NZ230855A

NZ230855A - Principal neutralising domain of hiv variant, dna, vaccine, assay, antibodies and treatment

Info

Publication number: NZ230855A
Application number: NZ230855A
Authority: NZ
Inventors: James R Rusche; Scott D Putney; Javaherian Kashayar; John Farley; Raymond Grimaila; Debra Lynn; Joan Petro-Breyer; Thomas O'keeffe; Gregory Larosa; Albert T Profy
Original assignee: Repligen Corp
Priority date: 1988-10-03
Filing date: 1989-10-02
Publication date: 1994-10-26
Also published as: AU640619B2; PT91881A; IL91843A0; EP0436634A1; FI911574A0; DK57391D0; JPH04502760A; WO1990003984A1; AU4403689A; DK57391A; KR900701836A

Description

<div class="application article clearfix" id="description"> • 23 0 8 5 5 Prioriv C.''to(S): ■ .*», -! /9.9-M j Cor.'irclion Fil.:ci: £/.9'. ! C'-.v ...... ! <&7HM (obp . /foited.3??, &9.l.rvZ?>fe\. C/^JMQP. ,, , .3 .nr. .. 2 6 OCT 1994 P.O. Jcurnd, Wo: .. 1.3^5. NEW ZEALAND PATENTS ACT, 1953 No.: Date: COMPLETE SPECIFICATION NOVEL HIV PROTEINS AND PEPTIDES USEFUL IN THE ^ DIAGNOSIS, PROPHYLAXIS OR THERAPY OF AIDS c E r| "wmw*"1''' I/We, REPLIGEN CORPORATION, a corporation of the State of Delaware, United States of America of One Kendall Square, Building 700, Cambridge, Massachusetts 02139, United States of America. hereby declare the invention for which I / we pray that a patent may be granted to me /us, and the method by which it is to be performed, to be particularly described in and by the following statement: - - 1 - (followed by page la) " a ?- o ,^:cj J ■ -* . £ ikJj la R167.C1C2C3 DESCRIPTION NOVEL HIV PROTEINS AND PEPTIDES USEFUL IN THE DIAGNOSIS. PROPHYLAXIS OR THERAPY OF AIDS 10 Background of the Invention Human immunodeficiency virus (HIV), human T-cell lymphotropic virus III (HTLV-III), lymphadenopathy-associated virus (LAV), or AIDS-associated retrovirus (ARV) has been identified 15 as the cause of acquired immune deficiency syndrome (AIDS) (Popovic, M., M.G. Sarngadharan, E. Read, and R.C. Gallo [1984] Science 224:497-500). The virus displays tropism for the OKT4+ lymphocyte subset (Klatzmann, D., F. Barre-Sinoussi, M.T. Nugeyre, C. Dauget, E. Vilmer, C. Griscelli, F. Brun-Vezinet, C. Rouzioux, J.D. Gluckman, J.C. Chermann, and L. Montagnier [1984] Science 225:59-63). Antibodies against HIV proteins in the sera of most AIDS and AIDS related complex 20 (ARC) patients, and in asymptomatic people infected with the virus (Sarngadharan, M.G., M. Popovic, L. Bruch, J. Schupbach, and R.C. Gallo [1984] Science 224:506-508) have made possible the development of immunologically based tests that detect antibodies to these antigens. These tests are used to limit the spread of HIV through blood transfusion by identifying blood samples of people infected with the virus. Diagnostic tests currently available commercially use the proteins of 25 inactivated virus and antigens. In addition to allowing new approaches for diagnosis, recombinant DNA holds great promise for the development of vaccines against both bacteria and viruses (Wilson, T. [1984] Bio/Technology 2:29-39). The most widely employed organisms to express recombinant vaccines have been E. coli. S. cerevisiae and cultured mammalian cells. For example, subunit vaccines against foot and mouth 30 disease (Kleid, D.G., D. Yansura, B. Small, D. Dowbenko, D.M. Moore, M.J. Brubman, P.D. McKercher, D.O. Morgan, B.H. Robertson, and H.L. Bachrach [1981] Science 214:1125-1129) and malaria (Young, J.F., W.T. Hockmeyer, M. Gross, W. Ripley-Ballou, R.A Wirtz, J.H. Trosper, R.L. Beaudoin, M.R. Hollingdale, L.M. Miller, C.L. Diggs, and M. Rosenberg [1985] Science 228:958-962) have been synthesized in E. coli. Other examples are hepatitis B surface antigen produced in yeast 35 (McAleer, W.J., E.B. Buynak, R.Z. Maigetter, D.E. Wampler, W.J. Miller, and M.R. Hilleman [1984] Nature 307:178-180) and a herpes vaccine produced in mammalian cells (Berman, P.W., T. Gregory, D. Chase, and L.A Lasky [1984] Science 227:1490-1492). . '\-A < \\ P'A m'l ^-6JUL1993 , . o. 23 0 85 5 2 R167.C1C2C3 The entire HIV envelope or portions thereof have been used to immunize animals. The terms "protein," "peptide," and "polypeptide" have been used interchangeably in this application to refer to chemical compounds having more than one amino acid. The term "compound" as used here refers to chemical compounds in general. Thus, "compound" includes proteins, peptides, and polypeptides. Also 5 included under the category of "compound" are fusion compounds where polypeptides are combined with non-polypeptide moieties. As used in the present application, the term "naturally occurring HIV envelope protein" refers to the proteins gpl60, gpl20, and gp41 only. As used in the present application, HIV refers to any HIV virus, including HIV-1 and HIV-2. Both the native gpl20 (Robey et al. [1986] Proc. Natl. Acad. Sci. 83:7023-7027; Matthews et 10 al. [1986] Proc. Natl. Acad. Sci. 83:9709-9713) and recombinant proteins (Laskey et al. [1986] Sciencc 233:209-212; Putney et al. [1986] Science 234:1392-1395) elicit antibodies that can neutralize HIV in cell culture. However, all of these immunogens elicit antibodies that neutralize only the viral variant from which the subunit was derived. Therefore, a novel vaccine capable of protecting against multiple viral variants would be advantageous and unique. 15 HIV is known to undergo amino acid sequence variation, particularly in the envelope gene (Starcich, B.R. [1986] Cell 45:637-648; Hahn, B.H. et al. [1986] Science 232:1548-1553). Over 100 variants have been analyzed by molecular cloning and restriction enzyme recognition analysis, and several of these have been analyzed by nucleotide sequencing. Some of these are the HIV isolates known as RF (Popovic, M. et al. [1984] Science 224:497-500), WMJ-1 (Hahn, B.H. et al. [1986] 20 Science 232:1548-1553), LAV (Wain-Hobson, S. et al. [1985] Cell 40:9-17), and ARV-2 (Sanchez- Pescador, R. et al. [1985] Science 227:484-492). One aspect of this invention is defining the portion of HIV that comprises the principal neutralizing domain. The principal neutralizing domain is located between the cysteine residues at amino acids 296 and 331 of the HIV envelope. The numbering of amino acids follows the published sequence of HIV-IIIB (Ratner, L. et al. [1985] Nature 313:277-25 284). This domain is known to be hypervariable but retains the type-specific antigenic and immunogenic properties related to virus neutralization. A further aspect of the subject invention is the discovery of highly conserved amino acids within the principal neutralizing domain. Although certain sequences from this region have been published (see, for example, Southwest Foundation for Biological Research, published PCT application, 30 Publication No. WO 87/02775; Genetic Systems Corporation, Published United Kingdom Application No. GB 2196634 A; Stichting Centraal Diergeneeskundig Instituut, Published EPO Application No. 0 311 219), the presence of the conserved regions described here have never before been described. Diagnostic kits or therapeutic agents using viral proteins isolated from virus infected cells or recombinant proteins would contain epitopes specific to the viral variant from which they were 35 isolated. Reagents containing proteins from multiple variants would have the utility of being more broadly reactive due to containing a greater diversity of epitopes. This would be advantageous in the screening of serum from patients or therapeutic treatment of patients. 10 15 • 20 25 30 r» % 0 5 5 3 R167.C1C2C3 Synthetic peptides can be advantageous as the active ingredient in a vaccine, therapeutic agent or diagnostic reagent due to the ease of manufacture and ability to modify their structure and mode of presentation. Synthetic peptides have been used successfully in vaccination against foot and mouth disease virus (Bittle et al. [1982] Nature 298:30-33); poliovirus (Emini et al. [1983] Nature 305:699); hepatitis B (Gerin et al. [1983] Proc. Natl. Acad. Sci. 80:2365-2369); and influenza (Shapira et al. [1984] Proc. Natl. Acad. Sci. 81:2461-2465). There is a real need at this time to develop a vaccine for AIDS. Such a vaccine, advantageously, would be effective to immunize a host against the variant AIDS viruses. Brief Summary of the Invention The subject invention defines the location of the HIV principal neutralizing domain and discloses methods to utilize this segment of the HIV envelope protein for developing diagnostic, therapeutic, and prophylactic reagents. More specifically, the HIV principal neutralizing domain is located between cysteine residues 296 and 331 of the HIV envelope protein. The location of this domain is shown in Table 1. Although the specific amino acid sequence of the principal neutralizing domain is known to be highly variable between variants, we have found that peptides from this domain are invariably capable of raising, and/or binding with, neutralizing antibodies. This unexpected discovery provides a basis for designing compositions and strategies for the prevention, diagnosis, and treatment of AIDS. The discovery of the principal neutralizing domain (also known as the "loop") resulted from extensive research involving a multitude of HIV envelope proteins and peptides from many HIV variants. Proteins and peptides capable of raising, and/or binding with, neutralizing antibodies are disclosed here. These novel HIV proteins and peptides, or their equivalents, can be used in the diagnosis, prophylaxis, and/or therapy of AIDS. Further, the peptides can be used as immunogens or screening reagents to generate or identify polyclonal and monoclonal antibodies that would be useful in prophylaxis, diagnosis and therapy of HIV infection. A further aspect of the invention is the discovery of highly conserved regions within the principal neutralizing domain. This discovery was quite unexpected because of the known variability of the amino acids within this segment of the HIV envelope protein. The proteins and peptides of the invention are identified herein by both their amino acid sequences and the DNA encoding them. Thus, they can be prepared by known chemical synthetic procedures, or by recombinant DNA means. These peptides, or peptides having the antigenic or immunogenic properties of these peptides, can be used, advantageously, in a vaccine, e.g., a cocktail of peptides, to elicit broad neutralizing antibodies in the host. Further, these peptides can be used sequentially, e.g., immunizing initially with a peptide equivalent to the principal neutralizing domain of an HIV variety followed by immunization with one or more of the above peptides. Polyclonal or monoclonal antibodies that bind to these peptides would be advantageous in prophylaxis or therapy against HIV, the causative agent of AIDS. The invention further provides kits for diagnostic use. Such kits contain one or more of the aforementioned compounds or antibodies raised against such compounds for use in detecting, neutralizing, or eliciting antibodies capable of neutralizing HIV. Figure 1 shows commonly occurring sequences of the principal neutralizing domain. Figure 2 is a schematic for multi-epitope gene construction. Figure 3 depicts the steps in the construction of a specific multi-epitope gene. Figure 4 shows the sequences of four synthesized single-stranded oligomers for construction of a multi-epitope gene. Described here is a segment of the HIV envelope protein which raises, and/or binds with, neutralizing antibodies. This unique and highly unexpected property has been observed in each HIV variant that has been examined. The segment of interest has been named the "principal neutralizing domain." The principal neutralizing domain is bounded by cysteine residues which occur at positions 296 and 331. It should be noted that these same cysteine residues have been described as beginning at 302, rather than 296 (Rusche, J.R. et al. [1988] Proc. Natl. Acad. Sci. USA 85(15):3198-3202). Because the cysteine residues are linked through disulfide bonds, the segment between the residues tends to form a loop. Therefore, the principal neutralizing domain is also referred to as the "loop." The segment of the protein envelope identified here as the principal neutralizing domain is known to be highly variable between HIV variants. Thus it is surprising that, for each variant, this segment is capable of eliciting, and/or binding with, neutralizing antibodies. The principal neutralizing domain identified here is a small segment of the HIV envelope protein. This small segment may be combined with additional amino acids, if desired, for a specific purpose. All such proteins are claimed here except where such proteins constitute a naturally occurring HIV envelope protein. As used here, the term "naturally occurring envelope protein" refers only to gpl60, gpl20, and gp41. Listed in Table 1 are sequences of the principal neutralizing domain for some of the variants tested. Table 9 contains a complete list of the principal neutralizing domains. Amino acids may be referred to using either a three-letter or one-letter abbreviation system. The following is a list of the common amino acids and their abbreviations: Brief Description of the Drawings Detailed Disclosure of the Invention 308 55 R167.C1C2C3 10 15 20 Amino acid Three-letter symbol One-letter: Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Asn and/or Asp Asx B Cysteine Cys C Glutamine Gin Q Glutamic acid Glu E Gin and/or Glu Glx Z Glycine Gly G Histidine His H Isoleucine lie I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V 25 The following is a list of proteins and peptides which comprise principal neutralizing domains or segments thereof. 30 A. Recombinant Proteins Comprising a Principal Neutralizing Domain 1. HIV 10 Kd fusion protein denoted Sub 1. The amino acid sequence of the HIV portion of Sub 1 is shown in Table 2 and the DNA sequence of the HIV portion of Sub 1 in Table 2A The amino acid sequence of Sub 1 is shown in Table 2B and the DNA sequence in Table 2C. 230 8 55 6 R167.C1C2C3 2. HIV 18 Kd fusion protein denoted Sub 2. The amino acid sequence of the HIV portion of Sub 2 is shown in Table 3 and the DNA sequence of the HIV portion of Sub 2 in Table 3A. The entire amino acid sequence of Sub 2 is shown in Table 3B and the entire DNA sequence in Table 3C. 5 3. HIV 27 Kd fusion protein denoted PB1RF. The amino acid sequence of the HIV portion of PB1RF is listed in Table 4 and the DNA sequence of the HIV portion of PB1RF is listed in Table 4A The entire amino acid sequence and DNA sequence of PBlRp are in Tables 4B and 4C, respectively. 4. HIV 28 Kd fusion protein denoted PB1MN. The amino acid sequence of the HIV 10 portion of PB1MN is shown in Table 5 and the DNA sequence of the HIV portion of PB1mn is shown in Table 5A. The entire amino acid sequence and DNA sequence of PBImn are shown in Tables 5B and 5C, respectively. 5. HIV 26 Kd fusion protein denoted PBlsc. The amino acid sequence of the HIV portion of PBlsc is listed in Table 6 and the DNA sequence of the HIV portion of 15 PBlsc *s shown in Table 6A The entire amino acid sequence and DNA sequence of PB1SC are shown in Tables 6B and 6C, respectively. 6. HIV 26 Kd fusion protein denoted PBIwj^- The amino acid sequence of the HIV portion of PB1Wmj2>s listed in Table 7 and the DNA sequence of the HIV portion of PB1wmj2 is shown in Table 7A The entire amino acid sequence and DNA 20 sequence of PBIwm^ are shown in Tables 7B and 7C, respectively. B. Synthetic Peptides Comprising Segments of the Principal Neutralizing Domuin From HIV Variants The amino acid cysteine in parentheses is added for the purpose of crosslinking to carrier 25 proteins. Also, where the peptides have cysteines at or near both ends, these cysteines can form a disulfide bond, thus giving the peptides a loop-like configuration. For any of these peptides which do not have cysteines at or near both ends, cysteines may be added if a loop-like configuration is desired. The loop configuration can be utilized to enhance the immunogenic properties of the peptides. Other amino acids in parentheses are immunologically silent spacers. 30 Peptide 135 (from isolate HIV-IIIB): Asn Asn Thr Arg Lys Ser He Arg lie Gin Arg Gly Pro Gly Arg Ala Phe Val Thr lie Gly Lys lie Gly (Cys) 35 L 4 u 8 5 7 R167.C1C2C3 Peptide 136 (from isolate HIV-IIIB): Leu Asn Gin Ser Val Glu He Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser He Arg He Gin Arg Gly Pro Gly Arg Ala Phe Val Thr He Gly Lys lie Gly Asn Met Peptide 139 (from isolate HIV-RF): Asn Asn Thr Arg Lys Ser lie Thr Lys Gly Pro Gly Arg Val He T^r Ala Thr Gly Gin lie He Gly (Cys) 10 Peptide 141 (from isolate HIV-WMJ2): Asn Asn Val Arg Arg Ser Leu Ser lie Gly Pro Gly Arg Ala Phe Arg Thr Arg Glu He lie Gly (Cys) Peptide 142 (from isolate HIV-MN): 15 Tyr Asn Lys Arg Lys Arg He His He Gly Pro Gly Arg Ala Phe Tyr Thr Thr Lys Asn He lie Gly (Cys) Peptide 143 (from isolate HIV-SC): 20 Asn Asn Thr Thr Arg Ser lie His He Gly Pro Gly Arg Ala Phe Tyr Ala Thr Gly Asp He He Gly (Cys) Peptide 131 (from isolate HIV-IIIB): 25 (Tyr) Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser He Arg He Gin Arg Gly Peptide 132 (from isolate HIV-IIIB): Pro Gly Arg Ala Phe Val Thr He Gly Lys He Gly Asn 30 Met Arg Gin AJa His Cys (Tyr) Peptide 134 (from isolate HIV-IIIB): Glu Arg Val Ala Asp Leu Asn Gin Ser Val Glu He Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser He 35 10 B 5 8 R167.C1C2C3 Peptide 339 (from isolate HIV-RF): lie Thr Lys Gly Pro Gly Arg Val He Tyr (Cys) RP341 (from isolate HIV-WMJ2): 5 Leu Ser lie Gly Pro Gly Arg Ala Phe Arg (Cys) RP343 (from isolate HIV-SC): lie His lie Gly Pro Gly Arg Ala Phe Tyr (Cys) 10 RP60 (from isolate HIV-IIIB): lie Asn Cys Thr Arg Pro Asn Asn Asn Thr Arg Lys Ser He RP33S (from isolate HIV-IIIB): 15 lie Gin Arg Gly Pro Gly Arg Ala Phe (Cys) RP337 (from isolate HIV-IIIB): Lys Ser He Arg lie Gin Arg Gly Pro Gly Arg Ala Phe (Cys) 20 RP77 (from isolate HIV-IIIB): Gly Pro Gly Arg Ala Phe RP83 (from isolate HIV-WMJ1): 25 His He His lie Gly Pro Gly Arg Ala Phe Tyr Thr Gly (Cys) RP79 (from isolate HIV-IIIB): Gin Arg Gly Pro Gly Arg Ala Phe (Cys) RP57: lie Asn Cys Thr Arg Pro Ala His Cys Asn He Ser 35 RP55: Ala His Cys Asn lie Ser • ? ^ 0 8 5 5 9 R167.C1C2C3 RP75A: (Ala Ala Ala Ala Ala Ala) Gly Pro Gly Arg (Ala Ala Ala Ala Ala Cys) RP56: lie Asn Cys Thr Arg Pro RP59: lie Gly Asp lie Arg Gin Ala His Cys Asn He Ser RP342 (from isolate HIV-MN): lie His lie Gly Pro Gly Arg Ala Phe Tyr Thr (Cys) RP96 (HIV-MN related): (Cys) Gly lie His He Gly Pro Gly Arg Ala Phe Tyr Thr (Cys) RP97 (HIV-MN related): (Ser Gly Gly) He His He Gly Pro Gly Arg Ala Phe Tyr (Gly Gly Ser Cys) RP98 (HIV-MN related): (Cys Ser Gly Gly) He His lie Gly Pro Gly Arg Ala Phe Tyr (Gly Gly Ser Cys) RP99 (HIV-MN related): (Cys Ser Gly Gly) lie His lie Gly Pro Gly Arg Ala Phe Tyr (Gly Gly Ser) RP100: (Ser Gly Gly) Thr Arg Lys Gly lie His He Gly Pro Gly Arg Ala lie Tyr (Gly Gly Ser Cys) ^ 0 8 5 5 10 10 R167.C1C2C3 RP102: (Ser Gly Gly) Thr Arg Lys Ser lie Ser He Gly Pro Gly Arg Ala Phe (Gly Gly Ser Cys) RP91 (MN-Hepatitis fusion): Arg lie His lie Gly Pro Gly Arg Ala Phe Tyr Gly Phe Phe Leu Leu Thr Arg lie Leu Thr He Pro Gin Ser Leu Asp (Cys) RP104: (Ser Gly Gly) He Gly Pro Gly Arg Ala Phe Tyr Thr Thr Lys (Gly Gly Ser Cys) RP106: (Ser Gly Gly) Arg lie His He Gly Pro Gly Arg Ala Phe (Gly 15 Gly Ser Cys) RP108: (Ser Gly Gly) His He Gly Pro Gly Arg Ala Phe Tyr Ala Thr Gly (Gly Gly Ser Cys) 20 RP70 (from isolate HIV-MN): lie Asn Cys Thr Arg Pro Asn Tyr Asn Lys Arg Lys Arg He His lie Gly Pro Gly Arg Ala Phe Tyr Thr Thr Lys Asn He lie Gly Thr He Arg Gin Ala His Cys Asn He Ser 25 RP84 (from isolate HIV-MN): lie His He Gly Pro Gly Arg Ala Phe Tyr Thr Gly (Cys) RP144 (from isolate 7887-3): 30 Asn Asn Thr Ser Arg Gly He Arg He Gly Pro Gly Arg Ala lie Leu Ala Thr Glu Arg lie He Gly (Cys) RP145 (from isolate 6587-7): Asn Asn Thr Arg Lys Gly He His lie Gly Pro Gly Arg Ala 35 Phe Tyr Ala Thr Gly Asp He He Gly (Cys) • 9JA8 55 11 R167.C1C2C3 RP146 (from isolate CC): Asn Asn Thr Lys Lys Gly lie Arg lie Gly Pro Gly Arg Ala Val Tyr Thr Ala Arg Arg lie He Gly (Cys) RP147 (from isolate KK261): Asn Asn Thr Arg Lys Gly lie Tyr Val Gly Ser Gly Arg Lys Val Tyr Thr Arg His Lys lie lie Gly (Cys) 10 RP1S0 (from isolate ARV-2): Asn Asn Thr Arg Lys Phe His Thr Thr Gly Ser lie Tyr lie Gly Pro Gly Arg Ala Arg lie He Gly (Cys) RP151 (from isolate NY5): 15 Asn Asn Thr Lys Lys Gly He Ala lie Gly Pro Gly Arg Thr Leu Tyr Ala Arg Glu Lys lie lie Gly (Cys) C. Ilybrid Peptides Containing Sequences from More Than One Variant RP73 (from isolates HIV-IIIB, HIV-RF): 20 Lys Ser He Arg He Gin Arg Gly Pro Gly Arg Val He Tyr (Cys) RP74 (from isolates HIV-IIIB, HIV-RF, HIV-MN, HIV-SC): Arg lie His He Gly Pro Gly Arg Ala Phe Tyr Ala Lys 25 Ser He Arg He Gin Arg Gly Pro Gly Arg Val He Tyr (Cys) RP80 (from isolates HIV-IIIB, HIV-RF): Arg He Gin Arg Gly Pro Gly Arg Val He Tyr Ala Thr 30 (Cys) RP81 (from isolates HIV-IIIB, HIV-RF, HIV-WMJ1, HIV-MN): Arg He His He Gly Pro Gly Arg Ala Phe Tyr Thr Gly Arg He Gin Arg Gly Pro Gly Arg Val He Tyr Ala Thr 35 (Cys) # # # 9.3 0 8 5 5 12 R167.C1C2C3 RP82 (from isolates HIV-MN, HIV-WMJ1): Arg lie His lie Gly Pro Gly Arg Ala Phe Tyr Thr Gly (Cys) 5 RP88 (from isolates HIV-MN, HIV-SC): Ser lie His lie Gly Pro Gly Arg Ala Phe Tyr Thr Thr Gly (Cys) 10 RP137 (from isolates HIV-IIIB, HIV-RF): Asn Asn Thr Arg Lys Ser He Arg He Thr Lys Gly Pro Gly Arg Ala Phe Val Thr He Gly Lys He Gly (Cys) RP140 (from isolates HIV-IIIB, HIV-RF): 15 Asn Asn Thr Arg Lys Ser lie Thr Lys Gly Pro Gly Arg Ala Phe Val Thr lie Gly Lys He Gly (Cys) Peptide 64 (from isolates HIV-IIIB, HIV-RF, HIV-MN, HIV-SC): Arg He His He Gly Pro Gly Arg Ala lie Phe Tyr Arg 20 He Gin Arg Gly Pro Gly Arg Val He Tyr (Cys) Peptide 338 (from isolates HIV-IIIB, HIV-RF): Arg He Gin Arg Gly Pro Gly Arg Val He Tyr (Cys) 25 Peptide 138 (from isolates HIV-IIIB, HIV-RF): Asn Asn Thr Arg Lys Ser lie Arg He Gin Arg Gly Pro Gly Arg Val lie Tyr Ala Thr Gly Lys lie Gly (Cys) 30 RP63 (IIIg-RF hybrid): Arg He Gin Arg Gly Pro Gly Arg Val He Tyr (Cys) 35 D. RP41: Gly Miscellaneous Peptide Sequences Pro Gly Arg • 230855 13 R167.C1C2C3 RP61: Gly Pro Gly Arg (Ala Ala Ala Ala Ala Ala Cys) 5 RP75: (Cys Ala Ala Ala Ala Ala) Gly Pro Gly Arg Ala Phe (Ala Ala Ala Cys) RP111: 10 lie Gin Arg Gly Pro Gly He Gin Arg Gly Pro Gly (Cys) RP113: Gin Arg Gly Pro Gly Arg Gin Arg Gly Pro Gly Arg Gin Arg Gly Pro Gly Arg (Cys) 15 RP114: Arg Gly Pro Gly Arg Gly Pro Gly Arg Gly Pro Gly Arg Gly Pro Gly Arg (Cys) 20 RP116: Gly Pro Gly Arg Ala Phe Gly Pro Gly Arg Ala Phe Gly Pro Gly Arg Ala Phe (Cys) RP120: 25 Ser lie Arg lie Gly Pro Gly Arg Ala Phe Tyr Thr (Cys) RP121c: (Cys) Gly Pro Gly Arg (Cys) 30 RP122c: (Cys) He Gly Pro Gly Arg Ala (Cys) RP123c: (Cys) His He Gly Pro Gly Arg Ala Phe (Cys) 35 23 0 8 55 14 R167.C1C2C3 The proteins and peptides exemplifying the subject invention can be made by well-known synthesis procedures. Alternatively, these entities can be made by use of recombinant DNA procedures. Such recombinant DNA procedures are disclosed herein since they were, in fact, the procedures initially utilized to obtain the novel proteins and peptides of the invention. However, once 5 these entities were prepared and their molecules sequenced, it is apparent to a person skilled in the art that the preferred method for making them would now be by chemical synthesis means. For example, there are available automated machines which can readily make proteins and peptides of the molecular sizes disclosed herein. In the recombinant DNA procedures for making some of the proteins and peptides of the 10 invention, an expression vector plasmid denoted pREV2.2 was used. This plasmid was initially constructed from a plasmid denoted pBGl. Plasmid pBGl is deposited in the E. coli host MS371 with the Northern Regional Research Laboratory (NRRL, U.S. Department of Agriculture, Peoria, Illinois, USA). It is in the permanent collection of this repository. E. coli MS371(pBGl), NRR1 B-15904, was deposited on November 1, 15 1984. E coli MS371, NRRL B-15129 is now available to the public. Plasmid pREV2.2 was deposited in the E. coli JM103 host with NRRL on July 30, 1986. E. coli JM103(pREV2.2) received the accession number NRRL B-18091. NRRL B-15904 and NRRL B-18091 will be available, without restrictions, to the public upon the grant of a patent which discloses them. 20 Other E. coli strains, disclosed herein, were deposited as follows: E. coli SG20251, NRRL B-15918, was deposited on December 12, 1984. E. coli CAG629(pKHl), NRRL B-18095, was deposited on July 30, 1986. This latter deposit can be subjected to standard techniques to separate the plasmid from the host cell, and, thus, use the host E. coli CAG629 as disclosed herein. 25 The subjcct cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of the patent application disclosing them to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 USC 122. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood 30 that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action. Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years 35 after the most recent request for the furnishing of a sample of the deposits, and in any case, for a 2 3 0 8 5 5 15 R167.C1C2C3 period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be 5 irrevocably removed upon the granting of a patent disclosing them. The novel HIV proteins and peptides of the subject invention can be expressed in Saccharomyces cerevisiae using plasmids containing the inducible galactose promoter from this organism (Broach, J.R., Y. Li, L.C. Wu, and M. Jayaram [1983] in Experimental Manipulation of Gene Expression, p. 83, ed. M. Inouye, Academic Press). These plasmids are called YEp51 and YEp52 10 (Broach, J.R. et al [1983]) and contain the E. coli origin of replication, the gene for ^-lactamase, the yeast LEU2 gene, the 2 /m origin of replication and the 2 /<m circle REP3 locus. Recombinant gene expression is driven by the yeast GAL10 gene promoter. Yeast promoters such as galactose and alcohol dehydrogenase (Bennetzen, J.L. and B.D. Hall [1982] J. Biol. Chem. 257:3018; Ammerer, G. [1983] in Methods in Enzymology Vol. 101, p. 192), 15 phosphoglycerate kinase (Derynck, R., R.A. Hitzeman, P.W. Gray, D.V. Goeddel [1983] in Experimental Manipulation of Gene Expression, p. 247, ed. M. Inouye, Academic Press), triose phosphate isomerase (Alber, T. and G. Kawasaki [1982] J. Molec. and Applied Genet. 1:419), or enolase (Innes, M.A et al. [1985] Science 226:21) can be used. The genes disclosed herein can be expressed in simian cells. When the genes encoding these 20 proteins are cloned into one of the plasmids as described in Okayama and Berg (Okayama, H. and P. Berg [1983] Molec. and Cell. Biol. 3:280) and references therein, or COS cells transformed with these plasmids, synthesis of HIV proteins can be detected immunologically. Other mammalian cell gene expression/protein production systems can be used. Examples of other such systems are the vaccinia virus expression system (Moss, B. [1985] Immunology Today 6:243; 25 Chakrabarti, S., K. Brechling, B. Moss [1985] Molec. and Cell. Biol. 5:3403) and the vectors derived from murine retroviruses (Mulligan, R.C. [1983] in Experimental Manipulation of Gene Expression, p. 155, ed. M. Inouye, Academic Press). The HIV proteins and peptides of the subject invention can be chemically synthesized by solid phase peptide synthetic techniques such as BOC and FMOC (Merrifield, R.B. [1963] J. Amer. Chcm. 30 Soc. 85:2149; Chang, C. and J. Meienhofer [1978] Int. J. Peptide Protein Res. 11:246). As is well known in the art, the amino acid sequence of a protein is determined by the nucleotide sequence of the DNA Because of the redundancy of the genetic code, i.e., more than one coding nucleotide triplet (codon) can be used for most of the amino acids used to make proteins, different nucleotide sequences can code for a particular amino acid. Thus, the genetic code can be 35 depicted as follows: 230855 16 R167.C1C2C3 10 15 20 25 30 Phenylalanine (Phe) TTK Histidine (His) CAK Leucine (Leu) XTY Glutamine (Gin) CAJ Isoleucine (He) ATM Asparagine (Asn) AAK Methionine (Met) ATG Lysine (Lys) AAJ Valine (Val) GTL Aspartic acid (Asp) GAK Serine (Ser) QRS Glutamic acid (Glu) GAJ Proline (Pro) CCL Cysteine (Cys) TGK Threonine (Thr) ACL Tryptophan (Trp) TGG Alanine (Ala) GCL Arginine (Arg) WGZ Tyrosine (Tyr) TAK Glycine (Gly) GGL Termination signal TAJ Termination signal TGA Key: Each 3-letter deoxynucleotide triplet corresponds to a trinucleotide of mRNA, having a 5'-end on the left and a 3'-end on the right. All DNA sequences given herein are those of the strand whose sequence corresponds to the mRNA sequence, with thymine substituted for uracil. The letters stand for the purine or pyrimidine bases forming the deoxynucleotide sequence. A = adenine G = guanine C = cytosine T = thymine X = T or C if Y is A or G X = C if Y is C or T Y = A, G, C or T if X is C Y = A or G if X is T W = C or A if Z is A or G W = C if Z is C or T Z = A, G, C or T if W is C Z = AorGifWisA QR = TC if S is A, G, C or T; alternatively QR = AG if S is T or C J = A or G K = T or C L = A, T, C or G M = A, C or T 35 • • 2308 55 17 R167.C1C2C3 The above shows that the novel amino acid sequences of the HIV proteins and peptides of the subject invention can be prepared by nucleotide sequences other than those disclosed herein. Functionally equivalent nucleotide sequences encoding the novel amino acid sequences of these HIV proteins and peptides, or fragments thereof having HIV antigenic or immunogenic or therapeutic 5 activity, can be prepared by known synthetic procedures. Accordingly, the subject invention includes such functionally equivalent nucleotide sequences. Thus the scope of the subject invention includes not only the specific nucleotide sequences depicted herein, but also all equivalent nucleotide sequences coding for molecules with substantially the same HIV antigenic or immunogenic or therapeutic activity. 10 Further, the scope of the subject invention is intended to cover not only the specific amino acid sequences disclosed, but also similar sequences coding for proteins or protein fragments having comparable ability to induce the formation of and/or bind to specific HIV antibodies possessing the properties of virus neutralization. The term "equivalent" is being used in its ordinary patent usage here as denoting a nucleotide 15 sequence which performs substantially as the nucleotide sequence identified herein to produce molecules with substantially the same HIV antigenic or immunogenic or therapeutic activity in essentially the same kind of hosts. Within this definition are subfragments which have HIV antigenic or immunogenic or therapeutic activity. As disclosed above, it is well within the skill of those in the genetic engineering art to use the 20 nucleotide sequences encoding HIV antigenic or immunogenic or therapeutic activity of the subject invention to produce HIV proteins via microbial processes. Fusing the sequences into an expression vector and transforming or transfecting into hosts, either eukaryotic (yeast or mammalian cells) or prokaryotic (bacterial cells), are standard procedures used in producing other well-known proteins, e.g., insulin, interferons, human growth hormone, IL-1, IL-2, and the like. Similar procedures, or obvious 25 modifications thereof, can be employed to prepare HIV proteins or peptides by microbial means or tissue-culture technology in accord with the subject invention. The nucleotide sequences disclosed herein can be prepared by a "gene machine" by procedures well known in the art. This is possible because of the disclosure of the nucleotide sequence. The restriction enzymes disclosed can be purchased from Bethesda Research Laboratories, 30 Gaithersburg, MD, or New England Biolabs, Beverly, MA The enzymes are used according to the instructions provided by the supplier. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. These procedures are all described in Maniatis, T., E.F. Fritsch, and J. Sambrook (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, 35 New York. Thus, it is within the skill of those in the genetic engineering art to extract DNA from • • 23 0 8 55 18 R167.C1C2C3 microbial cells, perform restriction enzyme digestions, electrophorese DNA fragments, tail and anneal plasmid and insert DNA, ligate DNA, transform cells, e.g., E. coli cells, prepare plasmid DNA electrophorese proteins, and sequence DNA Immunochemical assays employing the HIV proteins or peptides of the invention can take a 5 variety of forms. One preferred type is a liquid phase assay wherein the HIV antigen and the sample to be tested are mixed and allowed to form immune complexes in solution which are then detected by a variety of methods. Another preferred type is a solid phase immunometric assay. In solid phase assays, an HIV protein or peptide is immobilized on a solid phase to form an antigen-immunoadsorbent. The immunoadsorbent is incubated with the sample to be tested. After an 10 appropriate incubation period, the immunoadsorbent is separated from the sample, and labeled anti- (human IgG) antibody is used to detect human anti-HIV antibody bound to the immunoadsorbent. The amount of label associated with the immunoadsorbent can be compared to positive and negative controls to assess the presence or absence of anti-HIV antibody. The immunoadsorbent can be prepared by adsorbing or coupling a purified HIV protein or 15 peptide to a solid phase. Various solid phases can be used, such as beads formed of glass, polystyrene, polypropylene, dcxtran or other material. Other suitable solid phases include tubes or plates formed from or coated with these materials. The HIV proteins or peptides can be either covalently or non-covalently bound to the solid phase by techniques such as covalent bonding via an amide or ester linkage or adsorption. After the 20 HIV protein or peptide is affixed to the solid phase, the solid phase can be post-coated with an animal protein, e.g., 3% fish gelatin. This provides a blocking protein which reduces nonspecific adsorption of protein to the immunoadsorbent surface. The immunoadsorbent is then incubated with the sample to be tested for anti-HIV antibody. In blood screening, blood plasma or serum is used. The plasma or serum is diluted with normal 25 animal plasma or serum. The diluent plasma or serum is derived from the same animal species that is the source of the anti-(human IgG) antibody. The preferred anti-(human IgG) antibody is goat anti-(human IgG) antibody. Thus, in the preferred format, the diluent would be goat serum or plasma. The conditions of incubation, e.g., pH and temperature, and the duration of incubation are not crucial. These parameters can be optimized by routine experimentation. Generally, the incubation 30 will be run for 1-2 hr at about 45°C in a buffer of pH 7-8. After incubation, the immunoadsorbent and the sample are separated. Separation can be accomplished by any conventional separation technique such as sedimentation or centrifugation. The immunoadsorbent then may be washed free of sample to eliminate any interfering substance. The immunoadsorbent is incubated with the labeled anti-(human IgG) antibody (tracer) to 35 detect human antibody bound thereto. Generally the immunoadsorbent is incubated with a solution £ 5 19 R167.C1C2C3 of the labeled anti-(human IgG) antibody which contains a small amount (about 1%) of the serum or plasma of the animal species which serves as the source of the ami-(human IgG) antibody. Anti-(human IgG) antibody can be obtained from any animal source. However, goat anti-(human IgG) antibody is preferred. The anti-(human IgG) antibody can be an antibody against the Fc fragment of human IgG, for example, goat anti-(human IgG) Fc antibody. The anti-(human IgG) antibody or anti-(human IgG) Fc can be labeled with a radioactive material such as 125I; labeled with an optical label, such as a fluorescent material; or labeled with an enzyme such as horseradish peroxidase. The anti-human antibody can also be biotinylated and labeled avidin used to detect its binding to the immunoadsorbent. After incubation with the labeled antibody, the immunoadsorbent is separated from the solution and the label associated with the immunoadsorbent is evaluated. Depending upon the choice of label, the evaluation can be done in a variety of ways. The label may be detected by a gamma counter if the label is a radioactive gamma emitter, or by a fluorimeter, if the label is a fluorescent material. In the case of an enzyme, label detection may be done colorimetrically employing a substrate for the enzyme. The amount of label associated with the immunoadsorbent is compared with positive and negative controls in order to determine the presence of anti-HIV antibody. The controls are generally run concomitantly with the sample to be tested. A positive control is a serum containing antibody against HIV; a negative control is a serum from healthy individuals which does not contain antibody against HIV. For convenience and standardization, reagents for the performance of the immunometric assay can be assembled in assay kits. A kit for screening blood, for example, can include: (a) an immunoadsorbent, e.g., a polystyrene bead coated with an HIV protein or peptide; (b) a diluent for the serum or plasma sample, e.g. normal goat serum or plasma; (c) an anti-(human IgG) antibody, e.g., goat anti-(human IgG) antibody in buffered, aqueous solution containing about 1% goat serum or plasma; (d) a positive control, e.g., serum containing antibody against at least one of the novel HIV proteins or peptides; and (e) a negative control, e.g., pooled sera from healthy individuals which does not contain antibody against at least one of the novel HIV proteins or peptides. An example of a useful assay protocol which may be used as guidance in assembling such a kit is described in Current Protocols in Molecular Biology, 1989, eds. Ausubel et al., Greene Publishing, New York, Sections 11.2.5-11.2.20 and 11.4.1-11.4.3. If the label is an enzyme, an additional element of the kit can be the substrate for the enzyme. Another type of assay for anti-HIV antibody is an antigen sandwich assay. In this assay, a labeled HIV protein or peptide is used in place of anti-(human IgG) antibody to detect anti-HIV antibody bound to the immunoadsorbent. The assay is based in principle on the bivalency of antibody molecules. One binding site of the antibody binds the antigen affixed to the solid phase; the second • 230855 20 R167.C1C2C3 is available for binding the labeled antigen. The assay procedure is essentially the same as described for the immunometric assay except that after incubation with the sample, the immunoadsorbent is incubated with a solution of labeled HIV protein or peptide. HIV proteins or peptides can be labeled with radioisotope, an enzyme, etc. for this type of assay. In a third format, the bacterial protein, protein A, which binds the Fc segment of an IgG molecule without interfering with the antigen-antibody interaction can be used as the labeled tracer to detect anti-HIV antibody adsorbed to the immunoadsorbent. Protein A can be readily labeled with a radioisotope, enzyme, or other detectable species. Immunochemical assays employing an HIV protein or peptide have several advantages over those employing a whole (or disrupted) virus. Assays based upon an HIV protein or peptide will alleviate the concern over growing large quantities of infectious virus and the inherent variability associated with cell culturing and virus production. Further, the assay will help mitigate the real or perceived fear of contracting AIDS by technicians in hospitals, clinics and blood banks who perform the test. Immunochemical assays employing recombinant envelope proteins from multiple viral variants have additional advantages over proteins from a single HIV variant. Assays incorporating protein sequences from multiple variants are more likely to accurately survey antibodies in the human population infected with diverse HIV variants. Also, solid phase enzyme-linked immunosorbent assay (ELISA) utilizing different HIV variant proteins would allow determination of prevalent serotypes in different geographic locations. This determination has not been possible until now as no available antibody detection kit utilizes more than one HIV variant. Another use of recombinant proteins from HIV variants is to elicit variant-specific antisera in test animals. This antiserum would provide a reagent to identify which viral variant infected an individual. Currently, "virus typing" can only be done by viral gene cloning and sequencing. Binding of variant-specific serum to a patient viral isolate would provide a means of rapid detection not currently available. For example, sera raised to the proteins denoted PBIjub. PB1r1?, PB1mn, PB1sc, and PB1wmj2 0311 be used to screen viral isolates from patients to determine which HIV variant the clinical isolate most closely resembles. This "screening" can be done by a variety of known antibody-antigen binding techniques. Vaccines comprising one or more of the HIV proteins or peptides, disclosed herein, and variants thereof having antigenic properties, can be prepared by procedures well known in the art. For example, such vaccines can be prepared as injectables, e.g., liquid solutions or suspensions. Solid forms for solution in, or suspension in, a liquid prior to injection also can be prepared. Optionally, the preparation also can be emulsified. The active antigenic ingredient or ingredients can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. # 230855 21 R167.C1C2C3 Examples of suitable excipients are water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the vaccine can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants such as aluminum hydroxide or muramyl dipeptide or variations thereof. In the case of peptides, coupling to larger 5 molecules such as KLH sometimes enhances immunogenicity. The vaccines are conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, traditional binders and carriers include, for example, polyalkalene glycols or triglycerides. Suppositories can be formed from mixtures containing 10 the active ingredient in the range of about 0.5% to about 10%, preferably about 1 to about 2%. Oral formulations can include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions can take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain from about 10% to about 95% of active 15 ingredient, preferably from about 25% to about 70%. The compounds can be formulated into the vaccine as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl 20 groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like. A vaccine composition may include peptides containing T helper cell epitopes in combination with protein fragments containing the principal neutralizing domain. Several of these epitopes have been mapped within the HIV envelope, and these regions have 25 been shown to stimulate proliferation and lymphokine release from lymphocytes. Providing both of these epitopes in a vaccine may result in the stimulation of both the humoral and the cellular immune responses. Alternatively, a vaccine composition may include a compound which functions to increase the general immune response. One such compound is interleukin-2 (IL-2) which has been reported to 30 enhance immunogenicity by general immune stimulation (Nunberg et al. [1988] In New Chemical and Genetic Approaches to Vaccination. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). IL-2 may be coupled with an HIV peptide or protein comprising the PND to enhance the efficacy of vaccination. The vaccines are administered in a manner compatible with the dosage formulation, and in 35 such amount as will be therapeutically effective and immunogenic. The quantity to be administered 0 3 0 8 5 5 22 R167.C1C2C3 depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosage ranges are of the order of about several hundred micrograms active ingredient per individual. 5 Suitable regimes for initial administration and booster shots are also variable, but are typified by an initial administration followed in one or two week intervals by a subsequent injection or other administration. HIV is known to undergo amino acid sequence variation, particularly in the envelope gene (Starcich, B.R. [1986] Cell 45:637-648; Hahn, B.H. et al. [1986] Science 232:1548-1553). Over 100 10 variants have been analyzed by molecular cloning and restriction enzyme recognition analysis, and several of these have been analyzed by nucleotide sequencing. Some of these are the HIV isolates known as RF (Popovic, M. et al. [1984] Science 224:497-500), WMJ-1 (Hahn, B.H. el al. [1986] Science 232:1548-1553), LAV (Wain-Hobson, S. et al. [1985] Cell 40:9-17), and ARV-2 (Sanchez-Pescador, R. et al. [1985] Science 227:484-492). HIV peptides from different viral isolates 15 can be used in vaccine preparations to protect against infections by different HIV isolates. Further, a vaccine preparation can be made using more than one envelope protein fragment corresponding to the principal neutralizing domain of more than one HIV isolate to provide immunity and thus give better protection against AIDS. Alternatively, the vaccine preparation can be made using a single protein fragment that is comprised of a tandem arrangement of principal neutralizing epitopes from 20 more than one HIV isolate. By identifying the principal neutralizing domain of HIV, this polypeptide region can be applied to formulate valuable vaccine, diagnostic, and therapeutic reagents. Antibodies to recombinant peptides disclosed herein are useful as therapeutic and prophylactic reagents. The generation of polyclonal or monoclonal antibodies capable of neutralizing a variety of HIV variants could be used to reduce the incidence of accidental infection and treat HIV infected 25 people that are immuno-compromised. Additionally, immunization regimens may elicit polyclonal sera capable of broadly neutralizing several variants of HIV. The ability to neutralize multiple HIV variants is termed broadly neutralizing antibody. Broadly neutralizing antibody may neutralize two or more HIV variants or all HIV variants. Therefore, a mixture of broadly neutralizing antibodies that neutralize different groups of HIV variants would be useful for diagnosis, prophylaxis, and therapy of 30 AIDS. It is surprising and advantageous that immunization with peptides from five HIV variants would yield sera capable of neutralizing more than these five HIV variants when immunization with two does not. Example 22 shows that immunization with five peptides elicits broadly neutralizing sera. Broadly neutralizing sera may also be generated if several sequences from the hypervariable region of 35 diverse HIV variants are presented as a single synthetic peptide. Additionally, one may elicit this 0 3 0 8 5 5 23 R167.C1C2C3 broadly neutralizing sera by reimmunization of animals primed with RP136 or equivalent proteins with peptides containing only the conserved amino acids within this hypervariable region. These immunization regimens would be useful for vaccination and for deriving antibodies useful as therapeutic agents. Polyvalent immune globulin for use in passive immunization can be prepared by immunization of horses or by pooling immune human sera and fractionation of the IgG component from plasma or sera. Human or mouse monoclonal antibody producing cell lines may be prepared by standard transformation and hybridoma technology ^Methods in Enzvmology. Vol. 121, Sections I and II [1986] eds. J.J. Langone and H.V. Vunakis, Academic Press). HIV monoclonal antibody can be prepared in accord with the procedures disclosed by Matsushita et al. (Matsushita et al. [1988] Journal of Virology 62(6):2107-2114). Since, for the most part, monoclonal antibodies are produced in species other than humans, they are often immunogenic to humans. In order to successfully use these monoclonal antibodies in the treatment of humans, it may be necessary to create a chimeric antibody molecule wherein the portion of the polypeptide involved with ligand binding (the variable region) is derived from one species, and the portion involved with providing structural stability and other biological functions (the constant region) is derived from a human antibody. Methods for producing chimeric antibodies in which the variable domain is derived from one host and the constant domain is derived from a second host are well known to those skilled in the art. See, for example, Neuberger et al., WO Publication No. 86/01533, priority 9/3/84; Morrison et al., EP Publication No. 0 173 494, priority 8/27/84. An alternative method, in which an antibody is produced by replacing only the complementarity determining regions (CDRs) of the variable region with the CDRs from an immunoglobulin of the desired antigenic specificity, is described by Winter (GB Publication No. 2 188 638, priority 3/27/86). Murine monoclonals can be made compatible with human therapeutic use by producing an antibody containing a human Fc portion (Morrison, S.L. [1985] Science 229:1202-1207). Established procedures would allow construction, expression, and purification of such a hybrid monoclonal antibody. Regimens for administering immune globulin therapeutically have previously been used for a number of infectious diseases. As used herein, the term "antibody" is meant to encompass monoclonal or polyclonal antibodies, whole, intact antibodies or antibody fragments having the immunological activity of the whole antibody. Also encompassed within the term "antibody" are chimeric antibodies having the variable and constant regions from different host species, or those wherein only the CDRs are replaced. For treatment of HIV infection, compositions comprising antibodies may be administered to an individual or animal in need of treatment. Alternatively, the HIV antigens described here may be administered in order to stimulate the recipient's own immune response. When treating with an HIV antigen, a single antigen may be administered or, preferably, a broadly neutralizing antigen or mixture • 230855 24 R167.C1C2C3 of antigens may be administered. Such compositions are described in detail in the examples which follow. The ability to modify peptides made by organic synthesis can be advantageous for diagnostic, therapeutic, and prophylactic use by improving efficiency of immobilization, increasing protein stability, increasing immunogenicity, altering immunogenicity, reducing toxicity, or allowing multiple variations simultaneously. For example, peptides can be modified to increase or decrease net charge by modification of amino or carboxyl groups (carbamylation, trifluoroacetylation or succinylation of amino groups; acetylation of carboxyl groups). Peptides can be made more stable by, for example, inclusion of D-amino acids or circularization of the peptide. Reductive state of peptides can be altered by, for example, sulfonation of cystinyl groups. Peptides can also be modified covalently or non-covalently with non-proteinaceous materials such as lipids or carbohydrates to enhance immunogenicity or solubility. Polyethylene glycol can be used to enhance solubility. The subject invention includes all such chemical modifications of the proteins and peptides disclosed herein so long as the modified protein and/or peptide retains substantially all the antigenic/immunogenic properties of the parent compound. Peptides can also be modified to contain antigenic properties of more than one viral variant. This has been done, for example, with Foot and Mouth Disease virus. Foot and Mouth Disease virus is similar to HIV in that multiple variants exist and immunization with one variant does not lead to protection against other variants. The real utility of peptides as immunogens is demonstrated by eliciting immunity to more than one variant by modification of the peptide to possess properties of both natural variants. When such a modified variant was used to immunize test animals, they were protected against both Foot and Mouth virus strains A10 and A12 (Brown, F. in Virus Vaccines, ed. G. Dreesman, J. Bronson, R. Kennedy, pp. 49- HIV peptides or proteins containing a PND epitope can also be coupled with or incorporated into an unrelated virus particle, a replicating virus, or other microorganism in order to enhance immunogenicity. The HIV epitope may be genetically or chemically attached to the viral particle or microorganism or an immunogenic portion or component thereof. Antigenic epitopes have been attached to viral proteins or particles to enhance the immune response. For example, the VP6 capsid protein of rotavirus has been used as an immunologic carrier protein for an epitope of interest either in the monomeric form or as oligomers of VP6 in the form of particles (EP Publication No. 0 259 149). Similarly, Evans et al. (1989, Nature 339:385) have constructed chimaeras of the poliovirus capsid protein and an epitope of HIV gp41 to enhance immunogenicity of the HIV epitope. Foreign antigenic determinants have also been expressed and presented by bacterial cells. A Salmonella strain expressing a cloned Salmonella flagellin gene, into which was inserted an epitope of either cholera 54 [1985]). • • "J? A ■o) xj 55 25 R167.C1C2C3 toxin or hepatitis B surface antigen, was reported to elicit both cellular and humoral responses to the inserted epitopes (Newton et al. [1989] Science 244:70-72; and Wu et al. [1989] Proc. Natl. Acad. Sci. 86:4726-4730). Example 18 shows that a peptide containing amino acid sequences from two HIV variants can 5 block virus neutralization activity of two virus specific neutralizing antisera. This suggests that a peptide or protein containing sequences of two or more HIV variants can elicit an immune response effective against two or more HIV variants. Example 19 shows that co-immunization with envelope proteins from two HIV isolates elicits an immune response capable of neutralizing two HIV isolates. This suggests that co-immunization 10 with proteins from two or more HIV variants can elicit an immune response effective against two or more HIV variants. Following are examples which illustrate the process of the invention, including the best mode. These examples should not be construed as limiting. All solvent mixture proportions are by volume 15 unless otherwise noted. Example 1 - Construction of plasmid pREV2.2 The pREV2.2 plasmid expression vector was constructed from plasmid pBGl. Plasmid pBGl can be isolated from its E. co]i host by well known procedures, e.g., using cleared lysate-isopycnic 20 density gradient procedures, and the like. Like pBGl, pREV2.2 expresses inserted genes behind the E. coli promoter. The differences between pBGl and pREV2.2 are the following: 1. pREV2.2 lacks a functional replication of plasmid Crop) protein. 2. pREV2.2 has the trpA transcription terminator inserted into the Aatll site. This sequence insures transcription termination of over-expressed genes. 25 3. pREV2.2 has genes to provide resistance to ampicillin and chloramphenicol, whereas pBGl provides resistance only to ampicillin. 4. pREV2.2 contains a sequence encoding sites for several restriction endonucleases. The following procedures were used to make each of the four changes listed above: la. 5 fig of plasmid pBGl was restricted with Ndel, which gives two fragments of 30 approximately 2160 and 3440 base pairs. lb. 0.1 fig of DNA from the digestion mixture, after inactivation of the Ndel. was treated with T4 DNA Iigase under conditions that favor intramolecular ligation (200 fi\ reaction volume using standard T4 ligase reaction conditions [New England Biolabs, Beverly, MA]). Intramolecular ligation of the 3440 base pair fragment gave an 35 ampicillin resistant plasmid. The ligation mixture was transformed into the recipient • • 230855 26 R167.C1C2C3 strain E. coli JM103 (available from New England Biolabs) and ampicillin resistant clones were selected by standard procedures. lc. The product plasmid, pBGlAN, where the 2160 base pair Ndel fragment is deleted from pBGl, was selected by preparing plasmid from ampicillin resistant clones and 5 determining the restriction digestion patterns with Ndel and Sail (product fragments approximately 1790 and 1650). This deletion inactivates the rog gene that controls plasmid replication. 2a. 5 fig of pBGl N was then digested with EcoRI and Bell and the larger fragment, approximately 2455 base pairs, was isolated. 10 2b. A synthetic double stranded fragment was prepared by the procedure of Itakura et al. (Itakura, KL, J.J. Rossi, and R.B. Wallace [1984] Ann. Rev. Biochem. 53:323-356, and references therein) with the following structure: 5' GATCAAGCTTCTGCAGTCGACGCAT 3' TTCGAAGACGTCAGCTGCGTACGCC 15 GCGGATCCGGTACCCGGGAGCTCG 3* TAGGCCATGGGCCCTCGAGCTTAA 5* This fragment has Bell and EcoRI sticky ends and contains recognition sequences for several restriction endonucleases. 2c. 0.1 fig of the 2455 base pair EcoRI-BclI fragment and 0.01 fig of the synthetic 20 fragment were joined with T4 DNA ligase and competent cells of strain JM103 were transformed. Cells harboring the recombinant plasmid, where the synthetic fragment was inserted into pBGlAN between the Bell and EcoRI sites, were selected by digestion of the plasmid with Hpal and EcoRI. The diagnostic fragment sizes arc approximately 2355 and 200 base pairs. This plasmid is called pREVl. 25 2d. 5 fig of pREVl were digested with AatH. which cleaves uniquely. 2e. The following double-stranded fragment was synthesized: 5' CGGTACCAGCCCGCCTAATG 3' TGCAGCCATGGTCGGGCGGA AGCGGGCTTTTrnTGACGT3' 30 TTACTCGCCCGAAAAAAAAC 5' This fragment has AatH sticky ends and contains the trpA transcription termination sequence. 2f. 0.1 fig of AatH digested pREVl was ligated with 0.01 fig of the synthetic fragment in a volume of 20 fil using T4 DNA ligase. 23 0 8 55 27 R167.C1C2C3 2g. Cells of strain JM103, made competent, were transformed and ampicillin resistant clones selected. 2h. Using a KpnI. EcoRI double restriction digest of plasmid isolated from selected colonies, a cell containing the correct construction was isolated. The sizes of the KpnI, EcoRI generated fragments are approximately 2475 and 80 base pairs. This plasmid is called pREVITT and contains the trpA transcription terminator. 3a. 5 fxg of pREVITT, prepared as disclosed above (by standard methods) was cleaved with Ndel and XmnI and the approximately 850 base pair fragment was isolated. 3b. 5 fig of plasmid pBR325 (BRL, Gaithersburg, MD), which contains the genes conferring resistance to chloramphenicol as well as to ampicillin and tetracycline, was cleaved with Bell and the ends blunted with Klenow polymerase and dexoynucleotides. After inactivating the enzyme, the mixture was treated with Ndel and the approximately 3185 base pair fragment was isolated. This fragment contains the genes for chloramphenicol and ampicillin resistance and the origin of replication. 3c. 0.1 fig of the Ndel-XmnI fragment from pREVITT and the Ndel-Bcll fragment from pBR325 were ligated in 20 fi\ with T4 DNA ligase and the mixture used to transform competent cells of strain JM103. Cells resistant to both ampicillin and chloramphenicol were selected. 3d. Using an EcoRI and Ndel double digest of plasmid from selected clones, a plasmid was selected giving fragment sizes of approximately 2480, 1145, and 410 base pairs. This is called plasmid pREVlTT/chl and has genes for resistance to both ampicillin and chloramphenicol. 4a. The following double-stranded fragment was synthesized: Mlul EcoRV Clal BamHI Sail Hindlll Smal CGAACGCGTGGCCGATATCATCGATGG- This fragment, with a blunt end and an SstI sticky end, contains recognition sequences for several restriction enzyme sites. 4b. 5 fig of pREVlTT/chl was cleaved with Nrul (which cleaves about 20 nucleotides from the Bell site) and SstI (which cleaves within the multiple cloning site). The larger fragment, approximately 3990 base pairs, was isolated from an agarose gel. 4c. 0.1 fig of the Nrul-Sstl fragment from pREVlTT/chl and 0.01 fig of the synthetic fragment were treated with T4 DNA ligase in a volume of 20 fil ATCCGTCGACAAGCITCCCGGGAGCT 3' GCITGCGCACCGGCTATAGTAGCTAC- CTAGGCAGCTGTTCGAAGGGCCC 5' 853 28 R167.C1C2C3 4(1. This mixture was transformed into strain JM103 and ampicillin resistant clones were selected. 4e. Plasmid was purified from several clones and screened by digestion with Mlul or Clal. Recombinant clones with the new multiple cloning site will give one fragment when 5 digested with either of these enzymes, because each cleaves the plasmid once. 4f. The sequence of the multiple cicring «'te was verified. This was done by restricting the plasmid with Hpal and PvuII and isolating the 1395 base pair fragment, cloning it Into the Smal site of mpl8 and sequencing it by dideoxynucleotide sequencing using standard methods. 10 4g. This plasmid is called pREV2.2. Example 2 - Construction of the bacterial expression vector pREV2.1 Plasmid pREV2.1 was constructed using plasmid pREV2.2 and a synthetic oligonucleotide. The resulting plasmid was used to construct pPBl-Sub 1 and pPBl-Sub 2. 15 An example of how to construct pREV2.1 is as follows: 1. Plasmid pREV2.2 is cleaved with restriction enzymes Nrul and BamHI and the 4 Kb fragment is isolated from an agarose gel. 2. The following double-stranded oligonucleotide is synthesized: 20 5' CGAACGCGTGGTCCGATATCATCGATG 3' 3' GCrTGCGCACCAGGCTATAGTAGCTACCTAG 5' 3. The fragments from 1 and 2 are ligated in 20 /*1 using T4 DNA ligase, transformed into competent E. coli cells and chloramphenicol resistant colonies are isolated. 4. Plasmid clones are identified that contain the oligonucleotide from 2. spanning the 25 region from the Nrul site to the BamHI site and recreating these two restriction sites. This plasmid is termed pREV2.1. Example 3 - Construction of and expression from plasmid pPBl-Sub 1 Plasmid pPBl-Sub 1, which contains approximately 165 base pairs (bp) of DNA encoding 30 essentially the HIV env gene from the PvuII site to the Dral site, and from which is synthesized an approximately 12 Kd fusion protein containing this portion of the gpl20 envelope protein can be constructed as follows: 1. Restricting plasmid pPBl1IIB with Mlul and Dral and isolating the approximately 165 bp fragment. • ,30855 29 R167.C1C2C3 2. Restricting plasmid pREV2.1 with Mlul and Smal and isolating the large fragment, approximately 4 Kd, from an agarose gel. 3. Ligating the fragment prepared in 2. with the pREV2.1 fragment in a volume of 20 H1 using T4 DNA ligase, transforming the ligation mixture into competent cell strain 5 CAG629, and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gp120 fragment cloned in the proper orientation to generate a fusion protein. When the strain harboring this recombinant plasmid is grown in 2% medium containing 50/<g/ml ampicillin and the total complement of cellular proteins are electrophoresed on a 10 SDS-polyacrylamide gel, a protein of approximately 12 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from HIV infected individuals. Example 4 - Purification of recombinant protein containing HIV envelope sequences from plasmid 15 pPBl-Sub 1 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap (Chemapcc, Woodbury, NY) fermentor in 2% medium (2% yeast extract, bacto-tryptone, casamino acids [Difco, Detroit, MI], 0.2% potassium monobasic, 0.2% potassium dibasic, and 0.2% sodium dibasic). Fermentation temperature was 30°C, the pH was 6.8, and air 20 was provided at 1 wm. Plasmid selection was provided 20 nglm\ chloramphenicol. Typical cell yield (wet weight) was 30 g/1. 2. Cell lysis: 50 g, wet cell weight, of E. coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 8.0, 5 mM potassium ethylenediaminetetraacetic acid (KEDTA), 5 mM dithiothrcitol 25 (DTT), 15 mM /3-mercaptoethanol, 0.5% TRITON™X-100 (Pharmacia, Piscataway, NJ), and 5 mM phenylmethylsulfonyl fluoride (PMSF). The suspension was incubated for 30 min at room temperature. This material was lysed using a BEAD-BEATER™ (Biospec Products, Bartlesville, OK) containing an equal volume of 0.1-0.15 mm glass beads. The lysis 30 was done for 6 min at room temperature in 1-min intervals. The liquid was separated from the beads and centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was resuspended in 100 ml 8 M urea, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM /3-mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. • ,708 55 30 R167.C1C2C3 3. CM Chromatography: The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ (Pharmacia) equilibrated in 8 M urea, 10 mM 4-(2-hydroxyethyl-l-piperazine ethane-sulfonic acid (HEPES) pH 6.5, 15 mM /J-mercaptoethanol, and 1 mM KEDTA at room temperature. The column 5 was washed with 200 ml equilibration buffer, and the protein eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (12 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. Further purification was obtained by pooling Sub 1-containing fractions and applying to a S-200 (Pharmacia) gel filtration column equilibrated in the same buffer 10 as the previous column. Example 5 - Construction of and expression from plasmid pPBl-Sub 2 Plasmid pPBl-Sub 2, which contains approximately 320 bp of DNA encoding essentially the HIV env gene from the PvuII site to the Seal site, and from which is synthesized an approximately 15 18 Kd fusion protein containing this portion of the gpl20 envelope protein, can be constructed as follows: 1. Restricting the pPBljng plasmid with Mlul and Seal and isolating the approximately 320 bp fragment. 2. Restricting plasmid pREV2.1 with Mlul and Smal and isolating the large fragment, 20 approximately 4 Kd, from an agarose gel. 3. Ligating the fragment prepared in 2. with the pREV2.1 fragment in a volume of 20 pi\ using T4 DNA ligase, transforming the ligation mixture into competent cell strain SG20251 and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gpl20 25 fragment cloned in the proper orientation to generate a fusion protein. When the strain harboring this recombinant plasmid is grown in 2% medium containing 50/<g/ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyaciylamide gel, a protein of approximately 18 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from 30 HIV infected individuals. Example 6 - Purification of recombinant protein containing HIV envelope sequences from plasmid pPBl-Sub 2 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap fermentor in 2% 35 medium. Fermentation temperature was 37°C, the pH was 6.8, and air was provided # • • ?! 0 a 5 31 R167.C1C2C3 at 1 wm. Plasmid selection was provided by 20 /<g/ml chloramphenicol. Typical cell yield (wet weight) was 30 g/1. 2, Cell lysis: 50 g, wet cell weight, of E. coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 5 8.0, 5 mM KEDTA, 5 mM DTT, 15 mM /3-mercaptocthanol, 0.5% TRITON™X- 100, and 5 mM PMSF. The suspension incubated for 30 min at room temperature. This material was lysed using a BEAD-BEATER™ containing an equal volume of 0.1-0.15 mm glass beads. The lysis was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and 10 centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was resuspended in 100 ml 6 M guanidine-hydrochloride, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM /9-mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA. The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. The supernate (90 ml) was dialyzed against 4 liters of 8 M urea, 20 mM 15 sodium formate, pH 4.0,1 mM EDTA, and 15 mM /J-mercaptoethanol. Dialysis was done each time for 8 hr or longer with three changes of buffer. Spectraphor dialysis tubing (S/P, McGraw Park, IL) with a 3.5 Kd MW cut-off was used. 3. CM Chromatography: The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ (Pharmacia) equilibrated in 8 20 M urea, 20 mM sodium formate pH 4.0, 15 mM /3-mercaptoethanol, and 1 mM Na EDTA at room temperature. The column was washed with 2Q0 ml equilibration buffer, and the protein eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (18 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. 25 Further purification was obtained by pooling Sub 2-containing fractions and applying to an S-200 (Pharmacia) gel filtration column equilibrated in the same buffer as the previous column. Example 7 - Synthetic peptides 30 Synthesis of peptides can be done by a variety of established procedures, for example, automated peptide synthesis. Peptides were assembled by solid-phase synthesis on cross-linked polystyrene beads starting from the carboxyl terminus and adding amino acids in a step-wise fashion (Merrifield, R.B. [1963] S. Am. Chem. Soc. 85:2149). Each synthesis was performed on an automated peptide synthesizer (Applied Biosystems 430-A) using standard t-Boc chemistry. Amino acids were 35 coupled as highly reactive symmetric anhydrides formed immediately prior to use. To minimize A *** *\ 32 R167.CIC2C3 coupling difficulties, dimethylformamide was used as the coupling buffer. The quantitative ninhydrin assay was used to measure the efficiency of coupling after each amino acid addition (Sarin, V.K., S.B.H. Kent, J.P. Tam, R.B. Merrifield [1981] Anal. Biochem. 117:147 1981). All peptides were deprotected and cleaved from the polystyrene support using an alternative to HF cleavage. Resin containing peptide was resuspended in a mixture of trifluoroacetic acid, trifluoromethane sulfonic acid, and organic thiol scavengers (Tam, J.P., W.F. Heath, R.B. Merrifield [1986] J. Am. Chem. Soc. 108:5242). Soluble peptide was precipitated with ethyl ether and, after removing ether, resuspended in 200 mM sodium carbonate, 3 M guanidine HC1. The crude peptides were purified by reverse-phase chromatography on a 1.0 cm x 25 cm Vidac semi-preparative C18 column. The buffers employed were: (A) 0.1% trifluoroacetic acid in H20, and (B) 0.1% trifluoroacetic acid in 80% acetonitrile/20% H20. Gradient elution was utilized to elute the bound peptide and collected fractions were further analyzed to identify pure product. Peptide identity was confirmed by amino acid analysis following 6 N HC1 hydrolysis. The synthesis included the addition of terminal amino acids not homologous to HIV for purposes of labeling, cross-linking, or structure of the peptide. These non-HIV amino acids are indicated in parenthesis. The product of synthesis can be further purified by a number of established separatory techniques, for example, ion exchange chromatography. Example 8 - Construction of and expression from plasmid pPBlpp Plasmid pPBlRp, which contains approximately 565 bp of DNA encoding essentially the HIVRF env gene from the PvuII site to the Belli site, and from which is synthesized an approximately 27 Kd fusion protein containing this portion of the gpl20 envelope protein can be constructed as follows: 1. Synthesizing DNA fragment in Table 4A. 2. Restricting plasmid pREV2.2 with EcoRV and BamHI and isolating the large fragment, approximately 4 Kd, from an agarose gel. 3. Ligating the fragment prepared in 1. with the pREV2.2 fragment in a volume of 20 ftl using T4 DNA ligase, transforming the ligation mixture into competent cell strain CAG 629, and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gpl20 fragment cloned in the proper orientation to generate a fusion protein. When the strain harboring this recombinant plasmid is grown at 32°C in 2% medium containing 50 /tig/ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyacrylamide gel, a protein of approximately 27 Kd can be visualized by '308 55 33 R167.C1C2C3 either coomassie blue staining or by Western blot analysis using as probe selected sera from HIV infected individuals. Example 9 - Purification of recombinant protein containing HIV envelope sequences from plasmid 5 ™.RF 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap fermentor in 2% medium. Fermentation temperature was 30°C, the pH was 6.8, and air was provided at 1 win. Plasmid selection was provided by 20 /<g/ml chloramphenicol. Typical cell yield (wet weight) was 30 g/1. 10 2. Cell lysis: 50 g, wet cell weight, of E coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 8.0, 5 mM KEDTA, 5 mM DDT, 15 mM 0-mercaptoethanol, 0.5% TRITON™X-100, and 5 mM PMSF. 300 mg Iysozyme was added and the suspension incubated for 30 min at room temperature. 15 This material was lysed using a BEAD-BEATER™ containing an equal volume of 0.1-0.15 mm glass beads. The lysis was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was resuspended in 100 ml 8 M urea, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM /J-20 mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. The supemate (90 ml) was dialysed against 4 liters of 8 M urea, 20 mM HEPES, pH 6.5, 1 mM EDTA, and 15 mM /?-mercaptoethanol. Dialysis was done each time for 8 hr or longer with three changes of buffer. Spectrophor dialysis tubing 25 with a 3.5 Kd MW cut-off was used. 3. CM Chromatography: The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ equilibrated in 8 M urea, 10 mM HEPES pH 6.5, 15 mM /3-mercaptoethanol, and 1 mM Na EDTA at room temperature. The column was washed with 200 ml equilibrium buffer, and the protein 30 eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (26 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. Further purification was obtained by pooling PBlRrcontaining fractions and applying to an S-300 gel filtration column equilibrated in the same buffer as the 35 previous column. 230 8 55 34 R167.C1C2C3 Example 10 - Construction of and expression from plasmid pPBU<w Plasmid pPBlMN, which contains approximately 600 bp of DNA encoding essentially the HIVMN env gene from the Belli site to the Belli site, and from which is synthesized an approximately 5 28 Kd fusion protein containing this portion of the gpl20 envelope protein, can be constructed as follows: 1. Synthesizing DNA fragment in Table 5A. 2. Restricting plasmid pREV2.2 with BamHI. 3. Ligating the fragment prepared in 1. with the pREV2.2 fragment in a volume of 20 10 (i\ using T4 DNA ligase, transforming the ligation mixture into competent cell strain CAG 629, and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gpl20 fragment cloned in the proper orientation to generate a fusion protein. When the strain harboring this recombinant plasmid is grown at 32°C in 2% medium containing 15 50 /<g/ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyacrylamide gel, a protein of approximately 28 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from HIV infected individuals. 20 Example 11 - Purification of recombinant protein containing HIV envelope sequences from plasmid PPBImn 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap fermentor in 2% medium. Fermentation temperature was 30°C, the pH was 6.8, and air was provided at 1 wm. Plasmid selection was provided by 20 /*g/ml chloramphenicol. Typical cell 25 yield (wet weight) was 30 g/1. 2. Cell lysis: 50 g, wet cell weight, of E. coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 8.0, 5 mM KEDTA, 5 mM DTT, 15 mM /J-mercaptoethanol, 0.5% TRITON™X-100, and 5 mM PMSF. 300 mg lysozyme was added and the suspension incubated for 30 30 min at room temperature. This material was lysed using a BEAD-BEATER™ containing an equal volume of 0.1-0.15 mm glass beads. The lysis was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was 35 resuspended in 100 ml 8 M urea, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM ft- • • 8 55 35 R167.C1C2C3 mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA. The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. The supernate (90 ml) was dialysed against 4 liters of 8 M urea, 20 mM HEPES, pH 6.5, 1 mM EDTA, and 15 mM /3-mercaptoethanol. Dialysis was done 5 each time for 8 hr or longer with three changes of buffer. Spectraphor dialysis tubing with a 3.5 Kd MW cut-off was used. 3. CM Chromatography: The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ equilibrated in 8 M urea, 10 mM HEPES pH 6.5, 15 mM /9-mercaptoethanol, and 1 mM KEDTA at room 10 temperature. The column was washed with 200 ml equilibration buffer, and the protein eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (28 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyaciylamide gel electrophoresis. Further purification was obtained by pooling PBlMN-conta'ning fractions and 15 applying to an S-300 gel filtration column equilibrated in the same buffer as the previous column. Example 12 — Construction of and expression from plasmid pPBlgr Plasmid pPBlSc, which contains approximately 570 bp of DNA encoding essentially the H1VSC 20 env gene from the PvuII site to the Belli site, and from which is synthesized an approximately 26 Kd fusion protein containing this portion of the gpl20 envelope protein, can be constructed as follows: 1. Synthesizing DNA fragment in Table 6A. 2. Restricting plasmid pREV2.2 with EcoRV and BamHI and isolating the large fragment, approximately 4 Kd, from the agarose gel. 25 3. Ligating the fragment prepared in 1. with the pREV2.2 fragment in a volume of 20 fi\ using T4 DNA ligase, transforming the ligation mixture into competent cell strain CAG 629, and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gpl20 fragment cloned in the proper orientation to generate a fusion protein. When the 30 strain harboring this recombinant plasmid is grown at 32°C in 2% medium containing 50 fig!ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyacrylamide gel, a protein of approximately 26 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from HIV infected individuals. 35 ^08 55 36 R167.C1C2C3 Example 13 - Purification of recombinant protein containing HIV envelope sequences from plasmid pPBlSc 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap fermentor in 2% medium. Fermentation temperature was 30°C, the pH was 6.8, and air was provided 5 at 1 wm. Plasmid selection was provided by 20 //g/ml chloramphenicol. Typical cell yield (wet weight) was 30 g/1. 2. Cell lysis: 50 g, wet ceil weight, of E. coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 8.0, 5 mM KEDTA, 5 mM DTT, 15 mM /S-mercaptoethanol, 0.5% TRITON™X- 10 100, and 5 mM PMSF. 300 mg lysozyme was added and the suspension incubated for 30 min at room temperature. This material was lysed using a BEAD-BEATER™ containing an equal volume of 0.1-0.15 mm glass beads. The lysis was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and 15 centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was resuspended in 100 ml 8 M urea, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM /?-mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA. The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. The supernate (90 ml) was dialysed against 4 liters of 8 M urea, 20 mM 20 HEPES, pH 6.5, 1 mM EDTA, and 15 mM ^-mercaptoethanol and 1 mM KEDTA at room temperature. The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ equilibrated in 8 M urea, 10 mM HEPES pH 6.5, 15 mM ^-mercaptoethanol, and 1 mM KEDTA at room temperature. The column was washed with 200 ml equilibration buffer, and the 25 protein eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (26 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. Further purification was obtained by pooling PBlsc-containing fractions and applying to an S-300 gel filtration column equilibrated in the same buffer as the 30 previous column. Example 14 - Construction of and expression from plasmid pPBIiymy-? Plasmid pPBly/Mj2, which contains approximately 560 bp of DNA encoding essentially the HIVwmj2 env gene and from which is synthesized an approximately 26 Kd fusion protein containing 35 this portion of the gpl20 envelope protein, can be constructed as follows: 0 2308 5 37 R167.C1C2C3 1. Synthesizing DNA fragment in Table 7A. 2. Restricting plasmid pREV2.2 with EcoRV and BamHI and isolating the large fragment, approximately 4 Kd, from an agarose gel. 3. Ligating the fragment prepared in 1. with the pREV2.2 fragment in a volume of 20 5 fi\ using T4 DNA ligase, transforming the ligation mixture into competent cell strain CAG 629, and selecting ampicillin-resistant transformants. 4. Selecting such transformants, by appropriate restriction patterns, that have the gpl20 fragment cloned in the proper orientation to generate a fusion protein. When the strain harboring this recombinant plasmid is grown at 32°C in 2% medium containing 10 50 /Ug/ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyacrylamide gel, a protein of approximately 26 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from HIV infected individuals. 15 Example 15 — Purification of recombinant protein containing HIV envelope sequences from plasmid EEMwmj2 1. Growth of cells: Ceils were grown in a 10-liter volume in a Chemap fermentor in 2% medium. Fermentation temperature was 30°C, the pH was 6.8, and air was provided at 1 wm. Plasmid selection was provided by 20 ^g/ml chloramphenicol. Typical cell 20 yield (wet weight) was 30 g/1. 2. Cell lysis: 50 g, wet cell weight, of E. co]i containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 8.0, 5 mM KEDTA, 5 mM DTT, 15 mM 0-mercaptoethanol, 0.5% TRITON™X-100, and 5 mM PMSF. 300 mg Iysozyme was added and the suspension incubated for 25 30 min at room temperature. This material was lysed using a BEAD-BEATER™ containing an equal volume of 0.1-0.15 mm glass beads. The lysis was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was 30 resuspended in 100 ml 8 M urea, 20 mM Tris-Cl pH 8.0, 5 mM DTT, 15 mM /S- mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 xg for 2 hr. The supernate (90 ml) was dialysed against 4 liters of 8 M urea, 20 mM HEPES, pH 6.5, 1 mM EDTA, and 15 mM /3-mercaptoethanoI. Dialysis was done • • 230855 38 R167.C1C2C3 each time for 8 hr or longer with three changes of buffer. Spectraphor dialysis tubing with a 3.5 Kd MW cut-off was used. 3. CM Chromatography: The dialysate was loaded onto a 100 ml column (2.5 cm x 20 cm) packed with CM FAST FLOW SEPHAROSE™ equilibrated in 8 M urea, 10 5 mM HEPES pH 6.5, 15 mM /S-mercaptoethanoI, and 1 mM Na EDTA at room temperature. The column was washed with 200 ml equilibration buffer, and the protein eluted with a 1.0 liter linear gradient from 0-0.4 M NaCl. The HIV protein (26 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. 10 Further purification was obtained by pooling PBlWMJ2"conlaining fractions and applying to an S-300 gel filtration column equilibrated in the same buffer as the previous column. Example 16 - Cell fusion inhibition 15 The in vitro fusion of HIV infected cells with T4 positive T cells is measured in the presence and absence of immune serum. This is a well known assay (Putney et al. [1986] Science 234:1392-1395). Chronically infected cells and uninfected cells (1:15) are mixed and incubated 24 hr. Foci of fused cells (giant cells) are then counted (usually about 60). Dilution of an immune serum, for 20 example, serum to the entire HIV envelope (gpl60) or to a protein or peptide of the invention, is added when the cells are mixed. A 90% decrease in giant cells after 24 hr indicates the immune serum can block fusion. This assay can be done with cells infected with various virus strains, for example, HIVB and HIVRp. 25 Example 17 - Competition cell fusion Using the assay described in Example 16, one can determine if proteins or peptides contain the epitope recognized by antibodies that are responsible for cell fusion inhibition. For example, fusion inhibition of HIVmB infected cells by antiserum to the PBl-IIIg protein of the parent application is abated by addition of PBl-IIIg protein to 5 /<g/ml. Using antiserum to PB1-IIIb and 30 adding any one of the proteins or peptides, for example, Sub 2, Sub 1, CNBrl, peptide 135 or peptide 136 at 5 /tg/ml totally blocks the activity of the PB1 antiserum. Additionally, antiserum to PB1-RF that is capable of neutralizing HIV-RF can be blocked in this activity by peptide 139. A peptide containing only the central portion of the peptide 139, e.g., peptide 339, also can block the fusion inhibition activity of antiserum to PB1-RF. This, for the first time, localizes the critical amino acids Li- 308 55 39 R167.C1C2C3 necessary to elicit neutralization or block fusion inhibiting antibody to a ten amino acid sequence (e.g., peptide 339). Example 18 - Co-immunization of PBl-IIIn and PBlpp 5 Antisera from an animal immunized with two PB1 proteins from HIVi1IB and HIVRF isolates were capable of blocking cell fusion of both HIVjhB- and HIVRp-infected cells. This demonstrates that co-immunization with separate proteins containing envelope sequences of two HIV isolates elicits an immune response capable of neutralizing both isolates. This novel property of small proteins or peptides blocking immune serum has not been described before. 10 Some of the proteins and peptides of the subject invention contain the entire epitope for raising humoral immune responses that neutralize HIV infection and block HIV infected cell fusion. This is shown by these proteins and peptides competing these activities out of serum from animals immunized with the entire HIV envelope. More specifically, proteins and peptides that can compete the activities from anti-gpl60 or anti-PBl sera are Sub 2, Sub 1, CNBrl, peptide 135, and peptide 136. 15 The proteins and peptides of the invention also can be used to stimulate a lymphocyte proliferative response in HIV infected humans. This then would stimulate the immune system to respond to HIV in such individuals. Example 19 — Construction of and expression from plasmid pPBl nm 20 Plasmid pPBl, which contains approximately 540 bp of DNA encoding essentially the HIV env gene from the PvuII site to the Bgl.II site, and from which is synthesized an approximately 26 Kd fusion protein containing this portion of the gpl20 envelope protein, can be constructed as follows: 1. Synthesizing the DNA with the sequence shown in Table 8: This DNA fragment can be synthesized by standard methods and encodes a portion of gpl20. It has a blunt 25 end on the 5' end and an end which will ligate with a BamHI overhang on the 3' end. 2. Restricting 5 fig plasmid pREV2.2 with EcoRV and BamHI and isolating the large fragment, approximately 4 Kd, from an agarose gel. 3. Ligating 0.1 fig of the fragment in Table 8 with 0.1 fig of the pREV2.2 fragment in a volume of 20 fi\ using T4 DNA ligase, transforming the ligation mixture into 30 competent cell strain SG20251, and selecting ampicillin-resistant transformants. 4. Using the Ahalll restriction pattern of purified plasmid, selecting cells harboring the recombinant plasmid with the synthesized fragment in the orientation whereby the fragment blunt end ligated to the REV2.2 EcoRV end and the BamHI overhanging ends ligated together. Ahalll digestion of the proper plasmid gives fragment lengths 35 of approximately 1210,1020, 750, 690, 500, 340, and 20 base pairs. When the strain 2308 55 40 R167.C1C2C3 harboring this recombinant plasmid is grown in 2% medium containing 50 ftg/ml ampicillin and the total complement of cellular proteins electrophoresed on an SDS-polyacrylamide gel, a protein of approximately 26 Kd can be visualized by either coomassie blue staining or by Western blot analysis using as probe selected sera from AIDS, ARC, or HIV infected individuals. Example 20 - Purification of recombinant protein containing HIV envelope sequences from plasmid E£21iiib 1. Growth of cells: Cells were grown in a 10-liter volume in a Chemap fermentor in 2% 10 medium. Fermentation temperature was 37°C, the pH was 6.8, and air was provided at 1 wm. Plasmid selection was provided by 50 /<g/ml ampicillin and 20 /<g/ml chloramphenicol, "typical cell yield (wet weight) was 30 g/1. 2. Cell lysis: 50 g, wet cell weight, of E. coli containing the recombinant HIV envelope fusion protein were resuspended in a final volume of 100 ml in 50 mM Tris-Cl pH 15 8.0, 5 mM KEDTA, 5 mM DTT, 15 mM y3-mercaptoethanol, 0.5% TRlTON™X- 100, and 5 mM PMSF. 300 mg lysozyme was added and the suspension incubated for 30 min at room temperature. This material was lysed using a BEAD-BEATER™ (Biospec Products, Bartlesville, OK) containing an equal volume of 0.1-0.15 mm glass beads. The lysis 20 was done for 6 min at room temperature in 1 min intervals. The liquid was separated from the beads and centrifuged for 2.5 hr at 20,000 xg. The supernatant was removed and the pellet was resuspended in 100 ml 6 M guanidine-hydrochloride, 20 mM Tris-Cl pH 8.0,5 mM DTT, 15 mM /J-mercaptoethanol, 5 mM PMSF, and 1 mM KEDTA. The pellet was solubilized using a polytron homogenizer and centrifuged at 20,000 25 xg for 2 hr. The supernate (90 ml) was dialysed against 4 liters of 8 M urea, 20 mM Tris-Cl, pH 8.0, 1 mM EDTA, and 15 mM /3-mercaptoethanol. Dialysis was done each time for 8 hr or longer with three changes of buffer. Spectraphor dialysis tubing (S/P, McGraw Park, IL) with a 3.5 Kd MW cut-off was used. 30 3. CM Chromatography: The dialysate was loaded onto a 550 ml column (5 cm x 28 cm) packed with CM FAST FLOW SEPHAROSE™ equilibrated in 8 M urea, 10 mM potassium phosphate pH 7.0, 15 mM /J-mercaptoethanol, and 1 mM KEDTA at room temperature. The column was washed with 2 liters equilibration buffer, and the protein eluted with a 5.0 liter linear gradient from 0-0.4 M NaCl. The HIV • 23005 41 R167.C1C2C3 protein (26 Kd) eluted at approximately 0.2 M NaCl as assayed by SDS-polyacrylamide gel electrophoresis. Example 21 - Immunization with two or more peptides to obtain broadly neutralizing antisera Five peptides, i.e., peptide 135, peptide 139, peptide 141, peptide 142 and peptide 143, were cross-linked individually to carrier proteins and used to immunize goats. Each peptide is capable of eliciting type specific neutralization when used individually as an immunogen. Synthetic peptides were cross-linked through a sulfhydryl bond to keyhole limpet hemocyanin (KLH) by using Succinimidyl-4-(n-Maleimidomethyl)Cyclohexane 1-Carboxylate (Pierce). The ratio of peptide to KLH was 1:2 by weight. 200 //g of each cross-linked peptide was used in the immunization cocktail (a total of 1 mg of 5 peptides, 2 mg of KLH). This method of crosslinking or immunization regimen is but an example and not meant to be limiting. After four immunizations, immune sera was tested for neutralization of these five HIV isolates as well as distinctly different isolates. The immune serum could block fusion of cells infected with any of five isolates from which the peptide sequences were derived. In addition, the serum neutralized other variants not used in the immunization. Equivalent broad neutralizing sera may also be obtained by variations of this immunogen. For example, using more than five peptides having the amino acid sequence derived from the principal neutralizing domain from more than five variants. Alternatively, a single peptide (e.g., peptide 64 or peptide 74) containing segments homologous to diverse HIV variants may also be used to elicit broad neutralizing antibody. Example 22 - Sequential Immunization with Two or More Peptides as a Method to Elicit Broad Neutralizing Antisera An immunization protocol capable of eliciting broad neutralizing antibodies may take the form of initial immunization with a peptide or protein antigenically equivalent to the principal neutralizing domain, or segments thereof. The initial immunization is followed with a second immunization. The initial immunization could be done with, for example, peptide 135, peptide 139, peptide 141, peptide 142, or peptide 143, with subsequent immunization with, for example, one or more of the following peptides: RP57 lie Asn Cys Thr Arg Pro Ala His Cys Asn lie Sr RP55 Ala His Cys Asn lie Ser RP75 (Ala Ala Ala Ala Ala Ala) Gly Pro Gly Arg (Ala Ala Ala Ala Ala Ala Cys) RP56 lie Asn Cys Thr Arg Pro RP59 lie Gly Asp lie Arg Gin Ala His Cys Asn lie Sr • 230855 42 R167.C1C2C3 The method is to immunize with a protein or peptide and then boost the immune response to a defined subset of the original immunogen. This immunization method may be useful in vaccine methodology and also to generate broad neutralizing polyclonal or monoclonal antibodies for 5 therapeutic applications. Example 23 — Identification of Critical Segments of the Principal Neutralizing Domain Certain segments of the principal neutralizing domain have been found to be capable of eliciting the antigenic and immunogenic responses which are associated with the principal neutralizing 10 domain as a whole. For example, a region of the principal neutralizing domain known as the "tip of the loop" has been shown to be capable of raising, and/or binding with, neutralizing antibodies. This capability is observed for the "tip of the loop" of a variety of HIV variants. The tip of the loop comprises a three amino acid segment which is highly conserved between HIV variants, together with various amino acids which occur on either side of the three conserved 15 amino acids. The three conserved amino acids, which are Gly Pro Gly, usually occur at, or about, positions 311, 312, and 313 of the HIV envelope protein. The "tip of the loop" comprises the Gly Pro Gly segment together with the 2 to 8 amino acids which flank either or both sides of this segment in any given HIV variant. The amino acids which flank the conserved segment may be any of the 20 natural amino acids, in any sequential order. 20 Although the amino acid sequence of the principal neutralizing domain varies between different HIV- 1 isolates, conservation at particular positions, for example at the tip of the loop, suggests that certain amino acids at these positions are necessary for virus function. Example 24 - Sequence of the Principal Neutralizing Determinant from Randomly Selected HIV-1 25 Isolates Sequences of the principal neutralizing domains (PNDs) from random field isolates were obtained in order to determine the degree of heterogeneity within this region of the envelope protein. Peripheral blood lymphocytes (PBLs) from randomly selected HIV-1 infected donors were either co-cultured with uninfected PBLs or the virus isolates were adapted to CD4 cell lines. DNA was 30 extracted from these infected cells and a 240 base pair region encoding the PND was amplified by polymerase chain reaction using oligonucleotide primers that hybridize with flanking conserved regions. This product was cloned into pUC19 and the sequence of the PND from one or more clones from each original isolate were determined. Because of the heterogeneity of the virus population within one infected individual, when two or more sequences were obtained from one PCR reaction, these 35 sequences sometimes differed. t 23 0 8 55" 43 R167.C1C2C3 The data obtained from nearly 100 individuals (some infected with a heterogeneous virus population) was evaluated along with previously obtained HIV sequence information. Table 9 lists 138 PND sequences from HIV isolates. These sequences indicate that, despite the well-known and frequently cited variability in the amino acid sequence of the HIV envelope protein, there is actually 5 a high degree of conservation in the immunologically critical PND region, particularly in the region at the center of the PND. Specifically, the Gly-Pro-Gly sequence at the "tip of the loop" occurs in over 90% of the variants. Furthermore, other amino acids at certain positions on each side of the G-P-G were also found to be highly conserved. Table 10 shows the frequency of occurrence of the various amino acids at each position in the PND. In addition to the very strong conservation of the 10 glycines flanking the central proline, there is strong conservation at several other positions (e.g., R at x12, P at xu, G at yn, R at y14, and A at y16). A comparison of the relative frequency of variations of a 17-amino acid segment centered about the G-P-G sequence is shown in Table 11. In this table, the sequence which reflects the most commonly occurring amino acids at each position is listed first. The dashes indicate identity with the 15 consensus sequence. The remaining sequences are ordered from 2 to 138, according to their homology to the consensus sequence. Thus, the sequences at the top of the table display the greatest homology with the consensus sequence. Sequences far down the table display less homology. For example, the amino acid sequences from isolates IIIB and LAV-BRU occur at positions 92 and 93, respectively, on this table. This indicates that these isolates have only limited homology with the consensus sequence. 20 The present research shows that HIV viruses such as IIIB and LAV-BRU having the Gln-Arg (Q-R) dipeptide to the left of the Gly-Pro-Gly sequence are relatively uncommon. By contrast, the MN-like sequence in this region (...I H I G P G...) is the most common. The present research shows that principal neutralizing domains of other commonly studied variants comprise relatively uncommon sequences. 25 Although the subject invention pertains to the discovery of certain highly conserved regions in the principal neutralizing domain, there remains some degree of variability in this region among the various isolates. This variability includes "missing" or "added" amino acids at certain points in the sequence. Of course, "missing" or "added" amino acids can cause difficulty in devising aesthetically pleasing tables showing the sequences. However, these missing or added amino acids pose no difficulty 30 to a person skilled in the art in terms of locating the highly conserved regions which are critical to the subject invention. Table 9 shows one representation of 138 PND sequences. Table 11 uses a slightly different representation to show the same PND sequences. The primary discussion of sequence conservation can probably best be visualized by reference to the representation shown in Table 11. However, it should be noted that the existence of more than one means for representing these n T r> r-) O U Q Tfaa 44 R167.C1C2C3 sequences does not compromise the ability of the skilled artisan to accurately locate the sequences or the conserved regions. With the discovery of commonly occurring amino acid sequences, it is possible, for the first time, to develop prophylactic and therapeutic compositions which can predictably elicit and/or bind 5 with neutralizing antibodies to a broad range of HIV variants. The generalized formula for such a composition can be as follows: xGzGj wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and 10 z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T. 15 Further analysis of common sequence patterns reveals certain specific patterns which are very common among HIV isolates. Examples of these common sequences are shown in Table 12 and Figure 1. These common patterns, which are known only as a result of the research and discoveries described here, can be used to make pharmaceutical and diagnostic compositions which can be used . with a broad range of HIV isolates. This, of course, can be of critical importance, given the large 20 number of HIV variants which are now known to exist. Table 12 is a compilation of the common sequence patterns that occur in the region at the tip of the loop. For example, approximately 60% of the HIV isolates contain the core sequence I a I G P G R (a represents several different residues), approximately 50% contain the sequence I G P G R A, and approximately 40% contain G P G R A F. When a His residue is present at the a 25 position in I a I G P G R, this sequence occurs in approximately 30% of the HIV isolates. A vaccine composition comprising a mixture of peptides having the sequence I a I G P G R where all of the possible replacements for the a are present, is capable of eliciting antibodies which neutralizes a majority of HIV variants. Preferably, for use as immunogens, the peptides are linked to carrier proteins or adjuvants as described in Example 21. 30 As shown in Figure 1, common sequence patterns are also apparent within the 17 amino acid segment. Sequences which were isolated 4 or more times are highlighted. These commonly occurring sequences can be used to formulate vaccine cocktails which elicit a broadly neutralizing response. For example, a potential cocktail might contain peptides from each of the eight groups represented. Alternatively, the peptide sequences may be presented as a hybrid polypeptide containing the principal 9 230855 45 R167.C1C2C3 10 neutralizing domain from two or more of these groups. Preferably, such a cocktail will contain peptides which will be capable of raising antibodies which neutralize at least 70% and most preferably at least 90% of HIV variants. The antigens of the subject invention can be identified by their ability to raise antibodies which bind to certain amino acid sequences. For example, particularly advantageous antigenic compounds would raise antibodies which bind to common amino acid sequences such as G-P-G-R-A-F, I-G-P-G-R-A-F, I-G-P-G-R-A, I-a-I-G-P-G-R, I-a-I-G-P-G-R-A, and I-a-I-G-P-G-R-A-F, where a is any of the 20 amino acids. From Table 10 it can be seen that a polypeptide representing the occurrence of amino acids in all of the variants can be represented as follows: *13 X12 *11 *10 x9 x8 *7 *6 x5 x4 x3 x2 Xj G z G y2 y3 y4 ys y6 y7 y8 y9 y10 yn yi2 yi3 yi4 yis yi6 yn» wherein 15 x, is I, R, M, IQR, V, L, K, F, S, G, Y, SRG, or YQR; x2 is H, R, Y, T, S, P, F, N, A, K, G, or V; x3 is I, L, M, T, V, E, G, F, or Y; X4 is R, S, G, H, A, K, or not present; x5 is K, R, I, N, Q, A, IR, RQ, or not present; 20 Xg is R, K, S, I, P, Q, E, G, or T; x7 is T, K, V, I, A, R, P, or E; Xg is N, NV, Y, KI, I, T, DK, H, or K; x9 is N, S, K, E, Y, D, I, or Q; x10 is N, Y, S, D, G, or H; 25 xn is P; Xj2 is R, I, or K; x13 is T, I, M or A; z is P, A, Q, S, or L; yi is R, K, Q, G, S, or T; 30 y2 is A, V, N, R, K, T, S, F, P, or W; y3 is F, I, V, L, W, Y, G, S, or T; y4 is Y, V, H, L, F, S, I, T, M, R, VH, or FT; y5 is T, A, V, Q, H, I, S, Y, or not present; ye, is T, R, I, Q, A, M, or not present; 230 8 5 46 R167.C1C2C3 y7 is G, E, K, R, T, D, Q, A, H, N, P, or not present; y8 is R, Q, E, K, D, N, A, G, S, I, or not present; y9 is I, V, R, N, G, or not present; yJ0 is I, T, V, K, M, R, L, S, E, Q, A, or not present; 5 yn is G, R, E, K, H, or not present; yJ2 is D, N, I, R, T, S, or not present; y!3 is I, M, ME, L, or not present; yi4 is R, G, K, S, E, or not present; yi5 is Q, K, or R; 10 yJ6 is A; and yJ7 is H, Y, R, or Q. Monoclonal and/or polyclonal antibodies with broad neutralizing activity can be generated using the commonly occurring peptide sequences for use in prophylactic or therapeutic compositions. 15 The commonly occurring sequences described here can be used in much the same way as the other peptides described in this application. For example, these peptides can be modified in order to provide T-Iymphocyte stimulation, general immune stimulation, to enhance immunogenicity or solubility, or to reduce toxicity. The peptides may also be modified by addition of terminal cysteine residue(s) or by conjugation to a carrier protein, adjuvant, spacer, and/or linker. The peptides may 20 be fused with other HIV epitopes to produce a multiepitope polypeptide which could be useful with an even greater number of HIV variants. Also, the peptides can be circularized by bonding between cysteine residues. The cysteine residues used to make such circularized peptides could be the naturally occurring cysteine residues at the ends of the principal neutralizing domain, or cysteine residues may be added to the terminal ends of the peptides. 25 Additionally, vaccine compositions may include peptides containing T helper cell epitopes in combination with protein fragments containing the principal neutralizing domain. Several of these epitopes have been mapped within the HIV envelope, and these regions have been shown to stimulate proliferation and lymphokine release from lymphocytes. Providing both of these epitopes in a vaccine composition may result in the stimulation of both humoral and cellular immune responses. 30 Example 25 - Construction and Cloning of Multi-Epitope Genes Synthetic genes can be constructed which encode proteins comprised of the neutralizing epitopes from more than one HIV isolate. The synthetic gene exemplified here comprises a tandem arrangement of DNA sequences encoding neutralizing epitopes from HIV isolates IIIB, RF, SC, MN, 35 and WMJ1. Each epitope-encoding domain within the gene was designed to encode the 11 amino LL 308 55 47 R167.C1C2C3 acids centered at the common Gly-Pro-Gly sequence at the tip-of-the-loop for each of the isolates. Thus, the multi-epitope gene contained 5 different coding regions, each of which encoded a neutralizing epitope from a different isolate. For this particular construction, the epitope which was chosen for each of the 5 isolates consisted of the Gly-Pro-Gly sequence along with the 4 amino acids 5 on either side of the Gly-Pro-Gly sequence from each of the 5 isolates. Domains coding for other neutralizing epitopes from these isolates could have been incorporated into the multi-epitope gene. Also, genes coding for neutralizing epitopes from other isolates can be used. The genes were constructed such that the domains were linked by DNA sequences encoding four glycine residues. The composition or length of the linking sequence can be varied but preferably 10 it is a sequence that is non-immunogenic itself. The DNA sequence of the synthetic gene described here was designed such that restriction sites were encoded at either end of the fragment to facilitate cloning into the vector or, alternatively, to permit the construction of longer multi-epitope genes by attachment of 2 or more shorter genes (Figure 2). In addition, a methionine residue was encoded at the 5' end of the gene to facilitate cleavage when produced as part of a fusion protein. 15 Figure 3 depicts the steps in the construction of the multi-epitope gene described here. The amino acid sequence encoded by this gene is shown in Table 13. The portions of this amino acid sequence which correspond to each of the 5 isolates are identified in Table 13. Double-stranded subfragments of the full-length gene were first constructed starting with single-stranded synthetic oligomers designed to encode tandem neutralizing epitopes and linking amino 20 acid sequences. Any number of subfragments can be used. In this experiment the gene was divided into two portions, but three, four, or more portions can be used. Four single-stranded oligomers of between 67 and 78 nucleotides in length were synthesized (HEO-1, HEO-2, HEO-3, and HEO-4) (Figure 3). The oligomers were designed in pairs (HEO-1 and 2; HEO-3 and 4) as opposite and adjacent strands of the double-stranded subfragments having 10 (HEO-1 + 2) or 11 (HEO-3 +4) bases 25 of complementary overlap. The oligomers of each pair were mixed and heated 65 °C for 5 minutes, then incubated at 37°C for 1 hour to anneal. After annealing, the complementary strands of each pair were completed ("filled-in") using Sequenase (U.S. Biochem) and the four deoxynucleotide triphosphates. This reaction was incubated for 1 hour at room temperature, heated at 65 °C for 3 minutes, and then incubated for an additional 30 hour at 37°C with fresh Sequenase. Double-stranded fragments of 141 (HEO-1+2) and 126 (HEO- 3+4) base pairs were generated representing adjacent subfragments of the multi-epitope gene. HEO-1+2 comprised the coding sequences for 3 epitopes plus adjacent linker amino acids; HEO-3+4 extended from the fourth epitope to the end of the gene. Following the fill-in reaction, the samples were extracted with phenol/chloroform and 35 precipitated with ethanol by standard procedures. The resulting double-stranded DNAs were digested • 230855 48 R167.C1C2C3 with Hindlll (HEO-1+2) or SacI (HEO-3+4) and purified on a 3% NuSieve agarose gel. The purified fragments were ligated with Hindlll + SacI digested pUC19 (New England Biolabs) in a 3-component ligation and transformed into E. coli JM105 cells. The presence of a 256 base pair fragment in pUC19, encoding the full-length multi-epitope gene, was confirmed by restriction analysis and DNA sequencing. The resulting plasmid was designated pUC/MEP-1. The MEP-1 insert was removed from pUC/MEP-1 and recloned into Hindlll + SacI digested pRev2.1 for high-level expression of a fusion protein comprised of a leader portion from the EL coli BG gene fused to the multi-epitope protein. The resulting plasmid, designated pMEP-1-8342, was transformed into E. coli strain SG20251 and the 12.9 Kd multi-epitope fusion protein was identified by coomassie blue staining or Western blot analysis using a probe selected from antisera to the loop-tip peptides from each of the 5 HIV isolates. The fusion protein can be used intact or, alternatively, the leader portion can be cleaved off by cyanogen bromide which cleaves on the carboxy-terminal side of methionine residues. The amino acid sequence of the fusion protein is shown in Table 13A The multiepitope peptide can be purified from recombinant cells by methods described above. Other synthetic genes can be constructed which encode tandem neutralizing epitopes from any number of different HIV isolates using the procedure described above. In addition, variations on the above procedure can be made which are meant to be included in the present invention. For example, the lengths of the neutralizing epitopes encoded by a gene can vary, and there can be variation in the length of the individual epitopes within a single gene. Further, the number of neutralizing epitopes within a multi-epitope gene can vary, and the composition or the length of the amino acid sequences of the epitopes or the linking sequences can be varied from the example that is described herein. It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. This work was supported in part under contract number N01-AI-62558, awarded to Repligen Corporation by the National Institute of Allergy and Infectious Diseases (NLAID). IIIB (BH10) RF MN SC WMJ-2 LAV-MAL 9F-2 NY5 Z3 WMJ1 WMJ3 Z6 LAVELI CDC461 CDC42 BAL HIV-2 *RPHNHTRK8IRIQR0PGRAFVTIQK 1 ____ S-TK- -VITAT-QI- ----Y-K-- y - _ V - R 8 L 8 I - R | a-Hr---Q-i,x-i- i v _________ S-YI H-T-ri- K - G - X I _ _ _ -TIjYXR*-I - - - - 0 SDKKI - Q 8-RI---KV-YAK-0IT V-R RH-HI Y-Ot IR ----DIX-R I _ ---TK---Q HTPI-L-Q-LY -TRORT- I - X--YQ---Q -TPI-L-QBLY - TRSRS I - — H-_- -VTL----VHY-T-KIL _________ -VTL----VWY-T-KIL _________ 8-HI---_-_y_T_K1_ K--0-K-V-Q-ULMB -HV-H8HYQ PIH OHM - D I - T I - D I -IX - D I - D I - D I - - I - - I R Q X B - K - _ - R -_ K _ - - I - - I - D I K R P 1IIB (BH10) RF MN SC WMJ-2 LAV-MAL SF-2 NY5 Z3 WMJ1 WMJ3 Z6 LAVELI CDC451 CDC42 BAL HIV-2 ■f*. & On h Q Q Table 1. 50 TABLE 2 'LeuAsriGlriSerValGluIleAsnCasThrArSProAsnAsnAsnThrAraLas SerlleAr^IleGlnArSGlaProGlaAraAlaPheValThrlleGlaLysIle GlaAsnMetAr^GlriAlaHisCasAsrilleSerAraAlaLasTrpAsriAsriThr TABLE 2A CTGAACCAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAA AGTATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATA GGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTT TABLE 2B MetLeuArdProValGluThrProThrAr^GluIleLasLasLeuAspGlaLeij TrpAlaPheSerLeuAspAraGluAraValAlaAspLeuAsnGlnSerValGlu * I leAsnCasThrArgProAsriAsnAsnThr AraLasSerl leAr^IleGlnAra GlyProGlyAraAlaF'heValThrlleGlyLasIleGlyAsnMetArsGlriAla HisCasAsnll eSerArdAlaLasT rpAsriAsnTh rLeuGlaAlaAral leLeu GluAspGluAr^AlaSer TABLE 2C ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATCGCGAACGCGTGGCCGATCTGAACCAATCTGT AGAA ATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATCCGTATCCAGAGA GGACCAGGGAGAGCATTTGTT ACAATAGGAAAAAT AGGAAATATGAGACAAGCA CATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTGGGAGCTCGAATTCTT, , GAAGACGAAAGGGCCTCG / 51 TABLE 3 LeuAsnGlriSerVslGluIleAsnCysThrAraProAsnAsriAsnThrAr^Lys SerIleAr3lleGlriArSGlyF'roGlyAr3AlaPheValThrIleGlyLysIle GlyAsriMetArgGlnAlaHisCysAsnlleSerAraAlaLysTrpAsnAsriThr Leu LysGlnlleAspSerLysLeijAraGluGlnPheGlyAsnAsnLysTh rile IlePheLysGlnSerSerGlyGlyAspProGluIleValThrHisSerPheAsn CysGlyGlyGluPhePheTyrCysAsnSerThrGlriLeuPheAsnSer TABLE 3A CTGAACCAATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAA AGTATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATA GGAAATATGAGACAAGCACATTGTAACATTAGTAG^GCAAAATGGAATAACACT TTAAAACAGATAGATAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATA ATCTTTAAGCAGTCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAAT TGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGT ^ u o ij d 52 TABLE 3B MetLeuArSProValGluThrProThrArsfGluIleLysLysLeuAspGlyLeu T rpAlaPheSerLeuAspA rdGluAraValAlaAspLeuAsnGlnSerValGlu IleAsnCysThrAraProAsnAsnAsnThrArSLusSerlleArdlleGlriAr^ GlyProGlyAraAlaPheValThrlleGlyLysIleGlyAsnMetArSGlnAla HisCysAsnlleSerAr^AlaLysTrpAsriAsriThrLeuLysGlnlleAspSer LysLeuArdGluGlnPheGlyAsnAsriLysThrllellePheLysGlnSerSer GlyGlyAspProGluIleValThrHisSepPheAsnCysGlyGlyGluPhePhe TyrCysAsnSerThrGlnLeuPheAsnSerGlySerSerAsnSer TABLE 3C ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATCGCGAACGCGTGGCCGATCTGAACCAATCTGTAGAA ATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATCCGTATCCAGAGA GGACCAGGGAGAGCATTTGTTACAATAGGAAAAAT AGGAAATATGAGACAAGCA CATTGTAACATTAGTAGAGCAAAATGGAAT AACACTTTAAAACAGATAGAT AGC AAATT AAGAGAACAATTTGGAAATAATAAAACAAT AATCTTTAAGCAGTCCTCA GGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTC TACTGTAATTCAACACAACTGTTTAATAGTGGGAGCTCGAATTCT fj'M V17 MAY1990. Va 53 TABLE 4 LeijAsnAlaSerValGlnlleAsriCysThrAr^ProAsnAsnAsnThrArsLys SerlleThrLysGlyProGlyAraVallleTyrAlaThrGlyGlnllelleGly AspIleArsLysAlaHisCysAsnLeuSerAr^AlaGlriTrpAsnAsnThrLeu LysGlnValValThrLysLeuAraGluGlnPheAspAsriLysThrlleValPhe ThrSerSerSerGlyGlyAspProGluIleValLeuHisSerPheAsnCysGly GlyGluPhePheTyrCysAsnTh rThrGlnLeuPheAsnSerThrTrpAsnSer ThrGluGlySerAsnAsnThrGlyGlyAsnAspThrlleThrLeuProCysArS IleLysGlnlleValAsnMetT rpGlnGluValGlyLysAlaMetTyrAlaPro ProIleSerGlyGlnlleLysCysIleSerAsrilleThrGlyLeuLeuLeuThr A/dAspGlyGlyGluAspThrThrAsnThrThp TABLE 4A CTGAATGCATCTGTACAAATTAATTGTACAAGACCCAACAACAATACAAGAAAA GACTT APGTAGACATGTTTAATTAACATGTTCTGGGTTGTTGTTATGTTCTTTT AGTATAACTAAGGGACCAGGGAGAGTAATTTATGCAACAGGACAAATAATAGGA TCATATTGATTCCCTGGTCCCTCTCATTAAATACGTTGTCCTGTTTATT ATCCT .GATAT.AAGAAAAGCACATTGTAACCTTAGTAGAGCACAATGGAATAACACTTTA CTATATTCTTTTCGTGTAACATTGGAATCATCTCGTGTTACCTTATTGTGAAAT AAACAGGTAGTTACAAAATTAAGAGAACAATTTGACAATAAAACAATAGTCTTT TTTGTCCATCAATGTTTTAATTCTCTTGTTAAACTGTT ATTTTGTTATCAGAAA ACGTCATCCTCAGGAGGGGACCCAGAAATTGTACTTCACAGTTTTAATTGTGGA TGCAGTAGGAGTCCTCCCGTGGGTCTTT AACATGAAGTGTCAAAATT AACACCT GGGGAATTTTTCTACTGTAATACAACACAACTGTTTAATAGTACTTGGAATAGT CCCCTTAAAAAGATGACATT ATGTTGTGTTGACAAATT ATCATGAACCTTATCA ACTGAAGGGTCAAATAACACTGGAGGAAATGACACAATCACACTCCCATGCAGA rGACTTCCCAGTTTATTGTGACCTCCTTTACTGTGTTAGTGTGAGGGTACGTCT AT AAAACAAATTGTAAACATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCT TATTTTGTTTAACATTTGT ACACCGTCCTTCATCCTTTTCGTTACAT ACGGGGA CCCATCAGTGGACAAATTAAATGTATATCAAAT ATTACAGGGCTACT ATTAACA GGGTAGTCACCTGTTTAATTTACAT ATAGTTT ATAATGTCCCGATGATAATTGT AGAGATGGGGGTGAAGATACAACTAATACTACAGA TCTCTACCCCCACTTCTATGTTGATTATGATGTCTCTAG 54 TABLE 4B MetLeuArdProValGluThrProThrArsilGluIleLasLysLeuAspGlaLeu TrpAlaPheSerLeuAspArdGluAraValAlaAspLeuAsnAlaSerValGlri I leAsriCasThr ArdProAsnAsnAsriThrArdLysSerl leThrLasGlaPro GlyAraVallleTyrAlaThrGlyGlnllelleGlyAspIleArdLasAlaHis CasAsnLeuSerArdAlaGlnTrpAsnAsnThrLeuLysGlnValValThrLas LeuArdGluGlriPheAspAsnLysThrlleValPheThrSerSerSerGlaGly AspProGluIleValLeuHisSerPheAsnCasGlyGlaGluPhePheTarCas AsnThrThrGlnLeuPheAsnSerThrTrpAsnSerThrGluGlaSerAsnAsn ThrGlyGlaAsnAspThrlleThrLeuProCasArdlleLasGlnlleValAsri MetTrpGlnGluValGlaLysAlaMetTarAlaProProIleSerGlaGlnlle LysCysIleSerAsnlleThrGlaLeuLeuLeuThrArslAspGlaGlaGluAsp ThrThrAsnThrThrGluIleAr^ArdGlnAlaSeyAr3GluLeuGluPheLeu LysThrLysGlaProAraAspThrProIlePhelleGla '7 MAY mo n 8 55 R167.C1C2C3 TABLE AC ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATCGCGAACGCGTGGCCGATCTGAATGCATCTGTACAA ATTAATTGTACAA6ACCCAACAACAATACAAGAAAAAGTATAACTAAGGGACCA GGGAGAGTAATTTATGCAACAGGACAAATAATAGGAGATATAAGAAAAGCACAT TGTAACCTTAGTAGAGCACAATGGAATAACACTTTAAAACAGGTAGTTACAAAA TTAAGAGAACAATTTGACAATAAAACAATAGTCTTTACGTCATCCTCAGGAGGG GACCCAGAAATTGTACTTCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGT AATACAACACAACTGTTTAATAGTACTTGGAATAGTACTGAAGGGTCAAATAAC ACTGGAGGAAATGACACAATCACACTCCCATGCAGAATAAAACAAATTGTAAAC ATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATT AAATGTATATCAAATATTACAGGGCTACTATTAACAAuAGATGGGGGTGAAGAT ACAACTAATACTACAGAGATCCGTCGACAAGCTTCCCGGGAGCTGGAATTCTTG AAGACGAAAGGGCCTCGTGATACTCCTATTTTTATAGGT 23085 56 TABLE 5 GluAsnPheThrAspAsriAlaLysThrllelleValHisLeuAsnGlu SerValGlrilleAsriCysThrAraProAsriTyrAsnLysAraLysAralleHis .IleGlyProGlyAraAlaPheTyrThrThrLysAsnllelleGlyThrlleArd GlnAlaHisCysAsrilleSerArsAlaLysTrpAsnAspThrLeuAr^Glnlle ValSerLysLeuLysGluGlnPheLysAsnLysThrlleValPheAsnGlriSer SerGlyGlyAspProGluIleValMetHisSerPheAsnCysGlyGlyGluPhf? PheTy rCysAsnTh rSe rProLeuPheAsnSerThrCysLysIleLysGlnlle IleAsriMetTrpGlnGluValGlyLysAlafletTyrAlaProProIleGluGly GlrilleArslCysSerSerAsnlleThrGlyLeuLeuLeuThrAr^AspGlyGly LysAspThrAspThrAsnAspThr TABLE 5A GAT-CTGAAAATTTCACAGACAATGCTAAAACCATAATAGT ACACCTGAATGAA ACTTTTAAAGTGTCTGTTACGATTTTGGTATTATCATGTGGACTT ACTT TCTGTACAAATTAATTGTACAAGACCCAACTACAATAAAAGAAAAAGGATACAT AGACATGTTTAATTAACATGTTCTGGGTTGATGTT ATTTTCTTTTTCCTATGTA ATAGGACCAGGGAGAGCATTTTATACAACAAAAAATATAATAGGAACTATAAGA TATCCTGGTCCCTCTCGTAAAATATGTTGTTTTTTATATTATCCTTGATATTCT CAAGCACATTGTAACATTAGTAGAGCAAAATGGAATGACACTTTAAGACAGATA GTTCGTGTAACATTGTAATCATCTCGTTTTACCTTACTGTGAAATTCTGTCTAT GTTAGCAAATTAAAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCC CAATCGTTTAATTTTCTTGTTAAATTCTTATTTTGTTATCAGAAATTAGTTAGG TCAGGAGGGGACCCAGAAATTGTAATGCACAGTTTTAATTGTGGAGGGGAATTT A3TCCTCCCCTGGGTCTTTAACATTACGTGTCAAAATTAACACCTCCCCTTAAA TTCTACTGT AATACATCACCACTGTTTAATAGT ACTTGCAAAATAAAACAAATT AAGATGACATTATGTAGTGGTGACAAATTATCATGAACGTTTTATTTTGTTTAA ATAAACATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATTGAAGGA T ATTTGTACACCGTCCTTCATCCTTTTCGTT ACAT ACGGGGAGGGTAACTTCCT CAAATTAGATGTTCATCAAATATT ACAGGGCTACT ATTAACAAGAGATGGTOGT GTTTAATCTACAAGT AGTTTATAATGTCCCGATGATAATTGTTCTCTACCACCA AAGGACACGGACACGAACGACACCGA TTCCTGTGCCTGTGCTTGCTGTGGCTCTAG 230855 57 table 5b MetLeuArdProValGluThrProThrAraGluIleLysLysLeuAspGlyLeu TrpAlaF'heSerLeuAspAraGluAraValAlaAspIlelleAspGlaSerGlu AsnPheThrAspAsnAlsLasThrllelleValHisLeuAsnGluSerValGln IleAsnCasThrAr3ProAsnTarAsnLasAr3LasAr2lleHisIleGlaPro GlaAraAlaPheTarThrThrLysAsrillelleGlaThrlleAr^GlnAlsHis CasAsnIleSerAr2AlaLasTrpAsriAspThrLeijAr3GlnIleValSerLas LeuLasGluGlnPheLysAsnLasThrlleValPheAsnGlnSerSerGluGla AspProGluIleValMetHisSerPheAsriCasGlaGlaGluPhePheTarCas AsnThrSerProLeuPheAsnSe rThrCysLasIleLasGlnllelleAsnMet T rpGlnGluValGlaLasAlaMetTarAlaProProIleGluGlaGlnl1eAra CasSerSerAsnlleThrGlaLeuLeuLeuThrArSAspGlaGlaLasAspThr AspThrAsnAspThrGluIleAraArdGlnAlaSerArSGluLeuGluPheLeu ) LysThrLasGlyProAraAspThrProIlePhelleGly 23 0 8 58 R167.C1C2C3 TABLE 5C ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATDGCGAACGCGTGGCCGATATCATCGATGGATCTGAA AATTTCACAGACAATGCTAAAACCATAATAGTACACCTGAATGAATCTGTACAA ATTAATTGTACAAGACCCAACTACAATAAAAGAAAAAGGATACATATAGGACCA GGGAGAGCATTTTATACAACAAAAAATATAATAGGAACTATAAGACAAGCACAT TGTAACATTAGTAGAGCAAAATGGAATGACACTTTAAGACAGATAGTTAGCAAA TTAAAAGAACAATTTAAGAATAAAACAATAGTCTTTAATCAATCCTCAGGAGGG GACCCAGAAATTGTAATGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGT AATACATCACCACTGTTTAATAGTACTTGCAAAATAAAACAAATTATAAACATG TGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATTGAAGGACAAATTAGA TGTTCATCAAATATTACAGGGCTACTATTAACAAGAGATGGTGGTAAGGACACG GACACGAACGACACCGAGATCCGTCGACAAGCTTCCCGGGAGCTGGAATTCTTG AAGACGAAAGGGCCTCGTGATACTCCTATTTTTATAGGT 23 0 8 59 R167.C1C2C3 TABLE 6 LeuLasGluAlB'v13lGluIleAsnCysThrAr2ProAsriAsnAsr>7hrThrAr2 SerIleHisIleGlyFToG]yAr2AloPheTyrAlaThrGl«A5?IleIleG'. AspIleAraGlnAlsHisCysAsrilleSerArSAlaLysTrpAsnAsnThrLeij LysGlrilleVallleLysLeuAreAspGlnPheGluAsriLysThrllellePhe AsriAraSerSerGlyGlyAspProGluIleValHetHisSerPheAsnCysGly GlyGluPhePheTyrCysAsnSerThrGlnLeuPheSerSerThrTrpAsriGly ThrGluGlySerAsriAsriThrGlyGlyAsnAspThrlleThrLeuProCysAra IleLysGluIlelleAsnMetTrF'GlriGluUalGlyLysAlaMetTyrAlaPro ProIleLysGlyGlriUalLysCysSerSeT-AsnlleThrGlyLeuLeuLeuThr Ar^AsF'GlyGlyAsnSerLysAsnGlySerLysAsnThr ctgaaagaagctgtagaaattaattgtacaaggcccaachacaatacaa^aaga gactttcttcgacatct7taattaacatgttccgggttgttgttatgttgttct agtatacatataggaccagggagagcattttatgcaacaggagacataatagga tcatatgtatatcctggtccctctcgtaaaatacgttgtcctctgta77atcct gatataagacaagcacattgtaacattagtagagcaaaatggaataacacttta ctatattctgttcgtgtaacattgtaatcatctcgttttaccttattgtgaaat aaacagatagttataaaattaagagaccaatttgagaataaaacaataatcttt tttgtctatcaatattttaattctctggttaaactcttattttgttfcttagaaa aatcgatcctcaggaggagacccagaaattgtaatgcacagt7ttaattgtgga ttagctaggagtcctcctctgggtctttaacattacgtgtcaaaattaacacct ggggaatttttctactgtaattcaaoacaactgtttagtagtacttggaatggt cc:ccttaaaaagatgacattaagttgtgttgacaaatcatcatgaaccttacca actgaagggtcaaataacactggaggaaatgacacaatcaccctcccatgcaga tgacttcccagtttattgtgacctcctttactgtgttagtgggagggtacgtct ataaaagaaattataaacatgtggcaggaagtaggaaaagcaatgtatgcccct tattttctttaatatttgtacaccgtccttcatccttttcgttacathcgggga cccatcaaaggacaagttaaatgttcatcaaatattacagggctgctattaaca gggtagtttcctgttcaatttacaagtagtttataatgtcccgacgataattgt table 6a AGAGATGGTGGTAATAGCAAGAATGGTAGCAAGAATACAGA TCTCTACCACCATTATCGTTCTTACCATCGTTCTTATGTCTCTAG 60 R167.C1C2C3 TABLE 6B MetLeuArSProValGluThrProThrArsGluIleLysLasLeuAspGlaLeu TrpAlaPhsSerLe'jAspArsGIuArsVslAlsAspLeuLysGluAlsVslGlu IleAsriCysThrAr^ProAsnAsnAsnThrThrArSSerlleHisIlsGlyPro GlaArsAlaPheTyrAlaThrGlaAspIlelleGlaAsPlleArsGlriAIaHis CasAsrilleSerArSAlaLysTrpAsriAsnThrLeuLasGlrilleUslIleLas LeuArsAspGlriPheGluAsriLasThrllsIlePheAsnArSSerSerGlaGla AspProGluIleValMetHisSerPhsAsnCasGlaGlaGluPhsPheTarCys AsnSerThrGlnLeuPheSerSerThrTrpAsnGlyThrGluGlaSerAsnAsn ThrGlyGlaAsriAspThrlleThrLsuProCasArSlleLysGluIlelleAsn MetTrpGlnGluValBlyLysAlsfietT yrAlaProFroIleLysGlyGl riVal LasCysSerSerAsrilleThrGlyLeuLeuLeuThrAraAspGlaGlaAsnSer LasAsnGlySerLasAsnThrGluIleArsArSGlnAlsSerAraGluLeuGlu PheLeuLasThrLysGlyProAr^AspThrProI1ePheIleGly »7 MAY 1990 * !{ 23 0 8 61 R167.C1C2C3 TABLE 6C ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATCGCGAACGCGTGGCCGATCTGAAAGAAGCTGTAGAA ATTAATTGTACAAGGCCCAACAACAATACAACAAGAAGTATACATATAGGACCA GGGAGAGCATTTTATGCAACAGGAGACATAATAGGAGATATAAGACAAGCACAT TGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTATAAAA TTAAGAGACCAATTTGAGAATAAAACAATAATCTTTAATCGATCCTCAGGAGGA GACCCAGAAATTGTAATGCACAGTTTTAATTGTGGAG6GGAATTTTTCT ACTGT AATTCAACACAACTGTTTAGTAGTACTTGGAATGGTACTGAAGGGTCAAATAAC ACTGGAGGAAATGACACAATCACCCTCCCATGCAGAATAAAAGAAATTATAAAC ATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAAAGGACAAGTT AAATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGC AAGAATGGTAGCAAGAATACAGAGATCCGTCGACAAGCTTCCCGGGAGCTGGAA TTCTTGAAGACGAAAGGGCCTCGTGATACTCCTATTTTTATAGGT \i 0 6 u o 62 TABLE 7 LeuAsnGluSerValGluIleAsriCysThrArSProTyrAsfiAsnValAraAra SerLeuSerlleGlyProGlyAraAlaPheAraThrAraGluIlelleGlylle IleAraGinAlaHisCysAsnlleSerAr^AlaLysTrpAsnAsnThrLeuLys GlnlleValGluLasLeuAraGluGlnPheLysAsriLysThrlleValPheAsn HisSerSerGlaGlyAspPraGluIleValThrHisSerPheAsnCasGlaGla GluPhePheTarCasAsnSerThrGlnLeuPheAsnSerThrTrpAsnGlaThr AspIleLasGlyAspAsnLysAsnSerThrLeuIleThrLeuProCasAralle LusGlnllelleAsndetTrpGlnGlaValGlyLysAlahetTyrAlaProPro IleGlnGluGlnlleAraCasSerSerAsnlleThrGlaLeuLeuLeuThrAra AspGlaGlaAsnSerSerSerAraGlu TABLE 7A CTGAATGAATCTGTAGAAATTAATTGTACAAGACCCTACAACAATGTAAGAAGA GACTTACTTAGACATCTTTAATTAACATGTTCTGGGATGTJGTTACATTCTTCT AGTCTATCTATAGGACCAGGGAGAGCATTTCGTACAAGAGAAATAATAGGAATT TCAGATAGATATCCTGGTCCCTCTCGTAAAGCATGTTCTCTTTATTATCCTTAA ATAAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAA TATTCTGTTCGTGTAACATTGTAATCATCTCGTTTTACCTTATTGTGAAATTTT CAGATAGTTGAGAAATTAAGAGAACAATTT AAGAATAAAACAATAGTCTTT AAT GTCT ATCAACTCTTT AATTCTCTTGTT AAATTCTT ATTTTGTT ATCAGAAATTA CATTCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTT AATTGTGGAGGG GT AAGGAGTCCTCCCCTGGGTCTTTAACATTGCGTGTCAAAATTAACACCTCCC GAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGAATGGTACT CTTAAAAAGATGACATT AAGTTGTGTTGACAAATTATCATGAACCTT ACCATGA GACATTAAAGGAGAT AATAAAAAT AGCACACTCATCACACTCCCATGCAGAAT A CTGT AATTTCCTCTATT ATTTTTATCGTGTGAGTAGTGTGAGGGT ACGTCTTAT AAACAAATTAT AAACATGTGGCAGGGAGTAGGCAAAGCAATGTATGCCCCTCCC TTTGTTTAATATTTGTACACCGTCCCTCATCCGTTTCGTT ACATACGGGGAGGG ATCCAAGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGA / < TAGGTTCCTGTTTAATCTACAAGTAGTTTATAATGTCCCGACGATAATTGTTCT y V GATGGTGGTAATAGCAGCAGCAGGGAAGA , 17MAVi990 CTACCACCATTATCGTCGTCGTCCCTTCTCTAG i; 1J I !. li '• 63 TABLE 7B HetLeijAr3ProV3lGluThrF'roThrAr3GluIleLasLysLeuAspGlyLeu TrpAlaPheSerLeuAspArSGluAraValAlaAspLeuAsnGiuSerValGlu IleAsnCysThrAraProTyrAsnAsnValArSAraSerLeuSerlleGlyPro GlyAraAlaF'heAraThrAraGluIlelleGlyllelleAraGlnAlaHisCys AsnlleSerAraAlaLysTrpAsnAsnThrLeuLysGlnlleValGluLysLeu AraGluGlnPheLysAsnLysThrlleValPheAsnHisSerSerGlyGlyAsp ProGluIleValThrHisSerPheAsnCysGlyGlaGluPhsPheTyrCysAsri SerThrGlnLeuPheAsnSerThrTrpAsnGlyThrAspIleLysGlaAspAsn LysAsnSerThrLeuIleThrLeuProCysAralleLysGlnllelleAsnMet TrpGlnGlyValGlyLysAlaMetTyrAlaProProIleGlnGlyGlnlleAra CysSerSerAsnlleThrGlyLeuLeuLeuThrArdAspGlaGlyAsnSerSer SerArSGluGluIleArdAr^GlnAlaSerArdGluLeuGluPheLeuLysThr f LasGlyProAr^AspThrProIlePhelleGla 3 8 I 64 R167.C1C2C3 TABLE 7C ATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTGGACGGCCTG TGGGCATTCAGTCTGGATCGCGAACGCGTGGCCGATCTGAATGAATCTGTAGAA ATTAATTGTACAAGACCCTACAACAATGTAAGAAGAAGTCTATCTATAGGACCA GGGAGAGCATTTCGTACAAGAGAAATAATAGGAATTATAAGACAAGCACATTGT AACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGTTGAGAAATTA AGAGAACAATTTAAGAATAAAACAATAGTCTTTAATCATTCCTCAGGAGGGGAC CCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTG1AAT TCAACACAACTGTTTAATAGTACTTGGAATGGTACTGACATTAAAGGAGATAAT AAAAATAGCACACTCATCACACTCCCATGCAGAATAAAACAAATTATAAACATG TGGCAGGGAGTAGGCAAAGCAATGTATGCCCCTCCCATCCAAGGACAAATTAGA TGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAGC AGCAGGGAAGAGATCCGTCGACAAGCTTCCCGGGAGCTGGAATTCTTGAAGACG AAAGGGCCTCGTGATACTCCTATTTTTATAGGT 8 65 R167.C1C2C3 Table 8 51 CTGAACCAATCTGTAGAAATTAATTGTACAAGACCCAAC GACTTGGTTAGACATCTTTAATTAACATGTTCTGGGTTG AACAATACAAGAAAAAGTATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTT TTGTTATGTTCTTTTTCATAGGCATAGGTCTCTCCTGGTCCCTCTCGTAAACAA ACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCA TGTTATCCTTTTTATCCTTTATACTCTGTTCGTGTAACATTGTAATCATCTCGT AAATGGAATAACACTTTAAAACAGATAGATAGCAAATTAAGAGAACAATTTGGA TTTACCTTATTGTGAAATTTTGTCTATCTATCGTTTAATTCTCTTGTTAAACCT AATAATAAAACAATAATCTTTAAGCAGTCCTCAGGAGGGGACCCAGAAATTGTA TTATTATTTTGTTATTAGAAATTCGTCAGGAGTCCTCCCCTGGGTCTTTAACAT A'CGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTG TGCGTGTCAAAATTAACACCTCCCCTTAAAAAGATGACATTAAGTTGTGTTGAC TTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTAAAGGGTCAAATAACACT AAATTATCATGAACCAAATTATCATGAACCTCATGATTTCCCAGTTTATTGTGA GAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATG CTTCCTTCACTGTGTTAGTGGGAGGGTACGTCTTATTTTGTTTAATATTTGTAC TGGCAGGAAGTAGGAAAAGCAATGTATGCOCCTCCCATCAGTGGACAAATTAGA ACCGTCCTTCATCCTTTTCGTTACATACGGGGAGGGTAGTCACCTGTTTAATCT TGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAAC ACAAGTAGTTTATAATGTCCCGACGATAATTGTTCTCTACCACCATTATCGTTG AATGAGTCCGA 3' TTACTCAGGCTCTAG 'v . _ IJ O '■^ 66 EE1-707-1 CTRFNNY TRK RIHI GPGRAFY TTGQVIGRI RQAQC MN CTRFNYN KRK RIHI GPGRAFY TTKNIIGTI RQAHC EE1-708-1 CTRFNNN TRR RIHI GFGRAFY TTGQVIGRI RQAQC KW4-4-1 CTRPNNN TRR RIHI GPGRAFY TMGQIIGDI RKAHC - JH3 CTRFSKT TRR RIHI GPGRAFY ATGDIAGDL RQAHC WMJ3 CTRPNDI ARR RIHI GPGRAFY T GKIIGNI RQAHC BAL CTRPNNN TRK SIHI GFGRAFY TTGEIIGDI RQAHC EE3-7-3 CTIPNNN TRK SIHI GFGRAFY TTGEIIGDI RQAHC KW4-6-1 CTRFNNN TRK SIHI GFGRAFY TTGEIIGDI RQAHC EE3-4-3 CTRFNNN TRK SIHI GPGRAFY TTGEIIGDI RQAHC EE7-3-1 CTRPNNN TRK SIHI /■* T TTGEIIGNI RQAHC EE7-15-3 CTRPNNN TRK SIHI GFGRAFY TTGEIIGDI RQAYC EE7-24-1 r«fnn v~ iKhiiui TRK SIHI GFGRAFY TTGEIIGDI RQAHC EEG-4-1 CTRFNNN TRK SIHI GFGRAFY ATGAIIGDI RQAHC JG1 CTRPNNN TRK SIHI GPGRAFY ATGDIIGDI RQAHC -DD3-1 CTRFNNN TRK GIHI GFGRAFY ATGDIIGDI RQAHC DD7-1 CTRPNNN TRK GIHI GPGRAFY ATGDIIGDI RQAHC EE1-330-1 CIRFNNN TRK GIHI GPGRAFY ATGDIIGDI RQAHC SC CTRFNNN TTR SIHI GFGRAFY ATGDIIGDI RQAHC DD10-1 CTRFNNI" /RRR HIHI GFGRAFY TGEIRGNI RQAHC WMJ1.5 CTRPNNNVRRR HIHI GFGRAFYY GEIRGNI RQAHC KW3-2-2 CIRFHNTI RR RIHI GPGRAFS TTRGIQGDI RQAYC DD4-1 CTRPYSNV RN RIHI GPGRAFH TTKRITGDM RQARC AFL30-4-1 CTRFYSNV RN RIHI GPGRAFH TTKRITGDM RQARC KW2-1-1 CTRPYSNV RN RIHI GPGRAFH TTKRITGDM RQARC KW2-9-1 CTRPYSNV RN RIHI GPGRAFH TTKRITGDM RQARC EE6-4-4 CTRPYSNV RN RIHI GPGRAFH TTKRITGDM RQARC EE7-20-3 XTRPYSNV RN RIHI GPGRAFH TTKRITGDM RQARC RJS426 CTRPYNKK RIRKMHI GPGRAFY ATG GMGDI RQAHC KW4-13-1 CTRFNNKIFR KFHI r» r+ n * V7fVJfw/*r X r> rr * r> xvxvrt Kv AFL30-6-2 xrxTrt runrif x TRK GIHI GFGRAIY r»/-* * it/* KW2-8-2 XTRPNNN TRK GIHI GPGRAVY TTGRIVGDI RQAHC TM5-I6-1 CTRPNNN TRK GIHI GPGRAVY TTGRIVGDI RQAHC KW2-8-1 CTRFDNN ARK GIHI GPGRAVY TTGRIIGDI RQAHC EE5-6-1 CTRPDNN ARK GIHI GPGRAVY TTGRIIGDI RQAHC EE6-3-5 XTRPNNN TKK GIHI GPGRAWY TRTRIIGDI RQAHC TM5-8-1 /-•mfi n%r*r*f TKK GIHI GPGRAVY TARRIIGDI RQAHC TM5-12-1 CIRPNIN TGK RIPI GPGRAFY TTGAIKGNI RQAHC EE5-3-2 XTRPNNN TRK SIPI GFGRAFY TTGEIIGDI RQAHC EE3-2-4 XXX?SNN TRK SIPI GPGRAFY ATGDIIGNI RQAHC WH331 XXXXXXX XRK SIPI GFGRAFY ATGEIIGDI RQAHC EE1-279-1 CTRPNNN TRK RISI GFGRAFY ATRQIVGDI RQAHC EE3-5-1 CMRFNNN TRK <3 T*TT -L GFGRAFY RQAKC WH721 XXXXNNN TRK SINI GPGRAFY ARGEIIGDI RRAXX KW4-3-2 CTRPNNN TRK SIAI GPGRAFY ATRRIIGDI RQAHC TM4-11-1 CTRPNNN TRK RIYI GFGRAFY ARQ&IIGDI RQAKC TM5-13-1 CTRFNNN TRK RIYI GPGRAFY" ARQQVIGDI RQAHC SF2 CTRPNNN TRK SIYI GPGRAFH TTGRIIGDI RKAHC SF4 CTRPNNN TRK SIYI GPGRAFH TTGRIIGDI RKAHC Z321 CMRFNNN TRK SISI GPGRAFF ATGDIIGDI RQAHC WMJ2 CTRPYNNV ' RR SLSI GPGRAFR YRE IIGII RQAHC EE6-1-1 CTRPNNN TRK RIKI GPGRAFV TTKQIIGDI RQAYC KW4-10-1 ■ CTRPNNN TKK GIYI GPGRAVY TTEKIIGDI RRAKC . TM5-7-1 CTRPNNN TKK GIYI GPGRAVY TTEKIIGDI RRAHC - /V> EE7-15-1 CTRPNNN TKK GIRI GPGRAVY TAQRIIGDI RQAHC o% '7 MAY 1990jj Pi\f &V '/ :'[y) n o ^ 67 dd-3-3 ctrpnnn tkk giri gfgravy tarriigdi rqahc afl30-5-3 ctrpnnn trk giri gpgraiy atariigdi rqahc kw3-9-2 \*xhr nmi trk rigi ' gpgrail qq enigdi rqahc jg2 ctrpnnn. trk sini . gpgrafy ATGQIIGKI rqahc- ee3-5-2 cmrpnnn trk 5 ini gpgraly ttgqiigdi rqahc afl30-1-3 xtrpnnn tsr giri gfgrail ateriigdi rqahc afl30-3-1 ctrpnnn tsr giri gfgrail ateriigdi rqahc kw2-2-2 ctrfnnn tsr giri gfgrail ateriigdi rqahc ee5-3-3 xtrfnnn tsr giri gfgrail ateriigdi rqahc ee5-6-3 ctrpnnn tsr giri gpgrail ateriigdi rqahc ee5-10-3 /■•mri rimr*tuT v i. rwr ravii mnn l f* TT> T gpgrail ateriigdi rqahc ee5-11-3 ctrpnnn tsr giri gfgrail ateriigdi rqahc ee7-24-3 rmn ri*rmT*T L xKnuUi tsr giri gfgrail * mT7t> -r ^ r*T\ t rqahc kw4-3-1 ctrpnnn tkr giri gfgravy atdriigdi rqahc kw4-2-2 ctrfnnn tkr giri gpgravm qqtriigdi rqahc wh425 xxxxnnn trr sisi gpgraly ttgaiigsi rqaxx wh718 xxxxxxx xsk sisi gpgrawy qqeevigbi Aaaaa wh244 xxxxnnkikir rihi gfgrpfy ttk igdi rqayc ee3-6-2 ctrfnnn trk gihi gfgrtfy atgaiigdi rqahc ee6-3-1 ctrpnnn tkk gihi gpgrkwy trtkiigdi rqahc dd9-1 ctrfnnn trr sihi GPGRWSVHTTGEIVGDI rqahc tm5-11-1 ctrfnnn tqk riti GPGRVFY ttgkivgdi rqahc ee5-10-5 ctrpnnn trk gifi gpgrniy ttgniigdi rkahc ee5-11-1 ctrfnnn trk gifi GPGRNIY ttgniigdi rkahc ee5-14-1 ctrfnnn trk gifi gpgrniy ttgniigdi rkahc kw2-6-1 ctrpnnn trk gifi gpgrniy ttgniigdi rkahc dd5-1 xxxxnnn tra rlsi gpgrsfy atrnivgdi rqahc tm4-7-3 cirpnnn trk amsi gpgrkly trnkiigdi rqahc *mc ii: D ctrpnnn tkk giai gfgrtly arekiigdi rqahc afl30-11-1 ctrpnen tkk slyi gpgrrfh vtkaitgdi rqahc afl30-12-1 ctrpnen tkr slyi gfc7rrfh vtkaitgdi r»r\ * rtr* kw4-12-1 ctrpsnn tkq slyi gpgrrfh vtkaitgdi rqahc kw4-12-2 ctrfsnn tkr slyi gfgrrfh vtkaitgdi rqahc kw4-7-1 ctrfnnn trk gihm gpgrafy tqeni gdi rqarc kw4-7-2 ctrpnnn trk gihm gfgrafy tqeni gdi rqahc kw3-6-1 cirpnni trr smsm gpgrafv atrqiigdi rkahc iiib (bh10) ctrfnnn trk siriqrgfgrafv tigk ignm rqahc lav-bru ctrpnnn trk sihiqrgfgrafv tigk ignm rqahc ee5-10-1 ctrpnnn trk siriqrgfgrafv tigk ixnm rqahc ee7-3-3 ctrfnnn trk siriqrgpgrafv tigk ignm rqakc ee7-6-2 ctrpnnn trk siriqrgfgrafv tigk ignm rqahc kw2-1-3 ctrfnnn trk ririqrgpgrafv tigk ignmeeqahc ee3-6-1 ctrpnnn trk ririqrgpgrafv tigk ignm rqahc ee7-15-2 ctrpnnn trk kiriqrgpgrafv tigk irnm rqahc ee5-3-1 ctrfnnn trk kiriqrgpgrafv -tigk irnm rqahc tm4-14-2 ctrfnnn trk kivsrggpgrafv tigk- irnm rqahc kw3-6-2 ctrfnnn trr girv gfgravy stdkiigdi rqahc rf' (tm3-8-1) ctrfnnn trk ritk gpgrviy atgqiigdi rkahc RF . ctrfnnn trk sitk gpgrviy atgqiigdi rkahc ee7-20-1 ctrfnnh tek ritl gpgrvly ttgriigdi rrahc cdc451 ctrpnnh trk rvtl gpgrvwy ttgeilgni rqahc tm3-9-4 . ctrpnnn trk rvtm gpgrvwy ttgeivgdi rqahc ee1-706-1 ctrpnnn trk ritm gpgrvyy ttgqiigni rqahc ee1-706-2 ctrpnnn trk ritm gpgrvyy tagqiigni RQAHC RRAiHCI brva ctrfnnn trk ritm gpgrvyy ttgqiigdi I M 68 Kn'2-1-2 EE1-317-1 SF170 KW2-6-2_ Z3 "" EE3-8-1 KW4-8-1 KW4-8-3 TM4-14-1 KW2-2-1 LAV-MAL EE1-317-2 EEl-707-2 SF33 EE7-21-3 TM4-14-3 'EE7-6-1 DD1-1 AFL30-5-1 EE7-21-1 TM4-13-2 TM4-13-3 TM3-7-1 AFL30-9-1 AFL30-9-2 LAVELI JY1 2G CTRFNNN TRK RITM GPGRVYY TTGQIIGNI CTRPNNN TRK GIHI GPGT FY TTGEIIGDI CTRFNNN TRK SGTI GFGQAFY ATGDIIGDI CTKPNNN TKK GIFI. GPGKNIY TTENIIGD.I_ CTRPGSDKKIRQSIRI GPGKVFY AKGGITG CIRPNNN TRK SIPM GFGKAFY ATGEIIGDI SIPM GFGKAFY TTGDIIGDI SIPM GFGKAFY ATGDIIGDI CTRPNNY ARR GIRV GPGSATY TAPSIIADI CTRPNNN TEK ESYQRGFGGAFV TIGK IGNM GIHF GPGQALY CTRPNNN TRK CTRFNNN TRK CTRFGNN TRR CTRFNNN IRK RITR CTRPNNN IRK RITR CTRPNNN RRR RITS CTRFNNN TRR RIHI CTRPNNY AKR GIRV CTRFGNN TRR SISI CTRFNNN TRK SIRI CTRFNNN TRK SIRI CTRPNNN TRK SIRY CIRPNNN TKR AIYI CTRPNNN TKR AIYI XIRFNNN TRK GIYV CIRPNNN TRK GIYV CIRPNNN TRK GIYV CARPYQN TRQ RTFI CTRPDNKITRQ STPI CTRPYKN TRQ STPI ATGQIIGDI GPGKVIY ATGQIIGDI GPGKVLY TTGEIIGDI GPRRAFY TTGQVIGRI EPGKAII ATKKIIENI RPERAFFTQTGDVIGDI GAGRAIY ATARIIGDI GAGRAIY ATERIIGDI GAGRAIY ATARIIGDI GQGRAIH TTDRIIGDI GQGRAIH TTDRIXGDI GSGRAVY TRDKIMGDI GSGRKVY TRHKIIGDI GSGRKVY TRQKIIGDI GLGQSLY TTRSRS II GLGQALY TTR IKGDI GLGQALY TTRGRTKII RQAHC RQAHC RQAYC RKAHC QAHC RQAHC. RQAHC RQAHC SQAHC r» % m r* x\yiiav- RRAYC RKAHC RKAHC RKAYC RQAQC KKAHY RQAHC RQAHC RQAHC RQAHC RQAHC RQAHC RQAHC RQAHC RQAHC GQAHC RQAYC GQAHC ,f\' ' f/ ■ v. f/y f7 MAY B90 f v' 69 R167.C1C2C3 Table 10 x13 *12 *11 x10 *9 x8 x7 *6 x5 x4 x3 x2 X1 T 115 R 129 P 132 N115 N 121 N 118 T 113 R 103 K 90 R 37 I 120 H 47 I 100 G 136 P 127 G136 I 11 I 1 Y 10 S 7 NV 2 K 3 K 18 R 34 S 47 L 6 R 28 R 2 E 1 L 3 E 1 M 3 K 1 S 4 K 2 Y 4 V 7 S 9 I 1 G 43 M 3 Y 15 M 11 R 1 A 3 R 1 A 1 D 3 E 2 KI 3 I 3 I 2 N 6 H 4 T 3 T 14 V 6 S 3 G 3 Y 1 I 2 A 5 P 1 Q 4 A 3 V 2 S 10 IQR 9 Q 2 H 1 D 1 T 2 R 3 Q 1 A 1 K 3 G 1 P 10 L 2 I 1 DK 1 E 1 E 2 IR 1 F 1 F 5 K 2 Q 1 H 1 P 1 G 1 RQ 1 Y 1 N 4 F 1 K 1 T 1 E 1 A 2 S 1 K 1 G 1 G 1 Y 1 V 1 SRG 1 YQR 1 yi Y2 y3 y4 ys y6 yi ys y9 yio yn yi2 yi3 yi4 yis yie yn R 121 A 104 F 75 Y 94 T 81 T 102 G 78 R 34 I 115 I 105 G 130 D 106 I 119 R 131 Q 115 A 137 H 116 K 9 V 14 I 25 V 13 A 44 R 11 E 17 K 23 V 7 T 12 R 3 N 23 M 16 G 2 K 16 Y 8 Q 5 N 5 V 15 H 14 V 4 I 11 K 14 Q 20 R 2 V 7 E 1 I 3 ME 1 K 1 R 6 R 8 • G 1 R 4 L 8 L 8 Q 3 Q 5 R 10 E 20 N 1 K 2 K 1 R 3 L 1 S 1 Q 3 S 1 K 4 W 5 F 1 H 1 A 5 T 3 D 13 G 1 M 2 A 1 T 1 E 1 T 1 T 2 Y 5 S 2 1 1 M 1 D 5 N 9 R 2 S 1 S 2 G 1 1 1 S 1 Q 4 A 8 L 1 F 1 S 1 T 1 Y 2 A 3 G 4 S 1 U P 1 T 1 M 1 H 1 S 2 E 1 CM W 1 R 1 N 1 I 1 Q 1 tL ...JI VH 1 P 1 A 1 FT 1 GO UI Table 11 70 TRKRIHIGPGRAFYTTG EEl-707-1 MN EE1-708-1 KW4-4-1 JH3 WMJ3 KW3-2-2 DD4-1 AFL30-4-1 KW2-1-1 KW2-9-1 EE6-4-4 EE7-20-3 BAL EE3-7-3 KW4-6-1 EE3-4-3 EE7-3-1 EE7-15-3 EE7-24-1 EE6-4-1 JG1 DD3-1 DD7-1 EE1-330-1 SC DD10-1 WMJ15 RJS42 6 KW4-13-1 TM5-12-1 EE5-3-2 EE3-2-4 WH331 EE1-279-1 Z321 WMJ2 EE3-5-1 WH721 KW4-3-2 TM4-11-1 TM5-13-1 SF2 SF4 EE6-1-1 AFL30-6-2 EE6-3-5 KW2-8-2 EE5-6-1 TM5-16-1 KW2-8-1 TM5-8-1 KW4-10-1 TM5-7-1 EE7-15-1 DD3-3 AFL30-5-3 KW3-9-2 JG2 I I TRKRIHI GPG RAFYTTG A-R GE S—R H—K H—K H—K — — -H—K H — K H—K I-R V-N V-N V-N V-N V-N V-N S A-Q -TRS A— R-RH GE R-RH YGE RIRHM— IPRHF— -G P- S-P- S-P- X—S-p- —s-s- V-RSLS- S-N- S-N- S-A- s-y- S-Y- K- -K-G-— A—G— A—G— -K-G-— -K-G-Y--K-G-Y--K-G-R--K-G-R-—G-R- G- S-N- A-R FA-- R-RE AR- A-R ARQ ARQ — H V—K — I-A— —W—RT —V—AR —V E —V—E —V--AQ --V—AR —I-A-A —ILQQE —G-A— (2/3) (3/3), P (3/3) (3/3) (3/3) (6/6) (5/5) (1/3) (1/1) (1/3) (1/3) (2/2) (3/3) (1/1) (2/3) (1/3) (2/3) (2/3) (1/7) (1/6). (3/3) (5/5) (3/3) (3/3) (1/3) (3/3) (direct) (3/3) (1/2) (direct) (2/3) (5/8) (3/8) (3/3) (4/6) (2/3) (2/4) (1/2) (1/4) (1/4) (3/7) (3/3) (3/3) (1/3) (3/7) (1/5) (2/2) RIHTGPRGRAF TGPKRftF ij N * if * .» ft 7 MAY 1990S Table 11 (cont'd) 70A EE3-5-2 S-N- — L C (1/2) 2 AFL30-1-3 -SRG-R- —ILA-E A (2/2) 2 AFL30-3-1 -SRG-R- —ILA-E A (1/1) 2 KW2-2-2 -SRG-R- —ILA-E C (2/2) 2 EES-3-3 -SRG-R- —ILA-E C (1/3) 2 EE5-6-3 -SRG-R- —ILA-E c (1/2) 2 EE5-10-3 -SRG-R- —ILA-E c (1/3) 2 EE5-11-3 -SRG-R- —ILA-E c (1/2) 2 EE7-24-3 -SRG-R- —ILA-E c (1/3) 2 KW4-3-1 -KRG-R- —V-A-D c (1/3) 2 KW4-2-2 -KRG-R- —VMQQT c (2/2) . 2 WH425 —RS-S- —L c (direct) 2 WH718 xs-s-s- —W-QQE c (direct) 2 WH244 KIR -P K c (direct) 1 EE3-6-2 —G -T—A— c (1/3) 1 EE6-3-1 -K-G -KW—RT c (1/3) 2 DD9-1 —RS -WSVH-T A (3/3) 2 TM5-11-1 —Q T_ -V A (3/3) 2 EE5-10-5 —G-F- -NI C (1/3) 3 EE5-1X-1 G-F- -NI C (1/2) 3 EE5-14-1 G-F- -NI C (3/3) 3 KW2-6-1 —G-F- -NI C (1/2) 3 DD5-1 —A-LS- -S—A-R A (3/3) 3 TM4-7-3 AMS- -KL—RN A (1/8) 4 NY5 -K-G-A- -TL-ARE P 3 AFL30-11-1 -K-SLY- -R-HV-K A (3/5) 3 AFL30-12-1 -KRSLY- -R-HV-K A (2/5) 3 KW4-12-1 -KQSLY- -R-HV-K C (1/3) 3 KW4-12-2 -KRSLY- -R-HV-K C (2/3). 3 KW4-7-1 G—M QE C (1/3) 1 KW4-7-2 G—M QE C (2/3) 1 KW3-6-1 —RSMSM —-VA-R C (1/2) 3 IIIB(BHIO) KSI--QR V-I- p 2 LAV-BRU KSI—QR V-I- P 2 EE5-10-1 KSI— QR V-I- c (1/3) 2 EE7-3-3 KSI--QR V-I- c (1/3) 2 EE7-6-2 KSI--QR V-I- c (2/3) 2 KW2-1-3 K-I—QR V-I- c (1/3) 2 EE3-6-1 K-I—QR V-I- c (2/3) 2 EE7-15-2 KKI—QR v-i- c (1/3) 2 EE5-3-1 KKI--QR V-I- c (1/3) 2 TM4-14-2 KKIVSRG V-I- A (1/3) 3 KW3-6-2 —RG-RV —V-S-D C (1/2) 3 RF' TK -VI-A— P 4 RF —S-TK -VI-A— A (6/6) 4 EE7-20-X -E— TL -VL C (2/3) 4 CDC451 VTL -VW P 5 TM3-9-4 VTM -VW A (2/2) 5 EE1-70 6-1 TM -VY C (2/3) 4 EE1-706-2 TM -VY--A- C (1/3) 4 BRVA TM -VY P 4 KW2-1-2 TM -VY-HRT c (1/3) 4 EE3-8-1 —S-PM K A-- c (3/3) 3 KW4-8-1 S-PM K c (1/2) 3 KW4-8-3 —S-PM K A— c (1/2) 3 TM4-14-1 A-RG-RV S-T--AP A (1/3) 4- EE1-317-1 G TFYT-GE C (1/3) 3 SF170 SGT- Q A— P 3 KW2-6-2 -K-G-F- KNI E c (1/2) 4 Z3 I-QS-R— KV—AK- p 3 KW2-2-1 EKESYQR G—V-I- c (1/2) 4 LAV-MAL —RG—F Q-L p 3 EE1-317-2 I TR KVI-A— c (2/3) 5 EE1-707-2 I TR KVI-A— c (1/3) 5 TGPGRA igpcr gpgr s*T ■■ ' V 17 MAY 1990 P f; I) h 0 •) Table 11 (cont'd) 70B SF33 R-R--TS KVL P 5 £££ EE7-21-3 —R R 1— C (1/3) 1 TM4-14-3 AKRG-RV £— K-IIA-K A (1/3) 5 EE7-6-1 —RS-S- R-E F-QT C (1/3) 3 £ DD1-1 —S-R- -A I-A-A A (1/5) 3 AFL30-5-1 —S-R A I-A-E A (3/5) 3 EE7-21-1 —S-RY -A I-A-A C (2/3) 4 TM4-13-2 -KRA-Y- -Q IH—D A (4/5) 3 TM4-13-3 -KRA-Y- -Q IH—D A (1/5) 3 TM3-7-1 G-YV -S V—RD A (2/8) 4 AFL30-9-1 G-YV -S KV—RH A (4/8) - 5 AFL30-9-2 G-YV -S KV—RQ A (1/8) 5 LAVELI —Q-TP- -L- QSL R P 6 JY1 —QSTP L- Q-L T P 5 Z6 —QSTP L- Q-L R P 5 ^ 0 8 71 R167.C1C2C3 Table 12 COMMON SEQUENCE PATTERNS SEQUENCE APPROXIMATE OCCURENCE (%) I G P G R 60 I GPGRA 50 IGPGRAF 32 IGPGRA 52 GPGRAF 40 IGPGRAF 35 IGPGRAaY 3 1 3 0 8 55 72 R167.C1C2C3 Table 13 IIIB MetThrArglleGlnArgGIyProGlyArgAlaPheVal GlyGlyGlyGly - RF SerlleThrArgGlyProGlyArgVallleTyr GlyGlyGlyGly - MN ArglleHisIleGlyProGlyArgAlaPheTyr GlyGlyGlyGly - SC SerlleHisIIeGIyProGlyArgAlaPheTyr GlyGlyGlyGly - WMJ1 HisIleHisIIeGlyProGlyArgAlaPheTyr GlyGlyGlyGly - LeuSerlleCys • 23 0 8 73 R167.C1C2C3 Table 13A E.coli BG MetLeuArgProValGluThrProThrArgGluIleLysLysLeuAspGlyLeuTrp -AlaPheSerLeuAspArgGluArgValValArgTyrHisArgTrpIleArgGlnAlaSer - IIIB MetThrArglleGlnArgGIyProGlyArgAlaPheVal GlyGlyGlyGly - RF SerlleThrArgGIyProGlyArgVallleTyr GlyGlyGlyGly - MN ArglleHisIleGlyProGIyArgAlaPheTyr GlyGlyGlyGly - SC SerlleHisIleGlyProGlyArgAlaPheTyr GlyGlyGlyGly - WMJ1 HisIleHisIleGlyProGlyArgAlaPheTyr GlyGlyGlyGly -LeuSerlleCys </div>

Claims

<div class="application article clearfix printTableText" id="claims"> 1 2 3 4 5 1 2 3 1 2 3 4 1 2 3 1 2 3 4 5 6 7 8 9 :0 1 1 9". ; '■ ^ .» 74 R167.C1C2C3 WHATXZWE CLAIM IS:

1. A compound having the capability of eliciting, and/or binding with, HIV neutralizing antibodies, said compound having the formula x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T ; excluding a compound having the sequence NNTRKSIRIQRGPGRVIYATGKIKC.

2. The compound, according to claim 1, wherein said compound is circularized.

3. The compound, according to claim 1, wherein said compound comprises epitopes from the principal neutralizing domain of more than one HIV variant. i i ~ r ^ OFFICE 1 8 APR 1994 RL-UJVED 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 frn flF* v > R 75 R167.C1C2C3

4. A polypeptide selected from the group consisting of (1) peptide IIIb(BH10)-PND; (2) peptide RF-PND; (3) peptide MN-PND; (4) peptide SC-PND; (5) peptide WMJ-2-PND; (6) peptide LAV-MAL-PND; (7) peptide SF-2-PND; (8) peptide NY5-PND; (9) peptide Z3-PND; (10) peptide WMJ1-PND; (11) peptide WMJ3-PND; (12) peptide Z6-PND; (13) peptide LAVELI-PND; (14) peptide CDC451-PND; (15) peptide CDC42-PND; (16) peptide BAL-PND; (171_ peptide HIV-2-PND; (18) peptide 139; (19) peptide 141; (20) (21) peptide 142; peptide 143; N.Z. P "['.NT OFFICE 1 8 APR 1994 RLCCIVED 41 42 43 44 45 46 47 4& 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 0 76 R167.C1C2C3 (22) peptide 339; (23) RP341 (WMJ2); (24) RP343 (SC); (25) RP60(IIIB); (26) RP335 (IIIB); (27) RP337 (Ills); (28) RP77 (IIIB); (29) RP83 (WMJ1); (30) RP79 (IIIb); (31) RP57; (32) RP55; (33) RP75A; (34) RP56; (35) RP59; (36) RP73 (IIIb,RF); (37) RP74 (IIIb,RF,MN,SC); (38) RP80 (IIIB,RF); (39) RP81 (IIIb,RF,WMJ1,MN); (40) RP82 (WMJ1.MN); (41) RP137 (riIB,RF); (42) RP140 (IIIb,RF); (43) peptide 64 (HIV-IIIB/HIV-RF/HIV-MN/HIV-SC); (44) peptide 338 (HrV-IIIo/HIV-RF); (45) RP342; (46) RP96; (47) RP97; (481 _ RP98; (49) RP99; (50) RP100; (51) RP102; (52) RP88; (53) RP91; (54) RP104; (55) RP106; N Z. PATCNT OFFICE 1 8 APR 1994 f . 2 '/i-u 77 R167.C1C2C3 (56) RP108; (57) RP70; (58) RP84; (59) RP144; (60) RP145; (61) RP146; (62) RP147; (63) RP150; (64) RP151; (65) RP63; (66) RP41; (67) RP61; (68) RP75; (69) RP111; (70) RP113; (71) RP114; (72) RP116; (73) RP120; (74) RP121c; (75) RP122c; (76) RP123c; and chemical modifications thereof.

5. A DNA sequence which codes for a polypeptide, other than the naturally occurring HIV envelope protein, said polypeptide having the capability of eliciting, and/or binding with, neutralizing antibodies, said polypeptide comprising the principal neutralizing domain, or a segment thereof, of an HIV variant, wherein said polypeptide has the formula x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T ; excluding a DNA sequence which codes for a polypeptide having the sequence NNTRKSIRIQRGPGRVIYATGKIKC. 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 78 23 L i J R167.

C1C2C3 6 • A composition capable of eliciting and/or binding with neutralizing antibodies to a broad range of HIV variants, said composition comprising one or more compounds having the following formula: xGzGy wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T ; excluding a composition comprising a compound having the sequence NNTRKSIRIQRGPGRVIYATGKIKC.

7. A composition, according to claim 6, wherein x is selected from: x(0) s x is not present x(l) = x1 x(2) = x2 xj x(3) = x3 x2 Xj x(4) s x4 x3 x2 X! x(5) = x5 x4 x3 x2 Xj x(6) = xg x5 x4 x3 x2 xj x(7) = X7 x6 x5 x4 x3 x2 X! x(8) SX8X7X6 x5 X4 x3 x2 Xj x(9) 5X9X8X7X5*5 X4 X3 X2 Xj x(10) = x10 X9 Xg X7 X6 X5 X4 X3 X2 X! x(ll) = xn X10 X9 X8 x7 Xfi X5 x4 x3 X2 xt x(12) = x12 xn X10 X9 x8 x7 X6 x5 x4 x3 X2 Xj x(13) = x13 Xj2 xn x10 X9 X8 X7 X6 X5 X4 X3 X2 Xj z is P, L, A, S, or Q; and y is selected from: y(6) = yi y2 y4 ys y« y(7) = yi y2 y3 y4 ys y* y-i y(8) s yi y2 y.i y4 ys ye yn ys \Z. r , r OFFICE 1 8 APR 1994 RLCli v lO 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 79 y(9) = yi y2 y3 y4 ys y6 y7 ys ys y(10) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 y(ll) = yj y2 y3 y4 ys ye Yn ys K yio y» y(12) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y12 y(13) = yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y« yi3 y(14) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yn yi3 yw y(15) s yj y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yi2 y« Yw Yis y(16) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y12 y13 y14 y15 y16 y(17) = yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yi2 yi3 y« Yis yie yn and wherein X! is I, R, M, IQR, V, L, K, F, S, G, Y, SRG, or YQR; x2 is H, R, Y, T, S, P, F, N, A, K, G, or V; x3 is I, L, M, T, V, E, G, F, or Y; x4 is R, S, G, H, A, K, or not present; X5 is K, R, I, N, Q, A, IR, RQ, or not present; X6 is R, K, S, I, P, Q, E, G, or T; x7 is T, K, V, I, A, R, P, or E; x8 is N, NV, Y, KJ, I, T, DK, H, or K; fU) is N, S, K, E, Y, D, I, or Q; x10 is N, Y, S, D, G, or H; xn is P; Xj2 is R, I, or K; x!3 is T, I, M or A; yi is R, K, Q, G, S, or T; y2 is A, V, N, R, K, T, S, F, P, or W; y3 is F, I, V, L, W, Y, G, S, or T; y4 is Y, V, H, L, F, S, I, T, M, R, VH, or FT; y5 is T, A, V, Q, H, I, S, Y, or not present; y6 is T, R, I, Q, A, M, or not present; y7 is G, E, K, R, T, D, Q, A, H, N, P, or not present; y8 is R, Q, E, K, D, N, A, G, S, I, or not present; y9 is I, V, R, N, G, or not present; y10 is I, T, V, K, M, R, L, S, E, Q, A, or not present; yil is G, R, E, K, H, or not present; y12 is D, N, I, R, T, S, or not present; yJ3 is I, M, ME, L, or not present; y14 is R, G, K, S, E, or not present; 230855 R167.C1C2C3 63 64 65 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 11 12 13 0 65 5 80 R167.C1C2C3 y15 is Q, K, or R; y16 is A; and y17 is H, Y, R, or Q ; and wherein either y4 is Y or y6 is T-

8. The composition, according to claim l, wherein Xj is I; z is P; yi is R; and y2 is A.

9. The composition, according to claim 7, wherein Xj is I; x3 is I; z is P; and yi is R.

10. The composition, according to claim 7, wherein z is P; yi is R; y2 is A; and y3 is F.

11. A composition, according to claim 7, wherein Xj is I; x2 is H; x3 is I; x4 is R; X5 is K; Xfi is R; x7 is T; 2 is P; yi is R; y2 is A; Y3 is F; y4 is Y; y5 is T; y<5 is T; and t' 16 1 1 2 1 2 1 2 3 4 5 6 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 2o 0 c3 5 5 81 R167.C1C2C3 y7 is G.

12. The composition, according to claim 6, wherein said compound is circularized.

13. The composition, according to claim 6, wherein said moiety capable of enhancing immunogenicity is a viral particle, microorganism, or immunogenic portion thereof.

14. A. prophylactic or therapeutic composition comprising immune globulin, monoclonal antibodies, and/or polyclonal antibodies generated by immunizing an appropriate animal such as a mouse, rat, horse, goat, human, or chimpanzee with a hybrid compound which comprises compounds according to claim 1 where said polypeptides are not naturally occurring HIV envelope proteins, said polypeptides having the capability of eliciting, and/or binding with, neutralizing antibodies, said polypeptides comprising the principal neutralizing domain, or a segment thereof, of an HIV variant.

15. A prophylactic or therapeutic composition comprising antibodies generated by immunizing an animal or human with at least one compound comprising a principal neutralizing domain of an HIV variant according to claim 1 followed by immunization of said animal or human with (a) a mixture comprising compounds, where said compounds are not naturally occurring HIV envelope proteins, said compounds having the capability of eliciting, and/or binding with, neutralizing antibodies, said compounds comprising the principal neutralizing domain, or a segment thereof, of an HIV variant; or (b) a hybrid compound which comprises polypeptides, where said polypeptides are not naturally occurring HIV envelope proteins, said polypeptides having the capability of eliciting, and/or binding with, neutralizing antibodies, said polypeptides comprising the principal neutralizing domain, or a segment thereof, of an HIV variant.

16. A prophylactic or therapeutic composition, comprising an antibody raised against a mixture comprising compounds according to claim 1, where said compounds are not naturally occurring HIV envelope proteins, but have the capability of eliciting, and/or binding with, neutralizing antibodies, each of said compounds comprising the principal neutralizing domain, or a segment thereof, of an HIV variant. . ■■■■! i l * ' \ >? f.- .v." 1 2 3 4 5 6 7 8 9 10 11 1 2 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 10 11 2:"' R S? W '«■' V.y< 3 J 82 R167.C1C2C3

17. A prophylactic or therapeutic composition, comprising an antibody raised against at least one compound having the capability of eliciting, and/or binding with, HIV neutralizing antibodies, said compound having the formula x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T.

18. The composition, according to claim 17, wherein x and/or y comprises a peptide from an HIV principal neutralizing domain.

19. An antibody raised against a compound, said compound having the formula x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein either the fourth amino acid of said y is Y or the sixth amino acid of said y is T.

20. The antibody, according to claim 19, wherein x is selected from x(0) s x is not present x(l) s xx x(2) s x2 Xi x(3) 3 x3 x2 X! x(4) 2X4X3X2 xx x(5) 3 X5 X4 X3 X2 X! x(6) 2x6X5X4 x3 x2 Xj x(7) 3x7X5X5 x4 x3 x2 Xj x(8) 3X3X7X6 x5 x4 x3 x2 xx o <" ' ' * x(9) 3 x9 Xg x7 Xg x5 x4 x3 x2 X! V x(10) 3 X10 x9 Xg X7 X6 X5 X4 X3 X2 Xj ^ y ^ • >3 14 15 16 17 £ IS 19 20 21 22 23 24 25 26 27 28 29 30 31 ^ 32 33 34 35 36 # 37 38 39 40 41 42 43 44 45 83 R167.C1C2C3 x(ll) S xn x10 x9 Xg X7 x5 x4 x3 x2 Xj x(12) S x12 Xj j x10 Xg Xg X7 Xfi X5 X4 X3 X2 X! x(13) S X13 X12 xn XjQ X9 Xg X7 Xfi x5 x4 x3 x2 xx z is P, L, A, S, or Q; and y is selected from: y(6) = yi Y2 Yi Y4 Ys Ye y(7) = yi Y2 Yi Ya Ys Ye Yi y(8) s yi y2 y3 y4 y5 y6 y7 y8 y(9) = Y\ Y2 Yi y4 ys Ye yi ys y9 y(io) = yi y2 y3 y4 Ys Ys Yi ys yg yio y(ll) = yi Y2 Yi Ya, Ys Ys Yi ys y9 yio yn y(12) = yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yJ2 y(13) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yu y12 y13 y(14) s Y\ Y2 Yi Ya Ys Ys Yi ys Yv yio yn Y12 y« y« y(i5) = yi y2 y3 y4 ys Ys y? ys Yo yio yn yn yi3 Yu yis y(16) s yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yi2 y« yi4 Yis YlS y(i7) = yi y2 y3 y4 ys ys yi ys yg yio yn Yn yi3 y« yis yie Yn and wherein xx is I, R, M, IQR, V, L, K, F, S, G, Y, SRG, or YQR; x2 is H, R, Y, T, S, P, F, N, A, K, G, or V; x3 is I, L, M, T, V, E, G, F, or Y; x4 is R, S, G, H, A, K, or not present; X5 is K, R, I, N, Q, A, IR, RQ, or not present; x6 is R, K, S, I, P, Q, E, G, or T; x7 is T, K, V, I, A, R, P, or E; x8 is N, NV, Y, KI, I, T, DK, H, or K; x9 is N, S, K, E, Y, D, I, or Q; x10 is N, Y, S, D, G, or H; xn is P; x12 is R, I, or K; x13 is T, I, M or A; N J yi is R, K, Q, G, S, or T; 1 ^ 7 JUfefrQ-r ■ 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 1 kf. V=j '<■* J J 84 R167.C1C2C3 y2 is A, V, N, R, K, T, S, F, P, or W; y3 is F, I, V, L, W, Y, G, S, or T; y4 is Y, V, H, L, F, S, I, T, M, R, VH, or FT; y5 is T, A, V, Q, H, I, S, Y, or not present; y6 is T, R, I, Q, A, M, or not present; y7 is G, E, K, R, T, D, Q, A, H, N, P, or not present; y8 is R, Q, E, K, D, N, A, G, S, I, or not present; y9 is I, V, R, N, G, or not present; y10 is I, T, V, K, M, R, L, S, E, Q, A, or not present; yn is G, R, E, K, H, or not present; ^ y12 is D, N, I, R, T, S, or not present; y13 is I, M, ME, L, or not present; >\ ■<? / J/>2. y14 is R, G, K, S, E, or not present; y15 is Q, K, or R; y1(; is A; and y17 is H, Y, R, or Q; and wherein either y4 is Y or y6 is T.

21. The antibody, according to claim 20, wherein said compound(s) are selected from the group consisting of (a) Y-S-N-V-R-N-R-I-H-I-G-P-G-R-A-F-H-T-T-K-R-I-T ? (b) N-N-N-T-S-R-G-I-R-I-G-P-G-R-A-I-L-A-T-E-R-I-I ; (c) N-N-N-T-R-K-G-I-F-I-G-P-G-R-N-I-Y-T-T-G-N-I-I ; (d) N-T-R-K-S-I-R-I-Q-R-G-P-G-R-A-F-V-T-I-G-K-I-G; (e) N-N-N-T-R-K-R-(I or V)-T-M-G-P-G-R-V-(Y or W)-Y-(X or T)-(A or T)-G-Q-I-I ; (f) N-N-N-(I or T)-R-K-(R or S)-I-T-(R or K)-G-P-G-(R or K)-V-I-Y-A-T-G-Q-I-I; (g) N-N-N-T-R-K-G-I-Y-V-G-S-G-R-(A or K)-V-T-T-R-(D or H or Q)-K-I-(I or M); and (h) T-R-Q-(R or S)-T-P-I-G-L-G-Q-(A or S)-L-Y-T-T-R.

22. A vaccine composition for generating a broadly neutralizing immunological response, said vaccine composition comprising a mixture comprising compounds according to claim 1, where said compounds are not naturally occurring HIV envelope proteins, but have the capability of eliciting, and/or binding with, neutralizing antibodies, said compounds comprising the principal neutralizing domain, or a segment thereof, of HIV variants.

23. A vaccine composition, for generating a broadly neutralizing immunological response, said vaccine composition comprising a hybrid compound which comprises polypeptides according to claim 1, where'said polypeptides are not naturally occurring HIV envelope proteins, but have the capability of eliciting, 4 5 1 2 3 4 5 6 7 8 9 10 1 2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 <f% X 'J ^ 85 R167.C1C2C3 and/or binding with, neutralizing antibodies, said polypeptides comprising the principal neutralizing domain, or a segment thereof, of an HIV variant.

24. A vaccine composition comprising at least one compound having the capability of eliciting, and/or binding with, HIV neutralizing antibodies, said compound having the formula x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L; and x or y individually may comprise any one of the following: cysteine, a protein or other moiety capable of enhancing immunogenicity, a peptide from an HIV principal neutralizing domain, a peptide capable of stimulating T-cells, or a general immune stimulant, and wherein the fourth amino acid of said y is Y or the sixth amino acid of said y is T ; excluding a vaccine composition comprising a compound having the sequence NNTRKSIRIQRGPGRVIYATGKIKC.

25. The vaccine composition, according to claim 24, wherein said composition is formulated with an immunological adjuvant.

26. The vaccine, according to claim 23, wherein x is selected from x(0) = x is not present x(l) = xx x(2) s x2 xj x(3) = x3 x2 xj x(4) = x4 x3 x2 xx x(5) = x5 x4 x3 x2 xt x(6) = *6 xs x4 x3 X2 X! x(7) = x7 Xfi X5 x4 x3 X2 X! x(8) == x8 x7 xe x5 x4 x3 x2 xj X(9) = Xg Xg x7 X6 X5 X4 x3 X2 Xj x(10) = x10 Xg Xg x7 X6 x5 x4 x3 X2 Xj x(ll)~= Xn X10 Xg Xg X7 X6 X5 X4 X3 X2 Xj x(12) = Xj2 xu X10 Xg Xg x7 X6 X5 X,, X3 X2 XX X(13) = X13 X12 xn X10 Xg Xg X7 Xg XS X4 X3 X2 X! z is P, L, A, S, or Q; and y is selected from: :T OFFICE 1 8 APR 1994 r/..OL:yLD © 21 22 23 24 25 ^ 26 27 28 29 30 31 32 33 34 35 36 37 38 39 ^ 40 41 42 43 44 • 45 46 47 48 49 50 51 52 53 54 55 ^ ^ s* SJ \ '■ - ^ "I |L v.,- - ' ^ ^ 86 R167.C1C2C3 y(6) s yi y2 y3 y4 ys ye y(7) = yi y2 ys y4 ys ye ii y(8) s yi y2 y3 y4 y5 y6 y7 y8 y(9) = yi yz ys y4 ys ye y7 ys yo y(io) = yi y2 y3 y4 ys ye y7 ys yo yio y(ii) = yi y2 y3 y4 ys ye y? ys yo yio yn y(12) s yj y2 y3 y4 ys y6 y7 y8 y9 y10 yn yw y(i3) = yi y2 y3 y4 ys ye y7 ys yo yio yn Yn y» y(i4) = yi y2 y3 y4 ys ye Yi ys yo yio yn y« yi3 yw y(15) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y12 yi3 yM yis y(16) s yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y12 y13 yi4 y15 yi6 y(17) s yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn yi2 Yi3 yi4 yis yie Yn and wherein X! is I, R, M, IQR, V, L, K, F, S, G, Y, SRG, or YQR; x2 is H, R, Y, T, S, P, F, N, A, K, G, or V; x3 is I, L, M, T, V, E, G, F, or Y; x4 is R, S, G, H, A, K, or not present; x5 is K, R, I, N, Q, A, IR, RQ, or not present; xg is R, K, S, I, P, Q, E, G, or T; x7 is T, K, V, I, A, R, P, or E; x8 is N, NV, Y, KI, I, T, DK, H, or K; x9 is N, S, K, E, Y, D, I, or Q; x10 is N, Y, S, D, G, or H; xn is P; x12 is R, I, or K; xj3 is T, I, M or A; yx is R, K, Q, G, S, or T; Yi is A, V, N, R, K, T, S, F, P, or W; y3 is F, I, V, L, W, Y, G, S, or T; y4 is Y, V, H, L, F, S, I, T, M, R, VH, or FT; y5 is T, A, V, Q, H, I, S, Y, or not present; y$ is T, R, I, Q, A, M, or not present; y7 is G, E, K, R, T, D, Q, A, H, N, P, or not present; y8 is R, Q, E, K, D, N, A, G, S, I, or not present; ,• y9 is I, V, R, N, G, or not present; ' -> < W * 1 JUj, • # 58 59 60 61 62 #63 64 65 1 2 3 4 5 6 7 8 9 10 12 13 14 15 • 16 1 2 3 4 5 6 7 87 R167.C1C2C3 yio is I, T, V, K, M, R, L, S, E, Q, A, or not present; yn is G, R, E, K, H, or not present; y12 is D, N, I, R, T, S, or not present; y13 is I, M, ME, L, or not present; y14 is R, G, K, S, E, or not present; y15 is Q, K, or R; yjg is A; and yi7 is H, Y, R, or Q; and wherein either y4 is Y or yg is T.

27. The vaccine, according to claim 26, wherein Xi is I; x2 is H; x3 is I; X4 is R; x5 is K; Xg is R; x7 is T; z is P; yi is R; y2 is A;

28. The vaccine, according to claim 26, wherein said compound(s) are selected from the group consisting of (a) Y-S-N-V-R-N-R-I-H-I-G-P-G-R-A-F-H-T-T-K-R-I-T; (b) N-N-N-T-S-R-G-I-R-I-G-P-G-R-A-I-L-A-T-E-R-I-I ; (c) N-N-N-T-R-K-G-I-F-I-G-P-G-R-N-I-Y-T-T-G-N-I-I; (e) N-N-N-T-R-K-R-(I or V)-T-M-G-P-G-R-V-(Y or W)-Y-(X or T)-(A or T)-G-Q-I-I; (f) N-N-N-(I or T)-R-K-(R or S)-I-T-(R or K)-G-P-G-(R or K)-V-I-Y-A-T-G-Q-I-I ? (g) N-N-N-T-R-K-G-I-Y-V-G-S-G-R-(A or K)-V-T-T-R-(D or H or Q)-K-I-(I or M) ; and (h) T-R-Q-(R or S)-T-P-I-G-L-G-Q-(A or S)-L-Y-T-T-R. y3 is F; y4 is Y; Ys is T; / y6 is T; and y7 is G. L 1 2 1 2 1 2 1 2 1 1 2 1 1 2 1 1 1 2 1 2 J 4 5 1 23 0 S 55 88 R167.C1C2C3

29. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence G-P-G-R-A-F.

30. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence I-G-P-G-R-A-F.

31. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence I-G-P-G-R-A

32. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence I-a-I-G-P-G-R, wherein a is any of the 20 amino acids.

33. The vaccine, according to claim 32, wherein a is H.

34. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence I-a-I-G-P-G-R-A, wherein a is any of the 20 amino acids.

35. The vaccine, according to claim 34, wherein a is H.

36. The vaccine composition of claim 26, wherein said compound(s) are capable of eliciting antibodies that bind to the sequence I-a-I-G-P-G-R-A-F, wherein a is any of the 20 amino acids.

37. The vaccine, according to claim 36, wherein a is H.

38. The vaccine composition, according to claim 24, wherein said compound(s) are circularized.

39. The vaccine composition, according to claim 24, wherein said compound(s) comprise epitopes from more than one HIV variant. i. i i- i . f * c J * i* \\ 2 fJUftjgpj T

40. The vaccine, according to claim 26, wherein Xj is I; z is P; yi is R; and y2 is A.

41. The composition, according to claim 26, wherein Xj is I; 1 2 3 4 5 1 2 1 2 3 1 2 3 4 5 6 1 2 3 4 5 1 2 3 4 5 ? ^ 0 P R R llM W V * ^ 89 R167.C1C2C3 x3 is I; z is P; and yj is R.

42. The composition, according to claim 26, wherein z is P; yi is R; y2 is A; and y3 is F.

43. The vaccine, according to claim 26, wherein x is selected from the group consisting of x(5), x(6), x(7), x(8), x(9), x(10), and x(ll); and y is selected from y(6), y(7), y(8), y(9), y(10), and y(ll).

44. The composition, according to claim 26, wherein said compound has the following amino acid sequence: x13-R-p-x1o-x9-x8-x7-x6-x5-x4-x3-x2-xrG-z-G-y1-y2-y3-y4-y5-y6-y7-y8-y9-yio-G-yi2-yi3-R-yi5-A-yn'

45. A kit for use in detecting antibody against HIV in a biological fluid, said kit comprising: (a) a compound as defined in claim 1; and (b) a means for detecting complexes formed between said antibody and said compound.

46. The kit, according to claim 45, wherein said compound has the formula ^ x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L.

47. The kit, according to claim 46, wherein x is selected from x(0) = x is not present x(l) = Xj x(2) = x2 xx x(3) s x3 x2 X! x(4) = x4 x3 x2 xx x(5) = x5 x,, x3 x2 x2 • r, i £- / . ■■7 | ^ ' Jt/'fi 2 j ^ * Imm W vX 90 R167.C1C2C3 x(6) ^3^X5X4X3X2 Xj x(7) s x7 Xg x5 x4 X3 x2 Xj x(8) s x8 x7 xg x5 x4 x3 x2 xx x(9) s x9 Xg x7 Xg x5 x4 x3 x2 Xj x(10) = XjQ X9 Xg x7 Xg x5 x4 x3 x2 Xi x(ll) == xn Xjo X9 Xg X7 Xg x5 x4 x3 X2 Xj x(12) 3 x12 xu Xjo x9 Xg X7 Xg X5 X4 X3 X2 X! *(13) = X13 *12 X11 X10 to, Xg X7 Xg X5 X4 X3 X2 X! z is P, L, A, S, or Q; and y is selected from: y(6) = yj y2 y3 y4 ys y6 y(7) = yi y2 y3 y4 ys ys y7 y(8) = yi y2 y3 y4 ys ye y7 ys y(9) = yi y2 y3 y4 ys ye y7 ys y» y(10) e yi y2 y3 y4 y5 y6 y7 y8 y9 y10 y(ll) = yx y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y(12) s yj y2 y3 y4 y5 y6 y7 y8 y9 y10 yn y12 y(13) s yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yu y12 yi3 y(14) = yi y2 y3 y4 ys ye Y7 Ys Y9 yio yn Y12 Y13 Yu y(i5) 3 yi y2 Yz Y4 ys Ye Yn ys Y9 yio yn yi2 y« Yu yis y(16) H yi y2 y3 y4 y5 y6 y7 y8 y9 y10 yu y12 y13 yM y15 yie y(i7) = yi yi Yz y4 ys ye y7 ys yg yio yn Yn yo Yu yis yis yn and wherein Xj is I, R, M, IQR, V, L, K, F, S, G, Y, SRG, or YQR; x2 is H, R, Y, T, S, P, F, N, A, K, G, or V; x3 is I, L, M, T, V, E, G, F, or Y; x4 is R, S, G, H, A, K, or not present; x5 is K, R, I, N, Q, A, IR, RQ, or not present; x6 is R, K, S, I, P, Q, E, G, or T; . x7 is T, K, V, I, A, R, P, or E; x8 is N, NV, Y, KI, I, T, DK, H, or K; x9 is N, S, K, E, Y, D, I, or Q; \ 2 1 J • 45 46 47 48 49 • 5° 51 52 53 54 55 56 57 58 59 60 61 62 63 • 64 65 1 2 • 3 W 4 5 6 7 8 9 10 1 2 3 4 7- /-S p J 91 R167.C1C2C3 x10 is N, Y, S, D, G, or H; *11 is P; x12 is R, I, or K; x13 is T, I, M or A; yi is R, K, Q, G, S, or T; y2 is A, V, N, R, K, T, S, F, P, or W; y3 is F, I, V, L, W, Y, G, S, or T; y4 is Y, V, H, L, F, S, I, T, M, R, VH, or FT; ys is T, A V, Q, H, I, S, Y, or not present; y<; is T, R, I, Q, A, M, or not present; is G, E, K, R, T, D, Q, A, H, N, P, or not present; y8 is R, Q, E, K, D, N, A G, S, I, or not present; yg is I, V, R, N, G, or not present; yio is I, T, V, K, M, R, L, S, E, Q, A, or not present; yu is G, R, E, K, H, or not present; y12 is D, N, I, R, T, S, or not present; y13 is I, M, ME, L, or not present; yi4 is R, G, K, S, E, or not present; yls is Q, K, or R; y16 is A; and yi7 is H, Y, R, or Q; and wherein either y4 is Y or yg is T.

48. The kit, according to claim 45, wherein said compound(s) are selected from the group consisting of (a) Y-S-N-V-R-N-R-I-H-I-G-P-G-R-A-F-H-T-T-K-R-I-T; (b) N-N-N-T-S-R-G-I-R-I-G-P-G-R-A-I-L-A-T-E-R-I-l; p , (c) N-N-N-T-R-K-G-I-F-I-G-P-G-R-N-I-Y-T-T-G-N-I-I? (d) N-T-R-K-S-I-R-I-Q-R-G-P-G-R-A-F-V-T-I-G-K-I-G ? (e) N-N-N-T-R-K-R-(I or V)-T-M-G-P-G-R-V-(Y or W)-Y-(X or T)-(A or T)-G-Q-M ; (f) N-N-N-(I or T)-R-K-(R or S)-I-T-(R or K)-G-P-G-(R or K)-V-I-Y-A-T-G-Q-I-I ; (g) N-N-N-T-R-K-G-I-Y-V-G-S-G-R-(A or K)-V-T-T-R-(D or H or Q)-K-I-(I or M); and (h) T-R-Q-(R or S)-T-P-I-G-L-G-Q-(A or S)-L-Y-T-T-R.

49. An immunological assay for detecting and/or quantifying antibody against HIV in a fluid, said assay utilizing at least one compound according to claim 1, where said compound is not a naturally occurring HIV envelope protein, said compound having the capability of eliciting, and/or binding with, neutralizing antibodies, said compound comprising the principal neutralizing domain, or a segment thereof, of an HIV variant. B l 2 3 4 5 6 1 2 3 4 5 1 % 3 4 5 6 7 1 2 3 4 1 92 R167.C1C2C3

50. A method of detecting antibody against HIV in a biological fluid, comprising the steps of: (a) incubating a compound according to claim 1, other than a naturally occurring HIV envelope protein, said compound having the capability of eliciting, and/or binding with, neutralizing antibodies, said compound comprising the principal neutralizing domain, or a segment thereof, of an HIV variant; (b) detecting complexes formed between said antibody and said compound. /

51. The method, according to claim 5Q wherein said compound has the following formula: x G z G y wherein x is 0 to 13 amino acids in length; y is 6 to 17 amino acids in length; and z is P, A, S, Q, or L.

52. A method for assaying a biological fluid for the presence of an HIV variant-specific protein, said method comprising (a) contacting said fluid with an antibody specific for compounds according to claim 1 wherein said compounds are not naturally occurring HIV envelope proteins, but have the capability of eliciting, and/or binding with, neutralizing antibodies, said compounds comprising the principal neutralizing domain, or a i-segment thereof, of an HIV variant; and (b) detecting immune complexes as a measure of said variant in l2''0Yi993 said fluid. a V

53. A method of in vitro lymphocyte stimulation comprising treating lymphoid cells from immune animals with at least one compound according to claim 1, other than naturally occurring HIV envelope proteins, said compound having the capability of eliciting, and/or binding with, neutralizing antibodies, said compound comprising the principal neutralizing domain, or a segment thereof, of an HIV variant.

54. A method of identifying polyclonal or monoclonal antibodies which are useful in prophylaxis or therapy, said method comprising screening antibody-produdng cells for ability to bind with at least one compound according to claim 1, other than naturally occurring HIV envelope proteins, said compound having the 4 5 1 2 3 4 5 6 7 8 9 1 2 1 2 1 2 1 2 1 2 3 1 2 1 1 R167.C1C2C3 93 capability of eliciting, and/or binding with, neutralizing antibodies, said compound comprising the principal neutralizing domain, or a segment thereof, of an HIV variant.

55. A synthetic gene which encodes for a polypeptide wherein said polypeptide comprises more than one HIV neutralizing epitope.

56. A synthetic gene which codes for a polypeptide wherein said polypeptide comprises neutralizing epitopes from more than one HIV isolate.

57. The synthetic gene, according to claim 56, wherein said polypeptide comprises neutralizing epitopes from 2 to 20 HIV isolates.

58. The synthetic gene, according to claim 56, wherein one of said neutralizing epitopes is from the HTV isolate designated HIV-MN.

59. The synthetic gene, according to claim 56> wherein said polypeptide comprises neutralizing epitopes from the HIV isolates which have been designated HIV-MN, HIV-IIIB, HIV-RF, HIV-SC, and HIV-WMJ1.

60. The synthetic gene, according to claim 56, wherein the regions encoding neutralizing epitopes from different HIV isolates are separated by amino acid spacers.

61. The synthetic gene, according to claim 5^ wherein said amino acid spacers are glycines.'

62. The synthetic gene, according to claim 5$ wherein said gene codes for a polypeptide having the amino acid sequence shown in Table 13, or an equivalent amino acid sequence. 1 1 2 1 1 2 1 2 1 2 3 1 2 1 1 2 1 1 2 1 2 3 4 \sf 94 R167.C1C2C3

63. The synthetic gene, according to claim 56, wherein said gene codes for a fusion polypeptide.

64. The synthetic gene, according to claim 63, wherein said gene codes for a polypeptide having the amino acid sequence shown in Table 13A, or an equivalent amino acid sequence.

65. A compound comprising neutralizing epitopes from more than one HIV isolate.

66. The compound, according to claim 65, wherein said compound comprises neutralizing epitopes from 2 to 20 HIV isolates.

67. The compound, according to claim 6^ wherein one of said neutralizing epitopes is from the HIV isolate designated HIV-MN. 6G. The compound, according to claim 65, wherein said compound comprises neutralizing epitopes from the HIV isolates which have been designated HIV-MN, HIV-IIIB, HIV-RF, HIV-SC, and HIV-WMJ1.

69. The compound, according to claim 65, wherein said neutralizing epitopes are separated by amino acid spacers.

70. The compound, according to claim 65, wherein said amino acid spacers are glycines.

71. The compound, according to claim 65, wherein said compound has the amino acid sequence shown in Table 13, or an equivalent amino acid sequence. 72 i The compound, according to claim 6 5, wherein said compound is a fusion polypeptide.

73. The compound, according to claim 72, wherein said compound has the amino acid sequence shown in Table 13A, or an equivalent amino acid sequence.

74. A prophylactic or therapeutic composition, comprising immune globulin, monoclonal antibodies, and/or polyclonal antibodies generated by immunizing an appropriate animal with a composition comprising a multi-epitope compound wherein said multi-epitope compound comprises neutralizing epitopes from 2 to 20 HIV isolates, wherein one of said isolates is HIV-MN. <' ^ , C< \ 2 ia'JV i'//3 v 7 r V f I 95

75. The composition, according to claim 14, wherein said multi-epitope compound comprises neutralizing epitopes from the HIV isolates designated HIV-MN, HIV-IIIB, HIV-RF, HIV-SC, and HIV-WMJ1.

76. A compound having the capability of eliciting and/or binding with neutralizing antibodies substantially as herein described with reference to any example thereof.

77. A DNA sequence as defined in claim 5 substantially as herein described with reference to any example thereof.

78. A composition capable of eliciting and/or binding with neutralizing antibodies substantially as herein described with reference to any example thereof.

79. A prophylactic or therapeutic composition as defined in any one of claims 14 to 18, 74 and 75 substantially as herein described with reference to any example thereof.

80. An antibody as defined in claim 19 substantially as herein described with reference to any example thereof.

81. A vaccine composition for generating a broadly neutralizing immunological response as defined in any one of claims 22 to 44 substantially as herein described with reference to any example thereof.

82. A kit as defined in claim 45 for use in detecting antibody against HIV in a biological fluid substantially as herein described with reference to any example thereof.

83. An immunological assay for detecting, and/or quantifying antibody against HIV in a fluid as defined in claim 49 substantially as herein described with reference to any example thereof. 96

84. A method as defined in claim 50 of detecting antibody against HIV in a biological fluid substantially as herein described with reference to any example thereof.

85. A method for assaying a biological fluid for the presence of an HIV variant specific protein substantially as herein described with reference to any example thereof.

86. A method of in vitro lymphocyte stimulation as defined in claim 53 substantially as herein described with reference to any example thereof.

87. A method of identifying antibodies useful in prophylaxis or therapy substantially as herein described with reference to any example thereof.

88. A synthetic gene as defined in claim 55 or 56 substantially as herein described with reference to any example thereof or to the accompanying drawings.

89. A compound as defined in claim 65 containing neutralizing epitopes for more than one HIV isolate substantially as herein described with reference to any example thereof or to the accompanying drawings. My.teW OoWf^TlQN . .. ... By the authorised agents A J n"PK & $QM </div>