the reaction to the formulation is at least as large as the reaction to the positive control solution. It is determined that the animal is not susceptible or has allergic dermatitis if the reaction to the formulation is the same size as the reaction to the negative control solution. In particular, the method can detect immediate hypersensitivity and / or delayed hypersensitivity. Also, according to the present invention, a method can be used to identify an animal susceptible or having allergic dermatitis by measuring the presence of allergic dermatitis indicator antibodies in the animal, the method consists of: (a) contacting the formulation of the present invention with a fluid from the body of the animal under conditions sufficient for the formation of an immune complex between the formulation and the antibodies, if present, in the body fluid; and (b) determining the amount of immune complexes formed, in which the formation of the immune complex indicates that the animal is susceptible or has allergic dermatitis. In particular, the method can be used to detect IgE antibodies as an indicator of immediate hypersensitivity in the animal. The present invention also includes a method for l, or prescribing treatment for allergic dermatitis, comprising: (a) identifying an animal that is susceptible or has allergic dermatitis by means of an in vivo or in vitro assay comprising a formulation of the present invention; and (b) prescribe a treatment that includes the administration of a formulation of the present invention to the animal.

BRIEF DESCRIPTION OF THE DRAWINGS Figure IA illustrates the resolution of flea salivary proteins in Tris-glycine SDS-PAGE under 16 percent reducing conditions. Figure IB illustrates the resolution of flea salivary proteins FS-1 and FS-2 in Tris-glycine SDS-PAGE under 16 percent reducing conditions. Figure IC illustrates the resolution of fspN in Tris-25 glycine SDS-PAGE under 16 percent reducing conditions.

Figure 2 illustrates the resolution of flea salivary proteins using high pressure liquid chromatography (HPLC). Figure 3 illustrates the peaks obtained by reverse phase HPLC resolution (reverse phase HPLC) of proteolytic fragments of fspH protein digested with Endoproteinase Asp-N. Figure 4 illustrates a cross section of a flea saliva collection apparatus of the present invention. Figure 4b conspicuously illustrates the flea saliva collection apparatus of the present invention. Figure 5 illustrates the relative size of wheals produced 15 minutes after injection of various flea salivary protein formulations in flea-sensitized dogs. Figure 6 illustrates the relative induration of wheals 6 hours after the injection of various formulations of flea saliva proteins in dogs sensitized to fleas. Figure 7 illustrates the relative erythema of hives 6 hours after injection of various formulations of flea saliva proteins in dogs sensitized to fleas. Figure 8 illustrates the relative induration of wheals 24 hours after injection of various formulations of flea salivary proteins in dogs sensitized to fleas. Figure 9 illustrates the relative erythema of wheals 24 hours after injection of various flea salivary protein formulations in flea-sensitized dogs. Figure 10 illustrates ELISA results, which measure salivary flea IgE antibodies in the serum of dogs sensitized to fleas. Figures HA and 11B illustrate the results of ELISA measuring the IGE saliva antibodies against fleas in the serum of a flea-sensitized dog, and the lack thereof in dogs infected with heartworms.

DETAILED DESCRIPTION OF THE INVENTION The present invention includes a novel method and product for diagnosing and treating allergic dermatitis of animals to ectoparasites. The invention is particularly advantageous as it provides a unique formulation of ectoparasite saliva products sufficiently free of contaminants such as blood proteins., fecal material and larval culture media, to be useful in the diagnosis and treatment of allergies caused by ectoparasites. In addition, the present invention includes ectoparasite saliva products that have other important activities, for example, in the ability of a flea to feed and / or counteract the resistance of an animal to fleas, such as products having coagulant activity, anticoagulant, protease, phospholipase, prostaglandin, anticomplement, other immunosupressants, phosphatase, apyrase, vasoactive and / or anti-inflammatory activities. Included among the flea saliva products are products such as, but not limited to, proteases, which are regurgitated by the flea originating in other organs, such as, but not limited to, the midgut. The invention is particularly advantageous in that it provides an apparatus and method for efficiently reproducing and isolating ectoparasite saliva products substantially free of contaminating material. According to the present invention, ectoparasites are parasites living outside, which are stuck and fed through the skin of a carrier animal. Ectoparasites include parasites that live in the carrier animal and parasites that temporarily stick to the animal in order to obtain food. Also, according to the present invention, ectoparasite saliva refers to material released from the mouth of an ectoparasite when the ectoparasite attempts to feed in response to a differential temperature, such as exists in the apparatus of the present invention. Ectoparasite saliva includes ectoparasite saliva products. The ectoparasite saliva products of the present invention comprise the ectoparasite salivary portion attached to the harvesting medium of the present invention (described in detail below), which is referred to as ectoparasite saliva components. As such, the ectoparasite saliva products also include the ectoparasite salivary portion extracted from the collection means of the present invention, which is referred to as ectoparasite saliva extract. Included in the ectoparasite saliva extracts are the ectoparasite saliva proteins that can be isolated using, for example, any of the methods described herein. The ectoparasite saliva extracts of the present invention may also include other ectoparasite saliva products, such as prostaglandins and other active pharmacological molecules. Another aspect of the present invention is a formulation or preparation containing ectoparasite saliva products that can be used to diagnose and / or treat animals that are susceptible to or have (for example, suffering from allergic dermatitis) allergic dermatitis. Preferred types of allergic dermatitis to diagnose and / or treat using ectoparasite saliva products of the present invention include flea allergy dermatitis, Culicoides allergy dermatitis and mosquito allergy dermatitis. A preferred type of allergic dermatitis to diagnose and / or treat using ectoparasite saliva products of the present invention is flea allergy dermatitis. For the use described herein, an animal that is susceptible to allergic dermatitis refers to the animal that is genetically predisposed to develop allergic dermatitis and / or to the animal that has previously been treated with an antigen in such a manner that re-exposure to the antigen results in symptoms of allergy that can be perceived, for example, by observing the animal or by measuring the animal's production of antibodies to the antigen. As such, animals susceptible to allergic dermatitis may include animals with subclinical allergic dermatitis. Subclinical allergic dermatitis refers to a condition in which allergy symptoms can not be detected by simple observation of an animal (for example, the manifestation of the disease may include the presence of antiprotein antibodies of ectoparasite saliva inside an infected animal, but not dermatitis). For example, subclinical allergic dermatitis can be detected using in vivo or in vitro assays of the present invention, as described in detail below. Reference to animals having allergic dermatitis includes animals that do show allergy symptoms, which can be detected by simple observation of the animal and / or using in vivo or in vitro assays of the present invention, as described in detail below. .

One aspect of the present invention is a formulation that includes one or more isolated ectoparasite saliva proteins. According to the invention, an isolated protein is a protein that has been removed from its natural environment. An ectoparasite saliva protein can, for example, be obtained from its natural source, be produced using recombinant DNA technology, or be chemically synthesized. For the use described herein, an isolated ectoparasite protein can be complete ectoparasite salivary protein or any homologue of such a protein, such as an ectoparasite salivary protein in which some amino acids have been removed (e.g., a truncated version of protein, such as a peptide), inserted, inverted, substituted and / or derived (for example, by glycosylation, phosphorylation, acetylation, myristylation, prenylation, palmitation, amidation and / or addition of inositol). A homologue of an ectoparasite salivary protein is a protein that has an amino acid sequence sufficiently similar to the amino acid sequence of natural ectoparasite salivary protein that a nucleic acid sequence encoding the homologue is capable of hybridizing under stringent conditions (eg. say, with) a nucleic acid sequence encoding the amino acid sequence of natural ectoparasite salivary protein. Strict hybridization conditions, as used herein, refer to standard hybridization conditions under which nucleic acid molecules, including oligonucleotides, are used to identify similar nucleic acid molecules. Such standard conditions are set forth, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press, 1989. The minimum size of a protein homologous to that of the present invention is a sufficient size to be encoded by a nucleic acid molecule capable of forming a stable hybrid with the complementary sequence of a nucleic acid molecule encoding the corresponding natural protein. As such, the size of the nucleic acid molecule encoding such homologous protein is dependent on the nucleic acid composition and the percentage of homology between the nucleic acid molecule and the complementary sequence, as well as on the conditions of hybridization per se. (for example, temperature, concentration of al and concentration of formamide). The minimum size of such a nucleic acid molecule is typically at least 12 to 15 nucleotides in length if the nucleic acid molecules are rich in GC and at least 15 to 17 bases in length if they are rich in AT. As such, the minimum size of a nucleic acid molecule used to encode an ectoparasite salivary protein homolog of the present invention is approximately 12 to 18 nucleotides in length. There is no limit, other than a practical limit, on the maximum size of such a nucleic acid molecule, since the nucleic acid molecule can include a portion of a gene, an entire gene, or multiple genes, or parts thereof. Similarly, the minimum size of an ectoparasite salivary protein homologue of the present invention is from about 4 to 6 amino acids in length, with the preferred sizes, depending on whether the protein is desired to be full length, multivalent (e.g. , fusion proteins that have more than one domain, each of which has a function), or functional portions of such proteins. Homologues of ectoparasite saliva protein may be the result of allelic variation of a natural gene encoding an ectoparasite salivary protein. A natural gene refers to the form of the gene that is found most frequently in nature. Homologues of the ectoparasite saliva protein can be produced using techniques known in the art including, but not limited to, direct modifications to the gene encoding a protein using, for example, classical or recombinant DNA techniques to perform random or targeted mutagenesis (random or targeted mutagenesis). The preferred ectoparasite saliva proteins of the present invention, including homologs thereof, are capable of detecting and / or treating allergic dermatitis resulting from ectoparasite bites. A preferred ectoparasite salivary protein homologue includes at least one epitope capable of hyposensitizing an animal to the natural form of the protein. The ability of an ectoparasite salivary protein homologue to detect and / or treat (e.g., immunoregulate or regulate, e.g., desensitization) the hypersensitivities of an animal susceptible or having allergic dermatitis can be tested using techniques known to the art. those experienced in the -} art. Such techniques include skin tests and immunoabsorbent assays as described in detail below. Other ectoparasite saliva proteins of the present invention have other activities that include important activities for feeding and survival of the ectoparasite. In one aspect, a formulation of the current invention may comprise a protein having at least a portion of an isolated ectoparasite salivary protein. According to the present invention, "at least a portion of a "Ectoparasite salivary protein" refers to a portion of an ectoparasite salivary protein encoded by a nucleic acid molecule that is capable of hybridizing, under stringent conditions, to a nucleic acid encoding the full length of a human salivary protein. ectoparasite of the present invention. Preferred portions of ectoparasite saliva proteins are useful for detecting and / or treating allergic dermatitis resulting from ectoparasite bites. The additional preferred portions have important activities for feeding and survival of the flea. Suitable sizes for portions of an ectoparasite salivary protein of the present invention are such as those described for salivary protein homologs of the current invention. As will be apparent to a person skilled in the area of technology, the present invention is intended to apply to all ectoparasites. A formulation or preparation of the present invention may include saliva products of any ectoparasite. A preferred ectoparasite in this invention for isolating saliva products (including proteins), and / or for identifying proteins that can be produced synthetically or by recombinant technology, include arachnids, insects and leeches. Other preferred ectoparasites for obtaining the saliva products include fleas; ticks, including both types of ticks, hard ticks of the family Ixodidae (for example, Ixodes and Amblyomma) and soft ticks of the familiar Argasidae (for example, Ornithodoros, such as O. parkeri and O. turicata); the fly, such as, for example, Culicoides, mosquitoes, horseflies (for example, Tabanus atratus, Gasterophilus intestinalis), tsetse fly, fly Stomoxys calcitrans, fly that causes myiasis - botfly - and mosquitoes; the ants; spiders, lice; the mites; and certain insects, such as bugs and vinchuca, including carriers of Chagas disease. Even more preferred are the 5 ectoparasite saliva products that include those of fleas, mosquitoes, fly, such as, for example, Culicoides, horseflies, ticks and Rhodnius, and even more preferred are those of fleas, mosquitoes and Cullicoides. A particularly preferred preparation of the J P present invention includes flea saliva proteins. Preferred flea saliva products include those of the fleas Ctenocephalides, Xenopsylla, Pulex, Tunga, Nosopsyllus, Diamamus, Ctopsyllus and Echidnophaga, with flea saliva products being even more preferred.

Ctenocephalides canis and Ctenocephalides felis. For the purpose of illustration, many of the following aspects of the invention talk about flea saliva proteins. Such a discussion of flea saliva proteins is not intended, in any way, to limit the scope of the present invention. In one aspect, the preparation of the present invention is substantially free from the contaminating material. The contaminating material may include, for example, ectoparasite faecal matter, blood proteins 5 from ectoparasite pre-meals (e.g., fetuin, ferritin, albumin, hemoglobin, and other large blood proteins), cuticular debris from an ectoparasite, and ectoparasite larval culture media (e.g., blood, sand and mouse food). As used here, a substantially free preparation of contaminants is a preparation that without further purification can be used as a diagnostic or therapeutic agent without causing unwanted side effects. Preferably, a preparation substantially free of contaminants comprises less than 50 percent contaminating material, more preferably less than 10 percent contaminating material, and even more preferably less than 5 percent contaminating material. As such, a preparation of the present invention preferably comprises at least 50 percent flea saliva products, more preferably at least 90 percent flea saliva products, and even more preferably, at least 95 percent of flea saliva products. A preparation of the present invention substantially free of contaminating material can include a preparation that has no blood contaminants, or contents of the midgut of the flea. A preparation substantially free of contaminating material can be obtained using the saliva collection apparatus of the present invention, as described in detail below. A preparation substantially free of contaminating material can be identified by typical methods known to those skilled in that area of technology. For example, the presence of contaminants can be identified by: (1) overload and resolution of preparation by electrophoresis in a polyacrylamide sodium dodecyl sulfate gel (SDS-PAGE); (2) solving a preparation by a variety of chromatography techniques; (3) monitoring the preparation with antibodies capable of sticking to the specific contaminant, for example, immunoblotting techniques or linked enzyme immunoassays (ELISA); (4) resolution of the preparation by capillary electrophoresis; or (5) monitoring the preparation using an assay to detect hemoglobin. One embodiment of incorporating the formulation or preparation of the present invention includes at least one or more flea saliva proteins having molecular weights ranging from about 6 kD to about 65 kD, as determined by SDS-PAGE Tris- glycine, preferably using a 14 percent polyacrylamide gel, and resolving using standard technology methods. A preferred preparation includes one or more flea saliva proteins having molecular weights ranging from about 6 kD to about 55 kD. A more preferred preparation includes one or more proteins having an elution profile (or migration), such as those shown in Figure 1.

In another embodiment, a formulation or preparation of the present invention includes at least one or more flea saliva proteins having molecular weights ranging from about 40 kD to about 300 kD, as determined by the SDS-PAGE Tris-glycine , and it is solved using standard methods of technology. More than 50 percent of the flea saliva proteins contained in such a formulation or preparation have molecular weights ranging from about 40 kD to about 55 kD, and appear to be similar to fspN. A more preferred formulation or preparation includes one or more proteins having an elution profile (or migration), such as those shown in Figure 1. In yet another embodiment, a formulation or preparation of the present invention includes one or more salivary proteins. of flea that have values of basic isoelectric points, or pl. An isoelectric pH value, or pl, refers to the pH value, at which a molecule has no net electrical charge, and fails to move in an electric field. A preferred formulation or preparation of the present invention includes proteins having a pl value of at least about 8.5 pl, and more preferably of at least about 9.0 pl. The fspH flea salivary protein, for example, has pl values ranging from 8.5 pl to about 9.6 pl, which may represent protein heterogeneity, due to allelic variation in the flea population, from which Flea saliva proteins were collected. In still another embodiment, a formulation or preparation of the present invention includes at least a portion of one or more flea saliva products eluted from collection means of the present invention. Examples of such formulation or preparation include flea extracts FS-1, FS-2 and FS-3. The flea saliva extracts FS-1, FS-2 and FS-3 are produced according to the method described in detail in Example 2. According to the present invention, the terms flea saliva extract FS-1, saliva extract of flea FS-2, or FS-3 flea saliva extract can be used interchangeably with the terms flea saliva product FS-1, FS-2 flea saliva mixture, or saliva product mixture FS-3 flea, respectively. An FS-1 flea saliva extract includes a mixture of proteins (a) that, when subjected to reducing conditions 16 percent SDS-PAGE Tris-glycine, migrates as the bands, as shown in Figure IB, track 13; and (b) that, when subjected to high pressure liquid chromatography (HPLC) reserve phase, it migrates such as the peaks shown in Figure 2. The peaks of Figure 2 are obtained when the proteins included in FS- 1 are harvested using the saliva collection apparatus of the present invention, as described in detail below, and also resolved on protein peaks, by passing the collected proteins through a CLC HPLC column, which uses 5 percent at 63 percent acetonitrile, or 5.6 percent to 70 percent solvent B at a fluid velocity of 0.8 milliliters per minute, in which, Solvent A is approximately 0.1 percent TFA in water, and the Solvent B is approximately 0.085 percent TFA in 90 percent acetonitrile. Referring to Figure 2, the peaks are referred to and described as peak A, lt 'peak B, peak C, peak D, peak E, peak F, peak G, peak H, peak I, J peak, K peak, L peak, M peak and N peak. The flea salivary proteins (or protein fragments) contained within such peaks are referred to as fspA, fspB, fspC, fspD, fspE, fspF, fspG, fspH, fspl, fspj, fspK, fspL, fspM and fspN. The peaks refer to the regions marked in Figure 2, and it should be considered that a peak does not necessarily contain only one protein (or protein fragments). The additional resolution of proteins contained within the peaks referred to above, for example, amino acid sequencing or gel electrophoresis SDS-PAGE, has indicated that fspC includes at least two proteins referred to as fspCl and fspC2, fspD, includes at least two proteins referred to as fspDl and fspD2; fspG includes at least three proteins referred to as fspGl, fspG2 and fspG3; fspj includes at least two proteins referred to as fspJl and fspJ2; fspL includes at least two proteins referred to as fspLl and fspL2; fspM includes at least two proteins referred to as fspMl and fspM2; and fspN includes at least three proteins and / or protein fragments referred to as fspNl, fspN2 and fspN3. The amino acid sequences, at least partially, have been obtained for a number of flea salivary proteins as represented by SEQ ID NO: 1 (a partial N- (amino-) terminal amino acid sequence of fspA), SEQ ID NO: 2 (a sequence of amino acids, beginning at the N-terminus, representing the majority of the fspH protein), SEQ ID NO: 3 (a partial N-terminal amino acid sequence of an Endoproteinase Asp-N fragment defspH denoted fspHe), SEQ ID N0: 4: a partial N-terminal amino acid sequence of an Endoproteinase Asp-N, fragment of fspH, designated fspHh), SEQ ID NO: 5 (a partial N-terminal amino acid sequence of an Endoproteinase Asp-N, fspH fragment, denoted fspHj, which also represents a partial N-terminal amino acid sequence of fspH), SEQ ID NO: 6 (a partial N-terminal amino acid sequence of fspl), SEQ ID NO: 7 (a partial N-terminal amino acid sequence of fspJl), SEQ ID NO: 8 (a sequence of and partial N-terminal amino acids of fspJ2), SEQ ID NO: 9 (a partial N-terminal amino acid sequence of fspL1), SEQ ID NO: 10 (a partial N-terminal amino acid sequence of fspL2), SEQ ID NO: 11 (a partial N-terminal amino acid sequence of fspN1), SEQ ID NO: 12 (a partial N-terminal amino acid sequence of fspN2), SEQ ID NO: 13 (a partial N-terminal amino acid sequence of fspN3), SEQ ID NO: 14 (a partial N-terminal amino acid sequence of fspH), SEQ ID NO: 25 (a translation of the nucleic acid sequence represented by SEQ ID NO: 24, corresponding to fspl), SEQ ID NO: 26 (an apparent complete translation product of fspl), SEQ ID NO: 27 (a partial N-terminal amino acid sequence of fspB), SEQ ID NO: 28 (a partial N-terminal amino acid sequence of fspGl), SEQ ID NO : 29 (a partial N-terminal amino acid sequence of fspG2), SEQ ID NO: 30 (a partial N-terminal amino acid sequence of fspG3), SEQ I D NO: 31 (a partial N-terminal amino acid sequence of an Endoproteinase Asp-N, fragment of fspN, denoted fspN (100-101)), SEQ ID NO: 33 (a translation product, called PfspH80, of the sequence partial of nucleic acids corresponding to fspH, called nfspH242, denoting SEQ ID NO: 32), SEQ ID NO: 35 (a translation product, called Pfspl155, of the partial nucleic acid sequence corresponding to fspl, called nfspI5g; L / denoting SEQ ID NO: 34), SEQ ID NO: 51 (a translation product, called PfspN (A) 172, of the partial nucleic acid sequence of an fspN protein, called fspN (A) 616, described SEQ ID NO: 50), SEQ ID NO: 53 (a translation product called PfspN (B) 153, of the partial nucleic acid sequence of an fspN protein, called nfspN (B) 612, described by SEQ ID NO: 52), and SEQ ID NO: 54 (an apparent partial N-terminal amino acid sequence, called PfspN (A) 50, of an fspN protein called PfspN (A)). The details of how each protein was characterized is described in Examples 2 and 3. An FS-2 flea saliva extract includes a mixture of proteins that, when subjected to reducing conditions of 16% SDS-PAGE Tris-glycine, migrates as the bands shown in Figure IB, in lanes 14 and 15. It is within the scope of the present invention that flea saliva products of additional interest remain on the collection means, after the elution protocols to obtain flea saliva extracts FS-1, FS-2 and FS-3. It is also within the scope of the invention that a formulation or preparation of the present invention can include the flea saliva products removed from a collection medium by means of elution using other techniques, for example, by using higher concentrations of eluents. In another embodiment, a formulation or preparation of the present invention includes at least a portion of an ectoparasite saliva protein homologue preferably having at least about 50 percent, more preferably at least about 75 percent, and even more preferably at least about 85 percent amino acid homology (identity within comparable regions), with at least a portion of at least one product contained in the saliva extracts FS-1, FS-2 or FS -3. Preferred homologs include at least a portion of an ectoparasite saliva product having at least about 50 percent, more preferably at least about 75 percent, and even more preferably at least about 85 percent of homology, with at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. Also included are proteins that have at least a portion of one of the following amino sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO : 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54. In a preferred aspect, a formulation or preparation of the present invention includes at least a portion of a ectoparasite saliva product homolog of the present invention which is encoded by a nucleic acid molecule having at least about 50 percent, more preferably at least about 75 percent, and even more preferably, at least about 85 percent homology with a nucleic acid molecule, coding so less a portion of a product contained in saliva extract FS-1, FS-2 or FS-3. A preferred ectoparasite saliva product homologue is encoded by a nucleic acid molecule having at least about 50 percent, more preferably at least about 75 percent, and even more preferably at least about 85 percent. percent homology with a nucleic acid molecule encoding at least a portion of an ol »3+ of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. In still another embodiment, a formulation or preparation of the present invention includes a protein that, When digested with Endoproteinase Asp-N, it generates proteolytic fragments that, when subjected to reverse phase HPLC, migrate with peaks, as illustrated in Figure 3. The reverse phase HPLC was performed using the methods described by Stone and collaborators, Enzymatic Digestion of Protein and HPLC Peptide Isolation, in A Practical Guide to Protein and Peptide Purification for Microsequencing, PT Matsudaira ed. , Academic Press, San Diego, CA (for example, Narrowbore procedure: vydac C18 reverse phase, 300 A, 5 μm support, flow rate 0.2 ml / min, Solvent A, being 0.6 percent of TFA in water, and Solvent B, being 0.052 percent of TFA in 80 percent of acetonitrile in water; the sample was injected in 2 percent B; the gradient, after a hold at 2 percent B, was 2-37.5 percent B for 60 minutes; 37.5 percent - 75 percent B for 30 minutes, 75 percent - 98 percent B for 15 minutes; and detection at 214 nanometers). An example of such a protein is fspH, which also has the characteristics of a molecular weight close to 8613 + 6 daltons, when determined by ESMS. A particularly preferred formulation of the present invention includes an fspH protein, having the amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 14 or SEQ ID NO: 33. In a preferred embodiment, a preparation of the present invention can include at least one isolated protein that has (ie, includes) at least a portion of the amino acid sequence (using the amino acid code standard of a letter): YGKQYSEKGGRGQRHQILKKG KQYSSKILDL S R (SEQ ID N0: 1 represents a partial N-ter inal sequence of fspA). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: DRRVSKTCQSGGKIQSEXQVV IKSGQH / YILENYXSDGRNNNNPCHLFC MRECRSGNGGCGNGGRTRPDS KHCYCEAPYS (SEQ ID NO: 2, representing the N-terminal sequence almost full of fspH). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: DRRVSKTXQSGGKIQSEXQVV IKSGQH / YILENYXSDGR (SEQ ID NO: 14, representing a partial N-terminal sequence of fspH ). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence. D S K H C Y C E A P Y S (SEQ ID NO: 3 represents a partial sequence of the N-terminal of fspHe). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: D G R N N N N P C H L F C M R E C R S G N G G C G N G G R T R P D S K H C (SEQ ID NO: 4 represents a partial N-terminal sequence of fspHh). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: D RRV S K T C Q S G (SEQ ID NO: 5 represents a partial N-terminal sequence of fspHj). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: EDIW KV NKKXTSGGKNQDRKLDQIIQK CQQVXXQNXXK (SEQ ID NO: 6, representing a partial sequence of the N-terminal of the fspl ). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: N S H E P G N T R K I R E V M D K L R K Q H P (SEQ ID NO: 7 represents a partial sequence of the N-terminal of fspJl). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: E I K R N S H E P G N T R K I R E V M D K L R K Q H P (SEQ ID NO: 8 represents a partial sequence of the N-terminal fspJ2). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: NDKEPGNT RK IRE VM DKLRKQAQPRTDGQRPKTXIM (SEQ ID NO: 9, representing a partial sequence of the N-terminal fspLl ). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: X L X R N D K E P G N T R K I R E V M D K (SEQ ID NO: 10 represents a partial sequence of the N-terminal fspL2). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: N D E L K F V F V M A K SEQ ID NO: 11 represents a partial sequence of the N-terminal fspNl). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: X D E L K F V F V MA K G P S X Q A X D Y P C (SEQ ID NO: 12 represents a partial N-terminal sequence of fspN2). Note that although the fspNl and fspN2 appear to have identical or partial similarity to the N-terminal sequences, the two proteins migrate differently when they are subjected to SDS-PAGE Tris-glycerin, suggesting that they are different proteins, possibly due to truncation of the carboxyl terminus of one of the proteins and / or post-translational modification, such as glycosylation. A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: ELKFVFATARGMSHTPCDYP (SEQ ID NO: 13 represents a partial sequence of the N-terminal fspN3) . A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: S G K Q Y S E X G K Q S 20 (SEQ ID NO: 27 represents a partial sequence of the N-terminal fspB). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: D R R V S K (SEQ ID NO: 28 represents a partial sequence of the N-terminal fspGl). A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: S K M V T E K X K S G G N N P S T K E V S I P (SEQ ID NO: 29 represents a partial sequence of the N-terminal fspG2). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: E V S I P S G K L T I E D F X I G N H Q (SEQ ID NO: 30 represents a partial sequence of the N-terminal fspG3). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: F S L C V L Y Q I V V A R V S K T C Q S G G K I Q S E / X Q VV I K S G Q H / Y I L E N Y X S D G N N N N P C H L F C M R E C R S G N G G C G N G G R T R P D S (SEQ ID NO: 33 represents a translation product of the nucleic acid sequence represented by SEQ ID NO: 32, corresponding to fspH). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: L T S G G K N Q D R K L D Q I I Q K G Q Q V K I Q N I C K L I R D K P H T N Q E K E K C M K F C T K N V C K G Y R G A C D G N I C Y C S R P S N L G P D W K V N E R L P I T K I L V S G N S S S T T I T N S K Y F E T K N S E N T S K S K K H S K E K C R G G N D G C D G N V L L S T K K (SEQ ID NO: 25 represents a translation of the nucleic acid sequence represented by SEQ ID NO: 24, corresponding to fspl). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: E D I W K V N K K L T S G G K N Q D R K L D Q I I Q K C Q Q V K I Q N I C K L I R D K P H T N Q E K E K C M K F C T K N V C K G Y R G C C G L V H L S S T S T S T S T S T S T S T S T T T T T T T T T T T T T T T T T T T T T T T K K (SEQ ID NO: 26 represents an apparent complete translation product of the fspl). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: W K V N K K L T S G G K N Q D R K L D Q I I K K G Q Q V K I Q N I C K L I R D K P H T N Q E K E K C M K F C T K N V C K G Y R G A C D G N I C Y C S R P S N L G P D W K V N E R I E R L P I T K I L V S G N S S I S T T I T N S K Y F E T K N S S T N S K S K K H S K E K C R G G N D G C D G N V L L S T K K (SEQ ID NO: 35 represents a translation of the nucleic acid sequence represented by SEQ ID NO: 34, corresponding to fspl). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: DIENIKKGEGQPGAPGGKENN LSVL (SEQ ID NO: 31 represents a partial amino acid sequence of N-terminal amino acids of a Endoproteinase fragment Asp-N of fspN, called fspN (lOO-lOl)). A preparation of the present invention may also include at least one isolated protein having at least a portion of the amino acid sequence: ARARSVGSMKNKLKSFSEKYV WAALTSNDNLRKMSGGRMIND ILNDIDNIKKGNGQPNAPGKT ENKLSVSDRSSRYLSSIRFSL FRPRYKIENQDLEPSSLYPGQ GALHVIELHKDKNQWNVKTLY RNNDQQELKP MK THE KCGDTCSYETFKSTLQSYNMD KTAHDKLCKSS (SEQ ID NO: 51 represents a product of translation of the nucleic acid sequence represented by SEQ ID NO: 50, corresponding to the fspN protein). Comparison of the amino acid sequence of SEQ ID NO: 51 with amino acid sequences reported in GenBank indicates that SEQ ID NO: 51 is approximately 28 percent identical with human prostatic acid phosphatase. A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: G T RK N E L K S F S E E Y L W RA L T S N E N L R K M S G G RM I N D I L N D I D S I K E E R D N R V L L E K Q E I K L S M L T V P Q A I LA A F V S A F A P K G T K I E N Q D L G P S S L Y P G Q G A L H V I E L H K D N N Q W S V K V L Y R N N D K M E L E P M K L P S C D D C C C L L N N L L Y N P M I (SEQ ID NO: 53 represents a product of Translation of the nucleic acid sequence represented by SEQ ID NO: 52, corresponding to the fspN protein). Comparison of the amino acid sequence of SEQ ID NO: 53 with amino acid sequences reported in GenBank indicates that SEQ ID NO: 53 is approximately 30 percent identical with human prostatic acid phosphatase.

A preparation of the present invention can also include at least one isolated protein having at least a portion of the amino acid sequence: M W R L L L V I S S A L I I Q N V N A E L K F V F A T A T R Y V S H T P S P C D P G G P K I T N K P G D F Q R V (SEQ ID NO: 54 represents a partial N-terminal sequence of the fspN protein). It should be noted that the ectoparasite salivary proteins of the present invention include, but are not limited to, complete, hybrid, fusion, multivalent proteins, and proteins that are truncated homologs of, or proteolytic products of, at least a portion of the protein contained in the saliva extracts FS-1, FS-2 or FS-3; and preferably at least a portion of the saliva proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3. As such, proteins that have at least a portion of one of the following amino acid sequences are also included: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID N0: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54. For the use used herein, the term hybrid protein refers to a product protein of two different proteins. The above sequences (SEQ ID NOS :) represent inferred amino acid sequences according to methods described in the Examples. It should be noted that since the amino acid sequencing technology is not entirely error-free, the above sequences (SEQ ID NOS :), probably represent an apparent amino acid sequence of the ectoparasite saliva proteins of the present invention. In addition, the variation seen in the previous sequences (SEQ ID NOS :) may also be due, at least in part, to allelic variation since the protein sequences were derived from flea populations. According to the present invention, a preparation of the invention can include flea saliva proteins that have undergone a post-translational modification. Such modification may include, for example, glycosylation. Glycosylation can include addition of N- and / or O-linked oligosaccharides (N-linked and / or O-linked). It should be noted that the post-translational modification of a protein of the present invention may contribute to the ability of an epitope to induce an allergic response against the protein in an immediate or delayed hypersensitive response.

Another form of the present invention is an isolated nucleic acid molecule, capable of hybridizing, under stringent conditions, with an ectoparasite salivary protein gene, encoding a salivary protein of the present invention of ectoparasite. According to the present invention, an isolated nucleic acid molecule is a nucleic acid molecule that has been removed from its natural environment (eg, which has been subject to human manipulation). As such, "isolated" does not reflect the extent to which the nucleic acid molecule has been purified. An isolated nucleic acid molecule can include DNA, RNA or derivatives of, or DNA or RNA. A nucleic acid molecule of the present invention can be obtained from its natural source as a whole (e.g., complete) gene, or a portion capable of forming a stable hybrid with that gene. As used herein, the phrase "at least a portion of", an entity refers to an amount of the entity, which is at least sufficient to have the functional aspects of that entity. For example, at least a portion of a nucleic acid sequence, as used herein, is an amount of a nucleic acid sequence capable of forming a stable hybrid with the corresponding gene under stringent hybridization conditions. A nucleic acid molecule in the present invention can also be produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloned) or chemical synthesis. 5 ectoparasite salivary protein nucleic acid molecules isolating include natural nucleic acid molecules and homologues, including, but not limited to, natural allelic variants and modified nucleic acid molecules, in which nucleotides have been inserted, have been deleted, replaced and / or inverted, such that the p-* such modifications do not substantially interfere with the ability of the nucleic acid molecules to encode an ectoparasite salivary protein of the present invention, or to form stable hybrids under strict conditions with isolated from the natural acid molecule nucleic. An isolated nucleic acid molecule of the present invention can include a nucleic acid sequence encoding at least one ectoparasite salivary protein of the present invention, examples of such proteins are described in the present invention. Although the phrase "nucleic acid molecule" refers primarily to the physical nucleic acid molecule, and the phrase "nucleic acid sequence" refers primarily to the nucleotide sequence of the nucleic acid molecule, the two phrases can be used, interchangeably or indistinctly, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, capable of encoding an ectoparasite salivary protein. As heretofore described, the ectoparasite salivary proteins of the present invention include, but are not limited to, the full (lenght) proteins of ectoparasite saliva encoding regions, part thereof, and other homologs of ectoparasite saliva protein. It should be noted that an ectoparasite salivary protein of the present invention can be encoded by a complete nucleic acid sequence encoding a polyprotein. Polyproteins can be processed post-translationally into multiple proteins found in saliva. As used herein, an ectoparasite salivary protein gene includes all nucleic acid sequences relative to a natural ectoparasite salivary protein gene, such as regulatory regions that control the production of an ectoparasite salivary protein encoded by that gene (such as, but not limited to, transcription, translation or post-translation of control regions), as well as the coding region itself. A nucleic acid molecule of the present invention may be a nucleic acid molecule, isolated natural ectoparasite salivary protein, or a homologue of such a molecule. A nucleic acid molecule of the present invention can include one or more regulatory regions, complete or partial coding regions, or combinations. The minimum size of an ectoparasite salivary protein nucleic acid molecule of the present invention is the minimum size capable of forming a stable hybrid with the corresponding natural gene under stringent hybridization conditions. A homologue of ectoparasite salivary protein nucleic acid molecule can be produced using a number of methods known to those with experience in the technology (see, for example, Sambrook et al., Ibid.). For example, nucleic acid molecules can be modified using a variety of techniques, including, but not limited to, techniques, classical, mutagenesis and recombinant DNA techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule a induce mutations, cleavage restriction enzymes of a nucleic acid fragment, binding of nucleic acid fragments, amplification of polymerase chain reaction (PCR), and / or mutagenesis of selected regions of a nucleic acid sequence, synthesis of mixtures of oligonucleotides and binding of the mixture groups to "build" a mixture of nucleic acid molecule or combinations thereof. Homologs of nucleic acid molecules can be selected from a modified nucleic acid mixture by monitoring to detect the function of the protein encoded by the nucleic acid (eg, the ability of a homologue to elicit an allergic response in animals having dermatitis allergic or the ability of a homologue to act as an anticoagulant) and / or by hybridization under strict conditions with isolated nucleic acids of ectoparasite salivary protein. One aspect of the present invention is an ectoparasite salivary protein nucleic acid molecule capable of encoding at least a portion of a flea saliva product, or a homologue thereof (e.g., the saliva products of other ectoparasites). ), contained in the saliva extract FS-1, FS-2 or FS-3, where FS-1, when subjected to HPLC, resolves to peak A, peak B, peak C, peak D, peak E, peak F, peak G, peak H, peak I, peak J, peak K, peak L, peak M and / or peak N. Preferred nucleic acid molecule is one capable of encoding at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspL1, fspL2, fspMl, fspM2, fspN1, fspN2 and / or fspN3, or homologs thereof. As such, preferred nucleic acid molecules include, but are not limited to, nucleic acid molecules that encode proteins that have at least a portion of one or more of the following amino acid sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, 5 SEQ ID NO: 27, SEQ ID NO: 28 , SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54 , or their counterparts. A preferred nucleic acid molecule of the present invention is capable of hybridizing under conditions % "stringent to the nucleic acid encoding at least a portion of a flea saliva product, or homologues thereof (e.g., the saliva products of other ectoparasites), contained in the saliva extract FS-1, FS -2 or FS-3. Also preferred is a nucleic acid molecule of ectoparasite saliva protein that includes a nucleic acid sequence having at least about 65 percent, preferably at least about 75 percent, more preferably at least about 85 percent, and even more preferably at least approximately 95 percent, of homology to the corresponding regions of the nucleic acid sequence, encoding at least a portion of a flea saliva product, or a homologue thereof (e.g., the saliva products of other ectoparasites) ), contained in the extract of 5 saliva FS-A, FS-2 or FS-3. A particularly preferred nucleic acid sequence is the nucleic acid sequence having at least 65 percent bristle, preferably at least about 75 percent, more preferably at least about 85 percent, and yet 5 more preferably at least about 95 percent homology, with a nucleic acid sequence encoding at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, ? * 'fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3. As such, nucleic acid molecules having at least about 65 percent, more preferably at least about 75 percent, more preferably at least about 85 percent, and even more preferred are also preferred. more preferably at least about 95 percent homology to a nucleic acid sequence encoding at least a portion of one or more of the following amino acid sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: ll, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54. 25 Such nucleic acid molecules can be of full length gene and / or a nucleic acid molecule encoding a complete protein, a hybrid protein, a fusion protein , a multivalent protein or a truncated fragment. More preferred are the nucleic acid molecules of the present invention which comprise isolated nucleic acid molecules having a nucleic acid sequence, such as that represented by SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50 or SEQ ID NO: 52. SEQ ID NO: 20 is a nucleic acid sequence that includes approximately 60 nucleotides of the apparent gene encoding flea saliva protein fspH, includes of 25 percent of the coding region of fspH. The sequence of SEQ ID NO: 24 is a sequence of nucleic acids that include approximately 573 nucleotides of the apparent gene encoding flea salivary protein fspl, encoding a protein of about 149 amino acids, represented by SEQ ID NO: 25 The entire product of fspl translation is apparently about 158 amino acids and is denoted in SEQ ID NO: 26. The sequence of SEQ ID NO: 32 is a nucleic acid sequence of 242 bp of the apparent gene encoding the protein of flea saliva fspH, which encodes a protein of approximately 80 amino acids, which is denoted in SEQ ID NO: 33. The sequence of SEQ ID NO: 34 is a nucleic acid sequence of 591 bp of the apparent gene encoding the flea salivary protein fspl, which encodes a protein of approximately 155 amino acids, which is denoted in SEQ ID NO: 35. The sequence of SEQ ID NO: 50 is a 646 bp nucleic acid sequence of the apparent gene encoding a fspN flea salivary protein, which encodes a protein of about 172 amino acids, which is denoted in SEQ ID NO: 51. The sequence of SEQ ID NO: 52 is a nucleic acid sequence of 612 bp of the apparent gene encoding a fspN flea salivary protein, which encodes a protein of about 153 amino acids, which is denoted in SEQ ID NO: 53. Knowing a nucleic acid molecule of the ectoparasite saliva protein of the present invention allows a person experienced in the area of technology to make copies of such a molecule. nucleic acid, as well as obtaining a nucleic acid molecule, including additional portions of genes coding for ectoparasite salivary protein (e.g., nucleic acid molecules that include the start and translation site) and / or transcription and / or translation control regions), and / or homologs of ectoparasite salivary protein nucleic acid molecules. By knowing a portion of an amino acid sequence of an ectoparasite salivary protein of the present invention, it allows a person experienced in the area of technology to clone a sequence of amino acids that encode such an ectoparasite saliva protein. In addition, a desired ectoparasite salivary protein nucleic acid molecule can be obtained in a variety of ways including monitoring of appropriate expression libraries with antibodies that bind to or bind to ectoparasite salivary proteins of the present invention.; traditional cloning techniques using oligonucleotide assays of the present invention to monitor appropriate libraries or DNA; and PCR amplification of the appropriate libraries, or RNA or DNA, using oligonucleotide "primers" of the present invention (genomic and / or cDNA libraries can be used). To isolate nucleic acid molecules, the flea salivary protein, preferred cDNA libraries include libraries of cDNA made from whole flea not fed, whole flea fed, fed midgut flea, midgut flea not fed, and salivary gland of flea Cloning and gene amplification techniques are described, for example, in Sambrook et al., Ibid. The Examples section includes examples of the isolation of cDNA sequences, encoding flea saliva proteins of the present invention. The present invention also includes nucleic acid molecules that are oligonucleotides capable of hybridizing, under stringent conditions, with complementary regions of other, preferably longer, nucleic acid molecules of the present invention that encode at least a portion of a saliva product. of flea, or homolog thereof (for example, the saliva products of other ectoparasites), contained in the saliva extract FS-1, FS-2 or FS-3. A preferred oligonucleotide is capable of hybridizing, under stringent conditions, to a nucleic acid molecule that is capable of encoding at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF , fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3, or homologs thereof. Certain preferred oligonucleotides are capable of hybridizing a nucleic acid molecule capable of encoding a protein having at least a portion of one of the following amino acid sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 , SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO : 30, SEQ ID N0: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54, or homologs thereof. Certain preferred oligonucleotides are capable of hybridizing a nucleic acid molecule, including nucleic acid sequences represented by SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50, SEQ ID NO: 52, or complements thereof. The oligonucleotides of the present invention can be RNA, DNA, or derivatives of any of them. The minimum size of such oligonucleotide is the size required to form a stable hybrid between a given oligonucleotide, and the complementary sequence of another nucleic acid molecule of the present invention. The minimum size characteristics are described in this invention. The size of the oligonucleotide must also be sufficient for the use of the oligonucleotide according to the present invention. The oligonucleotides of the present invention can be used in a variety of applications, including, but not limited to, as a test or probe to identify additional nucleic acid molecules, as primers, to amplify or extend nucleic acid molecules or in therapeutic applications to inhibit , for example, the expression of saliva proteins by ectoparasites. such therapeutic applications include the use of such oligonucleotides in, for example, antisense-based drug technologies, triplex formation, ribozyme and / or RNA. The present invention, therefore, includes such oligonucleotides and methods for interfering with the production of ectoparasite saliva proteins by the use of one or more such technologies. The present invention also includes a recombinant vector, which includes an ectoparasite salivary protein nucleic acid molecule of the present invention inserted into any vector capable of introducing the nucleic acid molecule into the host cell. The vector contains heterologous nucleic acid sequences, ie, nucleic acid sequences that are not naturally found adjacent to ectoparasite salivary protein nucleic acid molecules of the present invention. The vector can be either A-RN or DNA, or prokaryotic or eukaryotic, and is typically a virus or a plasmid. Recombinant vectors can be used in the cloning, sequencing, and / or other modes of manipulation of the ectoparasite salivary protein nucleic acid molecule of the present invention. One type of recombinant vector, which we refer to herein as a recombinant molecule, and which is described in more detail below, can be used in the expression of nucleic acid molecules of the present invention. Preferred recombinant vectors are capable of duplicating in the transformed cell. A preferred nucleic acid molecule for inclusion in a recombinant vector of the present invention is a nucleic acid molecule that bears the code of at least a portion of at least one flea saliva product, or homologue thereof (e.g. , the saliva products of other ectoparasites), contained in the saliva extract of FS-1, FS-2 or FS-3. A particularly preferred nucleic acid molecule for inclusion in a recombinant vector is capable of encoding at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2 , fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and / or fspN3, or homologs thereof. As such, nucleic acid molecules encoding a protein having at least a portion of one or more of the following amino acid sequences are also included: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 , SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID N0: 12, SEQ ID N0: 13, SEQ ID N0: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and / or SEQ ID NO: 54, or homologues thereof, and the molecules of nucleic acid, including at least a portion of a nucleic acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50 and / or SEQ ID NO: 52. In one embodiment, an ectoparasite-isolated salivary protein of the present invention is produced by a culture of cells capable of expressing the protein under conditions to effectively produce the protein in question and recover it from the culture. The preferred cell to culture is a recombinant cell, produced by the transformation of a host cell with one or more nucleic acid molecules of the present invention, capable of expressing the ectoparasite salivary protein. The transformation of a cell can be obtained by any method, by means of which, a nucleic acid molecule can be inserted into the cell. Transformation techniques include (but are not limited to): transfection, electroporation, microinjection, lipofection, adsorption or fusion of protoplasts. A transformed (recombinant) cell can be kept isolated, or grow by producing a multicellular tissue, organ or organism. The transformed nucleic acid molecules of the present invention can be left as extrachromosomal, or they can be integrated into one or more sites within the chromosome of the transformed cell, so that it retains its ability to be expressed. Preferred nucleic acid molecules for transforming a host cell include nucleic acid molecules that encode at least a portion of the flea saliva product or homologs (e.g., products of the saliva of other ectoparasites), contained in the FS-1 extracts , FS-2 or FS-3 of saliva. Particularly preferred nucleic acid molecules are those described herein for inclusion with recombinant vectors of the present invention. Suitable host cells include any cell that can be transformed and that can express the salivary protein of the introduced ectoparasite. Such cells are, therefore, capable of producing salivary proteins of ectoparasites of the nucleic acid, after being transformed with at least one nucleic acid molecule of this invention. The host cells may be cells not transformed or already transformed with at least one nucleic acid molecule. These include bacterial cells, fungi (including yeast), insect cells, animals or plants. In particular, bacterial (e.g., E. coli) and insect (by "example *, Spodoptera) are preferred." A recombinant cell is preferably produced by transforming a host cell with one or more recombinant molecules, each one of them consisting of one or more nucleic acid molecules of the present invention 5 operatively linked to an expression vector containing one or more transcription control sequences The terms "operably linked" refer to the insertion of a molecule of nucleic acid in an expression vector, such that the molecule is capable of being expressed in a transformed host cell.An expression vector, as used herein, is a DNA or RNA vector, which is capable of of transforming a host cell, and effecting the expression of the specified nucleic acid molecule Preferentially, the expression vector must be capable of replicating in the cell The expression vectors can be prokaryotic or eukaryotic, and are typically viruses or plasmids. The expression vectors of the present invention include any vector capable of directing gene expression in recombinant cells (bacterial, fungal, insect, animal and / or plant). As such, the nucleic acid molecules of the present invention can be operatively linked to expression vectors containing regulatory sequences, such as promoters, operators, repressors, enhancers, termination sequences, origins ? Replication and other regulatory sequences compatible with the recombinant cell, and which control the expression of the nucleic acid molecules of the present invention. As used herein, a transcription control sequence includes a sequence that is capable of controlling initiation, elongation and termination of transcription. Particularly important transcription control sequences are those that control the initiation of transcription, such as promoter, enhancer, operator and repressor. Appropriate transcription control sequences include all those Which can function in at least one of the recombinant cells of the present invention. There is a variety of transcription control sequences, well known to those skilled in the art, and include those that function in bacterial cells, yeast, delrin, insect and mammals, such as (but not limited to) lac, lac, trp, trc, oxy-pro, omp / lpp, rrnB, bacteriophage lambda (?) (Such as? PL and? PR, and fusion products of those promoters ); bacteriophage T7, TI lac, bacteriophage T3, bacteriophage SP6, bacteriophage SP01, metallothionein, alpha coupling, alcohol oxidase of Pichia, subgenomic promoters of alphavirus (such as the subgenomic promoter of Sindbis virus), baculovirus, Heliothis zea virus, vaccinia virus , poxvirus, adenovirus, simian virus 40, retrovirus actin, long terminal repeat of retroviruses, Rous sarcoma virus, heat shock, as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Additional appropriate transduction control sequences, including tissue-specific promoters, as well as lymphokine-inducible promoters (e.g., interferon- or interleukin-inducible promoters.) Control sequences naturally associated with the DNA sequence encoding the salivary protein. Ectoparasites The expression vectors of the present invention may also contain secretory signals to allow the ectoparasite salivary protein produced by the cell to be secreted.Appropriate signal segments include the signal segment of the ectoparasitic salivary protein. or any heterologous signal segment capable of directing the secretion of the salivary protein from ectoparasites, including fusion proteins of the present invention.The preferred signal segments include, but are not limited to, the tissue plasminogen activator (t - PA), interferon, interleukin , growth hormone and the 5 segment signal of the viral coat glycoprotein. The expression vectors of the present invention may contain fusion sequences that can result in the expression of the nucleic acid molecules of the present invention inserted as fusion proteins. The inclusion of } '? A fusion sequence as part of the nucleic acid molecule of an ectoparasite of the present invention can increase the stability during the production, storage and / or use of the protein encoded by the nucleic acid molecule. In addition, a merger segment can be used as a tool to simplify the purification of the ectoparasite saliva protein, as, for example, allow the purification of the resulting fusion protein using affinity chromatography. An appropriate merging segment can be a domain of any size it possesses the proper function (for example, increased stability and / or tool for purification). It is within the scope of the present invention to use one or more fusion segments. The fusion segments can be linked to the amino or carboxyl terminal end of the ectoparasitic saliva protein 5. The ligation between the fusion segments and the ectoparasitic saliva protein can be constructed so that it is susceptible to rupture to facilitate recovery of the specific protein. Fusion proteins are preferably produced by culturing a recombinant cell transformed with a fusion sequence in the nucleic acid encoding a protein, in which the fusion segment linked to the amino or carboxyl terminal group of the ectoparasite saliva protein is included. A recombinant molecule of the present invention is a molecule that can include at least one nucleic acid molecule, any of those described heretofore, operatively linked to at least any transcription control sequence capable of effectively regulating the expression of the nucleic acid molecule (s) in the cell to be transformed. A preferred recombinant molecule includes one or more nucleic acid molecules that encode at least a portion of a flea saliva product, or a homolog thereof (eg, saliva products of other ectoparasites), contained in the saliva extract FS-1, FS-2 or FS-3. Particularly preferred nucleic acid molecules for inclusion in a recombinant molecule are, as described herein, for inclusion in a recombinant vector of the present invention. A recombinant cell of the present invention includes any cell transformed with at least one of any of the nucleic acid molecules of the present invention. A preferred recombinant cell is a cell transformed with at least one nucleic acid molecule encoding at least a portion of a flea saliva product, or a homolog thereof (eg, saliva products of other ectoparasites), content in the saliva extract FS-1, FS-2 and / or FS-3. A preferred recombinant cell is transformed with at least one nucleic acid molecule that is capable of encoding at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, spfH, spfl, spfJl, spfJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, spfN2 and spfN3, or homologs thereof. As such, nucleic acid molecules encoding a protein having at least a portion of one or more of the following amino acid sequence are also included: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 , SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO : 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51 SEQ ID NO: 53 and / or SEQ ID NO: 54, or homologues thereof, and acid molecules nucleic acid, including at least a portion of a nucleic acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50 and / or SEQ ID NO: 52. Particularly preferred recombinant cells include those transformed by E. coli, with at least one of the aforementioned nucleic acid molecules. A person skilled in the area of use of recombinant DNA technologies can improve the expression of transformed nucleic acid molecules by manipulating, for example, the number of copies of the nucleic acid molecules within a cell, the efficiency with which those molecules of Nucleic acid is copied, the efficiency with which the resulting copies are translated, and the efficiency of post-translational modifications. Recombinant techniques useful for increasing the expression of nucleic acid molecules of the present invention include, but are not limited to, operably linking nucleic acid molecules to plasmids of high copy number, integration of the nucleic acid molecules into one or more chromosomes. of the cell, add vector stability sequences to plasmids, substitutions or modifications of transcription control signals (eg, promoters, operator, facilitators), substitutions or modifications of translation control signals (eg, binding sites of ribosomes, Shine-Dalgarno sequences), modification of nucleic acid molecules of the present invention to correspond to the use of the codon of the cell, elimination of sequences that destabilize the copies (transcription), and use of signal control that temporarily separate the growth of the recombinant cell from the production of the recombinant protein during fermentation. The activity of an expressed recombinant protein of the present invention can be improved by means of fragmentation, modification or derivatization of the resulting protein. According to the present invention, recombinant cells can be used to produce an ectoparasite salivary protein of the present invention, by culturing such cells under conditions effective to produce such a protein, and recovering the protein. Effective conditions for producing a protein include, but are not limited to, appropriate media, bioreactor, temperature, pH, and oxygen conditions allow for the production of protein. An appropriate or effective means refers to any medium in which a cell of the present invention, when cultured, is capable of producing an ectoparasite salivary protein. Such a medium is typically an aqueous medium comprising assimilable carbohydrate, phosphate and nitrogen sources, as well as also suitable salts, minerals, metals and other nutrients, such as vitamins. The medium may comprise complex nutrients, or may be a defined minimum medium. The cells of the present invention can be cultured in conventional fermentation bioreactors, including, but not limited to, batch, batch feed, cell recycle, and continuous fermentors. The cultures are conducted in shake flasks, test tubes, microtiter plates and Petri dishes. The cultures are carried out at an appropriate temperature, pH and oxygen content for the recombinant cell. Such culture conditions are well within the ordinary skill of a person experienced in such technologies. Depending on the vector and system used for production, the resulting ectoparasite saliva proteins may remain within the recombinant cell, or be secreted into the fermentation medium.; or to be secreted in a space between two cell membranes, such as the periplasmic space in E. coli, or to be retained on the outer surface of a cell or viral membrane. The phrase "recovering the protein" refers simply to recovering the entire fermentation medium containing the protein, and does not need to involve additional steps of separation or purification. The ectoparasite saliva proteins of the present invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography , gel filtration chromatography, reverse phase chromatography, chromatofocalisation and differential solubilization. The ectoparasite saliva proteins are preferably recovered in "substantially pure" form. As used herein, "substantially pure" refers to a purity that allows effective use of the protein as a diagnostic or therapeutic composition. For example, if an animal is administered a dose of ectoparasite saliva proteins isolated from a recombinant cell of the present invention, it should not exhibit substantial toxicity of contaminants mixed with the protein. The ectoparasite saliva products substantially free of contaminating material can be isolated using the saliva collection apparatus of the present invention. A saliva collection apparatus of the present invention is designed to stimulate (e.g., cause) the ectoparasites retained in the container to be fed, and thereby release saliva, which is collected separately from the contaminating material. The ectoparasites stick and feed on warm-blooded animals carrying them. A carrier animal, as used herein, refers to the animal from which, or on which, the ectoparasites can feed. Without being limited to theory, it is believed that ectoparasites, such as fleas, have heat receptors that allow ectoparasites to feel a temperature difference between the warm skin of the wearer and the ambient air. This temperature difference stimulates (e.g., causes) the ectoparasite to feed from the warm surface (e.g., from the warm skin of the animal). It is also believed that movement, vibration and darkness can be felt by ectoparasites, and through that be encouraged to feed. An ectoparasite is fed by penetrating the dermis of an animal with parts of its mouth, the parts of the mouth remain in such position while the ectoparasite secretes saliva to improve its feeding. During feeding, the ectoparasite can release contaminants, such as blood proteins and fecal material. A saliva collection apparatus of the present invention includes a chamber and structure such that a temperature differential between the chamber and the structure of the apparatus is maintained to cause or promote the ectoparasite retained in the structure to attempt feeding from the chamber. When the ectoparasite, within such an apparatus attempts to feed itself, according to the present invention, the arthropod releases saliva which is collected in such a manner that the proteins and the other products in the saliva are substantially free of contaminating material. In order to collect saliva substantially free of contaminating material, the apparatus of the present invention also includes collection means for capturing the saliva on a surface separated from the surface that captures the contaminating material. A saliva collection apparatus of the present invention can be used to collect saliva from any ectoparasite, such as those described herein. The nucleic acid molecules of the present invention can be fed to any animal susceptible to ectoparasite infestation (e.g., a carrier animal), including, but not '"' limited to, a wide variety of vertebrates. 2 preferred carriers include mammals and birds. The most preferred animals include cats, dogs, humans, horses, rabbits, sheep, cattle, pigs, goats, raccoons, ferrets, rats and weasels, as well as other animals domestic animals, animals for food and animals that are carriers of fleas that infest domestic animals and animals for food. Particularly preferred carrier animals of ectoparasites are expenses and dogs. The ectoparasites of the present invention particularly preferred for collecting saliva include any convenient flea species. Preferred fleas include fleas capable of infesting cats and dogs. Newly hatched fleas (for example, recently emerged from the pupal state) that have not had a first meal containing blood are preferred for the following reasons: Because recently born fleas have not had a first meal containing blood, and such fleas try to feed themselves. Since recently born fleas have not had a blood meal, they do not release as much contaminating material as fleas fed. Newly born fleas live longer without a blood meal, than fleas that have had at least one blood meal. It should be noted that fleas fed can also be used with an apparatus of the present invention. It will be obvious to a person skilled in this area of technology, that a saliva collection apparatus of the present invention is useful for collecting saliva from any ectoparasite. By way of illustration, an apparatus of The saliva collection of the flea of the present invention is described in detail below. Such description is not intended to limit, in any way, the scope of the present invention. It is within the knowledge of a person experienced in the area of technology, the collect saliva from other ectoparasites in a direct way based on the methods of flea saliva collection. One form of the present invention is a saliva collection apparatus that includes a chamber and a structure operatively connected to an interface, such that a temperature differential is maintained between the chamber and the structure. The interface includes a collection means and barrier means located in such a way that, in order to attempt to feed, the parts of the flea mouth penetrate the barrier means prior to the collection means 5. The temperature differential between the chamber and the structure is a convenient temperature difference to attract the fleas retained in the structure to try to feed through the interface and, by means of. that, deposit the saliva products on the '* "Collection means Due to the relative location of the collection means and the barrier means, the contaminant material is deposited on the barrier means A flea saliva collection apparatus of the present invention includes a structure. An structure can comprise any material capable of retaining fleas, which provides structural support and which can be connected to retention means. The structure is preferably made of a material capable of tolerating cleaning and / or the sterilization procedures usually employed by those experienced in this area of technology. As such, the structure can be reused. Preferred materials for the structure of the present invention include, but are not limited to, plastic, metal, rubber, wood and glass materials, and combinations of such materials. The materials of Most preferred structures include metal and plastic materials, with plastic materials being even more preferred. Preferred plastic materials include plexiglass, Teflon, nylon and polycarbonates. A particularly preferred plastic material is plexiglass, or other durable plastic, tear-resistant, preferably clear so as to allow the ectoparasite to be seen inside the container. According to the present invention, the size of a structure of the invention is such that the structure can hold a desired number of fleas without excessive -V "~ grouping Both the surface area and the volume of the structure can be important.The size of the structure can vary, depending on the number of fleas to be retained in the structure.Preferably, the size of the structure is sufficient to keep from around ,000 fleas, up to about 6,000 fleas per structure for about 72 hours, more preferably from about 2,000 fleas, up to about 5,000 fleas per structure for about 72 hours, and even more preferably from about 3,000 fleas, up to about from 4,000 fleas per structure for about 72 hours. A convenient height for a structure of the present invention is a height that is high enough to allow space for fleas to move around while feeding. The height of a flea structure 5 is preferably from about 1.0 centimeters (cm) to about 3.0 centimeters, more preferably from about 1.5 centimeters, to about 2.5 centimeters, and even more preferably, from about 1.8 centimeters to about of 2.2 centimeters. The shape of a structure of the present invention can be any shape, provided that it has at least one convenient flat surface for feeding fleas contained within the structure. A structure of the present invention is preferably formed as a cylinder, a box of four or more sides, a dome half, or a cylinder half.A particularly preferred form is a short cylinder.The diameter of a structure The preferred embodiment of the present invention can be varied widely. Containers of different diameters can be used according to, for example, the number of fleas to be placed in the structure without excessive grouping. The internal diameter of a round structure of the present invention is preferably from about 4.0 centimeters to about 5.5 centimeters, more preferably from about 4.5 centimeters to about 5.5 centimeters. centimeters, and even more preferably around 5.0 centimeters. According to the present invention, the size, shape, height and diameter of the structure may vary for different ectoparasites, depending on the size and number of the anthropods to be retained in the structure.

According to the present invention, a structure is operatively connected to retaining means and exchange means. "Operably connected", as used herein, refers to combining portions of the saliva collection apparatus of the present invention, such that fleas can be retained within the apparatus, and can deposit saliva on the collection means . A retaining means of the present invention is penetrable by the mouth portions of the fleas. A means of retaining the ! ^ * ~. present invention can comprise any material or combination of materials that is convenient for retaining fleas and through which fleas can be fed (eg, the retaining means are penetrable by the mouth parts of the flea). As such, the means of Retention may comprise a material having openings large enough for the flea mouth parts to penetrate, but small enough to efficiently prevent the loss of any fleas held therein. The preferred means of retention comprise a material having apertures ranging from about 0.25 millimeters (mm) to about 0.50 millimeters, more preferably with apertures of from about 0.30 millimeters to about 0.50 millimeters, and even more preferably with apertures of about 0.35 millimeters to 5 millimeters. around 0.45 millimeters. A person skilled in this area of technology will recognize that the size of the apertures may vary according to the type of ectoparasite retained in the structure of the apparatus. For example, maintaining ectoparasites particularly small as, but not limited to, lice 5 may require that the retainer means have minor openings. Reciprocally, a retention means for hard ticks, which are ectoparasites that cement parts of their mouths in the carrier animal, requires larger openings, preferably about 1 millimeter. . { * H- Preferred materials for use as the retention means include, but are not limited to, metal mesh, nylon mesh, plastic film, cloth and plastic combinations of such materials. The most preferred retaining means include nylon mesh, mesh Metal and retaining means even more preferred include nylon mesh. The collection apparatus can be retrofitted with a variety of retention means. The preferred means of retention are reusable. Means of change or exchange of this The invention may comprise any material or combination of materials capable of maintaining a permissive environment for fleas within the structure allowing the exchange of gas, moisture and heat between the internal environment of the structure and the external environment thereof. The structure can be retrofitted with different means of changes, having different permeabilities of gas, humidity and heat. As used herein, the term "gas" refers to any gas or atmospheric gases required for the survival of the flea, including, but not limited to, carbon dioxide, oxygen and nitrogen. The gas may also refer to gaseous products produced by the fleas while they are maintained in the structure of the present invention, such as gaseous products of metabolism including expirations or excreta gases. "" "Swap means of the present invention comprise materials having holes large enough to allow gas, heat and moisture to escape, but small enough to effectively prevent the loss of fleas The preferred shifting means comprise a material with openings ranging from about 0.10 millimeters (mm) to about 0.45 millimeters, more preferably with apertures of about 0.10 millimeters to about 0.30 millimeters, and even more preferably with apertures of about 0.13 millimeters to about 0.15 millimeters. Preferred materials for use as exchange media include, but are not limited to, wire mesh, nylon mesh, plastic, cloth and combinations of such materials.Most preferred exchange media include mylon mesh, metal mesh, and combinations of such materials and an even more preferred medium of exchange includes mylon mesh. Preferred exchange rates are reusable. According to the present invention an apparatus includes a chamber operatively connected to a structure. A chamber of the present invention is capable of maintaining a suitable internal temperature to create a differential temperature between the structure and the chamber of the apparatus that promotes the deposition of saliva by fleas retained in the structure -jf on a means of collection of the device. A preferred chamber is also capable of maintaining a suitable internal moisture level for the survival of ectoparasites contained in the apparatus (for example, convenient to prevent the dissection of ectoparasites). a camera of The present invention is also capable of being attached to an artificial feeding system, as described in detail in the Examples. A camera can comprise any material capable of maintaining suitable humidity and temperature levels within the chamber. A camera is made preferably of a material capable of withstanding the sterilization or cleaning procedures usually employed by the experts in this area of technology. As such, a camera can be reused. Preferred materials for a chamber of the present invention include, but are not limited to, glass, plastic, metal, rubber, and wood materials and combination of such materials. More preferred camera materials include glass and plastic materials, with glass materials being even more preferred. According to the present invention, the size of a chamber is such that the chamber can maintain a suitable temperature level to stimulate fleas to deposit saliva on the collection means of the apparatus. The size of the camera may vary depending on the amount of staining material (depending on # * 'described below in detail below) to be placed in the chamber, the diameter of the collection means to be included in the chamber or whether the chamber is to be included in an artificial feeding system as described in detail in the Examples. Preferably, the height of a chamber of the present invention is sufficient to allow a convenient amount of staining material to be placed in the chamber, such that the staining material maintains a moisture level in the chamber convenient for the survival of the flea. The height of a camera is preferably from 0.1 centimeters to 7.0 centimeters approximately, more preferably from 2.0 centimeters to 6.0 centimeters approximately, and even more preferably from 3.0 centimeters to approximately 5.0 centimeters. According to the present invention, the shape of a camera may be in any form so long as it has at least one open termination to which an interface of the present invention may be included. A chamber of the present invention is preferably formed as a cylinder that opens at both ends or an open cylinder at one of the tips. A particularly preferred form is an open cylinder at both ends. The diameter of a preferred chamber of the present invention can vary widely. Cameras of different diameters can be used according to, for example, the diameter of the interface to be attached to the chamber or the diameter of the structure to be attached to the chamber. The diameter of a chamber of the present invention is preferably from 2.0 centimeters to 6.5 centimeters approximately, more preferably from 3.0 centimeters to 5.5 centimeters, and even more preferably from 4.0 centimeters to 4.5 centimeters. A chamber of the present invention may contain suitable spotting means to maintain a level of humidity in the chamber, convenient for the survival of the flea. The methods for maintaining suitable moisture levels are described in detail below. A chamber of the present invention may contain food or water, but preferably is moist (eg, moist but not wet) and does not contain the food. A saliva collection apparatus of the present invention includes an interface. An interface of the present invention includes means capable of collecting the saliva products free of contaminating material. As such, an interface of the present invention is penetrable by the flea mouth parts, but capable of storing contaminating material such as blood and fecal matter, separated from the flea saliva products segregated by themselves in their intent. to feed An interface of the present invention comprises a means for collecting saliva products and a means for creating a barrier between the contaminating material and the ** saliva products harvested. A collecting means of the present invention may be of any material capable of collecting (eg, adsorbing) at least a portion of the deposited (eg, secreted) saliva proteins by fleas. retained who try to feed through the interface. In addition, a collection means of the present invention is capable of collecting saliva components other than saliva proteins deposited by fleas attempting to feed through the interface. The means of collection is such that the saliva products can not only be bound to the collection means but can also be eluted (eg, extracted) therefrom when exposed to a suitable eluent (eg, extractant). As such, preferred harvesting materials of the present invention include materials that are hydrophobic and have a low ability to bind since the saliva components are easily eluted from such material. The material of collecting means of the present invention should also be capable of being penetrated by the mouth parts of the fleas. The preferred collection material of the present invention includes, but is not limited to, nylon, nitrocellulose, CM-derivatized, diethylaminoethyl (DEAE) -derivatized, paper, polysulfone, cellulose ester, polytetrafluoroethylene (PTFE) and polyvinylidene fluoride membranes (PVDF) ). Membranes • Anion exchange is a particularly preferred collection media material and includes DE-81 chromatography paper, which can be obtained from Whatman, Inc., Clifton, NJ. Materials for collection media particularly Preferred include PVDF. A preferred PVDF as a material of collection means includes Durapore ^. The shape of the collection means of the present invention may vary according to the shape of the chamber to which the collection means are to be attached. Form The preferred means of harvesting includes, but is not limited to, a round shape or a shape similar to a box having four or more sides, with a round shape being more preferred. The size of a collection medium of this The invention may also vary according to the size of the chamber to which the collection means are to be attached. The size of collecting means is preferably larger than the open termination of a chamber, in such a way as to prevent the collecting means from passing into the chamber. The size 5 of collection means is preferably from 2.2 centimeters to approximately 6.5 centimeters in diameter, more preferably from 3.2 centimeters to 5.7 centimeters approximately, and even more preferably from 4.2 centimeters to 4.7 centimeters approximately. - * "* A saliva collection apparatus of the present invention provides a novel means of barrier that allows the collection of ectoparasite saliva substantially free of contaminating material A barrier means of the present invention can be any material capable of preventing substantially that the contaminating material is contacted with the collection medium (for example, it prevents the passage of contaminating material such as faecal products and flea blood through the collection medium), but it is also capable of being penetrated by the parts of the mouth of fleas and allow the passage of saliva through the barrier means. Preferably, the thickness of the material of a barrier of the present invention has a micron thickness. Preferred materials of the barrier medium of the present invention include, but are not limited to, very thin plastic, Teflon, cloth, paper, paraffin and wax materials. The most preferred barrier medium materials of the present invention include stretched plastic, with Saran Wrap * 11 *, and particularly Parafilm ™, stretched very thin (eg, as thin as can be stretched by the machine and / or manually), still the most preferred. The size of a barrier means of the present invention may vary according to the size of the chamber to which the barrier means are to be attached. The size of the barrier means is preferably large enough "" * "so that the barrier means can extend up the sides of a chamber of the present invention, then allowing the barrier means to be secured to the chamber.The size of the barrier means is small enough so that the barrier means not interfere with, for example, the capacity of the saliva collection apparatus that contains the camera to be attached to the artificial feeding system. According to the present invention, a collecting means and a barrier means are operatively connected to a chamber of a saliva collection apparatus in such a way that the fleas retained in the structure of such an apparatus are able to penetrate both barrier and collection means to deposit saliva on the collection means. A collecting means of the present invention is Preferably included removably to a site on the chamber through a barrier means. A preferred site for including a collection means and a barrier means is the portion of a chamber designed to interface with the structure. A more preferred site for including a collection means and a barrier means is the open termination of a camera. A saliva collection apparatus of the present invention may also include a staining means. A staining means of the present invention is capable of maintaining the proper humidity for the survival of the flea within the apparatus and, as such, it is capable of retaining liquid for the period of time in which the fleas are retained in the apparatus. As such, a staining means can be any suitable absorbent material. Preferred staining media materials include natural and synthetic sponges, foam, paper, cloth and agarose. The most preferred staining media materials still include sponges and paper, with filter paper being the most preferred. In a particularly preferred aspect or form, one or more pieces of spotting bearings # 320 VWR (available from VWR Scientific, Denver, Colorado) comprise the spotting means. As set forth herein, a saliva collection apparatus of the present invention is capable of maintaining a temperature differential between a structure and a chamber of the apparatus.

As noted above, a saliva collection apparatus of the present invention is capable of maintaining a temperature difference between a structure and a chamber of the apparatus. An appropriate differential temperature within an apparatus of the present invention includes a differential temperature that stimulates the fleas retained in the apparatus to penetrate the interface of the apparatus and deposit saliva on the collection means. Preferred temperatures in a chamber of the present invention are in a range of 20 ° C to 45 ° C, while preferred temperatures in a structure of the present invention are in a range of about 5 ° C to about 35 ° C. In a preferred aspect or form, the temperature in the chamber ranges from about 35 ° C to about 40 ° C and the temperature in the structure ranges from 10 ° C to 30 ° C. A particularly preferred chamber temperature ranges from about 35 ° C to 37 ° C; and a particularly preferred temperature for a structure ranges from 20 ° C to 27 ° C. The survival of ectoparasites can be affected by humidity. As such, the moisture level in a structure of an apparatus of the present invention is that convenient to maintain the survival of the ectoparasites retained therein. Suitable levels of relative humidity within an apparatus of the present invention may vary depending on the ectoparasite contained within the apparatus. As used herein, relative humidity refers to the degree of atmospheric water vapor relative to the maximum degree of atmospheric water vapor that results in precipitation. Thus, the relative humidity is expressed as a percentage of humidity, where 100% humidity represents atmospheric water vapor saturation. The preferred humidity level in a chamber of the present invention ranges from 50% to 100%, while the preferred humidity level in a structure of the present invention ranges from 40% to 60%. In a preferred aspect or form, --- »* the humidity level in the chamber goes from approximately 50% to 94% and the humidity level in the structure is 50%. Another aspect or form of the present invention is the use of contrasting colors to attract fleas. For example, at least one surface of a collection apparatus of the The present invention can be of a color sufficiently dark to attract fleas to penetrate the interface of the apparatus. Without being limited by theory, it is believed that fleas are able to sense light from darkness and tend preferentially towards a dark surface to feed. Therefore, according to the present invention, a camera can be darker than a structure, thus attracting fleas to the interface between the camera and the structure. Suitable dark colors include colors ranging from black to light brown, with black being preferable. A preferred aspect or form of a collection apparatus of the present invention is shown in Figures 4A and 4B. A saliva collection apparatus (2) is separable into a structure (4) and a chamber (6). A cross section of a section of a saliva collection apparatus of the present invention (2) is shown in Figure 4A. With reference to Figures 4A and 4B, the structure (4) has an open termination cylinder having a first portion (8) and a second portion (10). The '---- > The second portion (10) of the structure (4) has an outer diameter (12) and an inner diameter (14) The shift means (16) are operatively included at an end of the first portion of (8) of the structure (4) and retaining means (18) are included to the opposite termination of the First portion (8), between first portion (8), and outer diameter (12) and inner diameter (14) of second portion (10). The shifting means (16) and the retaining means (18) are included in a manner that prevents the fleas from escaping. The means of inclusion of the media change (16) and retention means (18) to the first portion (8) of the structure (4) include, but are not limited to, rubber cement, glue paste, adhesive tape, welding and araldite. A preferred adhesive means is rubber cement. The chamber (6) of the saliva collection apparatus (2) has an open termination cylinder having an upper termination (20) and a lower termination (22). The upper end (20) has a convenient diameter to allow adhesion of the chamber (6) to an artificial feed system as described in detail in the Examples. The lower end (22) has a convenient diameter so that the lower end (22) can be adhered to the structure in a reversible manner (4), in such a way as to provide a slidable fit. The lower termination (22) is covered by a collection means (24). iv The collection means (24) have a diameter larger than the inner circumference of the lower end (22) of the chamber (6), thus preventing the collection means (24) from passing into the interior space (26) of the camera (6). Preferably, the diameter of the collection means (24) is not greater than the outer circumference of the lower termination (22) of the chamber (6). The collection means (24) can be connected to the lower termination (22), in order to provide a detachable connection, thus facilitating the removal of the collection means (24) from the collection apparatus of saliva (2) to recover saliva products from the collection medium (24). A collection means (24) adhered to the lower termination (22) of a chamber (6) is covered by barrier means (28). The barrier means (28) are operatively connected to a chamber (6), in such a way that a seal is formed preventing the contact of the collection means (24) with the contaminating material deposited by the fleas. The barrier means (28) can be connected to the chamber (6), in order to provide a detachable connection. Preferably, the barrier means (28) comprises a stretchable plastic material, such as Parafilm ™, which is stretched as thin as possible through a collection means (24), contacting the lower end (22) of a chamber ( 6), and more stretched along the side wall (30) of the / '+ camera (6) towards the upper end (20) of the camera (6) The barrier means (28) can be more secured to the wall of the side (30) of the chamber (6), using a rubber seal (32). The rubber seal (32) removably connects the portion of the barrier means (28) that is is located on the wall of the side (30) of the chamber (6), thus further securing the collection means (24) to the chamber (6), and seal in the chamber environment (6). The staining material (absorbent) can be placed in the interior space (26) in the lower termination (22) of a chamber (6) to form a staining means (34). The staining means (34) may comprise one or more individual spotting pads (eg, pieces of staining material). The staining means (34) preferably ranges from approximately 2.0 millimeters in thickness to approximately 15.0 millimeters thick (when dry) when placed in a 47-centimeter high chamber (6), and more preferably from approximately 2.2 millimeters thick to approximately 12.5 millimeters thick (when dry) when placed in a chamber 47 millimeters high (6), and even more preferably ranging from approximately 2.45 millimeters in thickness to approximately 10.0 millimeters in thickness (when dry) when placed in a chamber (6) of 47 millimeters high. In a particularly preferred aspect or form, the staining means (34) comprises from about 2 to 6 pieces of VWR # 320 staining bearings. The diameter of the staining means (34) is selected to contact the internal side wall (36) of the chamber (6). The staining means (34) is preferably pre-wetted sufficiently to provide moisture to the chamber (6), but not so much so that there is liquid dripping from the staining media (34). The staining means (34) is juxtaposed to the side of the collection means (24), facing the upper end (20) of the chamber (6). The staining means (34) can directly contact the collection means (24) detachably. The chamber (6) is reversibly detachable from the structure (4). The chamber (6) can be interconnected to the structure (4) in any secure reversible manner, such as a slidable, instantaneous or screwed-in shape.

Preferably, the chamber (6) slides inside the structure (4) and is secured using shape bands. The relative height dimensions of the chamber (6) may vary in relation to the structure (4). typically, the height dimension of the chamber (6) is greater than the structure (4). Preferably, the height of the chamber (6) ranges from about 1.0 centimeters to about 7.0 centimeters, more preferably from about 2.0 centimeters to about 6.0 centimeters, and even more preferably from about 3.0 centimeters to about 5.0 centimeters. The height of the structure (4) is preferably from about 1.0 centimeters to about 3.0 centimeters, more preferably from about 1.5 centimeters to about 2.5 centimeters, and even more preferably from about 1.8 centimeters to about 2.2 centimeters. One embodiment of the present invention is a method for collecting ectoparasite saliva products using an apparatus of the present invention. Such a method is particularly advantageous, because it allows the isolation of saliva from ectoparasites, iding saliva proteins, substantially free of contaminating material. As such, the method can be used, for example, to characterize ectoparasite saliva proteins and to isolate ectoparasite saliva proteins for diagnostic and therapeutic use. One embodiment of the present invention ides the steps of: (a) collecting ectoparasite saliva products 5 in a collection medium within a saliva collection apparatus containing ectoparasites in the structure of the apparatus; and (b) extract (e.g., eluting) saliva products from ectoparasites collected from the collection means with a solution to form a product of ; 'extraction contained in the solution. Such extracted solution can be used directly as a preparation or formulation of the present invention, or can be subjected to further fractionation and / or purification steps as here described in detail, to prepare formulations or additional preparations of the present invention. Examples of such extraction solutions ide FS-1, FS-2 and FS-3. According to the present invention, a saliva collection device containing ectoparasites has an interface between the chamber and the structure comprising a A collection means capable of collecting at least a portion of saliva products deposited by the ectoparasites retained in the apparatus, and a barrier means capable of substantially preventing the contaminating material from coming into contact with the collection means. 25 The ectoparasites contained in the apparatus are maintained under such conditions that there is a differential temperature between the chamber and the structure; that is, the chamber of the apparatus has a warmer temperature than the temperature of the structure containing the ectoparasites, in such a way that the warmer temperature in the chamber attracts the ectoparasites retained in the structure to try to penetrate the collecting means and barrier medium, thus depositing saliva products in the collection means. In one embodiment, the method of collecting the saliva products ides prewetting a collection means of the present invention in advance, to locating the collection means in an apparatus of the present invention. A convenient pre-formulated solution for the present invention is capable of facilitating the adsorption (eg, collection) of the saliva products, such that the products can also be extracted during an extraction step (eg, when exposed). to an appropriate solvent). A convenient prewet solution of the present invention ides any regulator that is not toxic to ectoparasites, and has a physiological pH. Examples of suitable regulators ide regulated phosphate saline, water, phosphate regulator, regulator of HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic salt regulator), TS regulator (Tris-EDTA saline regulator), Tris regulator and TAE (Tris-Acetate-EDTA). A preferred pre-wet solution includes sterile water containing 50 U / ml penicillin and 50 μg / ml streptomycin. When an apparatus used to collect 5 saliva products includes a staining means, that staining means should be wet, either prior to or subsequent to the placement of the staining medium in the chamber. Preferred solutions for wetting include, but are not limited to, water, phosphate buffered saline (PBS), j- phosphate buffer, tris buffer, HEPES regulator, TEA regulator, and TS regulator. The most preferred moistening solutions include water and 50 μg / ml penicillin and 50 μg / ml streptomycin. According to the present invention, a staining medium is sufficiently wetted to produce humidity in a chamber, but not to drip the liquid that the ectoparasites retained in the apparatus can drink. In a preferred form, a staining means is approximately 4.0 centimeters in diameter and approximately 2.5 millimeters in thickness is moistened with approximately 2.3 milliliters (ml) of solution to moisten. In one embodiment, a predetermined number of ectoparasites are introduced into the structure of an apparatus of the present invention. The number of ectoparasites to be introduced into a structure may vary with the size of the structure, and should be a number that would not impede the ability of an ectoparasite to deposit saliva in the collection medium of the present invention. In a preferred embodiment of the present invention, the fleas are added to an apparatus of the present invention. The appropriate and preferred number of fleas to introduce into a structure is described herein. In particular, fleas born recently in the pupal stage are used. Such fleas can be bred as described in Wade et al., Pages 186-190, 1988, J. Med. Entomol , volume 25. Preferably, such fleas have not made a blood meal. Fleas can be loaded into an appliance by placing the fleas in an aquarium container, and sucking them into the structure under vacuum conditions. Additional optional components suitable for maintenance of fleas can be added to the container, such as animal hair, and dry tissue. In a preferred embodiment, at least one apparatus of the present invention having fleas contained in the structure of the apparatus is attached to an artificial feeding system, such as the one described herein. The device can remain attached to the feeding system, as long as the fleas continue to release saliva while penetrating the collection medium. Preferably, the fleas are kept in the apparatus attached to the feeding system for about 12 hours to about 120 hours, more preferably, about 24 hours to about 96 hours, and even more preferably, about 72 hours, since the fleas they essentially stop secreting saliva around that time. According to the method of the present invention, preferably at least about 80 micrograms (μg), more preferably at least about 90 micrograms, and even more preferably at least 200 micrograms amino acids, • "flea salivary protein can be collected at approximately 106 f-hour when measured using a Bio-Rad Bradford assay (available from Bio-Rad, Hercules, California). According to the present invention, the saliva products Ectoparasite can be extracted using a solvent capable of extracting saliva products from a collection medium of the present invention, preferably in such a way that the functional activities of the eluted products are maintained. If the functional activity of flea or saliva proteins, for example, is not maintained, reassembly (of proteins to recover functionality using techniques known to those skilled in the art) is within the scope of the invention. of extraction include, but are not limited to, phosphate-regulated serum, phosphate-regulated serum containing sodium chloride, tFA in acetonitrile, chaotropic agents, detergents, organics, salts, or combinations thereof.The most preferred extraction solvents include , lMNaCl in phosphate-regulated serum, 0.1 percent TFA in 50% acetonitrile, 1 percent TFA in 50 percent acetonitrile, 12.8 percent acetonitrile and 50 percent acetonitrile, Convenient extraction moments to elute proteins and other products of a collection medium are described in detail in the Examples. saliva extracted from a collection means of the present invention can be carried out by fractionating the solution containing the extracted product to obtain the separated peak fractions and recovering at least one of the peak fractions substantially free of the remaining fractions for obtain a preparation or formulation of ectoparasite saliva proteins. In a preferred aspect or form, the proteins contained in the saliva products extracted from the present invention are further resolved by subjecting the extract to purification by HPLC to obtain peak fractions. In a preferred embodiment, the saliva proteins extracted from the present invention are further resolved by HPLC to obtain the peak fractions illustrated in Figure 2. Details of the extraction and resolution of such proteins are presented in the Examples.

According to the present invention, a preparation or formulation comprising at least one ectoparasite saliva product of the present invention or a mimetope thereof, can be used to identify animals that are susceptible or have allergic dermatitis. In accordance with the present invention, a "mimetic" refers to any compound that is capable of mimicking the ability of an isolated ectoparasite saliva product of the present invention to perform its function (e.g., anticoagulation, anticomplement, vasodilators, proteases) , acid phosphatases or detecting and / or treating the hypersensitivity of an animal that has, or is susceptible to, allergic dermatitis A "mimetic" may be a peptide that has been modified to decrease its susceptibility to degradation, but which still retains desired activity Other examples of mimetopes include, but are not limited to, carbohydrate-based compounds, lipid-based compounds, nucleic acid-based compounds, natural organic compounds, synthetically derived natural compounds, anti-idiotypic and / or catalytic antibodies, or fragments The methods of the present invention may also include non-proteinaceous portions of ectoparasite saliva product having allergenic and / or antigenic activity (e.g., carbohydrate moieties associated with ectoparasite saliva proteins). A mimetic can be obtained, for example, by monitoring libraries of synthetic compounds to find compounds capable of altering the ability of ectoparasites to feed, or detecting and / or treating allergic dermatitis as a result of ectoparasite bites. A mimetic can also be obtained, for example, by rational drug design. In a rational drug design procedure, the three-dimensional structure of a compound of the present invention can be analyzed, for example, by nuclear magnetic resonance (NMR), or X-ray crystallography. The three-dimensional structure can then be used to predict structures of potentiality of mimetopos, for example, by computer modeling. Predicted mimetope structures can then be produced, for example, by chemical synthesis, recombinant DNA technology, or by isolation of a mimetic from a natural source (e.g., plants, animals, bacteria and fungi). One embodiment of the present invention is an in vivo test, which is capable of detecting whether an animal is hypersensitive to ectoparasite saliva products. An in vivo test of the present invention may initially be used to determine if an animal is hypersensitive to the ectoparasite saliva products, and then be used to determine whether an animal is hypersensitive to a particular ectoparasite saliva component, in particular to an ectoparasite saliva protein. An in vivo hypersensitivity test of the present invention is particularly useful for identifying animals that are susceptible or have allergic dermatitis. An in vivo hypersensitivity test of the present invention is even more useful for identifying animals that are susceptible or have FAD. A convenient in vivo hypersensitivity test of the present invention may be, but is not limited to, a > skin test, which comprises administering (e.g., intradermally injecting or superficially scratching) an effective amount of a preparation or formulation containing at least one product of ectoparasite saliva or a mimetope thereof. The methods to carry out tests of the present invention are known to those skilled in the art, and are briefly described herein. Suitable preparations or formulations for use in an in vivo skin test include ectoparasite saliva components (e.g., saliva products) collected from, and remaining absorbed into, a collecting medium of the present invention, ectoparasite saliva extracts and one or more isolated ectoparasite saliva proteins). An appropriate amount of saliva product from The ectoparasite for use in a skin test of the present invention can vary widely, depending on the allergenicity of the product used in the test, and the site at which the product is administered. Appropriate amounts of ectoparasite saliva products for use in a skin test of the present invention include an amount capable of causing reaction, such as a perceptible wheal or induration (hardness), resulting from an allergic reaction to the product. Preferred amounts of ectoparasite saliva protein extract for use in a skin test of the present invention range from about 1 nanogram (ng) to about 500 microgram (μg), more preferably from amino acids 5 nanogram to about 300 microgram, and even more preferably from amino acids 10 nanograms, up to about 50 micrograms of proteins or extracts of ectoparasite saliva. It should be noted by those experts in the area of technology, that such amounts vary, depending on the allergenicity of the extracts and / or proteins that are administered. In accordance with the present invention, the ectoparasite saliva products of the present invention can be combined with immunopotentiators (e.g., carriers or adjuvants of the present invention, as defined in detail below). A novel aspect, however, of the present invention, is that the saliva product of an ectoparasite of the present invention can induce a hypersensitive response in the absence of an immunopotentiator. A skin test of the present invention comprises, moreover, administering a control solution to an animal. A control solution may include a negative control solution and / or a positive control solution. A positive control solution of the present invention contains an effective amount of at least one known compound J.}. as inducer of a hypersensitive response when administered to an animal. A preferred compound to be used as the positive control solution includes, but is not limited to, histamine. A negative control solution of the present invention may comprise a solution known that it does not induce a hypersensitive response when administered to the animal. As such, a negative control solution may comprise a solution having compounds essentially incapable of inducing a hypersensitive response or simply a regulator used to prepare the Preparation or formulation, such as a saline solution. An example of a preferred negative control solution is a buffered phenalate phosphate buffered saline solution (available from Greer Laboratories, Inc., Lenoir, North Carolina). The hypersensitivity of an animal to one or more of the formulations or preparations of the present invention can be evaluated by measurable reactions (eg, wheal size, induration or hardness, using techniques known to those skilled in this area of technology) resulting from the administration of one or more experimental samples and control samples in an animal, and comparison of reactions to such experimental sampling with reactions that result from the administration of one or more control solutions. Preferred devices for intradermal injections include individual syringes. Preferred devices for scratching include devices that allow the administration of a number of samples at the same time. The hypersensitivity of an animal can be evaluated by determining whether the reaction resulting from the administration of a preparation or formulation of the present invention is greater than the reaction resulting from the administration of a negative control, and / or by determination whether the reaction resulting from the administration of the preparation or formulation is at least about the same size as the reaction resulting from the administration of a positive control solution. As such, if an experimental sample produces in the animal a reaction greater than or equal to the size of a wheal produced by the administration of a positive control sample, then the animal is hypersensitive to the experimental sample. Conversely, if an experimental sample produces in the animal a reaction similar to the reaction produced by the administration of a negative control sample, then the animal is not hypersensitive to the experimental sample. Preferred sizes of wheal to evaluate the hypersensitivity of an animal range from about 16 millimeters to about 8 millimeters in diameter, more preferably from about 15 millimeters to about 9 millimeters, and even more preferably from about 14 millimeters to about 10 millimeters diameter. Preferably, the ability or inability of an animal to exhibit an immediate hypersensitive response to a preparation or formulation of the present invention is determined by measurements of the size of the wheal during a period ranging from about 2 minutes to about 30 minutes after of the administration of a sample, more preferably from about 10 minutes to about 25 minutes after the administration of a sample, and even more preferably, from about 15 minutes after the administration of a sample. Preferably, the ability or inability of an animal to exhibit a delayed hypersensitive response to a preparation or formulation of the present invention is determined by measurements of indurations and / or erythema from about 18 hours to about 30 hours after administration of a sample, more preferably from about 20 hours to about 28 hours after the administration of a sample, and even more preferably, from about 24 hours after the administration of a sample. A delayed hypersensitivity response can also be measured using other techniques, such as the determination (using techniques known to experts in this area of technology) of the extent of the cellular infiltrate at the site of administration during the periods directly defined above. In a preferred embodiment, a skin test of the present invention comprises injecting intradermally into an animal at a given site an effective amount of a preparation that includes flea saliva extract (eg, flea saliva products extracted by the means of harvesting of the present invention), or at least one Figure protein of the present invention, and intradermally injecting an effective amount of a control solution into the same animal at a different site. It is within the reach of a person experienced in this area of technology to use devices capable of simultaneously administering multiple samples in a number of sites, preferably allowing the concurrent evaluation of numerous preparations. A preferred preparation or formulation comprises the flea saliva products harvested according to the present invention. Also preferred are formulas comprising one or more flea saliva proteins produced by recombinant technology. Suitable flea saliva products for use with a skin test of the present invention include FS-1, FS-2 and / or FS-3, as well as at least a portion of a flea saliva product that it can be isolated from FS-1, FS-2 and / or FS-3. A preferred flea saliva product for use with a skin test includes FS-1, FS-2, FS-3 and / or at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3, or homologs thereof. A more preferred flea saliva product for use with a skin test includes FS-1, FS-2 and FS-3, and / or at least a portion of one or more of the proteins fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. An even more preferred flea saliva product for use with a skin test includes FS-1, FS-2, FS-3 and / or at least a portion of one or more of the proteins fspGl, fspG2, fspG3, fspH , fspMl, fspM2, fspNl, fspN2 and fspN3. Such preparations or formulations capable of inducing FAD in dogs are shown in the Examples section. A preferred positive control may be a sample comprising histamine. A preferred negative control may be a sample comprising a diluent.

Described herein are convenient and preferred animals for testing hypersensitivity to ectoparasite saliva proteins using a skin test of the present invention. Particularly preferred animals to be studied with a skin sample of the present invention include dogs, cats and horses, dogs and cats being even more preferred. Another embodiment of the present invention is an in vitro immunosorbent test that is capable of detecting the presence of an antibody capable of binding to one or more ectoparasite saliva products of the present invention, by contacting a solution containing a putative antibody. , with a solution containing ectoparasite saliva products, in such a way, that it can form immune complexes and is detected. Thus, an in vitro immunoabsorbent test of the present invention is particularly useful for identifying animals susceptible or having allergic dermatitis, demonstrating that an animal has been previously exposed to an ectoparasite saliva antigen and, therefore, may be hypersensitive to the additional exposure to an ectoparasite saliva antigen. In accordance with the present invention, an in vitro hypersensitivity test of the present invention can be, but is not limited to, an immunosorbent test comprising: (a) contacting the preparation or formulation of the present invention with a fluid of the body of an animal under conditions sufficient for the formation of an immune complex between the preparation or formulation and the antibodies, if present, in the body fluid, and (b) determining the amount of immune complex formed, wherein the formation of the Immune complex indicates that the animal is susceptible or has allergic dermatitis. The immunosorbent test is particularly useful for the detection of IgE antibodies in the body fluid, and thereby, indicate immediate hypersensitivity in the animal. Determining the amount of immune complexes formed can include a separation step, depending on the mode of detection. Immunoabsorbent tests can be of a variety of protocols, and can be designed by experts in this area of technology. A preferred immunoabsorbent test of the present invention comprises a first step of covering one or more portions of a solid substrate with a convenient amount of one or more ectoparasite saliva products of the present invention or a mimetic thereof, and covering one or more additional portions of the (or other) solid substrate with a convenient amount of positive and / or negative control solutions of the present invention. A preferred solid substrate of the present invention may include, but is not limited to, an ELISA plate, a dipstick, a radioimmunoassay plate, agarose pores, plastic pores, immunoassay membranes and paper; a more preferred solid substrate includes an ELISA plate, an immersion rod, or a radioimmunoassay, being even more Preferred are an ELISA plate and an immersion rod. As used herein, an immersion rod refers to any solid material having a surface to which the antibodies can be ligated, such a solid material having a stick-like shape, capable of being inserted into a tube. test. Flea saliva products preferred and appropriate - * for use with an in vitro hypersensitivity test of the present invention are those described for the skin test of the present invention. A second preferred step is the in vitro hypersensitivity test of the present invention which comprises contacting the coated substrate with a body fluid, such as serum, plasma or whole blood of an animal susceptible to allergic dermatitis, in such a way as to allow to the antibodies contained in the body fluid, which are able to bind to the ectoparasite saliva products, bind to such products attached to the substrate to form immune complexes. Excessive antibodies and body fluid are then washed off the substrate. In a preferred embodiment, where the IgE antibodies of the body fluid are to be measured, the body fluid can be treated to remove at least some of the other immunoglobulin isotypes and / or other proteins, such as albumin, present in the fluid. . This removal may include, but is not limited to, contacting the body fluid with a material, such as Protein G, to remove the IgG antibodies and / or affinity purify IgE antibodies from other components of the body fluid, by exposure. of the fluid to, for example, Concanavalin A (Con-A). The third preferred step, in the in vitro hypersensitivity test of the present invention comprises contacting immune complexes bound to the substrate, with a compound capable of binding to immune complexes, such as a secondary antibody or other compound, which is capable of of binding to the heavy chain of antibodies related to allergy, produced by animals allergic to ectoparasite, in such a way, that the compounds can bind to immune complexes. Preferred compounds include, but are not limited to, secondary antibodies capable of binding to the heavy chain of IgE antibodies. Preferred animals to study are described herein. Compounds capable of binding immune complexes are commonly labeled, so that it allows estimating the amount of compound bound to the antibody of the body fluid to be measured. Such labels include, but are not limited to, a radioactive label, an enzyme capable of producing a color reaction when a contact with a substrate, a fluorescent label, a luminescent chemical label, a chromophoric label or a compound capable of being bound by another compound. Preferred brands include, but are not limited to, fluorescein, radioisotopes, alkaline phosphatases, biotin, avidin or peroxidases. A fourth preferred step in the in vitro hypersensitivity test of the present invention comprises measuring the detectable amount of label bound to the solid substrate using techniques known to those skilled in the art.; in the area of this technology. It is within the scope of the present invention that the amount of body fluid antibody bound to the substrate can be determined using one or more layers of secondary antibodies or other compounds that are linked. For example, an unlabeled secondary antibody can be ligated to a serum antibody, and the unlabeled secondary antibody can then be ligated by a labeled tertiary antibody. A hypersensitive animal is identified by comparing the level of immune complex formation using the body fluid samples with the level of immune complex formation using control samples. An immune complex refers to the complex comprising an antibody and its ligand (e.g., antigen). As such, immune complexes are formed using positive control samples, and are not formed using negative control samples. As such, if a sample of body fluid results in immune complex formation greater than or equal to the formation of immune complex using a positive control sample, then the animal, from which the fluid was taken, is hypersensitive to the ectoparasite at saliva product bound to the substrate. Conversely, if a sample of body fluid results in the formation of an immune complex similar to the immune complex formation form that results from using a negative control sample, then the animal, from which the fluid was taken, is not hypersensitive to the ectoparasite. to the saliva product bound to the substrate. One embodiment of the present invention is a kit useful for identifying susceptible animals or having allergic dermatitis. As used herein, a suspect animal is an animal to be studied. A kit of the present invention comprises a preparation of the invention and means for determining whether an animal is susceptible or has allergic dermatitis, wherein the preparation is used to identify susceptible animals, or have allergic dermatitis. The means for determining whether an animal is susceptible or has allergic dermatitis may include an in vivo or in vitro hypersensitivity test of the present invention, as described in detail above. A case of the present invention also comprises at least one control solution, such as those described herein. A preferred case of the present invention comprises the elements useful for performing an immunoassay. A kit of the present invention may comprise one or more experimental samples (eg, preparations or formulations of the present invention), and one or more control samples linked to at least one pre-packaged dipstick, and the means necessary to detect formation of immune complexes (eg, labeling of secondary antibodies or other binding compounds, and any solutions needed to resolve such marks, as described in detail above) between antibodies contained in the body fluid of the animal studied, and proteins linked to the immersion rod. It is within the scope of the invention that the kit may simply comprise a preparation or formulation of the present invention, and that the detection means may be provided otherwise. An alternative preferred case of the present invention comprises elements useful for performing a skin test. A kit of the present invention may comprise at least one pre-packaged needle and syringe apparatus containing one or more experimental samples and / or one or more control samples. It is within the scope of the present invention that two or more different in vitro and / or in vivo tests can be used in combination for diagnostic purposes. For example, the immediate hypersensitivity of an animal to the ectoparasite salivary allergen can be tested using an in vitro immunoabsorbent test capable of detecting IgE antibodies specific for an ectoparasitic salivary allergen in the body fluid of the animal. While most of the animals that exhibit delayed hypersensitivity to the ectoparasite saliva allergen also • X > they show immediate hypersensitivity to the allergen, a small number of animals that exhibit delayed hypersensitivity to the allergen do not show immediate hypersensitivity to the allergen. In such cases, obtaining negative results in the specific in vitro IgE test, the delayed hypersensitivity of the The animal to the ectoparasite saliva allergen can be tested using an in vivo test of the present invention. Another aspect of the present invention includes treating animals susceptible or having allergic dermatitis, with a preparation or formulation of the present invention.

According to the present invention, the term treatment may refer to the regulation of a hypersensitive response by an animal to bites of ectoparasites. The regulation may include, for example, immunomodulation of cells involved in the hypersensitive response of the animal or alteration of the The ability of an ectoparasite to introduce allergens into an animal, for example, by inhibiting the anticoagulant activity of a salivary enzyme, thereby impairing the ability of the arthropod to penetrate an animal's dermis, and feeding. Immunomodulation may include modulating the activity of molecules typically involved in an immune response (eg, antibodies, antigens, major histocompatibility molecules (MHC), and coreactive molecules with MHC molecules). In particular, immunomodulation refers to the modulation of the i-) 'antigen: antibody interactions that result in inflammatory responses, immunosuppression and immunotolerance of cells involved in a hypersensitive response. Immunosuppression refers to inhibiting an immune response by, for example, killing particular cells involved in the response immune. Immunotolerance refers to inhibiting an immune response by energizing (e.g., decreasing the reactivity of a T cell to an antigen) of particular cells involved in the immune response. The convenient and preferred ectoparasites are described herein. against whom to treat an animal. A preferred preparation or formulation of the present invention is used to treat FAD. One embodiment of the present invention is a therapeutic composition which, when administered to the animal In an effective manner, it is useful to immunomodulate the animal's immune response (eg, by immunomodulating the animal) to block (e.g., to inhibit, reduce or substantially prevent) a hypersensitive response by the animal when it is subsequently exposed to allergic components. transmitted by bites of ectoparasites. Such a therapeutic composition is useful for immunomodulating animals that are known to be hypersensitive to ectoparasite saliva products and animals susceptible to hypersensitive responses to ectoparasite saliva products. One embodiment of the present invention is a therapeutic composition that includes desensitizing compounds capable of inhibiting an immune response to ectoparasite saliva products of the present invention. such desensitizing compounds include blocking compounds, tolerant and / or suppressor compounds. Blocking compounds comprise compounds capable of demodulating the antigen: antibody interactions that can result in inflammatory responses, tolerant ones are compounds capable of immunotolarizing an animal, and suppressor compounds are capable of immunosuppressant an animal. A desensitizing compound of the present invention can be soluble or bound to a membrane. A membrane-bound desensitizing compound can be associated with biomembranes, including cells, liposomes, planar membranes or micles. A soluble desensitizing compound of the present invention is useful for: (1) inhibiting a Type I hypersensitivity reaction, by blocking the degranulation of mast cells (mast cells - mast cells) mediated by the antigen: IgE; (2) inhibit a Type III hypersensitivity reaction, blocking the formation of antigen: IgE complex, which leads to the destruction of cells by complement, and (3) inhibit a Type IV hypersensitivity reaction, blocking the stimulation of cytokine secretion. by macrophages per T cell assistant. A membrane-bound desensitizing compound of the present invention is useful for: (1) inhibiting a Type II hypersensitivity reaction, blocking the formation of antigen: IgE complex, on the cell surface that leads to destruction to cells by complement; (2) inhibit a Type II hypersensitivity reaction by blocking the IgG-regulated transduction signal in immune cells; and (3) inhibit a Type IV hypersensitivity reaction, by blocking cytotoxic T cells that kill antigen-bearing cells. A desensitizing compound of the present invention can also be covalently linked to a ligand molecule, capable of directing the desensitizing compound to a specific cell involved in a hypersensitive response to ectoparasite saliva products.

Suitable ligands with which to bind or bind a desensitizing compound may include, for example, at least a portion of an immunoglobulin molecule, cytokines, lectins, heterologous allergens, CD8 molecules or major histocompatibility molecules (eg, MHC molecules, Class I, or MHC Class II). Preferred portions of the immunoglobulin molecule for linking the desensitizing compound include variable regions capable of binding to specific molecules of the surface of the immune cell and constant regions capable of binding to Fc receptors in immune cells, in particular IgE constant regions. Preferred CD8 molecules include at least the extracellular functional domains of the a chain of CD8. An "immune cell" refers to a cell involved in an immune response, in particular, cells that have MHC, Class I, or MHC Class II molecules. Preferred immune cells include cells that present antigens, T cells and B cells. In one aspect or form, a therapeutic composition of the present invention includes ectoparasite saliva products of the present invention, or mimetopes or the like. Preferred therapeutic compositions include preparations or formulations comprising ectoparasite saliva extracts or at least one ectoparasite saliva product (preferably protein) of the present invention, or mimetics thereof.

Suitable therapeutic compositions of the present invention for treating flea allergy dermatitis include flea saliva extract and other preparations or formulations, including at least one product of flea saliva, preferably a protein, or a mimetic of the same Preferred therapeutic compositions include FS-1, FS-2 and / or FS-3, as well as at least a portion of a flea saliva product which can be isolated from FS-1, FS-2 and / or FS- 3. As such, the * ~) Preferred preparations or formulations for use as therapeutic compositions include FS-1, FS-2, FS-3, and / or at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspN1, fspN2 and fspN3, or homologs thereof. A more preferred flea saliva extract for use as a therapeutic composition includes FS-1, FS-2, FS-3, and / or at least a portion of one or more of the proteins fspE, fspF, fspGl, fspG2, fspG3 , fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. An even more preferred flea saliva extract for use as a therapeutic composition includes FS-1, FS-2, and / or at least a portion of one or more of the proteins fspGl, fspG2, fspG3, fspH, fspMl, fspM2, fspNl, fspN2 and fspN3. In another embodiment, a therapeutic composition may include ectoparasite products of the present invention associated with a convenient excipient. A therapeutic composition of the present invention can be formulated in an excipient that the animal to be treated can tolerate. Preferred excipients are capable of maintaining a product of the present invention in a form that is capable of being bound by cells involved in the allergic response in an animal, such that the cells are stimulated to initiate or enhance an immune response. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous solutions physiologically balanced in salt. Nonaqueous vehicles or excipients, such as fixed oils, sesame oil, ethyl oleate, or triglycerides, may also be used. Other useful preparations or formulations include suspensions containing viscosity improving agents, such as sodium carboxymethyl cellulose, sorbitol or dextran. The excipients may also contain minor amounts of additives, such as substances that improve isotonicity and chemical stability. Examples of regulators include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of prophylactics include thiol, m-or o-cresol, formalin and benzyl alcohol. The standard preparations or formulations can be injectable or solid liquids which can be taken in a convenient liquid, such as a suspension or solution for injection. Thus, in a non-liquid preparation or formulation, the excipients may comprise dextrose, human serum albumin, prophylactics, etc., to which sterile water or saline may be added prior to administration. In another embodiment, a therapeutic composition of the present invention may also comprise a carrier or adjuvant, although it should be noted that an advantage of the saliva products of the present invention is that adjuvants and / or transporters are not required for administration. Adjuvants are typically substances that generally improve the immune response of an antigen-specific animal. Suitable adjuvants may include, but are not limited to, Freund's adjuvant; other bacterial cell wall components; aluminum-based salts; calcium-based salts; silica; polynucleotides; toxoids; whey proteins; viral layer proteins; other preparations derived from bacteria; gamma interferon; blocking copolymer adjuvants, such as Hunter's Titermax adjuvant (Vaxcel * ®, Inc. Norcross, Georgia); Ribi adjuvants (obtainable from Ribi I-mmunoChem Research, S.A., Hamilton, Montana); and saponins and their derivatives, such as Quil A (obtainable from Superfos Biosector A / S, Denmark).

Transporters are typically compounds that increase the half-life of a therapeutic composition in the treated animal. Convenient carriers include, but are not limited to, polymer controlled release preparations, biodegradable implants, liposomes, bacteria, viruses, ester oils, glycols. One embodiment of the present invention is a controlled release preparation that is capable of slowly releasing a therapeutic composition of the present invention into the bloodstream of an animal. Suitable controlled release preparations include, but are not limited to, biocompatible polymers (including biodegradable), other polymer matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, fusion devices, liposomes, lipospheres, and transdermal administration. Other controlled release preparations of the present invention include liquids which, when administered to the animal, form a solid or a gene in situ. The present invention also includes a therapeutic composition of recombinant virus particle. Such a composition includes a recombinant molecule of the present invention that is enveloped in a viral layer, and that can be expressed in an animal after administration. Preferably, the recombinant molecule is deficient in the envelope. A number of recombinant virus particles can be used, including, but not limited to, those based on alphaviruses, poxviruses, adenoviruses, herpesviruses, and retroviruses. Preferred recombinant particle viruses are those based on alphaviruses (such as Sindbis), herpesviruses and poxviruses. Methods for producing and using recombinant virus particle vaccines are described in United States Patent Application No. 08/015/414, filed on February 8, 1993, entitled 'V *' "Recombinant Virus Particle Vaccines", which is incorporated herein by reference in its entirety. When an animal is administered a therapeutic composition of recombinant virus particle of the present invention, it infects cells within the immunized animal and directs the production of a protective protein or a nucleic acid RNA molecule, which is capable of protecting the animal of allergic dermatitis caused by bites of ectoparasites. For example, a recombinant virus particle comprising a nucleic acid molecule 0 encoding one or more ectoparasite salivary proteins of the present invention is administered according to a protocol that results in tolerance of an animal against ectoparasitic saliva allergens. The therapeutic compositions of the present invention can be sterilized by conventional methods that do not result in protein degradation (eg, filtration) and / or lyophilization. A therapeutic composition of the present invention can be administered to any animal susceptible to ectoparasite infestation, as described herein. The acceptable protocols by which the therapeutic compositions of the present invention are administered in an effective manner may vary according to the individual size of the dose, the number of doses, the frequency of dose administration, and the mode of administration. The •? The determination of such protocols can be carried out by experts in this area of technology. An "effective dose" refers to a dose capable of treating an animal against hypersensitivity to ectoparasite saliva allergens. Effective doses may vary depending on, For example, the therapeutic composition used, the anthropod from which the composition was derived, and the size and type of recipient animal. Effective doses to immunomodulate an animal against ectoparasite saliva allergens include doses administered over time that are capable of relieving a hypersensitive response of an animal to ectoparasite saliva allergens. For example, a first dose for creating tolerance may comprise an amount of a therapeutic composition of the present invention that causes a minimal hypersensitive response when administered to a patient. hypersensitive animal. A second dose to create tolerance may comprise a greater amount of the same therapeutic composition as the first dose. Effective doses for causing tolerance may comprise increasing concentrations of the therapeutic composition necessary to make an animal tolerant, and that the animal does not have a hypersensitive response to the bite of an ectoparasite. Effective doses of desensitizer may include repeated doses having concentrations of a therapeutic composition that causes a minimal hypersensitive response when ^ í > administers to a hypersensitive animal. An appropriate single dose is a dose that is capable of treating an animal against hypersensitivity to ectoparasite saliva allergens when administered one or more times over a convenient period of time. For example, a dose The preferred sole of an ectoparasite saliva product, or therapeutic composition, is at about 0.5 nanograms to about 1 gram of the therapeutic composition per kilogram of body weight of the animal. Additional treatments with the therapeutic composition may administered from about 1 hour to 1 year after the original administration. Additional treatments with the therapeutic composition are preferably administered when the animal is no longer protected from hypersensitive responses to the ectoparasite. Particular doses and schemes The administration can be developed by a person skilled in this area of technology based on the parameters discussed above. The modes of administration may include, but are not limited to, the subcutaneous, intradermal, intravenous, nasal, oral, transdermal or transdermal and intramuscular routes. A therapeutic composition of the present invention may be used in conjunction with other compounds capable of modifying the hypersensitivity of an animal to ectoparasite bites. For example, an animal can be treated with compounds capable of modifying the function of a cell involved in a hypersensitive response, compounds that reduce allergic reactions, such as by systemic or anti-inflammatory agents (e.g., antihistaminics, anti-steroidal, anti-inflammatory, and directing agents). the class of heavy chain immunoglobulin to be changed from IgE to IgG). Conveniently useful compounds for modifying the function of a cell involved in a hypersensitive response include, but are not limited to, antihistamines, sodium comolin, theophylline, cyclosporin A, adrenaline, cortisone, compounds capable of regulating cellular transduction signals, capable compounds of regulating the 3 ', 5' adenosine cyclic phosphate cavity (AMPc), and compounds that block IgE activity, such as IgE peptides or IgE specific Fc receptors, antibodies specific for IgE peptides, or IgE receptors. IgE-specific Fc, or antibodies capable of blocking IgE binding to Fc receptors. Another aspect of the present invention includes a method for prescribing the treatment of animals susceptible or having allergic dermatitis, using a preparation or formulation of the present invention. A preferred method of prescribing a treatment for flea allergy dermatitis, for example, comprises: (1) intradermally injecting an animal at a site with an effective amount of a preparation or formulation containing at least one salivary antigen from flea of the present invention, or mimetic thereof (convenient and preferred preparations or formulations are described herein); (2) intradermally injecting in the animal in a second site an effective amount of a control solution; (3) evaluate if the animal has flea allergy dermatitis by measuring and comparing the size of the wheal resulting from the injection of the preparation or formulation with the size of wheal resulting from the injection with the control solution; and (4) prescribe a treatment for flea allergy dermatitis. A preferred alternative method of prescribing for flea allergy dermatitis comprises: (1) contacting a first portion of a sample of body fluid obtained from an animal to be studied with an effective amount of a preparation or formulation containing thereby less a flea salivary antigen, or a mimetope thereof (convenient and preferred preparations or formulations are described herein) to form a first immune complex solution; (2) contacting a positive control antibody to form a second immune complex solution; (3) evaluate if the animal has flea allergy dermatitis by measuring and comparing the amount of immune complex formed in the first and second solution; and (4) prescribe a treatment for flea allergy dermatitis. It should be noted that similar methods can be used to prescribe treatment for allergies caused by other ectoparasites, using the preparations or product formulations of ectoparasite saliva described herein. Another aspect of the present invention includes a method for controlling susceptible animals, or having allergic dermatitis, using a preparation or formulation of the present invention. In vivo and in vitro tests of the present invention can be used to study animals with allergic dermatitis prior to treatment, or to follow any treatment of allergic dermatitis. A preferred method for controlling the treatment of flea allergy dermatitis (which can also be adapted to control the treatment of other ectoparasite allergies) comprises: (1) intradermally injecting an animal at a site with an effective amount of a preparation or formulation containing at least one flea saliva product, or a mimetope thereof (convenient and preferred preparations are described herein); (2) intradermally injecting the animal in a second site with an effective amount of a control solution; and (3) determine whether the animal is desensitized to the antigens of flea saliva by measuring and comparing the size of the wheal resulting from the injection of the preparation or formulation with the size of wheal resulting from injection of the control solution. A preferred alternative method for monitoring the treatment of flea allergy dermatitis (which can be adapted to monitor or control treatments of allergies to other ectoparasites) comprises: (1) contacting a first portion of a body fluid sample obtained from an animal to be studied with an effective amount of a preparation or formulation containing at least one flea saliva antigen, or a mimetope thereof (the preferred and preferred preparation or formulation are described herein) to form a first complex solution immune; (2) contacting a positive control antibody to form a second immune complex solution; and (3) determining whether the animal is desensitized to the antigens of flea saliva by measuring and comparing the amount of immune complexes formed in the first and second immune complex solutions. The present invention also includes antibodies capable of selectively binding the ectoparasite saliva product or mimetic thereof. Such an antibody refers herein to an antiproduct antibody to ectoparasite saliva. As used herein, the term "selectively bind" refers to the ability of such an antibody to be preferentially ligated to an ectoparasite saliva product or mimetope thereof, in particular, the present invention includes antibodies capable of selectively binding to saliva products of flea The ligation can be measured using a variety of methods known to persons skilled in this area of technology, including immunoblotting assays, immunoprecipitation assays, enzyme immunoassays (e.g., ELISA); radioimmunoassays, immunofluorescent antibody assays and immunoelectron microscopy; see, for example, Sambrook et al., ibid. The antibodies of the present invention may be polyclonal or monoclonal antibodies. Antibodies of the present invention include functional equivalents, such as fragment antibody and genetically engineered antibodies, including single chain antibodies, which are capable of selectively binding to at least one of the epitopes of the protein or mimetic used to obtain the antibodies . Preferred antibodies are produced, with respect to the ectoparasite saliva proteins or mimetic thereof. More preferred antibodies are produced, with respect to at least one ectoparasite salivary protein or mimetope thereof, having at least a portion of an ectoparasite salivary protein eluted from the collection means of the present invention. Even more preferred antibodies are produced with respect to at least one flea saliva product, or homologues thereof (e.g., the saliva products of other ectoparasites), contained in the saliva extract FS-1, FS-2 and / ó FS-3. The most preferred ectoparasite salivary proteins for producing antibodies include at least a portion of one or more of the proteins fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, L2, fspMl, fspM2, NI, N2 and fspN3, or homologs thereof. Preferably, an antibody of the present invention has a unique site binding affinity for a flea saliva product of the present invention ranging from about 103M-1 to about 1012M_1. A preferred method for producing antibodies of the present invention includes administering to the animal an effective amount of an ectoparasite saliva product, or mimetope thereof, to produce the antibody and recover the antibodies. Antibodies raised against defined products or mimetics may be advantageous, because such antibodies are not substantially contaminated with antibodies against other substances that may otherwise cause an interference in a diagnostic assay or cause side effects if used in a therapeutic composition. The antibodies of the present invention have a variety of potential uses that are within the scope of the present invention. For example, such antibodies can be used (a) as vaccines to passively immunize an animal, in order to protect it from allergic dermatitis, (b) as positive controls in test kits, and / or (c) as tools to recover ( extract) desired ectoparasite saliva products from a mixture of proteins or other contaminants. The following examples are provided for purposes of illustration and are not intended to limit the scope of the present invention.

EXAMPLES Examples 1 This example describes the collection of flea saliva proteins using a saliva collection apparatus of the present invention. A saliva collection device was prepared as indicated below. Referring to Figures 4A and 4B, humidification means (349 including about 4 pieces of VWR # 320 bearings (VWR, Denver, Colorado) were adapted to the inner diameter (about 47 millimeters in diameter) of a chamber ( 6) of a saliva collection apparatus 2. The bearings were pre-wetted using a sufficient amount of pre-wetting solution (sterile water containing 50 units / milliliters of penicillin, and 60 micrograms / milliliters of streptomycin, available from Sigma, St. Louis, Missouri), such that the bearings are wet, but not wet, dripping.The pre-moistened filters (34) were placed inside the lower end (22) of the chamber (6) of the saliva collection apparatus (2), such that the filter paper will sit immediately within the lower termination (22) of the chamber (6). The collection means (24) consisting of a Durapore * 11 * membrane (available through Milli) pore, Bedford, Massachusetts) were cut to fit the outer diameter (about 48 millimeters in diameter) of the chamber (6) of the saliva collection apparatus (29. The Durapore ™ membrane was pre-wetted using the pre-wetting solution described above. The Durapore * 11 * (24) membrane was immediately placed outside the lower termination (22) of the chamber (6), so that the Durapore * * * membrane (24) contacts the outer edge of the lower termination (22) of the chamber (6), and also contact the wet filter paper 5. The barrier means consisting of a piece of stretched Parafilm ™ (28) (available through American National CanMR, Greenwich, Connecticut) was stretched over the media of collection (24) and the lower termination (22) of the chamber (6), and up of the outer wall (30) of the -, - 5 camera (6). A rubber seal (32) (eg, a 0-ring) was placed on the Parafilm ™ (28), thereby, further securing the Parafilm ™ (28) through the collection means (24) and the outer wall (30), and to seal the chamber environment (6). The collection apparatus (2) was preassembled, and then the upper termination (20) of the chamber (6) was included in an artificial feeding system capable of acting as a source of heat and moisture, as described in FIG. Wade et al. (Ibid.). The system of The artificial feed comprises a large plexiglass box (40 centimeters x 40 centimeters x 40 centimeters) divided horizontally in an upper compartment and a lower compartment by a plexiglass shelf, which has been perforated. A collection device (2) was inserted into a hole such that the chamber (6) of the apparatus (2) was located above the shelf in the upper compartment, and the structure (4) was located below the shelf in the lower compartment. The apparatus (2) was secured to the shelf by attaching a rubber band attached to the metal hooks placed on the shelf. Any of the holes opened on the shelf were closed using rubber plugs to isolate the environment inside the upper compartment of the room inside the lower compartment. The upper compartment contains two water trays, a fan and a heating block. The water trays were placed in such a way that the fan looks at the trays. While the apparatus (2) was maintained in the artificial feeding system, the fan continuously blew the heat and humidity circulating along the upper compartment and the chamber (6) of the collection apparatus (2). As such, the relative humidity inside the chamber (6) was maintained at about 94 percent humidity, and the temperature was maintained at about 73 ° C. Approximately 3,000 to 5,000 fleas Ctenocephalides felis recently born, not fed, were added to the structure (4) of the collection apparatus (2). The fleas were first collected in a 20-gallon aquarium tank. The fleas were then transferred to the structure (4) of the collection apparatus (2), placing the termination of the structure (4) having the nylon mesh of the exchange means (16) on top of a vacuum chamber, and sucking the fleas from the aquarium tank to the structure (4) by means of a typhoon tube. The structure (4) was then covered with the nylon mesh of the retaining means (18) to secure the fleas within the structure (4). The lower termination (22) of the chamber (6) was then placed on the structure (4), such that the Parafilm * 11 * (28) and the nylon mesh of the retaining means (18) were juxtaposed. When the harvesting apparatus (2) was included in the artificial feeding system, the ambient temperature within the structure (4) was maintained at about 27 ° C, while the ambient temperature of the chamber (6) was maintained at about of 37 ° C. The relative humidity of the house (4) was maintained at around 50%, closing the lower compartment with the plexiglass dividing shelf. In one experiment, flea saliva products were collected on a Durapore ™ membrane (24), and visualized by immersing the membrane in 0.1 percent Coomassie Blue for 20 minutes, removing the membrane mark at 50 percent of methanol, and air drying the membrane. The proteins deposited on the membrane were detected by their blue color. In another experiment, flea saliva products were harvested from hour 0 to hour 24, and then from 24 hours to 72 hours, and from 72 hours to 120 hours, after loading the fleas into the apparatus of collection. At 24 hours, 72 hours and 120 hours, the Durapore * ® membrane (24) included in the collection apparatus (2) was removed, and a new membrane of Durapore * ^ pre-wetted (24) was included in the same apparatus. The bearings were rewetted using the pre-wetting solution described above, when the new Durapore ™ membrane (24) was replaced. The flea saliva products were extracted from the Durapore * 11 * membrane (24) by wetting each membrane separately for each point in time in a solvent comprising 50 percent acetonitrile with 1 percent TFA overnight at room temperature, stirring to obtain a flea saliva product mixture comprising flea saliva products that had been eluted in the solvent. The mixture containing the flea saliva products was recovered and lyophilized until it was dry to form a granule. The quantity and characteristics of flea saliva proteins eluted from each Durapore ™ membrane from each point in time was determined by SDS-PAGE Tris-glycine, 14 percent reducing, using techniques similar to those described by Sambrook et al., Ibid. The resulting protein standard was visualized by means of Coomassie Blue in the gel, using techniques such as those described above. The amount of saliva proteins collected in the membranes decreased when the fleas were in the collection apparatus for more than 72 hours.

EXAMPLE 2 Standard procedures for collecting flea saliva extracts FS-1, FS-2 and FS-3 of the present invention were performed as indicated below. The flea saliva products were harvested for 72 hours in the collection membranes, using the methods described in Example 1, except that for the flea saliva extract FS-3, the collection membrane was DE-81 chromatography paper. , available through Whathan, Inc., Clifton, New Jersey.

A. Flea Saliva Extract FS-1 v FS-2 Flea saliva products were extracted from the Durapore ™ membrane (24)wetting each membrane separately for each point in time in a solvent comprising 50 percent acetonitrile with 1 percent TFA for 8 hours. The first mixture containing the flea saliva products eluted was recovered and lyophilized until it was dry, and thus form a first granule. The same membranes were then soaked in a second solvent, consisting of 50 percent acetonitrile with 1 percent TFA overnight at room temperature, stirring to obtain a flea saliva product mixture, which comprises saliva products of flea that had been eluted into the second solvent. The second mixture was recovered from this second extraction and lyophilized until dry and formed a second granule. The two granules recovered from the two lyophilization steps were mixed with a third solvent consisting of 12.8 percent acetonitrile, and the flea saliva products solubilized in the solvent were recovered. The non-solubilized material was again mixed with 12.8 percent acetonitrile, and the additional flea saliva product solubilized in the solvent was recovered. The two mixtures were combined to obtain the FS-1 extract. The non-solubilized material remaining after the second solubilization step was then mixed with 50 percent acetonitrile, which solubilized the remaining material to obtain the FS-2 extract. The quantity and characteristics of flea saliva proteins contained in flea saliva extracts FS-1 and FS-2 obtained in at least one experiment were determined according to the following method. Each extract was concentrated by vacuum evaporation, and evaluated by SDS-PAGE, 16 percent, Tris-glycine, under reducing conditions, using techniques similar to those described by Sambrook et al., Ibid. Using such standard procedures, about 10 milligrams of FS-1 or FS-2 eluded from a Durapore1® membrane was loaded onto a polyacrylamide gel in 16 percent Tris-glycine, and subjected to electrophoresis under reducing conditions. The gel was stained with Coomassie Blue and dried. The results are shown in Figure IB. The FS-1 is shown on the track 13 of Figure IB, and FS-2 is shown on the track 14 and 15 of Figure IB. It was found that FS-1 contained estimated proteins having the following molecular weights: 9 kD, 11 kD, 12 kD, 15 kD, 22 kD, 48 kD, 50 kD, 53 kD, 80 kD, 124 kD, 130 kD, 189 kD and 201 kD. The 80 kD up proteins were much fainter than the lower molecular weight bands. FS-2 was found to contain proteins having the following molecular weights: 47 kD, 49 kD, 52 kD, 57 kD, 64 kD, 71 kD, 88 kD, 96 kD, 97 kD, 130 kD, 161 kD, 175 kD , 189 kD, 222 kD, 235 kD and 320 kD. The bands at 47 kD, 49 kD and 52 kD were more prominent than bands having higher molecular weights. The results suggest that a substantial portion of the protein contained in FS-2 is fspNl, fspN2 and / or fspN3. Protein concentrations were measured using a Bio-Rad Bradford assay (available through Bio-Rad, Hercules, California). The results indicate that about 750 milligrams of protein can be collected at about 3.66 x 107 flea hours (5.08 x 105 fleas per 72 hours) in an FS-1 extract, and approximately 2.35 5 milligrams of protein can be collected at about 3.66. x 107 flea hours in an FS-2 extract.

B. Saliva Extract from Pul to FS-3 Flea saliva products to produce a _, FS-3 flea saliva extract were collected in a manner similar to the method by which FS-2 and FS-2 were collected, except that the collection membrane (24) was DE-81 chromatography paper. The flea saliva products were extracted from the DE-81 membrane by wetting each membrane 5 separately for each point in time in a solvent comprising ÍM NaCl in phosphate buffered saline for about 8 hours. The products were recovered from the solvent using standard techniques, such as described for FS-1 and FS-2. 0 Analysis of flea saliva extract FS-3 indicated that FS-3 appeared to contain proteins, such as those found in FS-1 and FS-2, at least on the basis of a one-dimensional electrophoresis. The SDS-PAGE profile of FS-3, for example, was very similar to that of FS-1, except that in the FS-3 extract the amounts of the highest molecular weight proteins appeared to have increased. FS-3 flea saliva extract showed, using standard techniques in the art, also to have anticoagulation activity, see, for example, Dunwiddle et al., 1991, Thrombosis Research 64, 787-794; Ribeiro et al., 1990, Comp. Biochem. Physiol, 95, 215-128; Ribeiro et al., 1990, Br. J. Pharmacol. 101, 932-936; Ribeiro et al., 1987, Ex per. Parasitol. 64, 347-353; Cupp et al., 1994, Am. J. Trop. Med. Hyg. 50, 241-246; García et al., 1994, Exper. Parasitol. 78, 287-293. The FS-3 extract also showed, using technical standards in the area of this technology, to exhibit acid phosphatase activity, with acid phosphatase assay from Sigma Chemical (supplied by Sigma, St. Louis, Missouri).

EXAMPLE 3 This example describes the HPLC characterization of the flea saliva proteins harvested using a saliva collection apparatus of the present invention. An FS-1 flea saliva extract was collected as described in Example 2, of around 140,000 fleas for 72 hours. The proteins contained in FS-1 were resolved using standard procedures of high pressure liquid chromatography (HPLC). Specifically, the proteins were passed through a C4 column of 15 centimeters x 0.46 centimeters, which uses 0.1 percent gradient of TFA in water (Solvent A) at 0.085 percent TFA in 90 percent CH3CN (Solvent B) at a flow rate of 0.8 milliliters per minute. Thus, the gradient was around 5.6 percent Solvent B in 15 minutes, and approximately 100 percent Solvent B in 75 minutes. The results are shown in Figure 2. Around 14 important protein fractions were resolved. The recovery for each peak was around 5 milligrams to 10 milligrams of protein per peak. The peaks were named peak A, peak B, peak C, peak D, peak E, peak F, peak G, peak H, peak I, peak J, peak K, peak L, peak M and peak N, as shown in Figure 2, and represent, respectively, the preparations or formulations of fspA, fspB, fspCl and fspC2, fspDl and fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl and fspJ2, fspK, fspLl and fspL2 , fspMl and fspM2, t fspNl, fspN2 and fspN3. Samples from each HPLC peak were resolved by SDS-PAGE gels Tris-glycine, using the method described in Example 1. The results are shown in Figures IA, IB and IC. The proteins illustrated in Figure IA and IB were resolved on SDS-PAGE gels Tris-glycine, 16 percent, and the proteins illustrated in Figure IC were resolved by SDS-PAGE gels Tris-glycine, 14%. The protein markers are shown in lane 1 of Figure IA, lane 2 of FIG. IB, and lane 1 of FIG. 1c. Additional clues are samples of saliva preparations, as indicated below: Figure ÍA Track Fraction FS- () 1) Molecular weight markers 2) 10 3) 11-13 A 4) 14 B 5) 15 B 15 6) 16 Cl 1) 17 C2 8) 18 DI 9) 19 DI 10) 20 D2 * »/) 11 ) 21 D2 12) 22 E 13) 23 F 14) 24 G 15) 25 G 25 Figure IB Track Fraction FS- () 1) 26-27 2) - Molecular weight markers 3) 28 H 4) 29-30 I 5) 31 J 6) 32 K 7) 33 K 8) 34 L 9) 35 Ml 10) 36-37 Ml 11) 38 Ml 12) 39-50 M2 13) - FS -1 14) - FS-2 15) - FS-3 Figure ÍC Track Fraction FS- () 1) Molecular weight markers 2) 56-58 N Referring to Figure IA, the following flea saliva proteins (referred to as bands) were observed: a prominent band of about 20 kD in samples of peaks A and B; an outstanding band of around 6 kD, and a less prominent band of about 9 kD in peak C of the sample referred to as Cl; an outstanding band of about 7 kD at peak C of the sample referred to as C2; an outstanding band of around 7 kD, and a less prominent band of 8 kD in order D of the sample referred to as DI; an outstanding band of about 8 kD, and a less prominent band of about 9 kD in the peak D of the sample referred to as D2; an outstanding band of around 8 kD, and a less prominent band of around 7 kD in the peaks E and F of the sample; and an outstanding band of around 9 kD, and less prominent bands of around 7 kD and lOkD in the G peak of the sample. Referring to Figure IB, the following flea saliva proteins were observed: a prominent band of about 9 kD, and a less prominent band of about 2 kD at the H peak of the sample; an outstanding band of around 21 kD, and less prominent bands of around 7 kD, 9 kD, 12 kD, 14 kD and 70 kD in peak 1 of the sample; prominent bands of around 14 kD and 21 kD, and less prominent bands of around 11 kD and 17 kD in the J peak of the sample; prominent bands of around 14 kD and 14 kD, and less prominent bands of around 12 kD, 18 kD and 21 kD in the K peak of the sample; an outstanding band of around 15 kD in the peak L of the sample; prominent bands of around 11 kD, 12 kD and 21 kD, and less prominent bands of around 15 kD, 17 kD, 22 kD and 37 kD in the M peak of the sample referred to as Ml; and an outstanding band of around 36 kD, and less prominent bands of around 11 kD, 21 kD and 22 kD in the M peak of the sample referred to as M2. Referring to Figure IC, prominent bands of around 42 kD, 43 kD and 44 kD, and a less prominent band of about 32 kD, were detected at the N peak of the sample.

Example 4 This example describes the amino acid sequence analysis of flea saliva proteins isolated and purified by HPLC. The analysis of amino-terminal amino acid (N-) sequence was performed on several of the HPLC-separated flea saliva proteins described in Example 3, using standard procedures known to experts in this area of technology (see, for example, Geisow et al., 1989, in Protein Sequencing: A Practical Approach, JBC Findaly and MJ Geisow (eds.), IRL Press, Oxford, England, pages 85-98; Hewick et al., 1981, J. Biol. Chem., Volume 256, pages 7990-7997). The partial N-terminal amino acid sequence of the fspA flea salivary protein, which migrated as peak A in Figure 2, was determined to be: Y G K Q Y S E K G G R G Q R H Q I L K K G K Q Y S S K I L K L S R as represented in the standard single-letter code. This N-terminal partial amino acid sequence of fspA is denoted in SEQ ID N0: 1. It should be noted that there is a heterogeneity in several positions that may represent sequence errors (eg, misidentification of amino acids), or allelic variations in the flea population, from which the saliva proteins were collected. There is an apparent likelihood of finding any of the alternative amino acids at the indicated positions. The partial amino acid sequence of the N-terminal flea saliva fspB protein, which migrated as peak B in Figure 2, determined to be S / QGKQYSEXG / SK, described in SEQ ID NO: 27. This amino acid sequence is essentially the same as, or at least a subset of, the amino acid sequence of the N-terminal obtained from flea saliva fspA protein. Sequence analysis of the G peak of proteins indicated the presence of three proteins in that peak, here referred to as fspGl, fspG2 and fspG3.The flea salivary protein fspGl has a molecular weight of about 9 kD, has a sequence of N-terminal amino acids of DRRVSK, described in SEQ ID NO: 28. This amino acid sequence of the N-terminus is the same as that of fspH, as shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 14. The flea salivary protein fspG2 has a molecular weight of about 7 kD, has a partial amino acid sequence of the N-terminus of SK MV TEKXKSGGNNPSTKEVSYOP, described in SEQ ID NO: 29. The flea salivary protein fspG3 has a molecular weight of about 6 kD, has a partial amino acid sequence of the N-terminus of EVSYOPSGKLTYOEDFXYOGN HQ, described in SEQ ID NO: 30. A comparison of SEQ ID NO: 30 with SEQ ID NO: 29 indicates that fspG3 it may be a product of proteolytic degradation of fspG2, as the last five amino acids of fspG2 are identical with those of the N-terminus of fspG3. The partial amino acid sequence of the N-terminus of the fspH flea salivary protein, which migrated as peak H in Figure 2, was determined to be: DRRVSKTXQSGGKIQSEXQVV YOKSGQH / YYOLENYXSDGR, described herein as SEQ ID NO: 14. Histidine and tyrosine they are equally likely at the amino acid position 27.

The fspH flea salivary protein was also subjected to proteolytic cleavage, in order to obtain internal amino acid sequence data. Specifically, fspH was disrupted with Endoproteinase Asp-N (available through Boehringer Mannheim Biochemica, Indianapolis, Indiana), using standard methods in the area of technology. The digested protein was then resolved by HPLC, using the method described by Stone et al. (IJid.). The profile of the resulting HPCL is shown in Figure 3. Three proteolytic fragments were isolated, they are referred to herein as fspHe, fspHh and fspHj. The N-terminus of the partial amino acid sequence of fspHe was determined to be DSKHCYCEAPYS, also described in SEQ ID NO: 3. The N-terminus of the partial amino acid sequence of fspHh was determined to be: DGRNNNNPCHLFC MR ECRSGNGGCGNGGRTRPDSKH C, also described in SEQ ID NO: 4. The N-terminus of the partial amino acid sequence of the fspHj was determined to be D RRV SKT CQ SG, also described in SEQ ID NO: 5. The comparison of SEQ ID NO: 5 with SEQ ID NO: 14 indicates that fspHj was the terminal fragment of fspH. By aligning SEQ ID NO: 14, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, the following amino acid sequence was inferred, starting at the N-terminus of fspH: DR RV SKTCQSGGKIQSEXQVVIKSG QH / YILENYXSDGRNNNNPCHLFC MRECRSGNGGCGNGGRTRPDS KHCYCEAP S. This amino acid sequence is noted in SEQ ID NO: 2, and is believed to represent the majority of fspH, since the molecular weight of a protein having this sequence is in about 8600 kD. The N-terminus of the amino acid partial sequence of flea salivary protein fspl, which migrated as peak I in Figure 2, was determined to be: E D I W K V N K K X T S G G K N Q D R K L D Q I I Q K G Q Q V X X Q N X X K, described as in SEQ ID NO: 6. The sequence analysis of the peak J protein indicates the presence of two proteins in said peak, which we refer to here as fspJl and fspJ2. The N-terminus of the partial amino acid sequence of flea salivary protein fspJl was determined to be: NSHEPGNTRKIREVMDKLRKQ HP, described herein as SEQ ID NO: 8. The proteins depicted in SEQ ID NO: 7 and SEQ ID NO. : 8 were not resolved separately by SDS-PAGE, which method is described in Example 1. The comparison of SEQ ID NO: 7 and SEQ ID NO: 8 suggests that the fspJl may be a truncated version of fspJ2, since the N-terminal amino acid partial sequence of fspJl could be very similar to that of fspJl, except that fspJl lacks the first 4 amino acids found in the N-terminus of fsp2. The existence of two proteins, specifically fspL1 and fspL2 was shown by subjecting the L peak to a C4 column of reverse phase chromatography, using 0.13 percent hepatafluorobutyric acid (Solvent A), and 0.1 percent heptafluorobutyric acid at 90 percent acetonitrile (Solvent B) with the following gradient format: a 80-minute gradient from 30 percent Solvent B to 70 percent Solvent B. The N-terminus of the partial amino acid sequence of fspLl separated by HPLC was determined to be: NDKEPGNTRKIRE VM DKL RK QAQPRTDGQRPKTXIM, also described in SEQ ID NO: 9. The N-terminus of the partial amino acid sequence for fspL2 was determined to be: XLXRNDKEPGNTRKIRE VM DK, also described in SEQ ID NO: 10. A comparison of SEQ ID NO: 9 and SEQ ID NO: 10 indicates that fspLl and fsp2 are similar proteins, except that fspLl has 4 amino acids less than e fspL2 in the N-terminus. The resolution of the proteins contained in the N-peak by SDS-PAGE, as described in Example 3, shows 3 distinct bands. Bands describe flea saliva proteins fspNl, fspN2 and fspN3. The N-terminus of the partial amino acid sequence of fspNl was determined to be: NDELKFVFVMAK, also described as contained in SEQ ID NO: 11. The N-terminal amino acid sequence of the fspN2 was determined to be: XDEKFVFVMAKGPSXQAXDYP C , also described as set forth in SEQ ID NO: 12. The N-terminus of the partial amino acid sequence of the fspN3 was determined to be: • OELKFVFATARGMSHTPCDYP, also described as shown in SEQ ID NO: 13. The comparison of the SEQ ID NO: 11 and SEQ ID NO: 12 suggest that fspNl and fspN2 share the same N-terminal sequence. The proteins fspNl and fspN2 migrate in a Differently when subjected to SDS-PAGE, however, the two proteins are likely to be different homologs, possibly because one of the proteins has a longer C-terminal domain and / or due to post-translational modifications. The comparison of the sequences of the SEQ ID NO: 13 to SEQ ID NO: 11 and SEQ ID NO: 12 suggest that fspN3 may be a homologue of fspNl and fsp2 with internal sequence variations. The flea saliva proteins of peak N were also subjected to proteolytic cleavage, in order to obtain internal data of the amino acid sequence.

Specifically, the proteins in the N peak were disrupted with Endoproteinase Asp-N (available through Boehringer Mannheim Biochemica, Indianapolis, Indiana) using standard methods in this area of technology. The digested protein was then resolved by HPLC, using the method described by Stone et al. (Ijid.) And sequenced as described above. A partial amino acid sequence of flea salivary proteins at the N peak, named fspN fragment (100-101) was determined to be: F D I E N I K K G E G G P P G G K E N N L S / L V L, described herein as SEQ ID NO: 31.

Example 6 This example describes the isolation of the nucleic acid sequence encoding at least portions of the flea salivary proteins fspH and fspl.

A. Description of Flea Libraries Fodder cDNA libraries fed and not fed were prepared using standard procedures. Briefly, about 3,000 to 4,000 fleas fed and about the same number of fleas not fed were collected separately, placed in a mortar and cooled with dry ice and milled until a fine powder was obtained. RNA from ground fleas was prepared by direct extraction using the guanidinium thiocyanate method, followed by centrifugation in cesium chloride gradients (see, for example, Sambrook et al., Ibid.). Gelatinous granules of RNA purified in cesium chloride were collected and dissolved in a sterile TE regulator (10 mM Tris-HCl, pH 7.6 and 1 mM EDTA) containing 0.1% sodium dodecyl sulfate. The dissolved granules were precipitated with the addition of 3 M sodium acetate, pH 5.2 to a final concentration of 0.2 mM and two volumes of absolute ethanol to remove the residual CsCl. Total RNA was fractionated for enrichment of the mRNA fraction using a FastTrack ™ kit (available, with procedures, through Invitrogen Corp., San Diego, California). The whole flea isolated mRNA was used directly for cDNA synthesis and molecular cloning. The cDNA synthesis and molecular cloning methods were provided in the Lambda Zap-cDNA synthesis kit (available through Stratagene, Inc., La Jolla, California). Next, the list of flea cDNA libraries prepared which have indicated the total number of packed plate units (PFU) packaged is described: (a) cDNA expression libraries of two whole fleas fed, referred to as Library C (about 2.5) x 10 ° PFU) and Library H (about 1.3 x 10 ° PFU); (b) a cDNA expression library of a whole flea not fed (about 1.3 x 10 ° PFU); (c) a cDNA expression library of a flea salivary gland prepared from approximately 6,000 salivary glands collected from fleas fed and not fed (about 1.5 x 10 ° PFU); and (d) a cDNA expression library from the midgut of a fed flea was prepared from approximately 5000 isolated middle intestines (about 2.3 x 10 ° PFU).

B. Isolation of a Nucleic Acid Molecule Coding fspH A nucleic acid molecule encoding a portion of the fspH flea salivary protein was identified using the flea salivary gland cDNA expression library described in Example 6A. The degenerate synthetic oligonucleotide primers were designed from the inferred amino acid sequence for fspH (see Example 4). Three synthetic oligonucleotides were synthesized. They corresponded to the region of fspH that goes from around residue 38 to 51 of the sequence SEQ ID NO: 2: Primer 1, a sensitive primer corresponding to amino acid residues ranging from about 38 to around residue 44 of SEQ ID NO: 2, has the following nucleic acid sequence: 5 'AAT (C) AAT (C) AAT ( C) AAT (C) CCT (GAC) TGT (C) CA 3 ', and is described in the sequence SEQ ID NO: 15. Primer 2, an antisense primer corresponding to amino acid residues ranging from around the residue 46 to approximately residue 51 of the sequence SEQ ID NO: 2, has the following nucleic acid sequence: 5 'CA C (T) TC C (TAG) CT (G) CAT G (A) CA G (A) AA 3 'and is described in the sequence SEQ ID NO: 16. Primer 3, a sense corresponding to amino acid residues ranging from residue 43 to approximately residue SEQ ID NO: 2, has the following sequence of nucleic acids: 5 'TGT (C) CAT (C) T (C) TG (ATC) TTT (C) TGC (T) ATG-3' and is described in the sequence SEQ ID NO: 17. A fourth primer, Primer 4 was synthesized and corresponds to the carboxyl region of fspH, specifically it goes from around residue 69 to around residue 76 of sequence SEQ ID NO: 2. Primer 4, an antisense primer, has the following nucleic acid sequence: 5ß GGA (CGA) GCT (C) TCA (G) CAA (G) TAA (G) CAA (G) TGT (C) TT '3', and is described in the sequence SEQ ID NO: 18. The PCR amplification of the fragments of the Flea salivary gland library was performed using standard techniques. The PCR amplification products were generated using the combination of Primer 1 and the universal standard primer M135 'GTAAAACGACGGCCAGT 31, which is described in the sequence SEQ ID NO: 19. The resulting PCR amplification products were used for a nested PCR using Primer 3 and Primer 4. The resulting PCR product, a fragment of 101 nucleotides described as nfspHlOl, was cloned into the TAMR cloning vector of Invitrogen, Corp. (the procedures were provided by Invitrogen, Corp.) and subjected to analysis of DNA sequence using standard techniques. The resulting nucleic acid sequence is described in SEQ ID NO: 20: T TGT CAC TTT TTT TGT ATG AGA GAA TGC AGG TCA GGA AAC GGC GGT TGC GGA AAC GGA GGA AGG ACA AGA CCT GAT TCG AAG CAC TGC TAT GC (the sequences derivatives of the primer appear in darker letters). The 60 internal sequence nucleotides not derived from the primer code for 20 amino acids of fspH, going from around residue 48 to around residue 68, according to the numbering described in SEQ ID NO: 2. Using standard techniques, the nucleic acid molecule nfspHlOl it can be used as a control or test to isolate a nucleic acid molecule encoding a protein that corresponds to the complete or a larger partial protein fspH.

C. Isolation of a Nuleic Acid Molecule Encoding fspl The amino acid sequence of fspl (SEQ ID NO: 6) described in Example 4 was used to design a set of synthetic oligonucleotide primers degenerated from the PCR amplification. The degenerate primer 5, a sensitive primer corresponding to residues ranging from residue 1 to around 8 of sequence SEQ ID NO: 6, has the following nucleic acid sequence: 51 GAA (G) GAT (C) ATT (CA) TGG -AAA (G) GTT (CAG) AAT (C) AA 3 ', described in SEQ ID NO: 21. Degenerate primer 6, a sensitive primer corresponding to the residues that go from around the residue 11 to around residue 18 of the sequence SEQ ID NO: 6, has the following nucleic acid sequence: 5 'ACT (CGA) TCT (CGA) GGT (CGA) GGT (CGA) AAA (G) AAT (C) CAA (G) GA 3 ', described in SEQ ID NO: 22. Primers 5 and 6 were used in combination with the vector primers BSKX (5' TTGGGTACCGGGCCCCCCCT 3 ', SEQ ID NO: 23) and the primer M13 described in the sequence SEQ ID NO.19 in order to generate PCR extension products. The PCR products were cloned into the TAMR cloning vector of Invitrogen, Corp. (the procedures were provided by Invitrogen, Corp.) and subjected to DNA sequence analysis using standard techniques. A analyzed cloning product, called nfspl573, contains a product of 573 nucleotides that corresponds, at least in part, to the partial amino acid sequence determined for fspl. The nucleotide sequence of nfspI573 is described in SEQ ID NO: 24. The translation of SEQ ID NO: 24 yields the following longer open reading frame, described in SEQ ID NO: 25. By means of the combination of the N-terminal of the partial sequence of fspl (SEQ ID NO: 6) with the protein sequence described in SEQ ID NO.25 inferred from the nucleic acid sequence described in SEQ ID NO.24, it is possible to obtain an apparent complete amino acid sequence for fspl, described in SEQ ID NO.26.

Example 7 This example further describes the isolation of the nucleic acid sequence encoding at least portions of the flea salivary proteins fspH and fspl.

A. Enlargement of a Nucleic Acid Molecule Encoding fspH The DNA sequence determined from the carboxy terminal PCR product (SEQ ID NO: 20) in Example 6B was used to synthesize two non-degenerate synthetic homologous primers: The Primer 7, 5 'CCT GAC CTG CAT TCT CTC ATA C 3', described in the sequence SEQ ID NO: 38, and the primer 8,5 'AGG TCT TGT CCT TCC TCC GTT TCC GCA 3 •, described in the sequence SEQ ID NO: 39 The primer 8 was used in combination with the reverse primer M135 'GGAAACAGCTATGACCATG 3', described in the sequence SEQ ID NO: 40, to extend the 5 'terminal portion of the fspH gene from a fraction of the cDNA expression library of the salivary gland described above in Example 6A using standard techniques. The resulting PCR product, although not clearly visible on the gel, was identified as a single product by Southern hybridization, using radiolabelled primer [32 P] as a test. A clearly visible PCR product labeled with ethidium bromide was obtained by performing a nested PCR reaction using primer 7 and primer vector T3, 5 'ATTAACCCTCACTAAAG 31, described in the sequence SEQ ID NO: 41. The approximately 400-bp product was clearly visible on a 1% agarose gel and was positive in hybridization with marked degenerate Primer [32 P] (SEQ ID NO: 15). A partial, 242-bp, nucleotide sequence of the fspH product (400-bp), called nfspH242 is described in SEQ ID NO: 32. The translation of SEQ ID NO: 32 yields the amino acid sequence, named PfspHdO described in SEQ. ID NO: 33 B. Enlargement of a Nucleic Acid Molecule Encoding fspl Two additional primers were made to isolate the cDNA sequence of the protein fspl of the flea salivary gland library prepared as described in Example 6A. The isolation procedure used reiterative PCR from the flea salivary gland library and the hybridization tests to the product generated by PCR. Repetition of the PCR on fractions of the flea salivary gland library (the mini-libraries) reduced the frequency of occurrence of the cloned cDNA of fspl protein to approximately 1 in 200 units forming plates (PFU) before a final plate was lifted and identification by Hybridization with a test marked with [32P]. Two primers based on SEQ ID NO: 24 were used: Primer 9, 5 'GCA AAG GTT ATA GAG GAG CTT G 3', described in the sequence SEQ ID NO: 42, and Primer 10, 5 'AGC TTT CCA TCA CAT CCA GC 3', described in the sequence SEQ ID NO: 43. The primers generated an internal DNA sequence by 268bp PCR (including primers) which was used as a tag sequence to monitor salivary gland mini-libraries. The final monitoring of the salivary gland mini-libraries was performed with a group of four primers marked with [32P]; Primer 5, SEQ ID NO: 21, Primer 6, SEQ ID NO: 22, Primer 8, SEQ ID NO: 42 and Primer 10, SEQ ID NO: 43, using standard techniques. A nucleic acid molecule, named nfspI591, was identified by this technique and was sequenced using standard techniques to give the sequence described in SEQ ID NO: 34. The translation of SEQ ID NO: 34 produces the amino acid sequence described as SEQ ID NO. : 35, for a protein called Pfspl155. This amino acid sequence is similar to SEQ ID NO: 26, except that SEQ ID NO: 35 does not contain the amino acid sequence E D I at the amino terminus, and SEQ ID NO. 35 contains a residue "C" in the position 7, while SEQ ID NO: 26 has a residue "L" in the same position.

Example 8 This example demonstrates the ability of a preparation or formulation of the present invention to induce flea allergy dermatitis in an animal susceptible to flea allergy dermatitis. To determine whether the isolated flea salivary proteins described in Examples 2 and 3 were capable of inducing an allergic response in animals susceptible to flea allergy dermatitis, skin tests of sensitized dogs were performed. Six dogs were sensitized to fleas using the method of Gross, et al., 1985, Veterinary Pathology, Vol. 22, p. 78-71. Briefly, each dog was exposed to about 25 C. felis fleas held in chambers allowing fleas to feed on experimental dogs for periods of approximately 15 minutes at weekly intervals. The six dogs were sensitized during the following periods: The dog 2080109 was exposed to fleas 38 times over a period ranging from August 31, 1993 to June 7, 1994. Dog 2082101 was exposed to fleas 22 times in a period that goes from December 14, 1993 to June 7, 1994. The dog 2082128 was exposed to fleas 20 times in a period that goes from August 31, 1993 to May 24, 1994. The dog BFQ2 was exposed to fleas 17 times in a period from March 15, 1994 to July 12, 1994. Dog CP02 was exposed to fleas 12 times in a period from March 15, 1994 to on June 7, 1994. The dog CQQ2 was exposed to the fleas 1 time on March 15, 1994. The skin tests were performed on the morning of July 21, 1994. The dogs were shaved on the lateral thorax / abdominal area and injected intradermally in that area with a variety of preparations or formulations of the present invention, as well as with control solutions. The total volume per injection was 50 microliters (μl), with the formulas and controls being diluted in phenolated saline solution. Each dog received the injections numbered in Table 1.

Table 1. Samples administered to dogs.

DUPLICATE SAMPLE μs / HORA-PULGA injection DGLUENTE 2 N / A * N / A HIST AMINA 2 1.38 N / A GREER 50 (P / v) N / A FS-1 1.88 4,660 A * 0.23 23,000 B J 0.32 23,000 Cl 1.10 ** 23,000 C2 0.42 23,000 DI 0.24 23,000 D2 J 0.29 23,000 E 0.16 23,000 F 0.10 23,000 G 3 0.21 23,000 H 3 0.20 23,000 I - > J 0.12 23,000 J J 0.08 23,000 K - J 0.12 23,000 L - * 0.08 23,000 Ml - »0.16 23,000 M2 3 0.27 23,000 N - j 0.20 23,000 FS-2 0.71 4,660 * N / A is not applicable * * Apparent amount, probably artificially high due to interfer in the trial Note that in these studies, fspJl and fspJ2 were administered together as the fspJ; fspLl and fspL2 were administered together as fspL; the fspNl, fspN2 and fspN3 were administered together as fspN. It should also be noted that A, B Cl, C2, DI, D2, E, F, G, H, I, J, K, L, Ml, M2 and N refer, respectively, to the fspA flea salivary proteins, fspB, fspCl, fspC2, fspDl, fspD2, fsp3, fspF, fspG, fspH, fspl, fspJ, fspK, fspL, fspMl, fspM2 and fspN. The negative control consisted of a diluent (NC), and positive controls comprised the Greer antigen (GR) and histamine (HIS) . The amount of Greer antigen used was determined by weight per volume (w / v), according to the information provided by the manufacturers (Greer Laboratories, Inc., Lenoir, North Carolina) . The amount of histamine used was determined by the information provided on the provider's label (available through Greer Laboratories, Inc., Lenoir, North Carolina).

A. Comparison of the size of wheal at the injection site All the injection sites were objectively (Obj) measured in millimeters (mm) at 15 minutes, and subjectively (Sub) marked on a scale of 0 1 4. Subjective marking was performed by Kenneth W. Kwochka, DVM, ACVD Diploma (American College of Veterinary Dermatologists) at the Ohio State University, Columbus, Ohio. Tables 2 to 7 indicate the results obtained for each dog. # refers to the designation of the number given to the sample; antigen refers to the sample Iny 1, Iny 2 and Iny 3, refers to the triplicate of injections, and NA refers to "not applicable" Table 2. DOG ID: 2082101 Iny 1 Iny 1 Iny 2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 6 NA NA NA NA 2 Histamine 4 12 NA NA NA NA 3 Greer 10 10 J 10 4 FS-1 10 4 12 4 12 5A 1 8 0 8 0 8 6B 0 6 0 6 0 6 7C1 0 6 0 6 0 6 8C2 0 6 0 6 0 6 9D1 0 8 0 8 0 6 D2 0 6 0 6 0 8 HE J 12 3 12 • j 12 12F 14 3 12 3 12 13 G * > 12 J 12 12 14H 11 2 12 12 151 J 12 2 12 11 16 J 2 10 2 11 2 10 17 K 2 11 2 10 2 9 18L 2 9 1 10 1 10 19M1 2 12 2 11 2 11 M2 J 12 3 11 3 12 21 N - »J 11 3 10 2 11 22 FS-2 2 11 3 12 2 10 23 Neg Cntl 0 8 NA NA NA NA 24 Histamine 4 14 NA NA NA NA Table 3. DOG ID: 2080109 Iny 1 Iny 1 Iny 2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 7 NA NA NA NA 2 Histamine 4 14 NA NA NA NA 3 Greer 0 8 0 8 0 8 4 FS-1 4 13 4 13 4 13 A 0 9 0 8 0 8 6 B 0 7 0 7 0 7 7 C1 0 8 0 7 0 7 8 C2 0 8 0 7 0 8 9 D1 1 9 1 9 1 9 D2 1 9 1 8 1 8 H E J 11 3 11 2 10 12 F 11 3 13 4 13 13 G 14 13 3 13 14 H 2 12 2 11 2 10 1 2 10 10 - > J 10 16 J 2 10 3 10 3 10 17 K 2 9 2 9 2 9 18 L 1 9 1 6 1 7 19 Ml - > 1 1 - > J 13 3 13 M2 14 J 13 14 21 N 3 13 3 14 2 10 22 FS-2 2 9 1 7 1 8 23 Neg Cntl 0 6 NA NA NA NA 24 Histamine 4 16 NA NA NA NA Table 4. PERRO TD: 2082128 Iny 1 Iny 1 Iny 2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 6 NA NA NA NA 2 Histamine 4 12 NA NA NA NA 3 Greer 0 6 0 6 0 6 4 FS-1 12 J 12 3 12 5A 0 7 0 7 0 6 6B 0 7 0 7 0 6 7C1 0 7 0 6 0 7 8C2 0 6 0 7 0 7 9 DI 0 7 0 7 0 7 D2 0 7 0 7 0 7 11 E 0 7 0 6 0 7 12 F 0 6 0 6 0 6 13 G 1 10 1 9 1 9 14 H 2 10 2 10 2 11 151 J 12 J 12 - > eleven 16J 12 3 11 J 11 17K J 11 J 12 3 12 18L J 11 J 10 - > eleven 19M1 - > 11 11 3 12 M2 12 J 12 J 12 21 N J 12 - > 12 12 22 FS-2 J 12 11 12 23 Neg Cntl 0 6 NA NA NA NA 24 Histamine 4 14 NA NA NA NA Table 5. DOG ID: BFQ2 Iny 1 Iny 1 Iny 2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 6 NA NA NA NA 2 Histamine 4 12 NA NA NA NA 3 Greer 0 6 0 6 0 6 4 FS-1 1 9 1 9 1 9 5A 0 7 0 7 0 7 6B 0 7 0 7 0 7 7C1 0 7 1 7 1 7 8C2 0 7 0 7 0 6 9D1 0 8 1 7 1 8 D2 0 7 0 6 1 7 HE 1 7 0 6 0 6 12 F 1 6 1 7 0 7 13 G 0 8 1 8 1 8 14 H 0 8 0 7 0 7 151 1 7 0 7 0 8 16J 0 7 0 7 0 7 17K 0 7 0 7 0 6 18L 0 8 0 7 0 7 19M1 0 7 0 7 0 7 M2 0 7 0 7 1 8 21 N 3 12 3 11 3 11 22 FS-2 3 11 3 11 - > eleven 23 Neg Cntl 0 7 NA NA NA NA 24 Histamine 4 15 NA NA NA NA Table 6. DOG ID: CP02 íny 1 Iny 1 Iny 2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 NA NA NA NA 2 Histamine 4 13 NA NA NA NA 3 Greer 0 7 0 7 0 6 4 FS-1 4 12 4 12 4 12 5A 0 7 0 6 0 6 6B 0 6 0 7 0 7 7C1 0 7 0 6 0 7 8C2 0 6 0 6 0 6 9D1 0 7 1 7 0 7 D2 1 6 0 6 0 5 HE 0 6 0 6 0 6 12F 0 6 0 6 2 7 13 G 2 9 2 8 2 8 14 H 4 11 4 12 4 11 151 12 - J 11 J 10 16J 10 3 11 10 17K 2 8 2 8 2 8 18L 1 8 l 7 1 7 19 Ml 11 3 11 11 M2 J 11 4 12 4 12 21 N 4 12 10 - > eleven 22 FS-2 11 12 12 23 Neg Cntl 0 6 NA NA NA NA 24 Histamine 4 13 NA NA NA NA Table 7. DOG ID: COQ2 Inyl Iny 1 Íny2 Iny 2 Iny 3 Iny 3 # Antigen Sub Obj Sub Obj Sub Obj 1 Neg Cntl 0 6 NA NA NA NA 2 Histamine 4 13 NA NA NA NA 3 Greer 0 7 0 7 0 7 4 FS-1 2 8 2 8 2 8 5A 0 6 0 6 0 7 6B 0 7 0 7 0 6 7C1 0 7 0 6 0 6 8C2 0 7 0 7 0 6 9 DI 0 6 0 6 0 6 D2 0 6 0 6 0 7 HE 0 6 0 6 0 6 12 F 0 6 0 7 0 7 13 G 0 7 0 7 0 6 14 H 1 7 1 7 1 7 151 2 8 2 9 2 8 16J 2 8 2 8 2 8 17K 1 7 1 7 1 7 18L 1 6 0 6 0 6 19 MI 2 7 2 8 2 8 M2 2 8 2 8 2 9 21 N J 11 3 12 - > eleven 22 FS-2 11 3 11 - j 10 23 Neg Cntl 0 7 NA NA NA NA 24 Histamine 4 14 NA NA NA NA As a control, 2 virgin flea dogs (ie dogs that had never been exposed to fleas) were also studied, with unique duplicates of the same samples that were injected into the sensitized dogs. These dogs are described as WANU and WBCE dogs. The objective and subjective measures of the size of wheal 15 minutes after the injection of the samples are presented in Tables 8 and 9- Table 8. DOG ID: WANU Iny 1 Iny 1 # Sub Obj Antigen 1 Neg Cntl 0 7 2 Histamine 4 10 3 Greer 0 6 4 FS-1 0 6 5A 0 7 6B 0 6 7C1 0 6 8C2 0 6 9D1 0 7 D2 0 6 HE 0 6 12 F 0 6 13 G 0 7 14 H 0 7 151 0 7 16J 0 7 17 K 0 6 18L 0 7 19 Ml 0 6 M2 0 6 21 N 1 8 22 FS-2 1 8 23 Neg Cntl NA NA 24 Histamine NA NA Table 9. DOG ID: WBCE Iny 1 Iny 1 # Sub Obj Antigen 1 Neg Cntl 0 6 2 Histamine 4 12 3 Greer 0 7 4 FS-1 0 7 5A 0 7 6B 0 7 7CI 0 7 8C2 0 7 9D1 0 7 D2 0 6 HE 0 7 12F 0 7 13 G 0 8 14 H 0 7 151 0 7 16 J 0 7 17K 0 7 18L 0 6 19M1 0 7 M2 0 7 21 N 0 7 22 FS-2 0 7 23 Neg Cntl NA NA 24 Histamine NA NA The subjective average obtained for each flea salivary antigen of the 6 sensitized dogs studied was calculated and summarized in Figure 5. The results indicate that the flea saliva products produced as indicated in Examples 2 and 3 include at least one allergenic protein capable of inducing an immediate hypersensitive response in a sensitized dog. In particular, injections of flea saliva antigen mixtures referred to as FS-1 and FS-2 result in a substantial weld formation. The flea saliva proteins fspE, fspF, fspG, fspH, fspl, fspJ, fspK, fspL, fspMl, fspM2 and fspN also result in a substantial weld formation. The flea saliva proteins fspA, fspB, fspCl, fspC2, fspDl and fspD2 produced a minimal, if any, allergic response, depending on the dog studied. The sample containing fspH produced the largest wheal formation when compared to the other flea saliva proteins.

B. Comparison of Induration Levels? Erythema at the Sites of Injection In addition to the size of wheal, the amount of induration and erythema were also measured at each injection site. The induration produced by the injection of flea saliva antigens was measured at 6 hours and 24 hours per score or subjective marks. Such subjective measures of induration were performed by Kenneth W. Kwochka, D.V.M. In addition, the amount of erythema at each injection site was subjectively checked by Kenneth W. Kwochka, D.V.M. The amounts of induration and erythema measured by subjective score or mark at 6 hours were negative for each of the sensitized and control dogs, except for the following preparations or formulations in the following sensitized dogs. The administration of FS-1 to dog 2082101 produced an average induration of 1 to 2 injection sites, but no erythema. The administration of fspL to dog 2082101 produced no induration, but a mark of erythema of 1 in 1 injection site. The administration of fspMl to dog 2082101 produced no induration, but an erythema mark of 3 in 1 injection site. The administration of FS-2 to dog 2082101 produced no induration, but an average mark of erythema of 21.33 at 3 injection sites. The administration of fspH to dog 2082128 produced no induration, but an average mark of erythema of 2 in 3 injection sites. Administration of fspl to dog 2082128 yielded an average induration mark of 1, and an average mark of erythema of 1 in 2 injection sites. Administration of fspJ to dog 2082128 yielded an average induration mark of 1, and an average mark of erythema of 1 in 3 injection sites. The administration of FS-2 to dog 2082128 produced no induration, but an average mark of erythema of 2 in 3 injection sites. Administration of FS-1 to dog BFGQ2 produced an average induration mark of 2, and an average mark of erythema of 2 at 3 injection sites. Administration of fspN to dog BFGQ2 produced an average induration mark of 1, an average mark of erythema of 2 at 2 injection sites. Administration of FS-2 to dog BFGQ2 produced an average induration mark of 1, and an average mark of erythema of 2 in 2 injection sites. Administration of FS-1 to dog CP02 produced an average induration mark of 2.5, but no erythema at 2 injection sites. The administration of fspG to dog CP02 did not produce induration, but an average mark of erythema of 2 in 3 injection sites. The administration of fspH to dog CP02 did not produce induration, but an average mark of erythema of 1 in 2 injection sites. The administration of FS-2 to dog CP02 did not produce induration, but an average mark of erythema of 2 in 3 injection sites. The average subjective mark for induration obtained for each flea saliva antigen in the 6 sensitized dogs studied was calculated, and summarized in Figure 6. The subjective score. The average subjective mark for erythema obtained for each flea salivary antigen in the 6 sensitized dogs studied was calculated and summarized in Figure 7. The results of the induration and erythema quantities subjectively measured at 24 hours in 5 of sensitized dogs to flea, and two of the controls were negative, except for the following preparations or formulations in the following sensitized dogs. Administration of fspl to dog 2082101 produced an average induration mark of 1, and an average mark of erythema of 1 in 3 injection sites. The administration of fspJ to dog 2082101 produced an average induration mark of 1, and an average mark of erythema of 1 in 3 injection sites. The administration of fspMl to dog 2082101 produced an average induration mark of 1, and an average mark of erythema of 3 at 3 injection sites. Administration of fspN to dog 2082101 produced an average induration mark of 1, and an average mark of erythema of 2 at 3 injection sites. Administration of FS-2 to dog 2082101 produced an average induration of 3, and an average mark of erythema of 4 at 3 injection sites. Administration of FS-1 to dog BFQ2 produced an average induration mark of 1, and an average mark of erythema of 1 in 3 injection sites. The administration of FS-2 to dog BFQ2 produced an induration of 1, and an erythema of 1 in 1 injection site. The administration of FS-1 to dog CP02 produced an induration of 2, and an erythema mark of 1 in 1 injection site. Administration of fspl to dog CP02 produced an average induration mark of 1, and an average mark of erythema of 1 in 3 injection sites. Administration of FS-2 to dog CP02 produced an average induration mark of 1, and an average mark of erythema of 2 at 3 injection sites. The administration of Greer antigen to dog CQQ2 did not produce induration, but an average mark of erythema of 1 in 3 injection sites. The administration of FS-1 to dog CQQ2 produced an induration of 1, and an erythema of 1 in 1 injection site. The administration of fspl, fspJ, fspMl or fspM2 to dog CQQ2 did not produce induration, but an average mark of erythema of 1 in 3 injection sites. The administration of fspN to dog CQQ2 produced an induration of 1, and an erythema of 1 in 1 injection site. Administration of FS-2 to dog CQQ2 produced an average induration mark of 1, and an average mark of erythema of 2 at injection sites. The average subjective mark for induration obtained for each flea salivary antigen in the 6 sensitized dogs studied was calculated and summarized in Figure 8. The average subjective mark for erythema obtained for each flea salivary antigen in the 6 sensitized dogs studied. it was calculated and summarized in Figure 8. The results indicate that at least some of the flea saliva protein preparations or formulations produced according to the description in Examples 2 and 3 include at least one allergenic protein capable of inducing a delayed hypersensitive response in a sensitized dog. Injection of flea saliva protein mixtures referred to as FS-1 and FS-2 induces induration and substantial erythema for at least 24 hours. further, samples of flea salivary protein fspl, fspJ, fspMl and fspN were sufficiently allergenic to induce induration and erythema for at least 24 hours. The sample of flea salivary protein fspL and fspM2 induced substantial levels of induration, but not substantial levels of erythema for 24 hours. Taken together, the results indicated above and shown in Figures 5 to 9 indicate that the salivary protein preparations or formulations of the present invention are sufficiently allergenic to induce a hypersensitive response in a sensitized dog. Numerous samples induced an immediate hypersensitive response and a delayed hypersensitive response.

EXAMPLE 9 This example demonstrates by histopathology of the tissues of the dogs of Example 7, the ability of numerous isolated flea saliva protein samples as in Examples 2 and 3 to induce a hypersensitive response. Two tissue samples were obtained for each sensitized dog as described in Example 7. No biopsy was obtained from the two virgin dogs. The sites selected for the tissue samples are indicated in Table 10 below. The biopsies were taken with a 4-millimeter biopsy punch, after having undergone subcutaneous injections of Lidocaine. The biopsies were processed and read by Dr. David M. Getzy, DVM, Diplomat ACVP (American College of Veterinary Pathologists) at the Colorado Veterinary Diagnostic Laboratory (College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, Colorado).

Table 10. Histopatoloi to Dog Antí eno Time No. Sude Type of Injury Grade 101 FS-1 15 min. 1 A A 1 6hr. 2 B A 2.5 24 hr- C A 109 FS-1 15 in. 4 D A 1 6hr. 5 E C 2 24 hr. 6 F C 128 FS-1 15 min. 7 G A 1.5 6hr. 8 H C 1.5 24 hr. 9 I c CP02 FS-1 15 min- 10 J A 1.5 6hr. 11 K C 3 24 hr. 12 L c 4 CQQ2 FS-1 15 min. 13 M A 1.5 6hr. 14 N C 2.5 24 hr. 15 O C 2.5 101 fspE 15 min- 16 P A 1 6hr. 17 Q C 1.5 24 hr. 18 R A 1.5 109 fspF 15 min. 19 S A 1 6hr. 20 T A 1.5 24 hr. 21 u A 1.5 128 fspl 15 min. 22 V A 1 6hr. 23 W C 2.5 24 hr. 24 X C 2.5 BFQ2 fspN 15 min. 25 Y A 1.5 6hr- 26 z C 2 24 hr. 27 AA C 3.5 BFQ2 fspO 15 min. 28 BB A 1 Table 10 H [sjtopathogy Dog Antí-ueno Time No_ Slide Type of Injury Grade 6 hr 29 CC C J 24 hr 30 DD C 2.5 CP02 fspH 1 min 31 EE A 1 5 6 hr 32 FF C 1 5 24 hr GG A 1.5 CQQ2 fspN 1 min 34 HH A 1 6 hr 35 II C 2.5 24 hr 36 JJ C 2 5 Two types of lesions were found in the tissue samples studied. Type A injury refers to a moderate superficial dermal edema that has a mild number of mast cells in a perivascular orientation within the superficial dermis. The vascular endothelium exhibited mild reactive hypertrophy. A minimal number of neutrophils was also noticed in this region. The Type C Lesion refers to lesions that were similar to those described under Type A, except that the eosinophils were mild to moderate in severity, while neutrophils and mast cells were mild in severity. On a scale of 0 to 5, injuries range from grade 1 to 4 in severity. Some of the specimens had predominantly inflammatory mastocytic perivascular infiltration, edema, and a minimum number of other cellular components. Other sections showed a predominance of inflammatory eosinophilic infiltrates, with a smaller number of mast cells and neutrophils. The severity of these lesions was variable, however, in some areas progressed to intraepidermal eosinophilic pustulation and necrobiosis of collagen within the superficial dermis. Considering the whole, tissue samples indicate the presence of superficial perivascular / periadnexal, mastocytic and eosinophilic dermatitis, subacute dermatitis. The lesions observed in all the examined specimens are uniform with a type I allergic reaction of hypersensitivity.

EXAMPLE 10 This example further shows the ability of the proteins described in Examples 2 and 3 to induce an allergic response in animals naturally susceptible to flea allergy dermatitis by skin tests performed on dogs. These reactions were compared to those obtained using the current standard for the diagnosis of flea allergy dermatitis, Greer's Whole Flea Extract (Greer Laboratories, Inc., Lenoir, North Carolina). In addition, in order to determine the specificity of the reactions, the results of the tests were compared to those obtained from a population of control dogs with normal skin, and a population of dogs with pruritic skin disorders, with the exception of allergic dermatitis. of flea Three groups of dogs were used in the study. (1) Ten dogs with flea allergy dermatitis occurring naturally as determined by clinical signs, presence of fleas at diagnosis, and an immediate or delayed positive reaction to Greer's Whole Flea Extract.; (2) ten dogs with pruritic dermatitis unrelated to fleas, including, but not limited to, atopy, food allergy dermatitis, pyoderma, seborrhea, and other parasitic hypersensitivity reactions; and (3) ten dogs with normal skin and no history of chronic skin diseases. The dogs were of any breed, age or sex. They were recruited from the hospital population of Ohio State University Veterinary Teaching Hospital, Columbus, Ohio. All dog owners had given their written consent to participate in the study. All tests and subjective marks were made by Kenneth W. Kwochka, DVM, Diplomat ACVD (American College of Veterinary Dermatologists), in the Dermatology Examination Room at the Veterinary Teaching Hospital, College of Veterinary Medicine, Ohio State University, Columbus, Ohio. All dogs were studied in the anterior ventral-lateral area of the chest on the left side. The dogs were sedated for the study, using standard doses of xylazine and atropine administered intravenously immediately before the skin test. No glucocorticoid, antihistamines or other non-steroidal anti-inflammatory medication was allowed at least 3 weeks before the test. The area for the test was cut smoothly with an electric # 40 shaver, and the injection sites were marked with an indelible black marker. 22 sites were marked: two rows of ten points and one row of two points. Intradermal injections were administered above and below each mark for a total of forty-four injections that were administered in the following order: Row 1: Neg. cont.-Histamine-Greer-Greer-Saliva de Pulga- Saliva de Pulga-A-A-B-B. Row 2: C1-C1-C2-C2-D1-D1-D2-D2-E-E Row 3: F-F-G-G-H-H-I-I-J-J Row 4: K-K-L-L-M1-M1-M2-M2-N-N Row 5: FS2-FS2 Row 6: Neg. cont. -Histamine Each site was injected intradermally with 50 microliters of a sterile diluent (Neg. Cont.), 1 / 100,000 w / v histamine phosphate (Histamine). Whole Greer Flea Extract (Greer), whole flea saliva (Flea Saliva), or individual salivary protein fractions (fspA, (A); fspB, (B); fspCl, (Cl); fspC2, (C2); fspDl, (DI), fspD2, (D2), fspE, (E), fspF, (F), fspG, (G), fspH, (H), fspl, (I), fspK, (K), fspL , (L), fspMl, (Ml), fspM2, (M2), fspN, (N), and FS-2, (FS2) All injections were diluted in the same sterile diluent, as Neg. Skin reactions were read subjectively and objectively at 15 minutes and 24 hours after the injections.The owners of the dogs were required to return with their dogs to the Veterinary Teaching Hospital for 24 hours reading. scale of 0, 1+, 2+, 3+ and 4+, based on the size of the wheal, the amount of erythema and the amount of induration.The objective evaluation was based on the diameter of the wheal measured in millimeters.

Comparisons of Skin Reactions; A. Dogs with FAD Of the 10 dogs positive to Greer, 7 (70 percent) were positive to Flea Saliva (FS). None of the 3 FS negative dogs reacted to any of the salivary protein fractions. In addition, the 3 negative FS dogs at 15 minutes were negative at all at 24 hours. The 7 FS positive dogs were used to summarize the 15 minute reactions shown later in Table 11.

Table 11. - Immediate subjective marks (15 minutes) of 7 dogs FS positive to the antigen test.

Four of the FS-positive dogs could not be evaluated at 24 hours, because the severity of the immediate reactions required an anti-inflammatory therapy. The remaining 3 FS positive dogs were used to summarize the 24-hour reactions described in Table 12.

Table 12- Delayed subjective marks (24 hours) of 3 FS-positive dogs to antigen test.

B. Normal Dogs; Three dogs had some extension of immediate reaction to the antigens of the skin test. None had a delayed positive reaction at 24 hours. A summary of the immediate subjective reaction results (15 minutes) is shown below in Table 13.

Table 13 - Immediate subjective marks (15 minutes) of 10 normal dogs in the antigen test.

Comments of individual dogs: Dog # 1 Greer 3+, FS 3+, n 2+, FS2 4+ Dog # 2 Greer 3+ Dog # 1 FS 3+ C. Dogs with Pruritis Not Related to FAD Six dogs had a certain extension of immediate reaction to the antigens of the skin test. A summary of the immediate subjective results (15 minutes) are described in Table 14.

Table 14 - Immediate subjective marks (15 minutes) of 10 dogs with pruritis unrelated to FAD in the antigen test.

Comments of individual dogs: Dog # 1 FS 2+, Ml 3+, M2 3+, N 3+, FS2 3+ atopic dog under chronic exposure to fleas.

Dog # 2 FS 4+, G 4+, Ml 4+, M2 3+, N 3+ atopic dog under chronic exposure to fleas.

Dog # 3 FS 4+, M2 2+ atopic dog under chronic exposure to fleas.

Dog # 4 N 3+ atopic dog under chronic exposure to fleas.

Dog # 5 Greer 4+ chronic external otitis Dog # 6 Greer 4+ generalized demodicosis (scabies) Dogs # 1, # 2 and # 3 returned to the clinic subsequently diagnosed with FAD, and tested positive for Greer. Three dogs had a certain extent of delayed reaction to skin test antigens. A summary of the delayed subjective results (24 hours) is shown in Table 15.

Table 15 - Delayed subjective results marks (24 hours) in 10 dogs with pruritis unrelated to FAD in the antigen test.

Comments to individual dogs: Dog # 3 Greer 2+ atopic dog under chronic exposure to fleas Dog # 4 Greer 2+ atopic dog under chronic exposure to fleas Dog # 6 Greer 3+, FS 3+, N 3+, F2 3+ generalized demodicosis (scabies) To aid in determining fractions of flea saliva that correlates best with a positive skin test result, all data from dogs artificially sensitized and clinically diagnosed with FAD that were 2+ or greater than FS (total of 12 dogs, 5 artificially sensitized and 7 clinically diagnosed with positive FAD) were tabulated according to the responses to the antigen test. The immediate subjective results (15 minutes) are shown later in Table 16, and the delayed subjective results (24 hours) are shown in the Table 17 TABLE 16 PERCENTAGE OF RESPONSE (subjective mark of 15 minutes) TABLE 17 PERCENTAGE OF ANSWER (subjective mark of 24 hours) The results of these studies indicate that the most substantial responses were obtained with the fractions fspG, fspH, fspMl, fspM2 and fspP.

Example 11 The following example illustrates the expression of fspl proteins in bacteria and in insect cells.

A. Expression of flea protein fspl in E. coli A 500 bp fspl DNA fragment was amplified by PCR of the nfspl591 nucleic acid molecule, using: Primer 11, a sensitive primer having the following acid sequence nucleic acids: 5 'ATTCGGATCCATGGAAAGTTAATAAAAAATGTAC 3' (the BamHl site in dark print), described under SEQ ID NO: 36; and Primer 12, an antisense primer having the following nucleic acid sequence: 5'TAATGGATCCTTATTTTTTG 3 ', described under SEQ ID NO: 37. The PCR product, a fragment of about 535 nucleotides, described as nfspl535, was digested with restriction endonuclease BamHl, gel-purified, and subcloned into the expression of the vector pTrcHisB (available from Invitrogen Corp.) which had been digested with BamHl and treated with CIP to produce the recombinant molecule pHis-nfspI535. The recombinant molecule was transformed into HB101 competent cells (available from BRL, Gaithersburg, Maryland) and BL21 (available from Novagen, Madison, Wisconsin) to form recombinant cell E. coliHB: pHis-nfspI535 and E. coliBL: pHis-nfspI535. The recombinant cells were cultured in an enriched bacteriological growth medium containing 0.1 milligram / milliliter of ampicillin and 0.1 percent glucose at 32 ° C. When the cells reached an OD600 of about 0.4-0.5, the expression was induced by the addition of 0.5 mM isopropyl B-Dtiogalactoside (IPTG), and the cells were cultured for 2 hours at 32 ° C. Lysates recombinant cell containing the fusion protein PHIS-PFSPI155 were analyzed by SDS gel electrophoresis polyacrilamide immunostaining Western following standard procedures using a monoclonal antibody T7 Tag (available from Invitrogen Corp.) or rabbit anti-FAD rabbit (# A3381) produced by Paravax, Inc. in Fort Collins, Colorado, by immunization of rabbits with nitrocellulose membranes containing flea saliva, produced as described in Example 2. The antigen / antibody reactions were detected by reactions of Colorimetric enzymes using anti-rabbit antibodies or anti-mouse antibodies conjugated with alkaline phosphatase. A 28 kD protein was detected in the immune spots of lysates induced with both primary antibodies.

B. Expression of the Fspl Flea Protein in Insect Cells The nfspl475 nucleic acid molecule was amplified by PCR of an fspl nucleic acid molecule using the following primers, which were designed to facilitate expression in insect cells using a baculovirus vector: the sensitive primer 13 with the BamHI site in bold, it is 5 'CGC GGA TCC TAT AAA TAT GGA GGA CAT CTG GAA AGT TAA TAA AAA ATG ATC TAC 3', described as SEQ ID NO: 44; and Primer 14 antisense, with the XbaI site in bold, is 5 'GCT CTA GAG CAT TTA TTT TTT GGT CGA CAA TAA CAA AAC 3', described as SEQ ID NO: 45. The PCR product was digested with BamHl and Xbal and a DNA fragment of 475 bp was extracted and purified from an agarose gel. The nucleic acid molecule nfspl475 was ligated into a pVL1393 vector (available from Invitrogen Corp.) digested with BamHI and XbaI to produce a recombinant molecule pVL-nfspl 75. The recombinant molecule was transfected into cells Sf9 of S. frugiperda with Baculovirus DNA aligned to form S. frugiperda recombinant cell: pVL-nfspl475. The recombinant cells were cultured using the standard conditions to produce recombinant virus. The transfection supernatant was also found to contain a 23 kD protein which in the Western blot analysis reacted with a rabbit anti FAD antiserum (# A3381).

Example 12: This example describes the isolation of nucleic acid sequences encoding at least portions of flea saliva proteins in fspN, and its characterization related to human prostatic acid phosphatase. The whole-flea salivary flea and flea salivary gland cDNA libraries described above in Example 6A were immuno-monitored using New Zealand White rabbit antiserum developing against a collected mixture of flea salivary proteins (e.g., the rabbit was immunized one or more times with a powdered nitrocellulose filter used as a collection membrane, to collect the flea saliva proteins, followed by one or more immunizations with a saliva protein extract eluted from a Duropore filter). The immunomonitoring protocols used are those described in the instruction manual of the immunomodulation kit picoBlue111 * Immunoscreening, available from Stratagene, Inc. The methods for the preparation of the cDNA expression libraries for immunomonitoring, for example, expression of the clones of cDNA and procedures for transferring lambda phage plaques to membranes for immunomonitoring are described in the ZAP-cDNA Synthesis Kit, Instruction Manual, also available from Stratagene, Ine, La Jolla, California. Forty clones in unopositive monitoring were selected. One immunopositive clone was derived from the salivary gland cDNA library and another 39 immuno-positive clones were derived from the whole fed flea cDNA library. The DNA sequences of the initial fspN protein, called nfspN (A) and nfsp (B) were isolated from the whole fed flea cDNA library and came from this initial immunomonitoring. The partial nucleotide sequences for nfspN (A) and nfspN (B) are represented by sequences identified under SEQ ID NOs. Each sequence represents approximately half of the carboxyl terminal of the region encoding the cDNA gene as well as the 3 'untranslated region through the poly (A) region. The nucleotide sequence for a nfsoN (A) nucleic acid molecule called nfsoN (A) 646 was described as SEQ ID NO: 50. The translation of SEQ ID NO: 50 produces a protein called PfspN (A) 172 having a amino acid sequence described in SEQ ID NO: 51. The nucleotide sequence for a nucleic acid molecule of nfspN (B), called nfspN (B) 612 is described in SEQ ID NO: 52. The translation of SEQ ID NO: 52 produces a protein called PfspN (B) 153 having an amino acid sequence described in SEQ ID NO: 53. In addition, an apparent N-terminal amino acid sequence was deduced and determined from the nucleic acid sequence of nfspN (A); this was called PfspN (A) 56 and is described in SEQ ID NO: 54. The amino acid sequence of PfspN (A) 56 (SEQ ID NO: 54) is similar, but not identical, to the N-terminal sequences of amino acids obtained for fspN1 (SEQ ID NO: 11), fspN2 (SEQ ID NO: 12) and fspN3 (SEQ ID NO: 13). Not putting the boundary theory, it is believed that there is a family of fspN proteins that are found in flea saliva, which may be in the flea genome due to allelic variation or multiple genes. The nucleic acid molecules nfsoN (A) 646 and nfspN (B) 612 are about 76% identical, and the translated products are about 65% identical. In a second immuno-monitoring experiment, an antiserum was collected from a rabbit that was immunized with the proteins at the N peak of the HPLC separation of the flea saliva extract described in Example 4 (for example, the fspN proteins). This antiserum was used to monitor the flea salivary gland cDNA library (prepared as described in Example 6), and approximately 20 positive clones were isolated. The nucleic acid sequence of one of the recovered nucleic acid molecules appears to be identical to that of nfspN (A). At least two of the other nucleic acid molecules have nucleic acid sequences that are similar, but not identical, to that of nfspN (A), again strengthening the probability of a family of fspN proteins in flea saliva. Yet another nucleic acid molecule appears to have a nucleic acid sequence similar to the myosin gene sequences.

The nucleic acid and amino acid sequences of the nucleic acid molecules and proteins fspN (A) and fspN (B), respectively, were compared to known nucleic acid and amino acid sequences using the Genbank for the homology search. Both nucleic acid sequences were found similar to the corresponding (e.g., carboxyl terminal) region of the human prostatic acid phosphatase nucleic acid sequence. The most highly conserved region of continuous similarity between flea and human sequences of amino acids ranges from amino acid 272 to about amino acid 233 of the human enzyme. Comparison of the nucleic acid sequence encoding amino acids from about 268 to about 333 of the human enzyme with the corresponding regions of the nucleic acid sequences of nfspN (A) and nfspN (B) indicates that nfsp N (A) is about 40% identical, and nfspN (B) is about 43% identical, to said region of the human prostatic acid phosphatase gene. Comparison of the region from about amino acid 268 to about amino acid 333 of the human enzyme with the corresponding regions of PfspN (A) and PfspN (B) indicates that PfspN (A) is approximately 28% identical, and PfspN ( B) is about 30% identical, to said region of the human prostatic acid phosphatase gene. The possibility that at least some fspN proteins encode an active acid phosphatase is supported by the finding that flea saliva extract FS-3 has been shown to have acid phosphatase activity, as described in Example 3.

Example 13 This example demonstrates the production of a recombinant bacterial cell that includes an fspN protein. A DNA fragment of approximately 1000 bp, described as nfspN10oo / was amplified by PCR of a nucleic acid molecule encoding a protein using the following primers: The sensitive F7 Primer, which has the following 5 'nucleic acid sequence GGCGTCTCGAGAGAATTGAAATTTGTGTTTGCG 3 '(the Xhol site in dark letters), described in the sequence SEQ ID NO: 46; and the antisense F7 Primer having the following 5 'nucleic acid sequence AGACGAGAATTCCAATTTATCATGAGCGG 3 • (the EcoRI site in dark letters), described in the sequence SEQ ID NO: 47. The PCR product was digested with Xhol and EcoRI restriction endonucleases , purified by gel subcloned into the expression vector pTrcHisB (available from Invitrogen, Corp.) which had been digested with XhoI and EcoRI to form the recombinant molecule pHis-nfspN10oo 'The recombinant molecule was transformed into BL21 E. coli competent cells (available from Novagen) to form a recombinant E. coli cell: pHis-nfsp N1000.

Example 14 This example demonstrates the expression of an fspN protein in insect cells. The recombinant pVL-nfspN1000 molecule containing the nfspN1000 nucleic acid molecule operatively linked to baculovirus polyhedrin transcription control sequences was produced in the following manner. A DNA fragment of about 1000 bp, described as nfspN1000, was amplified by PCR of a nucleic acid molecule encoding an fspN protein using the following primers: Sensitive primer 17, which has the following nucleic acid sequence 51 CCG GAA TTC CGG TAT AAA TAT GTG GCG TCT ACT G 3 '(the EcoRI site in darker letters), described under SEQ ID NO: 48, and designed to improve expression in insect cells; and Antisense Primer 18, which has the following 5 'nucleic acid sequence CCG GAA TTC AGA CGA TTT ACA CAA TTT ATC 3' (the darker letter EcoRI site), described under SEQ ID NO: 49. The PCR product was digested with EcoRI and not cloned non-directionally in the baculovirus shuttle vector pVL1393 (available from Invitrogen, Corp.). The orientation was determined by restriction with the EcoRV enzyme. The resulting recombinant molecule, ie pVL-nfsoN100o was transfected into S. frugiperda cells (donated by the Colorado Bioprocessing Center, Fort Collins, Colorado) with the wild-type baculovirus linear DNA (AcMNPV) and cationic insectin liposomes according to the manufacturer's specifications (available from Invitrogen, Corp.) to produce the recombinant S. frugiperda cell: pVL-nfspN100o • The supernatant was studied for five days post-transfection by western blot analysis using rabbit antiserum against fspN flea proteins (as described in Example 12; referenced B2237) and a protein of approximately 40kD was detected. The recombinant virus, vBV-nfspN1000 was recovered from the supernatant and the purified plate.

Example 15 This Example demonstrates the use of ELISAs to detect IgE antibodies of saliva against fleas in the serum of dogs sensitized to flea or flea saliva. A. In a first study, sera collected from three dogs that had been artificially sensitized to flea bites were pooled and previously treated by contacting the sera pooled with Protein G to remove at least some of the immunoglobulins that were not IgE present in the sera. Then the IgE antibodies were purified by affinity from the previously treated sera, using Con-A chromatography. The affinity purified IgE antibodies were exposed to the following products and flea salivary protein: FS-1 saliva extract at 2 milligrams / milliliter (23, 300 hours-flea per microliter); fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspG, fspH, fspl, fspj, fspK, fspL, fspMl, fspM2 and fspN (from a sample of 233,000 flea-hours per microlitre applied to HPLC chromatography as described in Example 3). The flea saliva products and proteins were suspended in 0.1 M sodium carbonate, pH 9.6, and 100 microliter samples of each were placed in cavities of a microtiter dish. The samples were incubated overnight at room temperature, washed five times with PBS / Tween, blocked with a PBS solution; BSA, at 2 percent, NaN3 at 0.02 percent, for 1 hour at 37 ° C, and washed five times with PBS / Tween. The washed cavities were each exposed to 100 microliter aliquots of affinity purified dog IgE antibodies for 1 hour at 37 ° C. The wells were washed five times with PBS / Tween, and exposed for 1 hour at 37 ° C, to 100 microliters of a monoclonal mouse IgE antibody preparation against canine diluted 1: 000 in PBS, 2 percent BSA, Triton X-100 at 0.5 percent. The wells were washed five times with PBS / Tween, exposed for 1 hour, at 37 ° C, to 100 microliters of donkey IgG against mouse (H + L) -HRP, and washed five times with PBS / Tween. The cavities were developed with 100 microliters of KPL TMB: H202, 1: 1, for 10 minutes, stopping the reaction with 50 microliters of 2.5 N hydrogen sulfate. The cavities were read at 450 nanometers. The results, shown in Table 18 and Figure 10, indicate that the FAD + dogs have in their sera IgE antibodies that react in a sensitive and specific manner with the flea saliva extract FS-1, as well as with the saliva proteins. of flea fspE, fspF, fspG, fspH, fspl, fspJ, fspK, fspL, fspMl, fspM2 and fspN. The IgE antibody preparation reacted minimally, if at all, with the flea saliva proteins fspA, fspB, fspCl, fspC2, fspDl, and fspD2. Accordingly, the IgE reactivity closely followed the results of the skin test of Example 8 in artificially sensitized dogs with the same flea salivary products and proteins. bla 18 Table 19 B. In a second study, serum collected from a dog that had been artificially sensitized to flea bites was previously treated by contacting the serum with Protein G to remove at least some of the immunoglobulins other than IgE present in the serum. The reactivity of the previously treated serum to the flea out extract FS-1 was determined as described in Example 15A. The reactivity to FS-1 flea saliva extract from sera collected from dogs infected with heartworm was also tested and grouped and pretreated by contacting the serum with Protein G. The results shown in the Table 19 and Figures HA and 11B, demonstrate a dose-dependent reactivity of IgE from the FAD + dog, while the IgE of dogs infected with heartworm had no reactivity against flea saliva extract FS-1.

LIST OF SEQUENCES The following Sequence Listing is presented in accordance with Title 37 of the Code of Federal Regulations, Section 1.821. A copy in computer readable form is also provided with this. Applicants assert, in accordance with Title 37 of the Code of Federal Regulations, Section 1821, that the contents of the copies, paper and computer readable form of SEQ ID N0: 1 to SEQ ID NO: 54 delivered with the present, they are the same. 1) GENERAL INFORMATION: (1) APPLICANT: FRANK, GLENN R. HUNTER, SHIRLEY WIU WALLENFELS, LYNDA (Ü) TITLE OF THE INVENTION: NOVEDOSAS PROTEINS OF ECTOPARASIUM SALIVA, AND APPARATUS FOR THE OBTAINING OF SUCH PROTEINS. (Üi) NUMBER OF SEQUENCES. 54 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: Sheridan Ross & Mclntosh (B) STREET: 1700 Lincoln Street, Suite 3500 (C) CITY: Denver (D) STATE: Colorado (E) COUNTRY: E.U.A. (F) POSTAL CODE (ZIP): 80203 (V) LEGIBLE FORM FOR COMPUTER (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Reléase # 1.0, Version # 1.25. (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) SUBMISSION DATE (C) CLASSIFICATION: (viii) ATTORNEY / AGENT INFORMATION: (A) NAME: Connell, Gary J. (B) NUMBER REGISTRATION: 32,020 (C) REFERENCE / CASE NUMBER: 2618-17-C2 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 8303) 863-9700 (B) TELEFAX: (303) 863-0223 (2) INFORMATION FOR SEQ ID NO: l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Tyr, Gln, Ser or Arg (B) LOCATION: 1 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Gly or Tyr (B) LOCATION: 2 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Lys or Ser (B) LOCATION : 3 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Gly or Ser (B) LOCATION: 9 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Gly or Lys (B) LOCATION: 10 (ix) ) CHARACTERISTICS: (A) NAME / KEY: Xaa = Arg or lie (B) LOCATION: 14 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = He or Leu (B) LOCATION: 17 (ix) FEATURES: ( A) NAME / KEY: Xaa = Lys or Asp (B) LOCATION: 19 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Gly or Leu (B) LOCATION: 21 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO : l: (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 78 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = His or Tyr (B) LOCATION: 27 (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: Asp Arg Arg Val Ser Lys Thr Cys Gln Ser Gly Gly Lys He Gln Ser 1 5 10 15 Glu Xaa Gln Val Val He Lys Ser Gly Gln Xaa He Leu Glu Asn Tyr 20 25 30 Xaa Ser Asp Gly Arg Asn Asn Asn Asn Pro Cys Hiß Leu Phe Cyß Met 35 40 45 -Arg Glu Cyß Arg Ser Gly Asn Gly Gly Cys Gly Asn Gly Gly Arg Thr 50 55 60 Arg Pro Asp Ser Lys His Cys Tyr Cys Glu Ala Pro Tyr Ser 65 70 75 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 Asp Ser Lyß Hiß Cyß Tyr Cys Glu Ala Pro Tyr Ser 1 5 10 (2) INFORMATION FOR SEQ ID NOM: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE : SEQ ID NO: 4 Asp Gly Arg Asn Aßn Asn Asn Pro Cys His Leu Phß Cyß Mßt Arg Glu 1 5 10 15 Cyß Arg Ser Gly Aßn Gly Gly Cyß Gly Aßn Gly Gly Arg Thr Arg Pro 20 25 30 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (i) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: Asp Arg Arg Val Ser Lys Thr Cys Gln Ser Gly 1 5 10 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: Glu Asp He Trp Lys Val Asn Lys Lys Xaa Thr Ser Gly Lyly Asn 1 5 10 15 Gln Asp Arg Lys Leu Asp Gln He He Gln Lyß Gly Gln Gln Val Xaa 20 25 30 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: Asn Ser Hiß Glu Pro Gly Aßn Thr Arg Lys He Arg Glu Val Met Asp 1 5 10 15 Lys Leu Arg Lys Gln His Pro 20 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH : 27 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 8; Glu He Lys Arg Asn Ser His Glu Pro Gly Aßn Thr Arg Lys He Arg 1 5 10 15 Glu Val Met Asp Lyß Leu Arg Lyß Gln Hiß Pro 20 25 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: Aßn Asp Lys Glu Pro Gly Aßn Thr Arg Lys He Arg Glu Val Mßt Asp 1 5 10 15 Lys Leu Arg Lys Gln Wing Gln Pro Arg Thr Asp Gly Gln Arg Pro Lys 20 25 30 Thr Xaa He Met 35 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO : 10: Xaa Leu Xaa Arg Asn Asp Lys Glu Pro Gly Asn Thr Arg Lyß He Arg 1 5 10 15 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) ) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11: Asn Asp Glu Leu Lys Phe Val Phe Val Met Ala Lys 1 5 10 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12: Xaa Asp Glu Leu Lyß Phe Val Phe Val Met Ala Lyß Gly Pro Ser Xaa 1 5 10 15 Gln Ala Xaa Aßp Tyr Pro Cyß 20 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: Glu Leu Lyß Phe Val Phe Ala Thr Ala Arg Gly Met Ser Hiß Thr Pro 1 5 10 15 Cys Asp Tyr Pro 20 (2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = His or Tyr (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14 : Asp Arg Arg Val Ser Lys Thr Xaa Gln Ser Gly Gly Lys He Gln Ser 1 5 10 15 Glu Xaa Gln Val Val He Lys Ser Gly Gln Xaa He Leu Glu Asn Tyr 20 25 30 Xaa Ser Asp Gly Arg 35 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 15: AAYAAYAAYA AYCCNTGYCA (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 16: CAYTCNCKCA TRCA-RAA 1? (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 17: TGYCAYYTNT TYTGYATG 18TION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 18: GGNGCYTCRC ARTARCARTG YTT 23 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19: GTAAAACGAC GGCCAGT ?? (2) INFORMATION FOR SEQ ID NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (Ü) ) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 20: TTGTCACTTT TTTTGTATGA GAGAATGCAG GTCAGGAAAC GGCGGTTGCG GAAACGGAGG 60 AAGGACAAGA CCTGATTCGA AGCACTGCTA TGC 93 (2) INFORMATION FOR SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 21: GARGAYATHT GGAARGTNAA YAA 23 (2) INFORMATION FOR SEQ ID NO: 22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 22: ACNTCNGGNG GNAARAAYCA RGA 23 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (primer) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 23 TTGGGTACCG GGCCCCCCCT 20 (2) INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 573 base pairs (B) TYPE: nucleic acid (D) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 24: CTTACGTCCG GGGGTAAGAA TCAGGATAGA AAACTCGATC AAATAATTCA AAAAGGCCAA 60 CAAGTTAAAA TCCAAAATAT TTGCAAATTA ATACGAGATA AACCACATAC AAATCAAGAG 120 AAAGAAAAAT GTATGAAATT TTGCACAAAA AACGTTTGCA AAGGTTATAG AGGAGCTTGT 180 GATGGCAATA TTTGCTACTG CAGCAGGCCA AGTAATTTAG GTCCTGATTG GAAAGTCAAC 240 GAAAGAATCG AAAGACTCCC AATAACAAAG ATTCTCGTCT CAGGAAATAG TTCCATATCG 300 ACAACAATTA CGAATTCCAA ATATTTCGAA ACTAAAAATT CAGAGACCAA TGAAGATTCC 360 AAATCGAAAA AACATTCGAA AGAAAAATGT CGTGGTGGAA ATGATGCTGG ATGTGATGGA 420 AACGTTTTGT TATTGTCGAC CAAAAAATAA ATAATAATTA TAATAAATAA ATTGTTATAG_480_TTATTAGTTA TCCCGTCACA TATTAGAAAA GTGGCTTATA ATTTATGAAC AATATAACAC 540 ATAAATTAGT TGTGTAAAAA AAAAAAAAAA AAA 573 ) INFORMATION FOR SEQ ID NO: 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 149 base pairs (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 25: Leu Thr Ser Gly Gly Lys Asn Gln Asp Arg Lys Leu Asp Gln He He 1 5 10 15 Gln Lys Gly Gln Gln Val Lys He Gln Asn He Cyß Lys Lßu He Arg 20 25 30 Asp Lys Pro His Thr Asn Gln Glu Lys Glu Lys Cyß Met Lys Phe Cyß 35 40 45 Thr Lys Aßn Val Cys Lys Gly Tyr Arg Gly Ala Cyß Aßp Gly Asn He 50 55 60 Cys Tyr Cys Ser Arg Pro Ser Asn Leu Gly Pro Asp Trp Lys Val Asn 65 70 75 80 Glu Arg He Glu Arg Leu Pro He Thr Lys He Leu Val Ser Gly Asn 85 90 95 Be Being Thr Thr Thr Thr Asn Being Ser Lys Tyr Phe Glu Thr Lys 100 105 110 Asn Ser Glu Thr Aßn Glu Asp Ser Lys Ser Lys Lys His Ser Lyß Glu 115 120 125 Lys Cys Arg Gly Gly Asn Asp Arg Gly Cys Asp Gly Asn Val Leu Leu 130 135 140 Leu Ser Thr Lys Lys 145 INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 158 base pairs (B) TYPE: amino acid (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 26: Glu Asp He Trp Lys Val Asn Lys Lys Leu Thr Ser Gly Gly Lys Asn 1. 5 10 15 Gln Asp Arg Lys Leu Asp Gln He He Gln Lys Gly Gln Gln Val Lys 20 25 30 He Gln Asn He Cys Lys Leu He Arg Aßp Lys Pro Hiß Thr Asn Gln 35 40 45 Glu Lys Glu Lys Cys Met Lys Phe Cys Thr Lyß Aßn Val Cyß Lys Gly 50 55 60 Tyr Arg Gly Wing Cys Asp Gly Asn He Cys Tyr Cys Ser Arg Pro Ser 65 70 75 80 Asn Leu Gly Pro Asp Trp Lys Val Asn Glu Arg He Glu Arg Leu Pro 85 90 95 He Thr Lys He Leu Val Ser Gly Aßn Ser Ser Be Thr Thr He 100 105 110 Thr Asn Ser Lys Tyr Phe Glu Thr Lys Asn Ser Glu Thr Asn Glu Asp 115 120 125 Ser Lys Ser Lys Lys His Ser Lys Glu Lyß Cys Arg Gly Gly Asn Aßp 130 135 140 Arg Gly Cys Asp Gly Asn Val Leu Leu Leu Ser Thr Lys Lys 145 150 155 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids ( B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Ser or Gln (B) LOCATION: 1 (ix) CHARACTERISTIC: (A) NAME / KEY: Xaa = any amino acid (B) LOCATION: 8 (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = Gly or Lys (B) LOCATION: 9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27 : Xaa Gly Lys Gln Tyr Ser Glu Xaa Xaa Lys 1 5 10 (2) INFORMATION FOR SEQ ID NO: 28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 28: Asp Arg Arg Val Ser Lys 1 5 (2) INFORMATION FOR SEQ ID NO: 29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (ix) CHARACTERISTICS: (A) NAME / KEY: Xaa = any amino acid (B) LOCATION: 8 (Xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 29: Being Lyß Met Val Thr Glu Lyß Xaa Lys Being Gly Gly Asn Asn Pro Being 1 5 10 15 Thr Lys Glu Val Ser He Pro 20 (2) INFORMATION FOR SEQ ID NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iX) CHARACTERISTIC: (A) NAME / KEY: Xaa = any amino acid (B) LOCATION: 15 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 30: Glu Val Ser He Pro Ser Gly Lys Leu Thr He Glu Asp Phe Xaa He 1 5 10 15 Gly Asn His Gln 20 (2) INFORMATION FOR - SEQ ID NO: 31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 31: Asp He Glu Asn He Lys Lys Gly Glu Gly Gln Pro Gly Ala Pro Glv 1 5? O 15 Gly Lys Glu Asn Asn Leu Ser Val Leu 20 25 (2) INFORMATION FOR SEQ ID NO: 32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 242 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 3. . 242 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 32: AT TTT TCC CTT TGT GTT TTA TAC CAA ATT GTG GTT GCT GAT AGA AGA 47 Phe Ser Leu Cyß Val Leu Tyr Gln He Val Val Ala Aßp Arg Arg 1 5 10 15 GTT TCC AAA ACA TGT CAA AGT GGA GGA AAG ATA CAA AGT GAG GAG CAA 95 Val Ser Lyß Thr Cyß Gln Ser Gly Gly Lys He Gln Ser Glu Glu Gln 20 25 30 GTG GTA ATT AAA TCT GGA CAA CAT ATT CTT GAA AAT TAT TGC TCA GAT 143 Val Val He Lys Ser Gly Gln His He Leu Glu Asn Tyr Cys Ser Aßp 35 40 45 GGG AGA AAT AAT AAT AAT CAC TGC CAC TTG TTT TGT ATG AGA GAA TGC 191 Gly Arg Aßn Asn Asn Asn Pro Cyß His Leu Phe Cyß Met Arg Glu Cys 50 55 60 AGG TCA GGA AAC GGC GGT TGC GGA AAC GGA GGA AGG ACA AGA CCT GAT 239 Arg Ser Gly Asn Gly Gly Cly Gly Asn Gly Gly Arg Thr Arg Pro Asp 65 70 75 TCG 242 Ser 80 (2) INFORMATION FOR - SEQ ID NO: 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 80 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 33 Phe Ser Leu Cys Val Leu Tyr Gln He Val Val Wing Asp Arg Arg Val 1 5 10 15 Ser Lys Thr Cyß Gln Ser Gly Lyl He Gln Ser Glu Gllu Gln Val 20 25 30 Val He Lys Ser Gly Gln His He Leu Glu Asn Tyr Cys Ser Asp Gly 35 40 45 Arg Asn Asn Asn Asn Pro Cys His Leu Phe Cys Met Arg Glu Cyß Arg 50 55 60 Ser Gly Aßn Gly Gly Cys Gly Asn Gly Gly Arg Thr Arg Pro Asp Ser 65 70 75 80 (2) INFORMATION FOR SEQ ID NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 591 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 1.4666 (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 34: TGG AAA GTT AAT AAA AAA TGT ACA TCA GGT GGA AAA AAT CAA GAT AGA 48 Trp Lyß Val Aßn Lys Lyß Cys Thr Ser Gly Gly Lyß Aßn Gln Aßp Arg 1 5 10 15 AAA CTC GAT CAA ATA ATT CAA AAA GGC CAA CAA GTT AAA ATC CAA AAT 96 Lys Leu Asp Gln He He Gln Lys Gly Gln Gln Val Lys He Gln Asn 20 25 30 ATT TGC AAA TTA ATA CGA GAT AAA CCA CAT ACA AAT CAA GAG AAA GAA 144 He Cys Lys Leu He Arg Asp Lys Pro His Thr Asn Gln Glu Lys Glu 35 40 45 AAA TGT ATG AAA TTT TGC ACA AAA AAC GTT TGC AAA GGT TAT AGA GGA 192 Lys Cys Met Lys Phe Cys Thr Lys Asn Val Cys Lyß Gly Tyr Arg Gly 50 55 60 GCT TGT GAT GGC AAT ATT TGC TAC TGC AGC AGG CCA AGT AAT TTA GGT 240 Wing Cys Asp Gly Asn He Cys Tyr Cys Ser Arg Pro Ser Asn Leu Gly 65 70 75 80 CCT GAT TGG AAA GTC AAC GAA AGA ATC GAA AGA CTC CCA ATA ACA AAG 288 Pro Asp Trp Lys Val Asn Glu Arg He Glu Arg Leu Pro He Thr Lys 85 90 95 ATT CTC GTC TCA GGA AAT AGT TCC ATA TCG ACA ACA ATT ACG AAT TCC 336 He Leu Val Ser Gly Asn Ser Ser He Thr Thr He Thr Asn Ser 100 105 110 AAA TAT TAT GAA ACT AAA AAT TCA GAG ACC AAT GAA GAT TCC AAA TCG 384 Lys Tyr Phe Glu Thr Lys Asn Ser Glu Thr Asn Glu Asp Ser Lys Ser 115 120 125 AAA AAA CAT TCG AAA GAA AAA TGT CGT GGT GGA AAT GAT CGT GGA TGT 432 Lys Lys Hiß Ser Lys Glu Lys Cys Arg Gly Gly Asn Asp Arg Gly Cys 130 135 140 GAT GGA AAC GTT TTG TTA TTG TCG ACC AAA AAA T AAATAATAAT 476 Asp Gly Asn Val Leu Leu Leu Ser Thr Lys Lys 145 150 155 TATAATAAAT AAATTGTTAT AGTTATTAGT TATCCCGTCA CATATTAGAA AAGTGGCTTA 536 TAATTTATGA ACAATATAAC ACATAAATTA GTTGTGTAAA AAAAAAAAAA AAAAA 591 (2) INFORMATION FOR - SEQ ID NO: 35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 155 base pairs (B) TYPE: amino acids (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein ( Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 35 Trp Lys Val Asn Lys Lys Cys Thr Ser Gly Gly Lyß Aßn Gln Aßp Arg 1 5 10 15 Lyß Leu Aßp Gln He He Gln Lyß Gly Gln Gln Val Lys He Gln Aßn 20 25 30 He Cys Lys Leu He Arg Asp Lys Pro His Thr Aßn Gln Glu Lyß Glu 35 40 45 Lyß Cys Met Lys Phe Cyß Thr Lys Asn Val Cys Lys Gly Tyr Arg Gly 50 55 60 Wing Cys Asp Gly Asn He Cys Tyr Cys Ser Arg Pro Ser Asn Leu Gly 65 70 75 80 Pro Asp Trp Lys Val Asn Glu Arg He Glu Arg Leu Pro He Thr Lys 85 90 95 He Leu Val Ser Gly Aßn Ser Ser Thr Thr He Thr Asn Ser 100 105 110 Lys Tyr Phe Glu Thr Lys Aßn Ser Glu Thr Asn Glu Asp Ser Lys Ser 115 120 125 Lys Lys His Ser Lys Glu Lys Cys Arg Gly Gly Asn Aßp Arg Gly Cys 130 135 140 Asp Gly Asn Val Leu Leu Leu Ser Thr Lys Lys 145 150 155 (2) INFORMATION FOR - SEQ ID NO: 36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (i) DESCRIPTION OF SEQUENCE: SEQ ID NO: 36: 34 ATTCGGATCC ATGGAAAGTT AATAAAAAAT GTAC (2) INFORMATION FOR - SEQ ID NO: 37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 37: TAATGGATCC TTATTTTTTG GTCGACAATA AC 32 (2) INFORMATION FOR - SEQ ID NO: 38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 38: CCTGACCTGC ATTCTCTCAT AC 2 (2) PA INFORMATION A-SEQ ID NO: 39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 39: AGGTCTTGTC CTTCCTCCGT TTCCGCA 27 (2) INFORMATION FOR SEQ ID NO: 40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 40: GGAAACAGCT ATGACCATG g (2) INFORMATION FOR SEQ ID NO: 41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 41: ATTAACCCTC ACTAAAG 17 (2) INFORMATION FOR - SEQ ID NO: 42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 42: GCAAAGGTTA TAGAGGAGCT TG 22 (2) INFORMATION FOR - SEQ ID NO: 43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 43: AGCTTTCCAT CACATCCAGC 20 (2) INFORMATION FOR - SEQ ID NO: 44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 54 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 44: CGCGGATCCT ATAAATATGG AGGACATCTG GAAAGTTAAT AAAAAATGTA CATC (2) INFORMATION FOR SEQ ID NO: 45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 45: GCTCTAGAGC ATTTATTTTT TGGTCGACAA TAACAAAAC 3 (2) INFORMATION FOR SEQ ID NO: 46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 46: GGCGTCTCGA GAGAATTGAA ATTTGTGTTT GCG 33 (2) INFORMATION FOR - SEQ ID NO: 47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 47: AGACGAGAAT TCCAATTTAT CATGAGCGG 29 (2) INFORMATION FOR SEQ ID NO: 48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 48: CCGGAATTCC GGTATAAATA TGTGGCGTCT ACTG 34 (2) INFORMATION FOR SEQ ID NO: 49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: primer (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 49: CCGGAATTCT TAAGACGATT TACACAATTT ATC 33 (2) INFORMATION FOR - SEQ ID NO: 50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 646 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (i) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 3..519 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 50: CG GCA CGA GCT CGG TCT GTT GGA AGT ATG AAA AAC AAA TTG AAA AGT 47 Wing Arg Wing Arg Ser Val Gly Ser Met Lys Asn Lys Leu Lys Ser 1 5 10 15 TTT TCC GAG AAA TAT GTA TGG GCG GCT TTA ACT TCT AAC GAC AAT CTT 95 Phe Ser Glu Lys Tyr Val Trp Ala Ala Leu Thr Ser Aßn Aßp Asn Leu 20 25 30 AGG AAA ATG TCT GGA GGT CGT ATG ATT AAC GAT ATA TTG AAC GAT ATC 143 Arg Lys Met Ser Gly Gly Arg Met He Asn Asp He Leu Asn Asp He 35 40 45 GAT AAT ATA AAA GGA AAT GGA CAA CCG AAT GCT CCT GGA AAA ACT 191 Asp Asn He Lys Lys Gly Asn Gly Gln Pro Asn Wing Pro Gly Lys Thr 50 55 60 GAA AAT AAA TTA TCG GTG TCT GAC CGT TCC TCA AGG TAT CTT AGC AGC 239 Glu Aßn Lys Leu Ser Val Ser Asp Arg Ser Ser Arg Tyr Leu Ser Ser 65 70 75 ATT CGT TTC AGC CTT TTT CGT CCA AGG TAC AAA ATT GAA AAT CAG GAC 287 He Arg Phe Ser Leu Phe Arg Pro Arg Tyr Lys He Glu Asn Gln Asp 80 85 90 95 CTT GAA CCG TCT AGT TTA TAT CCT GGC CAA GGA GCC CTC CAT GTT ATT 335 Leu Glu Pro Ser Ser Leu Tyr Pro Gly Gln Gly Ala Leu His Val He 100 105 110 GAA CTG CAC AAA GAT AAG AAT CAG TGG AAT GTA AAA ACC CTC TAT AGA 383 Glu Leu His Lys Asp Lys Asn Gln Trn Asn Val Lys Thr Leu Tyr Arg 115 120 125 AAC AAT GAC CAA CAG GAA CTC AAA CCT ATG AAA CTT GCA AAA TGC GGT 431 Asn Asn Asp Gln Gln Glu Leu Lys Pro Met Lys Leu Wing Lys Cys Gly 130 135 140 GAC ACA TGT TCT TAT GAA ACT TTC AAA TCA ACT CTA CAA TCC TAT AAC 479 Asp Thr Cys Ser Tyr Glu Thr Phe Lys Ser Thr Leu Gln Ser Tyr Asn 145 150 155 ATG GAT AAG ACC GCT CAT GAT AAA TTG TGT AAA TCG TCT T AAAAATTATT 529 Met Asp Lys Thr Ala His Asp Lys Leu Cys Lys Ser Ser 160 165 170 CGTGAAAAAT AGAATTTTAT TGCTATTTTC TGTAAAACCA TATAAAGCTA TTTTAATACT 589 TTGTACAGTA TATACATAAT AAATTGCTAC ATTTGCTCTA AAAAAAAAAA AAAAAAA 646 INFORMATION FOR - SEQ ID NO: 51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 172 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: CDNA (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 51: Ala Arg Ala Arg Ser Val Gly Ser Met Lys Asn Lyß Leu Lyß Ser Phe 1 5 10 15 Ser Glu Lys Tyr Val Trp Wing Wing Leu Thr Ser Asn Asp Asn Leu Arg 20 25 30 Lyß Met Ser Gly Gly Arg Met He Aßn Aßp He Lßu Aßn Aßp He Aßp 35 40 45 Asn He Lys Lys Gly Asn Gly Gln Pro Asn Ala Pro Gly Lyß Thr Glu 50 55 60 Asn Lys Leu Ser Val Ser Asp Arg Ser Ser Arg Tyr Leu Ser Ser He 65 70 75 80 Arg Phe Ser Leu Phe Arg Pro Arg Tyr Lys He Glu Asn Gln Aßp Leu 85 90 95 Glu Pro Ser Ser Leu Tyr Pro Gly Gln Gly Ala Leu Hiß Val He Glu 100 105 110 Leu His Lys Asp Lys Asn Gln Trp Asn Val Lys Thr Leu Tyr Arg Asn 115 120 125 Asn Asp Gln Gln Glu Leu Lys Pro Met Lys Leu Ala Lys Cys Gly Asp 130 135 140 Thr Cys Ser Tyr Glu Thr Phe Lys Ser Thr Leu Gln Ser Tyr Asn Met 145 150 155 160 Asp Lys Thr Ala His Aßp Lyß Leu Cyß Lyß Ser Ser 165 170 (2) INFORMATION FOR SEQ ID NO: 52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 612 base pairs (B) TYPE: nucleic acid ( C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 2.481 (xi) DESCRIPTION OF THE SEQUENCE : SEQ ID NO: 52 C GGC ACG AGG AAA AAC GAG CTG AAA AGT TTT TCC GAA GAA TAT TTA 46 Gly Thr Arg Lys Asn Glu Leu Lys Ser Phe Ser Glu Glu Tyr Leu 1 5 10 15 TGG AGG GCT CTA ACT TCT AAT GAG AAT CTT AGA AAG ATG TCA GGA GGC 94 Trp Arg Ala Leu Thr Ser Aßn Glu Asn Leu Arg Lys Met Ser Gly Gly 20 25 30 CGT ATG ATT AAC GAT ATA TTG AAC GAT ATC GAT AGT ATA AAA GAA GAA 142 Arg Met He Asn Asp He Leu Asn Asp He Asp Ser He Lys Glu Glu 35 40 45 AGG GAC AAC CGG GTG CTC CTG GAA AAA CAG GAA ATT AAA TTA TCA ATG 190 Arg Asp Asn Arg Val Leu Leu Glu Lys Gln Glu He Lys Leu Ser Met 50 55 60 CTG ACC GTT CCT CAA GCT ATC TTA GCA GCA TTT GTT TCA GCT TTT GCT 238 Leu Thr Val Pro Gln Wing He Leu Wing Wing Phe Val Being Wing Phe Wing 65 70 75 CCC AAA GGT ACA AAA ATT GAA AAT CAG GAC CTT GGT CCG TCT AGT TTA 286 Pro Lys Gly Thr Lys He Glu Asn Gln Asp Leu Gly Pro Ser Ser Leu 80 85 90 95 TAT CCT GGC CAA GGA GCA CTC CTC GTT ATT GAA CTG CAC AAG GAT AAC 334 Tyr Pro Gly Gln Gly Ala Leu His Val He Glu Leu His Lys Asp Aßn 100 105 110 AAC CAA TGG AGT GTG AAA GTT CTC TAT AGA AAC AAT GAC AAA ATG GAA 382 Asn Gln Trp Ser Val Lys Val Leu Tyr Arg Aßn Aßn Aßp Lyß Met Glu 115 120 125 CTG GAA CCT ATG AAA CTT CCA TCA TGC GAT GAC AAA TGT CCT TGT GAA 430"Leu Glu Pro Met Lys Leu Pro Ser Cys Aβp Asp Lys Cyß Pro Cys Glu 130 135 140 CTT TTA AAT CAA CTC TAC AAT CCT ATG ATA T GAAAAAGCAG TCATGTAAAT 481 Leu Leu Asn Gln Leu Tyr Asn Pro Met He 145 150 TATGTAAAAA GCAATAAAAC TGTTGGCAAA ACATACACTT GAACATATTC TGCAAAATTA 541 TATGACGTTA TTTTTAATAT CACGAAATAA ACTACAAACA AACATATACA AATAAAAAAA 601 AAAAAAAAAA A 612 (2) INFORMATION FOR - SEQ ID NO: 53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 53 Gly Thr Arg Lyß Aßn Glu Leu Lys Ser Phe Ser Glu Glu Tyr Leu Trp 1 5 10 15 Arg Ala Leu Thr Ser Asn Glu Asn Leu Arg Lys Met Ser Gly Gly Arg 20 25 30 Met He Asn Asp He Leu Asn Asp He Asp Be He Lyß Glu Glu Arg 35 40 45 Asp Asn Arg Val Leu Leu Glu Lyß Gln Glu He Lys Leu Ser Met Leu 50 55 60 Thr Val Pro Gln Wing He Leu Wing Wing Phe Val Being Wing Phe Wing Pro 65 70 75 80 Lyß Gly Thr Lyß He Glu Aßn Gln Asp Leu Gly Pro Ser Ser Leu Tyr 85 90 95 Pro Gly Gln Gly Ala Leu His Val He Glu Leu His Lyß Asp Asn Asn 100 105 110 Gln Trp Ser Val Lys Val Leu Tyr Arg Asn Asn Asp Lys Met Glu Leu 115 120 125 Glu Pro Met Lys Leu Pro Ser Cys Asp Asp Lys Cys Pro Cys Glu Leu 130 135 140 Leu Asn Gln Leu Tyr Asn Pro Met He 145 150 INFORMATION FOR - SEQ ID NO: 54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 56 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 54 Met Trp Arg Leu Leu Leu Val He Ser Be Ala Leu He He Gln Asn 1 5 10 15 Val Asn Wing Glu Leu Lyß Phe Val Phe Wing Thr Wing Thr Arg Tyr Val 20 25 30 Ser Hiß Thr Pro Ser Pro Cys Asp Pro Gly Gly Pro Lys He Thr Aßn 35 40 45 Lyß Pro Gly Aßp Phe Gln Arg Val 50 55 Although various embodiments of the present invention have been described in detail, it can be seen that those skilled in the art will think about modifications and adaptations of those modalities. However, it should be expressly understood that such modifications and adaptations are within the scope of the present invention, as stipulated in the following claims.

Claims (46)

1. A formulation or preparation characterized by at least one isolated ectoparasite salivary protein, wherein said ectoparasite salivary protein comprises at least a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under strict conditions of hybridization with a nucleic acid molecule encoding a flea saliva protein present in a flea saliva extract selected from the group consisting of flea saliva extracts FS-1, FS-2 and FS- 3. A formulation or preparation characterized by at least one isolated ectoparasite salivary protein, wherein said ectoparasite salivary protein comprises at least a portion of an amino acid sequence, wherein said portion is encoded by an acid molecule nucleic that hybridizes under strict conditions of hybridization with a nucleic acid molecule encoding a flea salivary protein represented as a protein peak in Figure

2.

3. A formulation or preparation characterized by at least one salivary protein product of ectoparasite isolated substantially free of contaminating material, said preparation being produced by a process characterized by: (a) collection of ectoparasite saliva products with a collection means within a saliva collection device containing ectoparasites, said apparatus characterized by : (i) a structure operatively connected to a chamber, said chamber having a warmer ambient temperature than the structure by means of which a temperature differential is formed between the structure and the chamber, said structure being capable of retaining ectoparasites; and (ii) an interface between said structure and the chamber, said interface comprising ((a)) means capable of collecting at least a portion of the saliva products deposited by the ectoparasites retained in said apparatus and ((b)) means of barrier capable of substantially preventing the contaminating material from coming into contact with the collection means, wherein said temperature differential attracts the ectoparasites retained in said structure to try to feed through said barrier means and means of collection and, by means of of that, deposit deposit saliva products on said collection means; and (b) extracting said saliva products from the collection means to obtain said formulation or preparation.

4. A formulation or preparation characterized by an ectoparasite saliva product, wherein said preparation, when subjected to SDS-PAGE Tris-glycine, comprises a fractionation profile as illustrated in a figure selected from the group consisting of IB, lane 13 and FIG. IB, lane 14. A therapeutic composition for treating allergic dermatitis characterized by a formulation or preparation comprising at least one isolated ectoparasite salivary protein, wherein said ectoparasite salivary protein comprises at least minus a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule encoding a flea saliva protein present in a flea saliva extract selected from the group consisting of flea saliva extracts FS-1, FS-2 and FS-3. 6. A kit or test pack for testing whether an animal is susceptible or has allergic dermatitis, said set characterized by: (a) a formulation or preparation comprising at least one isolated ectoparasite salivary protein, wherein said Ectoparasite saliva comprises at least a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule encoding a flea saliva protein present in a flea saliva extract selected from the group consisting of flea saliva extracts FS-1, FS-2 and FS-3; and (b) means for determining whether said animal is susceptible or has allergic dermatitis, wherein said means comprises the use of said formulation or preparation for identifying susceptible animals or having allergic dermatitis. 7. An apparatus for collecting ectoparasite saliva products for use in formulation or preparation that are substantially free of contaminating material, said apparatus is characterized by: (a) a structure operatively connected to a chamber, said chamber having a warmer ambient temperature that of said structure and by means of it forming a temperature differential between said structure and said chamber, said structure being able to retain ectoparasites; and (b) an interface between said structure and said chamber, said interface comprising (i) means capable of collecting at least a portion of the saliva products deposited by ectoparasites retained in said apparatus and (ii) a barrier means capable of substantially preventing the contaminating material from coming into contact with said collection means, wherein said temperature differential attracts ectoparasites retained in said structure to try to feed by said collection means and barrier means and, thereby, deposit saliva products in said collection means. 8. A method for producing a formulation or preparation characterized by ectoparasite saliva products, wherein said formulation or preparation is substantially free of contaminating material, said method comprising: (a) collection of ectoparasite saliva products in collection means within a saliva collection apparatus containing ectoparasites, said apparatus comprising: (i) a structure operatively connected to a chamber, said chamber having a warmer ambient temperature than that of said structure and thereby forming a temperature differential between said structure and said chamber, said structure being able to retain ectoparasites; and (ii) an interface between said structure and said chamber, said interface comprising ((a)) means capable of collecting at least a portion of the saliva products deposited by ectoparasites retained in said apparatus and ((b)) a medium barrier capable of substantially preventing the contaminating material from coming into contact with said collection means, wherein said temperature differential attracts ectoparasites retained in said structure to try to feed by said collection means and barrier means and, by means of that, deposit saliva products in said collection means; and (b) extracting said products from the collection means to form said formulation or preparation. 9. A method for identifying an animal susceptible or having allergic dermatitis, said method characterized by: (a) administering to a site in said animal a preparation comprising at least one isolated ectoparasite saliva protein, wherein said protein Ectoparasite saliva comprises at least a portion of an amino acid sequence, said portion being encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions to a nucleic acid molecule encoding a flea saliva protein present in an extract of flea saliva selected from the group of saliva extracts of flea FS-1, FS-2 and FS-3, and administering to a different site of said animal a control solution selected from the group of positive control solutions and negative control solutions; and (b) comparing a reaction resulting from the administration of said preparation or formulation with a reaction resulting from the administration of said control solution, wherein it is determined whether said animal is susceptible or has allergic dermatitis, whether said reaction to the preparation is at least as large as the reaction to the positive control solution, and wherein it is determined if said animal is not susceptible or has allergic dermatitis, if said reaction to the preparation is about the same size as the reaction to the negative control solution. A method for identifying an animal susceptible or having allergic dermatitis by measuring the presence of allergic dermatitis indicator antibodies in said animal, said method characterized by: (a) contacting a formulation or preparation with a body fluid of said animal under conditions sufficient for the formation of an immune complex between said preparation and said antibodies, if present, in said body fluid, such preparation or formulation comprising at least one isolated ectoparasite salivary protein, wherein said salivary protein ectoparasite comprises at least a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under strict conditions of hybridization with a nucleic acid molecule encoding a flea saliva protein present in an extract of flea saliva selected from the group that ignite flea saliva extracts FS-1, FS-2 and FS-3; and (b) determining the amount of immune complexes formed, wherein the formation of said immune complex indicates that said animal is susceptible or has allergic dermatitis. 11. A method for desensitizing an animal to allergic dermatitis, comprising administering to said animal a therapeutic composition consisting of a preparation or formulation containing at least one isolated ectoparasite salivary protein, wherein said ectoparasite salivary protein comprises at least a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under strict hybridization conditions to a nucleic acid molecule encoding a flea salivary protein present in an extract of flea saliva selected from the group comprising flea saliva extracts FS-1, FS-2 and FS-3. 12. A method for prescribing treatment for allergic dermatitis, comprising: (a) identifying an animal that is susceptible or has allergic dermatitis, by means of an in vivo or in vitro assay comprising a preparation or formulation containing at least one isolated ectoparasite saliva protein, wherein said ectoparasite salivary protein comprises at least a portion of an amino acid sequence, wherein said portion is encoded by a nucleic acid molecule that hybridizes under strict conditions of hybridization with a molecule of nucleic acid encoding a flea salivary protein present in a flea saliva extract selected from the group comprising flea saliva extracts FS-1, FS-2 and FS-3; and (b) prescribing a treatment comprising administering said formulation or preparation to said animal. The invention of Claims 1, 2, 5, 6, 9, 10, 11 or 12, wherein said flea salivary protein is selected from the group consisting of fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. The invention of claims 1, 22, 5, 6, 9, 10, 11 or 12, wherein said flea salivary protein comprises an amino acid sequence selected from the group consisting of SEQ ID N0: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID N0: 4, SEQ ID N0: 5, SEQ ID N0: 6, SEQ ID N0: 7, SEQ ID N0: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 51, SEQ ID NO: 53 and SEQ ID NO: 54. 1

5. The invention of claims 1, 2, 3, 4, 5, 6, 7,8, 9, 10, 11, 12, 61, 62, 63 or 65, wherein said ectoparasite is selected from a group consisting of fleas , flies, mosquitoes, ticks, mites, lice, spiders, ants and beetles. 1

6. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 61, 62, 63 or 65, wherein said ectoparasite comprises the flea. The invention of Claim 16, wherein said flea is a species selected from the group consisting of Ctenocephalides canis and Ctenocephalides elis. 18. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 61, 62, 63 or 65, wherein said ectoparasite salivary protein or product of Ectoparasite saliva is selected from the group consisting of ectoparasite saliva proteins having molecular weights ranging from about 6 kilodaltons to about 65 kilodaltons, as determined by SDS-PAGE with Tris-glycine. 19. The invention of claims 1, 3, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation comprises a flea saliva extract selected from the group consisting of the saliva extract. of flea FS-1, flea saliva extract FS-2, flea saliva extract FS-3 and mixtures thereof. 20. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 61, 62, 63, 64 or 65, wherein said preparation or formulation, or a preparation that includes an expression product of said nucleic acid molecule comprises at least a portion of at least one flea saliva protein selected from the group consisting of fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH , fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. 21. The invention of Claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation comprises an ectoparasite salivary protein selected from the group consisting of fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE , fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3, and mixtures thereof. 22. The invention of Claims 1, 2, 4, 5, 6, 9, 10, 11 or 12, wherein said preparation or formulation is produced by a process comprising: (a) collecting ectoparasite saliva products with a collection medium within a saliva collection apparatus containing ectoparasites, said apparatus comprising: (i) a structure operatively connected to a chamber, said chamber having a room temperature warmer than that of said structure, and by means of which a temperature differential is formed between the structure and said chamber, said structure being able to retain ectoparasites; and (ii) an interface between said structure and the chamber, said interface comprising ((a)) means capable of collecting at least a portion of the saliva products deposited by the ectoparasites retained in said apparatus, and ((b)) a barrier means capable of substantially preventing the contaminating material from coming into contact with the collection means, wherein said temperature differential attracts the ectoparasites retained in said structure to attempt to feed through said barrier means and collection means and, by means of that, deposit deposit saliva products on said collection means; and (b) extracting said saliva products from the collection means to obtain said formulation or preparation. The invention of Claim 22, wherein the ambient temperature in said chamber ranges from about 20 ° C to about 45 ° C, to about 35 ° C. The invention of Claim 22, wherein the relative humidity in said chamber ranges from about 50 percent relative humidity, to about 100 percent relative humidity, and the relative humidity in said structure ranges from about 40%. percent relative humidity at about 60 percent relative humidity. 25. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation is produced by a process comprising: (a) collecting products of ectoparasite saliva with a collection means inside a saliva collection device containing ectoparasites, said apparatus comprising: (i) a structure operatively connected to a chamber, said chamber having a warmer ambient temperature than that of said structure, and by means of which a temperature differential is formed between the structure and said chamber, said structure being able to retain ectoparasites; and (ii) an interface between said structure and the chamber, said interface comprising ((a)) means capable of collecting at least a portion of the saliva products deposited by the ectoparasites retained in said apparatus, and ((b)) a barrier means capable of substantially preventing the contaminating material from coming into contact with the collection means, wherein said temperature differential attracts the ectoparasites retained in said structure to attempt to feed through said barrier means and collection means and, by means of that, deposit deposit saliva products on said collection means; and (b) extracting said products from the collection means with a solution to form an ectoparasite extract; (c) fractionating said ectoparasite extract to obtain fractions of separated peaks; and (d) recovering at least one said peak of fractions that is substantially free of the remaining fractions to obtain said preparation or formulation. 26. The invention of Claim 25, wherein the peaks of fractions obtained in step (c) comprise a fractionation profile as illustrated in Figure 2. 2

7. The invention of claims 1, 2, 5, 6, 9, 10, 11 or 12, wherein said preparation or formulation comprises an ectoparasite salivary protein produced by a process, comprising culturing a recombinant cell transformed with at least one nucleic acid molecule encoding at least one of said ectoparasite saliva proteins to produce said preparation or formulation. 2

8. The invention according to claims 1, 2, 3, 5, 6, 7, 61, 62, 63, 64 or 65, wherein said preparation or formulation, or preparation comprising an expression product of said nucleic acid molecule. , when administered to the animal, it is capable of substantially desensitizing said animal to allergic dermatitis. The invention of Claim 28, wherein said allergic dermatitis is selected from the group consisting of flea allergy dermatitis, mosquito allergy dermatitis, and Culicoides allergy dermatitis. 30. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 61, 62, 63, 64 or 65, wherein said preparation or formulation, or preparation comprising an expression product of said nucleic acid molecule, is used to identify susceptible animals or have allergic dermatitis. The invention of Claim 30, wherein said allergic dermatitis is selected from the group consisting of flea allergy dermatitis, mosquito allergy dermatitis, and Culicoides allergy dermatitis. 32. An isolated antibody capable of selectively binding to an ectoparasite salivary protein or ectoparasite salivary product, as set forth in Claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12. The invention of claims 1, 2, 4, 5, 6, 9, 10, 11 or 12, wherein said preparation or formulation is substantially free of contaminating material. The invention of Claim 33, wherein said contaminating material comprises material selected from the group consisting of blood proteins, faecal material, larval culture media, and mixtures thereof. 35. The invention according to claims 2 or 62, wherein said peak is selected from the group consisting of peak A, peak B, peak C, peak D, peak E, peak F, peak G, peak H, peak I, peak J, peak K, peak L, peak M and peak N. 36. The invention of claims 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 61, 62, 63, 64 or 65, wherein said preparation or formulation, or preparation comprising an expression product of said nucleic acid molecule, when subjected to SDS-PAGE Tris-glycine, consists of a fractionation profile as illustrated in a selected figure. of the group consisting of Figure IB, lane 13 and Figure IB, lane 14. 37. The invention of Claims 1, 2, 3, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said Preparation or formulation comprises less than about 50 percent polluting material. 38. The invention of claims 1, 2, 3, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation comprises less than about 10 percent polluting material. 3

9. The invention of claims 5, 6, 9, 10, 11, 12 or 63, wherein said composition further comprises at least one component selected from the group consisting of an excipient, an adjuvant and a carrier. 40. The invention of claims 5, 11 or 63, wherein said composition comprises a controlled release composition. 41. The invention of Claim 6, wherein said means of determination is selected from the group consisting of in vivo tests and in vitro tests. 42. The invention of Claim 41, wherein said in vivo test consists of a skin test, comprising: (a) administering to a site in the animal of said preparation or formulation, and the administration to a different site of said animal of a control solution selected from the group consisting of positive control solutions and negative control solutions.; and (b) comparing the reaction resulting from the administration of said preparation or formulation with the reaction, which results from the administration of said control solution, wherein it is determined that said animal is susceptible to allergic dermatitis, if said reaction to the preparation or formulation is at least as large as the reaction to the positive control solution, and wherein said animal is determined to be not susceptible, or has allergic dermatitis, if said reaction to the preparation or formulation is approximately the same size as the reaction to said negative control solution. 43. The invention of claims 6, 9, 10 or 12, wherein said kit or said method detects hypersensitivity selected from the group consisting of immediate hypersensitivity and delayed hypersensitivity. 44. The invention according to claims 9 or 42, wherein said reaction is selected from the group consisting of wheal, induration, erythema, and combinations thereof. 45. The invention of claim 41, wherein said in vitro test comprises a method for measuring the presence of allergic dermatitis indicator antibodies in said animal, wherein said method comprises: (a) contacting said preparation or formulation with a fluid from the body of said animal under conditions sufficient for the formation of an immune complex between said preparation or formulation and said antibodies, if present, in said body fluid, and (b) determining the amount of immune complexes formed, wherein said formation of immune complexes indicates that said animal is susceptible or has allergic dermatitis. 46. The invention according to claims 10 or 45, wherein said antibodies comprise IgE immunoglobulin antibodies. 48. The invention of claims 10 or 45, wherein said kit or assay detects immediate hypersensitivity in said animal. 49. The apparatus of Claims 3, 7 or 8, wherein said collection means comprises a membrane made of materials capable of gluing said products, such that said products can be eluted from said membrane. 50. The apparatus of Claims 3, 7 or 8, wherein said membrane comprises a material selected from the group consisting of polyvinyl difluorinated, cellulose esters, nitrocellulose, nylon, polysulfone and polytetrafluoroethylene. 51. The apparatus of Claims 3, 7 or 8, wherein said membrane comprises a Durapore141 * membrane. 52. The apparatus of Claims 3, 7 or 8, wherein said membrane comprises a DE-81 chromatography paper membrane. 53. The apparatus of Claims 3, 7 or 8, wherein said barrier means comprises a material selected from the group consisting of plastic, Teflon, cloth, paper, paraffin and wax. 54. The apparatus of Claims 3, 7 or 8, wherein said barrier means comprises Parafilm ™. 55. The apparatus of Claims 3, 7 or 8, wherein said apparatus further comprises staining means capable of maintaining a moisture convenient for the survival of said ectoparasite. 56. An isolated nucleic acid molecule encoding the ectoparasite salivary protein of Claims 1, 2 or 3. 57. An isolated nucleic acid molecule that hybridizes under stringent hybridization conditions to a gene coding for a human salivary protein. flea present in a flea saliva extract, selected from the group consisting of flea saliva extracts FS-1, FS-2 and FS-3. 58. A method for producing at least one ectoparasite salivary protein comprising: (a) culturing a transformed cell with at least one nucleic acid that hybridizes under stringent hybridization conditions to a gene encoding a flea salivary protein present in a flea saliva extract selected from the group consisting of flea saliva extracts FS-1, FS-2 and FS-3 to produce said protein; and (b) recovering said ectoparasite salivary protein. 59. The invention according to Claims 56, 57 or 58, wherein said nucleic acid molecule hybridizes under strict conditions of hybridization with a nucleic acid molecule encoding a flea saliva protein selected from the group consisting of fspA, fspB, fspCl, fspC2, fspDl, fspD2, fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. 60. The invention according to Claims 56, 57 or 58, wherein said nucleic acid molecule hybridizes under strict conditions of hybridization with a nucleic acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 50 and SEQ ID NO: 52. 61. A recombinant molecule comprising at least one isolated nucleic acid molecule, as set forth in Claims 56, 57 or 58, operatively linked to at least one transcription control sequence. 62. A recombinant cell comprising a cell having at least one isolated nucleic acid molecule, as set forth in Claims 56, 57 or 58, said cell being capable of expressing said nucleic acid molecule. 63. A therapeutic composition comprising at least one isolated nucleic acid molecule, as set forth in Claims 56, 57 or 58. 64. The invention according to Claim 4, wherein said preparation or formulation comprises a saliva extract of flea selected from the group consisting of the flea saliva extract FS-1, the flea saliva extract FS-2, and mixtures thereof. 65. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation comprises at least a portion of at least one protein of flea saliva selected from the group consisting of fspE, fspF, fspGl, fspG2, fspG3, fspH, fspl, fspJl, fspJ2, fspK, fspLl, fspL2, fspMl, fspM2, fspNl, fspN2 and fspN3. 66. The invention of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12, wherein said preparation or formulation comprises at least a portion of at least one protein of flea saliva selected from the group consisting of fspGl, fspG2, fspG3, fspH, fspMl, fspM2, fspNl, fspN2 and fspN3. 67. The invention of claims 10 or 45, wherein the body fluid is pretreated to remove antibodies other than IgE from said fluid.