NZ223869A - Genetically engineered production of human manganese superoxide dismutase - Google Patents
Genetically engineered production of human manganese superoxide dismutaseInfo
- Publication number
- NZ223869A NZ223869A NZ22386988A NZ22386988A NZ223869A NZ 223869 A NZ223869 A NZ 223869A NZ 22386988 A NZ22386988 A NZ 22386988A NZ 22386988 A NZ22386988 A NZ 22386988A NZ 223869 A NZ223869 A NZ 223869A
- Authority
- NZ
- New Zealand
- Prior art keywords
- sod
- hmn
- dna sequence
- sequence
- plasmid
- Prior art date
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Description
<div class="application article clearfix" id="description">
<p class="printTableText" lang="en"># <br><br>
22 3 8 6 9 <br><br>
M <br><br>
Q <br><br>
Priority C«»<*\ek..... <br><br>
...^.:.0.3DJ. 2J#SZJ£k <br><br>
Complete Specificitton Filed: .....\.Y. 2S&: <br><br>
Claw: {5)*C .. <br><br>
Publication MHn .. JUL <br><br>
P.O. Journal, No: J.£?.4tJr*. <br><br>
Class Cont: . ?£) J.. &?*.-, <br><br>
ssai.! <br><br>
Patents Form No. 5 <br><br>
COMPLETE SPECIFICATION; <br><br>
HUMAN MANGANESE SUPEROXIDE DISMUTASE (hMn-SOD) <br><br>
^/We,BOEHRINGER INGELHEIM INTERNATIONAL GMBH, a body corporate organised under the laws of the Federal Republic of Germany/ of D-6507 Ingelhiem am Rhein, Federal Republic of Germany, <br><br>
hereby declare the invention, for which^we pray that a patent may be granted to jj^/us, and the method by which it is to be performed, to be particularly described in and by the following statement: <br><br>
- 1 - <br><br>
-4B6l8&£,i ,*.3®,■ HH*OI-w " - <br><br>
„<4 <br><br>
22 3 8 6 9 <br><br>
- 2 - <br><br>
The present invention relates to a method of producing human manganese superoxide dismutase (hMn-SOD) by genetic engineering, the DNA sequences which code for this enzyme, suitable vectors which contain these DNA 5 sequences and host cells which are capable of expressing these DNA sequences, and the enzyme hMn-SOD itself. <br><br>
Proposed uses of this enzyme are also described. <br><br>
As a consequence of various biochemical processes 10 in biological systems (e.g. redox processes in the respiratory chain, oxidation in the cytoplasm), <br><br>
O2 radicals are continuously formed and, as is well known, these radicals are highly cytotoxic and capable of resulting in tissue damage. The degradation 15 of collagen and synovial fluid by such radicals has been discussed with reference to pathological conditions, e.g. in the course of rheumatically caused diseases (Pasquier, C. et al.. Inflammation 8, 27-32, 1984). Eukaryotic cells contain two forms 20 of superoxide dismutases, one of which occurs predominantly in cytosol (Cu/Zn-SOD) whilst the other occurs primarily in the mitochondria (Mn-SOD). <br><br>
In liver mitochondria it has been found that Mn enzyme is localised in the matrix enclosing the 25 inner membrane, although Mn-SOD has also been detected in the cytosol of the liver cells (Mc Cord J.M. <br><br>
et al., In: Superoxide and Superoxide Dismutases (A.M. Michelson, J.M. Mc Cord, I. Fridovich, eds.) <br><br>
Academic Press, N.Y., 129-138, 1977). <br><br>
30 <br><br>
In prokaryotes there is an Fe-SOD as well as an Mn-SOD. The former has also been found in algae and protozoa as well as in some plant species (Bridges, S.M., Salin, M.L., Plant Physiol. 68, 275-278, <br><br>
35 1981). These highly active enzymes catalyse the disproportionation 02+02+2H+ *H202+02 and prevent, <br><br>
e> 22 3 8 6 9 <br><br>
- 3 - <br><br>
by this dismutation of the superoxide radicals, the concentration thereof and hence their damaging effect on cells. Apart from the endoplasmic reticulum of the liver, the mitochondrial membranes can be regarded 5 as one of the most important sites of ol formation <br><br>
V <br><br>
in animal cells, so that it is not surprising that mitochondria have their own special SOD(Mn-SOD) <br><br>
available. <br><br>
C| 10 The structural gene of a prokaryotic Mn-SOD (E. coli) <br><br>
has been cloned and the chromosomal sodA gene was located (Touati, D., J. Bact. 155, 1078-1087, 1983). <br><br>
The 699 bp long nucleotide sequence of a mitochondrial 15 yeast Mn-SOD was determined and the primary structure of both the precursor and also the mature protein was derived therefrom - with molecular weight of 26123 Da for the precursor and 23059 Da for the mature protein (Marres, C.A.M. et al., Eur. J. 20 Biochem. 1£7, 153-161 (1985). Thus, the Mn- and <br><br>
Cu/Zn-SOD (MW=14893, EP-A 138111) differ significantly in their molecular weights. <br><br>
The complete amino acid sequence of Mn-SOD from 25 human liver was published by D. Barra et al., and according to this publication the hMn-SOD is supposed to consist of 196 amino acids (Barra, D. et al., J. <br><br>
Biol. Chem. 259, 12595-12601, 1984). Human Cu/Zn-SOD from erythrocytes, on the other hand, consists 30 of 153 amino acids (Jabusch, J.R., et al., Biochemistry 19, 2310-2316, 1980) and shows no sequence homologies with hMn-SOD (Barra, D. et al., see above). <br><br>
Generally, the superoxide dismutases are credited 35 with a protective function against certain inflammatory processes. In particular, deficiency in Mn-SOD <br><br>
22 3 8 6 9 <br><br>
- 4 - <br><br>
is supposed to have some significance in the development of rheumatoid arthritis (Pasquier, C. et al., see above). SOD is also assumed to have a protective effect against alcohol-induced liver damage (Del 5 Villano B.C. et al.. Science 202/ 991-993, 1980). <br><br>
The cloning and expression of a human SOD is known only for human Cu/Zn-SOD from human liver (EP-A 138111). <br><br>
10 In view of the above-mentioned essential properties of the superoxide dismutases, particularly hMn-SOD, <br><br>
a demand for its use in therapy and/or diagnosis can be expected. For this purpose it is advantageous to have access to sufficient quantities of Mn-SOD <br><br>
15 of the same species, i.e. human, in homogeneous form. The projected aim which derives therefrom is to minimise or prevent the immunological reactions which can be expected, e.g. after therapeutic use. <br><br>
20 Only with the development of technologies for the recombination of foreign DNA with vector DNA and the possibility of establishing the former in stable form in microorganisms and expressing it therein has made it possible to produce homogeneous proteins <br><br>
25 of animal or human origin in large quantities. <br><br>
The objective here is different, namely that the enzyme thus prepared, hMn-SOD, should have a biological activity spectrum which is characteristic of authentic genuine hMn-SOD. <br><br>
30 <br><br>
An aim of the present invention was therefore to determine or produce the novel DNA sequence coding for this enzyme by genetic engineering and, to provide novel methods by which this sequence can be obtained. <br><br>
35 <br><br>
An additional aim of this invention was to express the sequence coding for hMn-SOD in suitable host <br><br>
S«-< .(■ <br><br>
o <br><br>
© <br><br>
22 3 8 6 9 <br><br>
- 5 - <br><br>
f: *%rr t }: <br><br>
(' cells Cor the first time by genetic engineering, <br><br>
»v <br><br>
| to produce the homogeneous enzyme hMn-SOD by such f methods for the first time, to isolate it and prepare it in pure form and to describe for the first time 5 the procedure required to do this. <br><br>
The present invention thus provides a polypeptide in substantially pure form which has the enzymatic, biochemical and immunological properties of human 10 manganese superoxide dismutase (hMn-SOD) and further provides a DNA sequence which codes for all or a substantial part of such a polypeptide. <br><br>
Thus, according to the invention, the DNA sequences 15 coding for hMn-SOD, for example of formula Ilia or Illb <br><br>
20 <br><br>
25 <br><br>
30 <br><br>
ATG <br><br>
AAG <br><br>
CAC <br><br>
TCT <br><br>
TTG <br><br>
CCA <br><br>
GAC <br><br>
TTG <br><br>
CCA <br><br>
TAC <br><br>
GAC <br><br>
TAC <br><br>
GGT <br><br>
GCT <br><br>
CTA <br><br>
GAA <br><br>
CCA <br><br>
CAC <br><br>
ATC <br><br>
AAT <br><br>
GCT <br><br>
CAA <br><br>
ATC <br><br>
ATG <br><br>
CAA <br><br>
TTG <br><br>
CAC <br><br>
CAC <br><br>
TCT <br><br>
AAG <br><br>
CAC <br><br>
CAC <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
35 <br><br>
Formula Ilia <br><br>
- 6 - <br><br>
22 3 o b d <br><br>
ATG <br><br>
AAG <br><br>
CAC <br><br>
TCT <br><br>
TTG <br><br>
CCA <br><br>
GAC <br><br>
TTG <br><br>
CCA <br><br>
TAC <br><br>
GAC <br><br>
TAC <br><br>
GGT <br><br>
GCT <br><br>
CTA <br><br>
GAA <br><br>
CCA <br><br>
CAC <br><br>
ATC <br><br>
AAT <br><br>
GCT <br><br>
CAA <br><br>
ATC <br><br>
ATG <br><br>
CAA <br><br>
TTG <br><br>
CAC <br><br>
CAC <br><br>
TCT <br><br>
CAG <br><br>
CAC <br><br>
CAC <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
20 Formula Illb <br><br>
, optionally provided with corresponding signal or control sequences, were inserted into suitable vectors and suitable host cells were transformed therewith. 25 After cultivation of the transformed host cells the polypeptides formed are isolated and purified by methods known per se. The polypeptides obtained correspond to the following formulae IVa and IVb. <br><br>
30 i 5 10 15 <br><br>
Lys His Ser Leu Pro Asp Leu Pro Tyr Asp Tyr Gly Ala Leu Glu <br><br>
20 25 30 <br><br>
Pro His lie Asn Ala Gin lie Met Gin Leu His His Ser Lys His <br><br>
35 40 45 <br><br>
His Ala Ala Tyr Val Asn Asn Leu Asn Val Thr Glu Glu Lys Tyr <br><br>
22 3 8 6 9 <br><br>
- 7 - <br><br>
50 55 60 <br><br>
Gin Glu Ala Leu Ala Lys Gly Asp Val The Ala Gin lie Ala Leu <br><br>
65 70 75 <br><br>
Gin Pro Ala Leu Lys Phe Asn Gly Gly Gly His lie Asn His Ser <br><br>
80 85 90 lie Phe Trp Thr Asn Leu Ser Pro Asn Gly Gly Gly Glu Pro Lys <br><br>
95 100 105 Gly Glu Leu Leu Glu Ala lie Lys Arg Asp Phe Gly Ser Phe Asp <br><br>
110 115 120 <br><br>
Lys Phe Lys Glu Lys Leu Thr Ala Ala Ser Val Gly Val Gin Gly <br><br>
125 130 135 Ser Gly Trp Gly Trp Leu Gly Phe Asn Lys Glu Arg Gly His Leu <br><br>
140 145 150 <br><br>
Gin He Ala Ala Cys Pro Asn Gin Asp Pro Leu Gin Gly Thr Thr <br><br>
155 160 165 <br><br>
Gly Leu lie Pro Leu Leu Gly lie Asp Val Trp Glu His Ala Tyr <br><br>
170 175 180 <br><br>
Tyr Leu Gin Tyr Lys Asn Val Arg Pro Asp Tyr Leu Lys Ala lie <br><br>
185 190 195 <br><br>
Trp Asn Val He Asn Trp Glu Asn Val Thr Glu Arg Tyr Met Ala <br><br>
Cys Lys Lys <br><br>
Formula IVa <br><br>
' * K, , V ..1 , , v.., _ .. . <br><br>
22 3 8 6 9 <br><br>
- 8 - <br><br>
15 10 15 <br><br>
Lys His Ser Leu Pro Asp Leu Pro Tyr Asp Tyr Gly Ala Leu Glu <br><br>
20 25 30 <br><br>
Pro His lie Asn Ala Gin lie Met Gin Leu His His Ser Gin His <br><br>
35 40 45 <br><br>
His Ala Ala Tyr Val Asn Asn Leu Asn Val Thr Glu Glu Ly6 Tyr <br><br>
50 55 60 <br><br>
Gin Glu Ala Leu Ala Lys Gly Asp Val Thr Ala Gin lie Ala Leu <br><br>
65 70 75 <br><br>
Gin Pro Ala Leu Lys Phe Asn Gly Gly Gly His lie Asn His Ser <br><br>
80 85 90 <br><br>
lie Phe Trp Thr Asn Leu Ser Pro Asn Gly Gly Gly Glu Pro Lys <br><br>
95 100 105 <br><br>
Gly Glu Leu Leu Glu Ala lie Lys Arg Asp Phe Gly Ser Phe Asp <br><br>
110 115 12G <br><br>
Lys Phe Lys Glu Lys Leu Thr Ala Ala Ser Val Gly Val Gin Gly <br><br>
125 130 135 <br><br>
Ser Gly Trp Gly Trp Leu Gly Phe Asn Lys Glu Arg Gly His Leu <br><br>
140 145 150 <br><br>
Gin lie Ala Ala Cys Pro Asn Gin Asp Pro Leu Gin Gly Thr Thr <br><br>
155 160 165 <br><br>
Gly Leu lie Pro Leu Leu Gly lie Asp Val Trp Glu His Ala Tyr <br><br>
wiwwwnii" <br><br>
- 9 - <br><br>
22 3 8 <br><br>
170 175 180 <br><br>
Tyr Xeu Gin Tyr Lys Asn Val Arg Pro Asp Tyr Leu Lys Ala lie <br><br>
O 5 185 190 195 Trp Asn Val lie Asn Trp Glu Asn Val Thr Glu Arg Tyr Met Ala <br><br>
Cys Lys Lys <br><br>
Ww 10 <br><br>
Formula IVb <br><br>
^ The hMn-SOD according to the invention prepared by genetic engineering are of use, owing both to 15 their biological/enzymatic spectrum of activity on the one hand and to the quantity of highly purified v enzyme now available which has maximum possible immunological identity with genuine hMn-SOD, on the other hand, for every type of prevention, treatment ~tj 20 and/or diagnosis in inflammatory, degenerative, <br><br>
f': <br><br>
neoplastic or rheumatic diseases, for wound healing, j in autoimmune diseases and in transplants, and for the prevention and treatment of diseases which : O are accompanied by a deficiency of hMn-SOD or are <br><br>
25 causally linked thereto. For example, the clinical applications include those which may be inferred from Bannister W.H. and Bannister J.V. (Biological and Clinical Aspects of Superoxide and Superoxide Dismutase, Vol. 11B, Elsevier/North-Holland, 1980) 30 and Michelson, A.M., McCord, J.M., Fridovich (Superoxide and Superoxide Dismutases, Academic Press, 1977). Furthermore, the following clinical applications should be considered: for perfusion wounds, strokes, alcohol-damaged livers, premature babies, possibly 35 pancreatitis, acute respiratory diseases, (ARDs), <br><br>
emphysema, dialysis-damaged kidneys, osteoarthritis, rheumatoid arthritis, radiation-induced damage, <br><br>
1 <br><br>
fi> <br><br>
J}\ <br><br>
%- <br><br>
22 3 8 6 9 <br><br>
- 10 - <br><br>
sickle-cell anaemia. <br><br>
The invention therefore provides pharmaceutical compositions containing, in addition to one or 5 more pharmaceutically inert excipient and/or carrier, an effective quantity of at least one polypeptide which has the enzymatic, biochemical and immunological properties of hMn-SOD. <br><br>
Ci* 10 The hMn-SODs according to the invention may be administered either systemically or topically, <br><br>
whilst in the former case conventional parenteral routes of administration (e.g. i.v., i.m., s.c., <br><br>
i.a.) and for the latter case the known preparations 15 may be used (e.g. pastes, ointments, gels, tablets for sucking or chewing, powders and other galenic formulations which permit local resorption of the hMn-SOD preparations and pharmaceutically acceptable carriers). A therapeutically effective dosage 20 range of around 4 mg, for example, per day may be used depending on individual criteria (e.g. <br><br>
the patients, the severity of the illness, etc). <br><br>
The hMn-SODs according to the invention are also of 25 use for increasing the shelf-life of solid or liquid foods. <br><br>
Thus, according to the invention, the problem is solved by searching through a cDNA gene bank constructed 30 from human cells which produce the desired enzyme with synthetically produced DNA probe molecules, <br><br>
thereby isolating the gene which codes for hMn-SOD. <br><br>
In order to obtain the gene for hMn-SOD, the mRNA can be isolated, by known methods, from cells which 35 produce the desired enzyme. Various starting materials may be used, e.g. metabolically active gland tissue such as liver or placenta. <br><br>
. * 22 3 8 6 9 <br><br>
- 11 - <br><br>
After production of the cDNA, which can be obtained by known methods e.g. by primed synthesis with reverse transcriptase using isolated mRNA, subsequent incorporation into a suitable vector and amplification O 5 to obtain a complete cDNA gene bank, the latter can be searched with a defined, radioactively labelled DNA probe or a mixture of various probes of this kind. In order to take account of the degeneracy of the genetic code, defined DNA probe mixtures C 10 are preferably used which represent all possible nucleotide variations for each amino acid residue or which are selected so that the number of DNA probes in. a mixture to be synthesised is as small as possible and the homology with the hMn-SOD DNA 15 sequence sought is as high as possible. Another criterion for selection in the synthesis of DNA probes may require that these probes are complementary to at least two independent regions, for example near the 3' and 5' ends of the putative gene sequence. 20 In this way, clones which show positive signals against, for example, both independent DNA probes can be identified by means of at least two separate hybridisations. These clones may then preferably (^ be used to isolate the hMn-SOD gene, since they <br><br>
25 can be expected to contain either a substantial part of or the complete gene for hMn-SOD. <br><br>
The particular DNA sequences used for the DNA probes according to the invention were derived from liver <br><br>
'NW1 <br><br>
30 tissue using the amino acid sequence of human Mn-SOD published by D. Barra et al. (Barra, D. et al., Oxy Radicals and their scavenger Systems, Vol. 1, 336-339, 1983). In particular, two regions of the putative hMn-SOD DNA sequence which code for 35 at least five amino acid groups, preferably for 8 amino acid groups, may preferably be used, a DNA probe length of at least 14, preferably 23 bases <br><br>
C\ <br><br>
(->. <br><br>
a 22 3 8 6 9 <br><br>
- 12 - <br><br>
being preferred. It is particularly advantageous if a DNA probe is complementary to the derived hMn-SOD DNA sequence the genetic information of which is colinear with the amino acid groups 39 5 to 46 and a second DNA probe is complementary to the corresponding DNA region which codes for amino acid groups 200 to 207 of the known amino acid sequence. Similarly, of course, DNA sequences which may be derived using other Mn-superoxide 10 dismutases may also be used as probes. <br><br>
Using a DNA probe of this kind it is possible to obtain positive clones from which a cDNA sequence corresponding to the following formula la may be 15 isolated, containing a large amount of a region coding for hMn-SOD: <br><br>
O <br><br>
.***"> K. <br><br>
20 <br><br>
25 <br><br>
30 <br><br>
G ATC <br><br>
ATG <br><br>
CAG <br><br>
CTG <br><br>
CAC <br><br>
CAC <br><br>
AGC <br><br>
AAG <br><br>
CAC <br><br>
CAC <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
35 Formula la tv>-« tt; i'v • <br><br>
© 22 3 8 6 9 <br><br>
- 13 - <br><br>
Surprisingly, it has been found that this cDNA sequence codes for an amino acid sequence which differs from the published amino acid sequence (Barra, D. et al., J. Biol.Chem. 259, 12595-12601, 5 1984) both in terms of the groups of amino acids and in their length from one another. The differences discovered in this sequence compared to the "Barra sequence" are concerned with amino acid positions 42, 88, 109 and 131 (in each case Glu instead of 10 Gin) and two additional amino acids Gly and Trp between positions 123 and 124, so that the DNA sequence according to the invention corresponds to an hMn-SOD of 198 amino acids. <br><br>
15 In addition, it was also completely unexpected that a cDNA coding for hMn-SOD could be isolated which indicates an amino acid substitution at position 29 (codon for Gin instead of Lys) and thus, in this respect, has an additional difference compared to 20 the "Barra sequence" and to formula la, corresponding to formula lb: <br><br>
CAC <br><br>
CAC <br><br>
AGC <br><br>
CAG <br><br>
CAC <br><br>
CAC <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
Formula lb <br><br>
c <br><br>
22 3 8 6 9 <br><br>
- 14 - <br><br>
IC one assumes that the Barra sequence was correctly analysed, using the nucleotide or amino acid sequence according to the invention the possibility has to be considered that, surprisingly and for the f s <br><br>
5 first time, this indicates the possible existence of different genes or their allelic manifestations or isoenzymes for hMn-SOD. <br><br>
Since it is possible to obtain cDNA-bearing clones 10 which lack the end required for the complete hMn-SOD j gene, another object of the present invention was <br><br>
; to prepare the complete gene for hMn-SOD. <br><br>
This aim can be achieved by various known strategies. 15 For example, the sequence obtained may itself be used as a DNA probe and the cDNA bank can be searched S once more with it in order to detect a complete gene or a cDNA with the missing end or the DNA sequence obtained may be used as a hybridisation 20 probe against a genomic bank in order to isolate <br><br>
» ■ <br><br>
the complete hMn-SOD gene after identifying it. <br><br>
i <br><br>
Alternatively, there is the possibility of synthesising oligonucleotides in which the nucleotide sequence 25 corresponds to the missing end of the hMn-SOD and obtaining the complete cDNA for hMn-SOD with the aid of these oligonucleotides, after suitable linker ligation. This method has the advantage that, for example, a DNA coding for hMn-SOD may be obtained 30 in which the 5' end begins directly with the start codon CATG) . <br><br>
The DNA sequence of formula II has been found to be particularly suitable for solving this problem, 35 completing the cDNAs according to the invention which code, for example, from amino acid 22 or 26. This sequence begins with the 51 start codon <br><br>
m <br><br>
V* <br><br>
D <br><br>
11 3 a 6 9 <br><br>
- 15 - <br><br>
£ ATG and ends with the codon for amino acid 31 (His, <br><br>
whilst AAG [Lys] = 1) and utilizes known codon preferences, such as those which apply to yeast (Sharp, P.M. <br><br>
et al., Nucl.Acids.Res. 14 (13), 5125 - 5143, <br><br>
5 1986) <br><br>
5* ATG AAG CAC TCT TTG CCA GAC TTG CCA TAC GAC TAC GGT GCT TAC TTC GTG AGA AAC GGT CTG AAG GGT ATG CTG ATG CCA CGA <br><br>
10 CTA GAA CCA CAC ATC AAT GCT CAA ATC ATG CAA TTG CAC CAC <br><br>
GAT CTT GGT GTG TAG TTG CGA GTT TAG TAC GTT AAC GTG GTG <br><br>
TCT AAG CAC CAT G AGA TTC GTG GTA C <br><br>
15 <br><br>
Formula II <br><br>
Similarly, other known synonymous codons may be used to complete the hMn-SOD gene or to synthesise 20 the entire gene in vitro, e.g. those which facilitate an optimum codon-anticodon alternation in bacteria, e.g. E. coli, and increase the efficiency of translation (Grosjean, H., Fiers, W., Gene 18, 199 - 209, 1982; <br><br>
Q Ikemura, T., J. Mol. Biol. 151, 389 - 409, 1981) <br><br>
25 or codons which correspond to the actual conditions in mammalian cells (Grantham, R. et al., Nucleic Acid Research 9, 43-47, 1981). The latter may preferably be used for transformation and subsequently for expression in mammalian cells. <br><br>
30 <br><br>
It is theoretically possible to split off the methionine group which is coded by the start codon ATG and which precedes the mature hMn-SOD, which begins with the first amino acid lysine, using methods 35 known per se, for example using CNBr or CNC1. <br><br>
However, since other internal methionine groups may occur, e.g. at positions 23 or 192, in the <br><br>
f5*"" <br><br>
4 <br><br>
. .1 <br><br>
D <br><br>
r> ll 3 8 6 9 <br><br>
- 16 - <br><br>
mature enzyme hMn-SOD, such a procedure is impracticable, <br><br>
with the result that, in this case, the additional N-terminal methionine group remains, without affecting the biological activity of hMn-SOD. <br><br>
However, enzymatic cleavage may also be envisaged in which suitable synthetic linkers are used, in . known manner, since codons for correspondingly specific amino acids can be expected to be located 10 at the desired positions on the vector which contains the hMn-SOD cDNA. For example, Arg or Lys groups <br><br>
< <br><br>
for a tryptic cleavage or codons which code for protease-sensitive amino acids will generally be <br><br>
„ i used. These may be positioned in front of or behind 15 the start codon or within the coding region. <br><br>
s The sequences shown in formulae Ilia and Illb are particularly suitable for the preparation of non- <br><br>
glycosylated hMn-SOD of formulae IVa and IVb in <br><br>
A 20 microorganisms, particularly in E. coli or S. cerevisiae. <br><br>
. ^ _________ <br><br>
j The problem of glycosylation in yeast, for example, <br><br>
can be avoided by using mutants which are deficient in the glycosylation of proteins (alg mutants) (e.g. Huffaker, T.C., Robbins P.W., Proc. Natl. <br><br>
25 Acad. Sci. USA 80, 7466-7470, 1983). <br><br>
If necessary or advisable, the complete hMn-SOD gene, for example according to formula Ilia or Illb, may be preceded by a leader or signal sequence 30 directly before the first codon of the first N- <br><br>
terminal amino acid of the mature hMn-SOD or before the start codon ATG. This ensures that the hMn-SOD can be transported from the host cell and readily isolated from the culture medium. <br><br>
35 <br><br>
Signal sequences of this kind have been described; <br><br>
they code for a generally hydrophobic protein content, <br><br>
22 3 8 6 9 <br><br>
- 17 - <br><br>
which is split off by post-translational modification processes in the host cell (Davis, D.B., Tai.P.-C., <br><br>
Nature 283, 433-438, 1980; Perlman, D., Halvorson, H.O., J. Mol. Biol. 167, 391-409, 1983). If an 5 ATG codon has been constructed in front of the first amino acid of the hMn-SOD, a gene product may be obtained which contains an N-terminal methionine in front of the lysine. The use of signal sequences of prokaryotes in order to secrete proteins into 10 the periplasma and to process them correctly is known (see Davis, B.D., Tai, P.-C., 1980). <br><br>
Obviously, after isolating and cloning the hMn-SOD DNA sequence, it is possible specifically to modify 15 the enzyme coded by this sequence. Enzyme modifications may be effected, for example, by controlled in vitro mutations with synthetic oligonucleotides thereby influencing the catalytic properties of hMn-SOD and obtaining new enzymatic activities. <br><br>
20 The basic procedural steps for performing these protein manipulations are known (e.g. Winter, G. <br><br>
et al., Nature 299, 756 - 758, 1982; Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci.USA, 7S>, 6409-6413, <br><br>
1982) . <br><br>
25 <br><br>
For the cloning, i.e. amplification and preparation, <br><br>
of the hMn-SOD gene it is possible to use E. coli, <br><br>
preferably E. coli C600 (Nelson et al., Virology 108, 338-350, 1981) or JM 101, or E. coli strains 30 with at least one of the known sup-genotypes. <br><br>
However, the cloning may also be carried out in gram-positive bacteria such as B. subtilis. Systems of this kind have been described many times. <br><br>
35 Suitable hosts for the expression of the hMn-SOD <br><br>
gene according to the invention include both microorganisms and also cultures of multicellular organisms. <br><br>
VJ <br><br>
22 3 8 6 9 <br><br>
- 18 - <br><br>
The term microorganisms includes prokaryotesf i.e. gram-negative or gram-positive bacteria and eukaryotes such as protozoa, algae, fungi or higher protista. <br><br>
Of the gram-negative bacteria, the Enterobacteriaceae, 5 for example E. coli are preferred hosts, whilst of the gram-positive bacteria the Bacillaceae and apathogenic Micrococcaceae, e.g. B. subtilis and Staph, carnosus are preferred hosts, and of the eukaryotes the Ascomycetes, particularly the yeasts, 10 e.g. Saccharomyces cerevisiae are preferred hosts. <br><br>
For single-cell microorganisms there are a plurality of starting vectors available which may be of plasmidic and/or viral origin. These vectors may occur in 15 a single copy or as multicopy vectors. Vectors of this kind which are suitable for the cloning and expression of the hMn-SOD according to the invention and for eukaryotic DNA sequences in general have been described in a number of publications 20 and manuals {e.g. Maniatis, T. et al.. Molecular <br><br>
Cloning, Cold Spring Harbor Laboratory, 1982; Glover, D.M. (ed.) DNA Cloning Vol. I, II, 1985) and are commercially available. <br><br>
25 In general, plasmid vectors which as a rule contain a replication origin and control sequences for transcription, translation and expression may be used in conjunction with these hosts. These sequences must originate from species which are compatible 30 with the host cells. The vector usually carries, <br><br>
in addition to a replication site, recognition sequences which make it possible to phenotypically select the transformed cells. The selection may be carried out either by complementation, suppression 35 or by deactivation of a marker. With regard to the first two methods, there are auxotrophic mutants of bacteria and yeast which are deficient in an <br><br>
22 3 8 6 <br><br>
- 19 - <br><br>
essential product of metabolism and nonsense mutants in which chain breakage occurs on translation of the gene in question. Various suppressor genes, e.g. supD, E, F (which suppress UAG), supC, G (which 5 suppress UAG or UAA), are already known. In the third process, the vector carries a resistance gene against one or more cytotoxic agents, such as antibiotics, heavy metals. The insertion of a foreign DNA into a marker gene of this kind deactivates 10 the latter so that the newly formed phenotype can be distinguished from the original phenotype. <br><br>
Thus, for example, E. coli can be transformed with pBR322, a plasmid which originates from E. coli 15 species (Bolivar et al., Gene 2, 95 (1977). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides a simple means of identifying transformed cells, by converting the phenotype Apr, Tcr into Aps, Tcr by cloning in, 20 for example, the PstI site in the B-lactamase gene. <br><br>
Other methods may equally be used for which, for example, the lacZ-gene deactivation in \ and M13 vectors and in various plasmids (e.g. pUC, pUR) is important. These very versatile selection systems 25 have long been known and accordingly there is a wide range of literature on this subject. <br><br>
In addition to selection markers of this kind, <br><br>
these vectors, particularly expression vectors, <br><br>
30 must contain signal sequences which ensure correct initiation and termination of the transcription. <br><br>
For the correct transcription of the hMn-SOD gene therefore the vectors according to the invention may contain a bacterial or eukaryotic transcription 35 unit consisting of a promoter, the coding region with the hMn-SOD gene and an adjoining terminator. Depending on the nature of the transcription units. <br><br>
'am >«HWi *WA&VI <br><br>
C\ <br><br>
11 o d 6 9 <br><br>
- 20 - <br><br>
these may contain conserved prototype sequences such as, for example, Pribnow-box or TTG sequence or CAAT-box, TATA-box, the known termination signals (for example AATAAA, TATGT), and at least one stop codon, whilst preferably promoters and terminators which are homologous with respect to the host are used. <br><br>
The mRNA formed usually contains a 3' poly(A) sequence 10 and/or a 5' cap structure. Translation of the hMn-SOD gene requires a ribosomal binding site (RBS) consisting of a Shine/Dalgarno (S/D) sequence and an initiation codon at a defined spacing therefrom, generally of 3 to 12 nucleotides, and at least 15 one stop codon. Alternatively, RBSs may be prepared synthetically, thereby increasing the homology with the 3' end of the 16S rRNA (Jay, E. et al., <br><br>
Nucleic Acids Res. 10, 6319-6329, 1982). <br><br>
zJ 20 In eukaryotic expression systems, in particular <br><br>
(for example S. cerevisiae), it is preferable to use regulatory systems which originate from the <br><br>
J host for the translation since, in yeast, the conditions are analogous to those which apply to 25 prokaryotes (homology of the S/D sequence with j, the 3' end of the 16S rRNA) but the signals and the RBS for initiating translation are defined in a different way than in prokaryotes (e.g. Kozak, M., Nucleic Acids Res. 9, 5233-5252, 1981; Kozak, ^ 30 M., J. Mol. Biol. 156, 807-820, 1982). <br><br>
Preferably, the cloning or expression vector has only one restriction endonuclease recognition site which is either present in the starting vector 35 from the outset or can be inserted subsequently by means of suitable linkers. Linkers may be obtained either by a simple chemical synthesis or are commercially <br><br>
I <br><br>
I <br><br>
o <br><br>
J <br><br>
223869 <br><br>
- 21 - <br><br>
available. <br><br>
Yeast vectors frequently used in the production of corresponding expression plasmids contain promoters 5 which control expression particularly efficiently in the yeast system, such as the PGK promoter (Tuite, M.F. et al., EMBO Journal 1, 603-608, 1982; Hitzeman, R*A. et al., Science 219, 620-625, 1983), PH05 promoter (Hinnen, A., & Meyhack, B., Current Topics 10 in Microbiology and Immunology 96, 101-117, 1982; <br><br>
Kramer, R.A. et al., Proc. Natl. Acad. Sci. USA 81, 367-370, 1984), GAPDH promoter (Urdea, M.S. <br><br>
et al., Proc. Natl. Acad. Sci. USA 8£, 7461-7465, 1983), GAL10 promoter (Broach et al., Experimental 15 Manipulation of Gene Expression, 83-117, 1983), <br><br>
enolase (ENO)-promoter (Holland, M.J. et al., J. <br><br>
Biol. Chem. 256, 1385-1395, 1981), a-factor promoter (Bitter, G.-A. et al., Proc. Natl. Acad. Sci. USA 81, 5330-5334; Yakota, T. et al., Miami Winter 20 Symp. 17. Meet. Adv. Gene Technol.2, 49-52,1985) <br><br>
or the ADHI promoter (Ammerer, G., Methods in Enzymology 101, 192-201, 1983; Hitzeman, R.A. et al., Nature ^ 293, 717-722, 1981). <br><br>
■ u <br><br>
25 It is also possible to use promoters of other glycolytic ~1 enzymes (Kawasaki and Fraenkel, Biochem. Biophys. <br><br>
Res. Comm. 108, 1107-1112, 1982), such as hexokinase, _ pyruvate decarboxylase, phosphofructokinase, glucose- <br><br>
^ 6-phosphate isomerase, phosphoglucose isomerase <br><br>
30 and glucokinase. When constructing suitable expression plasmids, the termination sequences associated with these genes may also be included in the expression vector at the 3' end of the sequence which is to be expressed in order to provide polyadenylation 35 and termination of the mRNA. Other promoters which also have the advantage of transcription controlled by growth conditions are the promoter regions of <br><br>
o <br><br>
Nwi"*' <br><br>
© 22 3 8 6 9 <br><br>
- 22 - <br><br>
alcohol dehydrogenase-2, isocytochrome C, the degradation enzymes coupled to nitrogen metabolism, the above-mentioned glycerine aldehyde-3-phosphate dehydrogenase (GAPDH) and the enzymes which are responsible for 5 metabolising maltose and galactose. Promoters which are regulated by the yeast mating type locus, for example promoters of the genes BARl, MECI, <br><br>
STE2, STE3 and STE5, may be used in temperature-regulated systems by the use of temperature-dependent W' 10 sir mutations (Rhine, Ph.D. Thesis, University of Oregon, Eugene, Oregon (1979), Herskowitz and Oshima, The Molecular Biology of the Yeast Saccharomyces, Part I, 181-209 (1981), Cold Spring Harbour Laboratory)). These mutations affect the expression of the resting 15 mating type cassettes of yeast and thus indirectly the mating type dependent promoters. Generally, <br><br>
however, any plasmid vector which contains a yeast-compatible promoter, origin of replication and termination sequences is suitable. <br><br>
20 <br><br>
If the expression of hMn-SOD is to take place in bacteria, it is preferable to use promoters which result in a high rate of mRNA synthesis and which O are also inducible. Known promoters which may be <br><br>
25 used contain the beta-lactamase (penicillinase) <br><br>
and lactose promoter systems (Chang et al., Nature 275, 615 (1978); Itakura et al., Science 198, 1056 (1977); Goeddel et al., Nature 281, 544 (1979) <br><br>
including the UV5 promoter (Silverstone, A.E et 30 al., Proc. Natl. Acad. Sci. USA 66, 773-779, 1970) and tryptophan (trp) promoter systems (Goeddel et al., Nucleic Acids Res. 8, 4057 (1980); European patent application, publication No. 0036 776) . <br><br>
Moreover, other microbial promoters have also been 35 developed and used. The gene sequence for hMn-SOD may be transcribed, for example, under the control of the lambda-PL promoter. This promoter is known <br><br>
© 22 3 8 6 9 <br><br>
- 23 ~ <br><br>
as one of the particularly powerful, controllable promoters. Control is possible by means of a thermolabile repressor cl (e.g. cl857) to which adjacent restriction cutting sites are known. Furthermore, it is also 5 possible to use the promoter of alkaline phosphatase from E. coli (Ohsuye, K. et al., Nucleic Acids Res. 11, 1283-1294, 1983) and hybrid promoters such as, for example, the tac-promoter (Amann, <br><br>
E. et al., Gene 2J5, 167-178, 1983; De Boer, H.A. <br><br>
10 et al., Proc. Natl. Acad. Sci. USA 80, 21-25, <br><br>
1983). The use of promoters of this kind (lacuv5, <br><br>
lacZ SD, tac) which can be carried and vectors for preparing fused and non-fused eukaryotic proteins *n E. coli is described in T. Maniatis et al., <br><br>
15 Molecular Cloning, Cold Spring Harbor Laboratory, 1982, especially page 412ff. The expression and translation of an hMn-SOD sequence in bacteria may also be carried out under the control of other regulatory systems which may be regarded as "homologous" 20 to the organism in its untransformed state. For example, it is also possible to use promoter-operator systems such as arabinose operator, colicin El operator, galactose operator, alkaline phosphatase operator, trp operator, xylose A operator and the 25 like or parts thereof. <br><br>
For the cloning or expression of hMn-SOD in bacteria, for example in E. coli, or in yeasts, for example in S. cerevisiae, there are well known vectors 30 available, of which, for the former host systems, <br><br>
it is advantageous to use the pBR plasmids (Bolivar, <br><br>
F. et al., Gene 2, 95-113, 1977), pUC plasmids (Vieira,I., Messing I., Gene .19, 259-268, 1982) <br><br>
pOP plasmids (Fuller, F., Gene 19^, 43-54, 1982), <br><br>
35 pAT plasmids (Windass, J.D., et al., Nucleic Acids Res. 1£, 6639-6657, 1982), pHV plasmids (Ehrlich, <br><br>
S.D., Proc. Natl. Acad. Sci. USA 75, 1433-1436, <br><br>
$ <br><br>
n n 22 3 8 6 9 <br><br>
- 24 - <br><br>
1977), lambda vectors including phasmids (Brenner, S. et al., Gene 12, 27-44, 1982), cosmids (Collins, J., Hohn, B., Proc. Natl. Acad. Sci. USA IS.' 4242-4246, 1979) and the other vectors known from the literature 5 (e.g. Maniatis, T. et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982), particularly pBR and pUC derivatives, for example pBR322 and pUCl8. <br><br>
Suitable expression vectors in yeasts are integrating w 10 (Yip), replicating (YRp) and episomal (YEp) vectors <br><br>
(Struhl, K. et al., Proc. Natl. Acad. Sci. USA 76, 1035-1039, 1979; Stinchcomb, D.T. et al., Nature 282, 39-43, 1979; Hollenberg, C.P., Current Topics in Microbiology and Immunology 96, 119-144, 1982), 15 preferably YEpl3 (Broach, J.R. et al., Gene 8, <br><br>
121-133, 1979), YIp5 (Struhl, K. et al., 1979 see above, ATCC 37061) and pJDB207 (DSM 3181) or pEAS102. The vector pEASl02 may be obtained by digesting YIp5 partially with PstI and totally with BamHI 20 and ligating the isolated 4.3 kb fragment (which contains the URA3 gene) with the 4.4 kb BamHI/PstI fragment of pJDB2Q7. <br><br>
Q In addition to microorganisms, cultures of multicellular <br><br>
25 organisms are also suitable hosts for the expression of hMn-SOD. In theory any of these cultures may be used whether obtained from vertebrate or invertebrate animal cultures. However, the greatest interest has been in vertebrate cells with the result that 30 the multiplication of vertebrate cells in culture (tissue culture) has become a routine method in recent years (Tissue Culture, Academic Press, Editors Kruse and Patterson, (1973)). Examples of useful host cell lines of this kind include VERO and HeLa 35 cells, Golden Hamster Ovary (CHO) cells and W138, BHK, COS-7 and MDCK cell lines. Expression vectors for these cells generally contain a replication <br><br>
|P- <br><br>
"r1 <br><br>
f\ <br><br>
\~s <br><br>
22 3 8 6 9 <br><br>
j - 25 - <br><br>
? site, a promoter which is located in front of the <br><br>
■ hMn-SOD to be expressed, together with any necessary t ribosome binding site, RNA splicing site, polyadenylation site and transcriptional termination sequences. <br><br>
5 <br><br>
When used in mammalian cells, the control functions in the expression vector are often obtained from viral material. For example, the promoters normally used originate from papova viruses such as polyoma 10 viruses, papilloma viruses, Simian Virus 40 (SV40) and from retroviruses and adenovirus Type 2. The early and late promoters of SV40 and their applications have frequently been described. Furthermore, it is also possible and often desirable to use promoter 15 or control sequences or splicing signals which were originally linked to the desired genetic sequences, provided that these control sequences are compatible with the host cell systems. Thus, SV40 vectors are known in which an exogenic eukaryotic DNA with 20 its own promoter sequences and splicing signals, <br><br>
as well as the late SV40 promoter, will yield a stable transcript. <br><br>
A replication starting point may either be provided 25 by corresponding vector construction in order to incorporate an exogenic site, for example from SV40 or other viral sources (e.g. polyoma, adeno, VSV, PBV, etc.) or it may be provided by the chromosomal replication mechanisms of the host cell. If the 30 vector is integrated into the host cell chromosome, the latter measure is usually sufficient. <br><br>
Transformation of host cells with the vehicles can be achieved by a number of processes. For 35 example, it may be effected using calcium, either by washing the cells in magnesium and adding the DNA to the cells suspended in calcium or by subjecting ynwiMi, „• <br><br>
22 3 8 6 9 <br><br>
"fW' <br><br>
n <br><br>
Sf1' <br><br>
- 26 - <br><br>
the cells to a coprecipitate of DNA and calcium phosphate. During the subsequent gene expression the cells are transferred to media which select for transformed cells. <br><br>
In the intracellular production of hMn-SOD the enzyme may be isolated by centrifuging the cells off after a suitably high cell density has been reached and then enzymatically or mechanically O 10 lysing them. Purification of the hMn-SOD according to the invention may be carried out by known biochemical methods for purifying proteins or enzymes, such as dialysis, electrophoresis, precipitation, chromatography or combinations of these methods. If the 15 enzyme is secreted from the cell, analogous methods of protein purification are carried out in order to obtain hMn-SOD from the culture medium in pure form. <br><br>
20 The hMn-SOD according to the invention purified by these methods has a biological activity spectrum identical to the genuine enzyme both in vivo and in vitro. These activities include both immunological properties (e.g. cross-reaction with antibodies 25 of genuine hMn-SOD against the hMn-SOD according to the invention) and also biochemical and enzymatic activities. In order to characterise hMn-SOD biochemically and enzymatically, for example, the method described by Marklund, S. (Marklund, S. & Marklund, G., <br><br>
30 Eur. J. Biochem. 47, 469-474, 1974) may be used, <br><br>
according to which a strict distinction must be drawn between enzymes containing Cu/Zn and those containing Mn, for example by the addition of KCN (which inhibits Cu/Zn-SOD but not Mn-SOD) or using 35 the different pH dependencies of their activities (see particularly Ysebaert-Vanneste, M., Vanneste, W.H., Anal. Biochem. 107, 86-95, 1980). <br><br>
22 3 8 6 9 <br><br>
- 27 - <br><br>
The polypeptide according to the invention includes not only the mature hMn-SOD which is described in detail but any modification thereof, for example, shortening of the molecule at the N- or C-terminal 5 end or the substitution of amino acids by other groups, which do not substantially affect the enzyme activity. <br><br>
The invention further relates not only to genetic 10 sequences which code specifically for the hMn-SOD which is described and demonstrated in the examples, but also to modifications which are easily and routinely obtainable by mutation, degradation, transposition or addition. Any sequences which 15 code for the hMn-SOD according to the invention <br><br>
(i.e. which have the corresponding, known biological activity spectrum) and which are degenerate compared with those shown, are also included; experts in this field will be able to degenerate DNA sequences, 20 particularly in the coding regions. Similarly, any sequence which codes for a polypeptide with the activity spectrum of the authentic hMn-SOD and which hybridises with the sequences shown (or parts thereof) under stringent conditions is also 25 included. <br><br>
The particular conditions which constitute stringent conditions under which hybridisation (including pre-washing, pre-hybridisation, hybridisation and 30 washing) should be carried out are defined in the prior art. For hybridising oligonucleotides against a gene bank ("gene bank screening") the conditions described by Wood, I.M. et al. should preferably be used (Proc. Natl. Acad. Sci. USA 82, 1582-1588, 35 1985). To test whether a specific DNA sequence hybridises with one of the DNA sequences according to the invention which code for hMn-SOD - either <br><br>
JWVVsll.-'At-O'.'. <br><br>
- 28 - <br><br>
22 3 8 6 9 <br><br>
v*a ill sit" hybridisation against plaques or colonies of bacteria or via Southern Blotting - the methods and conditions described in detail by Maniatis, T. et al. should be adopted (Maniatis T. et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982, particularly pages 326-328 and 387-389). All signals which are clearly distinguishable against the background therefore indicate a positive hybridisation signal. <br><br>
More specifically, the problems described above are solved by preparing the RNA from human tissue, preferably from human placenta tissue. Whereas tissue culture cells can be lysed directly with hot phenol, tissue for this type of extraction first has to be broken up in deep-frozen condition, advantageously in the presence of powdered or granular dry ice or in liquid nitrogen (e.g. Starmix). <br><br>
Aggregates of mRNA and other RNAs formed by phenol may be broken up again using formamide or by heating (e.g. to 65°C). A preferred method of isolating RNA is the Chirgwin method (Chirgwin, J.M. et al., Biochemistry 18, 5294-5299, 1979). The poly (A)+ RNA may be conveniently purified from the isolated protein and DNA preparation by affinity chromatography, e.g. poly(U) Sepharose or oligo(dT) cellulose, since eukaryotic mRNA populations generally have a poly(A) tail at their 3' end (Aviv, H., Leder, P., Proc. Natl. Acad. Sci. USA (>9, 1409 - 1412, 1972; Lindberg, U., Persson, T., Eur. J. Biochem. 31, 246 - 254, 1972). Isolation of the poly(A)+ RNA may preferably be carried out using the method described by Auffray (Auffray, C., Rougeon, F., <br><br>
Eur. J. Biochem. 107, 303-314, 1980). <br><br>
The purified mRNA may be concentrated by dividing <br><br>
S«8 <br><br>
n <br><br>
O 29 22 3 8 6 9 <br><br>
up the entire mRNA fraction according to size e.g. by centrifuging in a sucrose gradient. The desired mRNA may be detected, for example, using known in vitro protein biosynthesis systems (reticulocytes, 5 oocytes of Xenopus laevis). <br><br>
The purified mRNA or the concentrated fraction is used as a template for synthesising the first strand of the cDNA, which is done using reverse v,_, 10 transcriptase and a primer. The primers used may be either oligo (dT) or synthetic primers; the latter may be obtained using the known amino acid sequence of hMn-SOD and make it possible to carry out repeated priming of reverse transcription (Uhlen, 15 M. et al., EMBO Journal 1, 249 - 254, 1982). <br><br>
In the present invention the synthesis of the first strand of the cDNA was started with oligo(dT)12-18 as primer in the presence of dNTPs. <br><br>
20 <br><br>
The second strand of the cDNA may be synthesised by various known methods, of which priming with a complementary primer (Rougeon, F., Mach, B., (^J J.Biol. Chem. 252, 2209 - 2217, 1977), self-priming <br><br>
25 with the aid of a "hairpin" structure located at the 3' end of the cDNA (Efstratiadis, A. et al., <br><br>
Cell 7, 279, 1976) or with an Okazaki fragment-like primer formed by RNaseH (Gubler, U., Hoffmann, <br><br>
B.J., Gene T5, 263, 1982) may be mentioned in particular. 30 The preferred method according to the present invention is the one described by Huynh, T.V. (Huynh, T.V. <br><br>
et al., in DNA Cloning Vol I, (D.M. Glover ed.), <br><br>
chapter 2, pages 49-78, 1985). The double-stranded cDNA obtained by this method can be cloned or packaged 35 directly into a suitable vector, e.g. into a cosmid, <br><br>
insertion or substitution vector, more particularly into a lambda vector, preferably in XgtlO (Huynh, <br><br>
o <br><br>
22 <br><br>
- 30 - <br><br>
T.V. et al./ 1985). There are a number of known methods of cloning in lambda, of which "homopolymer tailing" using dA-dT or dC-dG or the linker method with synthetic linkers should be mentioned by way of example (Maniatis, T. et al.. Molecular Cloning, Cold Spring Harbor Laboratory, 1982; Huynh, T.V. et al., DNA Cloning Vol. I (D.M., Glover ed.) 1985, 1980; Watson, C.J., Jackson, F. dtor 1985, chapter 3) . In the cloning of the cDNA according to the invention, the cDNA was inserted into the EcoRI site of XgtlO. The in vitro packaging and cloning of the cDNA according to the invention and the construction of the cDNA gene bank were carried out according to Huynh, T.V. et al. 1985, pages 49-78. <br><br>
Using the phage population obtained, which represents a cDNA gene bank from placental tissue, amplification and plaque purification were carried out by infecting 20 a suitable host, particularly E. coli, preferably E. coli C 600, and, respectively, by securing the lytic replication cycle of lambda. <br><br>
The cDNA gene bank was investigated under stringent 25 hybridisation conditions with radioactively labelled synthetic oligonucleotides which had been obtained using the published amino acid sequence (Barra, D. et al., Oxy Radicals and their scavenger Systems, Vol. 1, 336-339, 1983). In the present invention, 30 the method of hybridisation iji situ described by <br><br>
Benton and Davis (Benton, W.D., Davis, R.W., Science 196, 180 - 182, 1977) was used. Preferably, two mixtures, each consisting of eight synthetic 23-mer oligonucleotides of formulae Va and Vb were used, 35 which are colinear with amino acids 39 to 46 and <br><br>
200 - 207, respectively, of the amino acid sequence published by Barra, D. et al. (see above) and which n <br><br>
r>: <br><br>
10 <br><br>
15 <br><br>
C 22 3 8 6 <br><br>
- 31 - <br><br>
take into account the degeneracy of the genetic code. The last base at the 5' end of these DNA probes lacks the wobble base for the entire codon for Gin (amino acid 46) or Glu (amino acid 207). d) 5 A, G, C and T represent the corresponding nucleotides whilst I represents inosine. <br><br>
O <br><br>
o <br><br>
CCC TGITA TT TC TCIGTIACITT TTT <br><br>
Formula Va <br><br>
AC A <br><br>
i <br><br>
| 15 TCIGTIAC TT TCCCA TTIAT <br><br>
1 GTG <br><br>
S <br><br>
Formula Vb <br><br>
J 20 The oligonucleotide probes may be prepared by known <br><br>
'j chemical methods of synthesis. For the present invention, a Model 381A DNA Synthesizer (Applied ! Biosystems) was used. <br><br>
25 The synthesis of all possible combinations of these two DNA probes ensures that at least one of the oligonucleotides present forms an optimum pair with the single-stranded DNA region of the desired hMn-SOD gene, complementary to the probe. The 30 use of two independent pools of 23-mer oligonucleotides reduces the possibility of selecting "false" positives. <br><br>
After isolation of inherently homogeneous plaques which have been identified by positive signals 35 after hybridisation with the two 23-mer DNA probes, it was possible to isolate seven recombinant phage and to sequence 500 to 1000 bp long EcoRI fragments <br><br>
KJ <br><br>
n <br><br>
10 <br><br>
- 32 - <br><br>
22 3 8 6 9 <br><br>
o£ their DNA. After sequence analysis of these EcoRI fragments by the Sanger method (Sanger et al./ Proc. Natl. Acad. Sci. USA 74, 5463 - 5467, 1977; Sanger P. et al., FEBS Letters JJ7, 107 - 111, 1978) and after subcloning into the EcoRI site of the M13 vector (Bluescribe, Vector Cloning Systems) and transformation in E. coli, for example E. coli JM101, it was discovered that the EcoRI fragments contain cDNA inserts which code for hMn-SOD from amino acid 22 (clones BS5, BS8, BS9, BS13, BSXIII) or from amino acid 26 (clones BS3, BS12). <br><br>
some <br><br>
■A <br><br>
O <br><br>
Q <br><br>
Surprisingly however, it was also found that deviations from the amino acid sequence described 15 by Barra, D. et al. (1984, loc.cit.) arose i in the <br><br>
DNA sequences obtained: <br><br>
20 <br><br>
Clone <br><br>
Amino acid <br><br>
Codon <br><br>
Amino acids derived <br><br>
Amino acid according to Barra, D. et al., 1984 <br><br>
BS3, BS12 <br><br>
29 <br><br>
CAG <br><br>
Gin <br><br>
Lys <br><br>
(29) <br><br>
BS5, BS9, <br><br>
25 <br><br>
BS13, BSXIII <br><br>
29 <br><br>
AAG <br><br>
Lys <br><br>
Lys <br><br>
(29) <br><br>
BS3, BS12, <br><br>
BS13, BS5, <br><br>
42 <br><br>
GAG <br><br>
Glu <br><br>
Gin <br><br>
(42) <br><br>
BS9 <br><br>
30 <br><br>
BSXIII <br><br>
88 <br><br>
GAG <br><br>
Glu <br><br>
Gin <br><br>
(88) <br><br>
29 <br><br>
AAG <br><br>
Lys <br><br>
Lys <br><br>
(29) <br><br>
42 <br><br>
GAG <br><br>
Glu <br><br>
Gin <br><br>
(42) <br><br>
88 <br><br>
GAG <br><br>
Glu <br><br>
Gin <br><br>
(88) <br><br>
35 <br><br>
BS8 <br><br>
109 <br><br>
GAG <br><br>
Glu <br><br>
Gin <br><br>
(109) <br><br>
124 <br><br>
GGT <br><br>
Gly <br><br>
125 <br><br>
TGG <br><br>
Trp <br><br>
139 <br><br>
GAA <br><br>
Glu <br><br>
Gin <br><br>
(129) <br><br>
- 33 - <br><br>
22 3 8 6 9 <br><br>
The DNA sequence of a 617 bp long EcoRI fragment which could be isolated from one of the clones obtained, e.g. BS8, is shown in Fig. 1. The EcoRI fragment contains a 532 bp long sequence coding 5 for hMn-SOD and a 51 bp long non-translated region, including a poly(A)g0 tail. Sections of linker sequences, up to the (complete) EcoRI sites, are also shown. <br><br>
10 Positions 30 to 33 show a Thai cutting site whilst at positions 367 to 372 there is a BamHI site. Surprisingly, there are codons at positions 53 to 61, 155 to 163, 176 to 184 and 500 to 508 which are colinear to potential N-glycosylation sites 15 according to the general amino acid arrangements Asn-X-Thr and Asn-X-Ser characteristic thereof, wherein X represents valine, histidine or leucine, for example, whereas the Cu/Zn-SOD of the cytosol has only one such amino acid combination. <br><br>
20 <br><br>
The amino acid differences from the amino acid sequence of Barra, D. et al. (Barra, D. et al., J. Biol. Chem. 259, 12595 - 12601, 1984), which were derived from the EcoRI fragment obtained, 25 have already been discussed hereinbefore. <br><br>
Various strategies may be adopted in order to obtain the missing bases at the 3' and/or 5' termini of the hMn-SOD DNA partial sequence from the cDNA 30 gene bank to prepare a complete hMn-SOD gene. In order to obtain the sequence coding for the entire enzyme, for example, the cDNA obtained may be used as a hybridisation probe against a genomic gene bank, or the method described by H. Kakidani may be used, 35 for example, using synthetic oligonucleotides complementary to the mRNA as specific primers for the reverse transcription (Kakidani, H. et al., <br><br>
- 34 - <br><br>
22 3 8 6 9 <br><br>
Nature 298, 245 - 249, 1982). However, it is also possible to synthesise the missing end of the cDNA sequence chemically by means of the known amino acid sequence (Barra, D. et al., J. Biol. Chem. 259, 12595 - 12601, 1984) and to link it to the cDNA found, thereby obtaining a defined end. <br><br>
In the latter method, in order to prepare the complete DNA sequence according to the invention for hMn-SOD, the 5" end was completed by two oligonucleotides of formulae Via and VIb which advantageously had Xhol/Xbal - or Xbal/Ncol - projecting ends. According to the invention, the 3' end of the ADHI promoter was taken into consideration at the 5' end of the coding strand (Formula Via) <br><br>
S TCGAG TATACA ATG AAG CAC TCT TTG CCA GAC TTG 3 C ATATGT TAC TTC GTG AGA AAC GGT CTG AAC <br><br>
XhOl <br><br>
CCA TAC GAC TAC GGT GCT GGT ATG CTG ATG CCA CGA GATC <br><br>
Xbal <br><br>
Formula Via <br><br>
- 35 - <br><br>
22 3 8 6 9 <br><br>
5 CTAGAA CCA CAC ATC AAT GCT CAA ATC ATG CAA 3 TT GGT GTG TAG TTA CGA GTT TAG TAC GTT <br><br>
Xbal <br><br>
TTG CAC CAC TCT AAG CAC AAC GTG GTG AGA TTC GTG GTAC 10 Ncol <br><br>
Formula VIb <br><br>
15 <br><br>
After combination of the two synthetic oligonucleotides of formulae Via and VIb, cloning into a suitable vector, for example a correspondingly modified pUC18 derivative and addition of the Thal/EcoRI 20 fragment of the cDNA according to the invention from one of the clones obtained, the 5' end of which has at least the Thai site, it is possible to obtain a plasmid which contains a complete cDNA of the hMn-SOD gene in the correct reading frame 25 corresponding to formulae Vila and Vllb, without the Thai sites. <br><br>
- 36 - <br><br>
22 3 8 6 9 <br><br>
ATG <br><br>
AAG <br><br>
CAC <br><br>
TCT <br><br>
TTG <br><br>
CCA <br><br>
GAC <br><br>
TTG <br><br>
CCA <br><br>
TAC <br><br>
GAC <br><br>
TAC <br><br>
GGT <br><br>
GCT <br><br>
CTA <br><br>
GAA <br><br>
CCA <br><br>
CAC <br><br>
ATC <br><br>
AAT <br><br>
GCT <br><br>
CAA <br><br>
ATC <br><br>
ATG <br><br>
CAA <br><br>
TTG <br><br>
CAC <br><br>
CAC <br><br>
TCT <br><br>
AAG <br><br>
CAC <br><br>
CAT <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
•TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
Formula Vila <br><br>
ATG <br><br>
AAG <br><br>
CAC <br><br>
TCT <br><br>
TTG <br><br>
CCA <br><br>
GAC <br><br>
TTG <br><br>
CCA <br><br>
TAC <br><br>
GAC <br><br>
TAC <br><br>
GGT <br><br>
GCT <br><br>
CTA <br><br>
GAA <br><br>
CCA <br><br>
CAC <br><br>
ATC <br><br>
AAT <br><br>
GCT <br><br>
CAA <br><br>
ATC <br><br>
ATG <br><br>
CAA <br><br>
TTG <br><br>
CAC <br><br>
CAC <br><br>
TCT <br><br>
CAG <br><br>
CAC <br><br>
CAT <br><br>
GCG <br><br>
GCC <br><br>
TAC <br><br>
GTG <br><br>
AAC <br><br>
AAC <br><br>
CTG <br><br>
AAC <br><br>
GTC <br><br>
ACC <br><br>
GAG <br><br>
GAG <br><br>
AAG <br><br>
TAC <br><br>
CAG <br><br>
GAG <br><br>
GCG <br><br>
TTG <br><br>
GCC <br><br>
AAG <br><br>
GGA <br><br>
GAT <br><br>
GTT <br><br>
ACA <br><br>
GCC <br><br>
CAG <br><br>
ATA <br><br>
GCT <br><br>
CTT <br><br>
CAG <br><br>
CCT <br><br>
GCA <br><br>
CTG <br><br>
AAG <br><br>
TTC <br><br>
AAT <br><br>
GGT <br><br>
GGT <br><br>
GGT <br><br>
CAT <br><br>
ATC <br><br>
AAT <br><br>
CAT <br><br>
AGC <br><br>
ATT <br><br>
TTC <br><br>
TGG <br><br>
ACA <br><br>
AAC <br><br>
CTC <br><br>
AGC <br><br>
CCT <br><br>
AAC <br><br>
GGT <br><br>
GGT <br><br>
GGA <br><br>
GAA <br><br>
CCC <br><br>
AAA <br><br>
GGG <br><br>
GAG <br><br>
TTG <br><br>
CTG <br><br>
GAA <br><br>
GCC <br><br>
ATC <br><br>
AAA <br><br>
CGT <br><br>
GAC <br><br>
TTT <br><br>
GGT <br><br>
TCC <br><br>
TTT <br><br>
GAC <br><br>
AAG <br><br>
TTT <br><br>
AAG <br><br>
GAG <br><br>
AAG <br><br>
CTG <br><br>
ACG <br><br>
GCT <br><br>
GCA <br><br>
TCT <br><br>
GTT <br><br>
GGT <br><br>
GTC <br><br>
CAA <br><br>
GGC <br><br>
TCA <br><br>
GGT <br><br>
TGG <br><br>
GGT <br><br>
TGG <br><br>
CTT <br><br>
GGT <br><br>
TTC <br><br>
AAT <br><br>
AAG <br><br>
GAA <br><br>
CGG <br><br>
GGA <br><br>
CAC <br><br>
TTA <br><br>
CAA <br><br>
ATT <br><br>
GCT <br><br>
GCT <br><br>
TGT <br><br>
CCA <br><br>
AAT <br><br>
CAG <br><br>
GAT <br><br>
CCA <br><br>
CTG <br><br>
CAA <br><br>
GGA <br><br>
ACA <br><br>
ACA <br><br>
GGC <br><br>
CTT <br><br>
ATT <br><br>
CCA <br><br>
CTG <br><br>
CTG <br><br>
GGG <br><br>
ATT <br><br>
GAT <br><br>
GTG- <br><br>
TGG <br><br>
GAG <br><br>
CAC <br><br>
GCT <br><br>
TAC <br><br>
TAC <br><br>
CTT <br><br>
CAG <br><br>
TAT <br><br>
AAA <br><br>
AAT <br><br>
GTC <br><br>
AGG <br><br>
CCT <br><br>
GAT <br><br>
TAT <br><br>
CTA <br><br>
AAA <br><br>
GCT <br><br>
ATT <br><br>
TGG <br><br>
AAT <br><br>
GTA <br><br>
ATC <br><br>
AAC <br><br>
TGG <br><br>
GAG <br><br>
AAT <br><br>
GTA <br><br>
ACT <br><br>
GAA <br><br>
AGA <br><br>
TAC <br><br>
ATG <br><br>
GCT <br><br>
TGC <br><br>
AAA <br><br>
AAG <br><br>
TAA <br><br>
Formula Vllb <br><br>
rN <br><br>
O <br><br>
- 37 - <br><br>
22 3 8 6 9 <br><br>
Sequencing of the clones BS5, BS9, BS13, BSXIII and clones BS3 and BS12 showed that the sequences of clones BS5, BS9, BS13 and BSXIII are identical with clone BS8. As already stated, clones BS3 5 and BS12 differ from clone BS8 in amino acid 29 (CAG instead of AAG or Gin instead of Lys, formula lb, Illb and IVb). Otherwise, there is 100% homology with clone BS8 up to base 573 of the EcoRI fragment <br><br>
* 573 <br><br>
shown in Fig. 1 (...TA A ACC ACG ATC GTT ATG CTG J). <br><br>
10 Apart from this base, the two clones BS3 and BS12 <br><br>
are identical with respect to the 5-ut (untranslated) region shown in Formula VIII. <br><br>
5'AAG CAC TCT ... [Formula Illb] ... AAA AAG TAA ACC ACG <br><br>
15 <br><br>
ATC GTT ATG CTG AGTAT GTTAA GCTCT TTATG ACTGT TTTTG TAGTG GTATA GAGTA CTGCA GAATA CAGTA AGCTG CTCTA TTGTA GCATT TCTTG ATGTT GCTTA GTCAC TTATT TCATA AACAA CTTAA TGTTC TGAAT AATTT CTTAC TAAAC ATTTT GTTAT TGGGC AAGTG ATTGA AAATA GTAAA TGCTT 20 TGTGT GATTG AATCT GATTG GACAT TTTCT TCAGA GAGCT AAATT ACAAT TGTCA TTTAT AAAAC CATCA AAAAT ATTCC ATCCA TATAC TTTGG GGACT TGTAG GGATG CCTTT CTAGT CCTAT TCTAT TGCAG TTATA GAAAA GTAGT CGACCATGCGGAATTC Linker EcoRI 25 Formula VIII <br><br>
Furthermore, a number of cDNA clones were isolated from a cDNA gene bank (placenta) using Xgtll. <br><br>
This cDNA gene bank was prepared in the same way 30 as the cDNA gene bank described in the Examples from placenta DNA in XgtlO. One of the clones isolated from Xgtll, namely clone 4, was subcloned in Bluescribe M13+ in the manner described. Sequencing was carried out by repeated priming with the synthetic 35 17mer oligonucleotides <br><br>
EBI 760 : 5' AGATACATGGCTTGCAA 3' <br><br>
EBI 765 : 5' CTCTGAAGAAAATGTCC 3' <br><br>
EBI 782 : 5' EBI 785 : 5' <br><br>
- 38 - <br><br>
GGAGATGTTACAGCCCA 3' AAGGAACGGGGACACTT 3 <br><br>
22 3 8 6 9; <br><br>
Clone 4 is identical to clones BS3 and BS12 from 5 XgtlO apart from amino acid 29 (AAG or Lys) and a ...TCTA... sequence at the 3' end adjoining the multicloning site. Although the analysed DNA sequence of the remaining 61 bases of the 5' end (before formula Iar clone BS8, corresponding to codons 10 +1 to +21 corresponding to Lys to Glu) shows some base changes compared with the derived DNA sequence (Formula II, contained in Formula Illb), the translation of this DNA section does not produce any differences from Barra et al., 1984. A leader sequence in 15 front of the ATG was also analysed. Formula IX shows the sequence of clone 4 found. <br><br>
EcoRI (GGGCGAATTCCAGC) <br><br>
20 <br><br>
-24 -20 -15 <br><br>
MLSRAVCGTSRQLP <br><br>
o <br><br>
25 <br><br>
ATG TTG AGC CGG GCA GTG TGC GGC ACC AGC AGG CAG CTG CCT <br><br>
30 <br><br>
-10 <br><br>
-5 <br><br>
-1 +1 <br><br>
PV LGYLGSRQKHSL <br><br>
CCG GTT TTG GGG TAT CTG GGC TCC AGG CAG AAG CAC AGC CTC <br><br>
35 +5 +10 +15 <br><br>
PDLPYDYGALEPHI <br><br>
CCC GAC CTG CCC TAC GAC TAC GGC GCC CTG GAA CCT CAC ATC <br><br>
IMflWtoiiiiia 7 J... <br><br>
0 <br><br>
o <br><br>
5 <br><br>
■j 20 <br><br>
22 3 8 6 9 <br><br>
- 39 - <br><br>
+20 +21 N A Q I <br><br>
AAC GCG CAG ATC...[Formula la]... AAA AAG TAA ACC <br><br>
10 <br><br>
ACG ATC GTT ATG CTG AGTAT GTTAA GCTCT TTATG ACTGT TTTTG TAGTG GTATA GAGTA CTGCA GAATA CAGTA AGCTG CTCTA TTGTA GCATT TCTTG ATGTT GCTTA GTCAC TTATT TCATA AACAA CTTAA TGTTC TGAAT AATTT CTTAC TAAAC ATTTT GTTAT TGGGC AAGTG 15 ATTGA AAATA GTAAA TGCTT TGTGT GATTG AATCT GATTG GACAT TTTCT TCAGA GAGCT AAATT ACAAT TGTCA TTTAT AAAAC CATCA AAAAT ATTCC ATCCA TATAC TTTGG GGACT TGTAG GGATG CCTTT CTAGT CCTAT TCTAT TGCAG TTATA GAAAA TCTA GGAATTCGCCC <br><br>
EcoRI-Linker <br><br>
25 Formula IX <br><br>
♦Other sequenced clones show alanine (GCT) at position -9. <br><br>
30 Other clones have 5'ut regions of different lengths. <br><br>
The DNA sequences according to the invention may be incorporated into various expression vectors and expressed with the aid of the control elements 35 described, for example in pES103 with the ADHI <br><br>
promoter (DSM 4013). pES103 is obtained by incorporating the 1500 bp long BamHI/XhoI fragment of the ADHI <br><br>
- 40 - <br><br>
22 3 8 6 9 <br><br>
promoter (e.g. Ammerer, G., Methods in Enzymology 101, 192 - 201, 1983) into the pUCl8 derivative pESl02, which contains an Xho linker in the HincII catting site. <br><br>
5 <br><br>
Instead of this ADHI promoter sequence originally of 1500 bp, it is also possible to use an ADHI promoter shortened to a length of about 400 bp as the BamHI/XhoI fragment. The shortened ADHI promoter (ADHIk) 10 is obtained by digesting plasmid pWS323E (DSM 4016) <br><br>
with BamHI/XhoI and isolating the ADHIk promoter. <br><br>
For the correct termination, a suitable terminator sequence, conveniently an ADH terminator, preferably 15 the ADHII terminator is ligated behind the hMn-SOD. The ADHII terminator (Beier, D.R., Young, E.T., <br><br>
Nature 300, 724 - 728, 1982) can be obtained by SphI digestion of pMW5-ADHII (Washington Research Foundation) as a fragment 1530 bp long and, after 20 subsequent HincII digestion, as a final ADHII terminator (329 bp), or from plasmid pGD2 (DSM 4014) as a HinduI/Xbal fragment 336 bp long. <br><br>
For expression in yeast, there are various yeast 25 vectors available into which the expression cassettes with the hMn-SOD gene according to the invention can be incorporated, preferably YEpl3 (Broach, <br><br>
J-R- et al.. Gene 8, 121 - 133, 1979; ATCC 37115), <br><br>
pJDB 207 (DSM 3181, filed on 28.12.1984), YIp5 30 (Struhl, K. et al., Proc. Natl.Acad. Sci USA 76, 1035 - 1039, 1979; ATCC 37061), pEASl02 (pEASl02 can be obtained by digesting Ylp5 partially with PstI and completely with BamHI and ligating the isolated 4.3 kb fragment which contains the URA3 35 gene with the 4.4 kb BamHI/PstI fragment of pJDB207) . <br><br>
22 3 8 6 9 <br><br>
- 41 - <br><br>
-J <br><br>
With these yeast vectors which carry an expression cassette with the hMn-SOD gene according to the invention it is possible to transform suitable yeast cells by known methods. Suitable yeast cells 5 for expression are preferably all those which are deficient for their own yeast-specific Mn-SOD and which contain a selectable yeast gene, such as HIS3, URA3, LEU 2 and SUP, to name but a few. Mutants of this kind which contain, for example, mutated 10 genes constructed iri vitro or iri vivo and contain them via a "transplacement" may be obtained by integrative transformation (e.g. Winston, F. et al., Methods in Enzymology 101, 211-228, 1983). The Mn-SOD gene of the yeast which is to be mutated 15 is contained, for example, in plasmid pL41 as a BamHI fragment (van Loon et al., Gene 26, 261-272, 1983). Since the entire sequence of this BamHI fragment is known (Marres, C.A.M. et al., Eur.J.Biochem. 147, 153-161, 1985), the Mn-SOD gene of the yeast 20 is obtainable even without pL41. <br><br>
O <br><br>
25 <br><br>
The hMn-SOD produced by such transformants can be obtained by known methods of protein isolation and protein purification. The cell decomposition may be carried out, for example, according to van Loon et al. (Proc. Natl. Acad. Sci. USA 83, 3820 - 3824, 1986). <br><br>
o <br><br>
For the expression of hMn-SOD in bacteria, preferably 30 E. coli, more specifically E. coli HB101, C600 and JM101, it is possible to use the established expression systems mentioned hereinbefore. For this purpose, the DNA sequences according to the invention must be brought under the control of 35 a powerful E. coli promoter (loc.cit.), not under a eukaryotic promoter. Examples of these known promoters are lac, lacuv5, trp, tac, trp-lacuv5, <br><br>
- 42 - <br><br>
22 3 8 <br><br>
XPL#. ompF and bla. The obligatory use of a ribosomal binding site to ensure efficient translation in E. coli has already been described in detail earlier. <br><br>
5 In order to demonstrate the expression of the hMn-SOD activity by E. coli, the bacteria are lysed after incubation in a suitable conventional culture medium and the supernatant is tested for hMn-SOD activity as described (e.g. Marklund, S., Marklund, G., <br><br>
10 1974; Ch. Beauchamp and I. Fridovich, Anal. Biochem. 44, 276 - 287, 1971; H.P. Misra and I. Fridovich, Arch.Biochem.Biophys. 183, 511 - 515, 1977; B.J. <br><br>
Davis, Ann. NY Acad. Sci. 121, 404 - 427, 1964; M. Ysebaert-Vanneste and W.H. Vanneste, Anal.Biochem. 15 107, 86 - 95, 1980). <br><br>
The expression of the hMn-SOD gene may also be detected by labelling the proteins in maxicells. Plasmid-coded proteins may be labelled selectively 20 in vivo using the maxicell technique (Sancar, A. et al., J. Bacterid, 137, 692 - 693, 1979). The E. coli strain CSR603 (CGSC 5830) has no DNA repair mechanisms. A suitable dose of UV radiation destroys the bacterial chromosome, but some of the substantially 25 smaller plasmid DNAs which are present in several copies per cell remain functional. After all the undamaged, replicating cells have been killed off by means of the antibiotic D-cycloserine and the endogenous mRNA has been consumed, only plasmid-30 encoded genes are transcribed and translated in the remaining cells. The proteins formed may be radioactively labelled and detected by the incorporation <br><br>
35 <br><br>
of S-methionine. E. coli CSR603 is transformed with the expression plasmids by conventional methods 35 and the transformed bacteria selected for on ampicillin-containing agar plates. The preparation of the maxicells and the labelling of the proteins are <br><br>
J <br><br>
O 22 3 8 6 9 <br><br>
- 43 - <br><br>
carried out by the method of A. Sancar (1979, loc. <br><br>
14 <br><br>
cit.) A C-methylated protein mixture (Amersham) <br><br>
is used as the molecular weight standard. The plasmid containing only the promoter without the 5 hMn-SOD gene is used as control. <br><br>
After transformation of the host, expression of the gene and fermentation or cell cultivation under conditions in which the proteins according to the \ 10 invention are expressed, the product can usually be extracted by known chromatographic methods of operation, so as to obtain a material which contains proteins with or without leader and tailing sequences. The hMn-SOD according to the invention can be expressed 15 with a leader sequence at the N-terminus, which may be removed by some host cells as already described. If not, the leader polypeptide (if present) must be cleaved, as described hereinbefore, <br><br>
to obtain mature hMn-SOD. Alternatively, the sequence 20 can be modified so that the mature enzyme is produced directly in the microorganism. The precursor sequence of the yeast mating pheromone MF-alpha-1 may be used for this purpose to ensure correct "maturation" <br><br>
of the fused protein and the secretion of the products 25 into the growth medium or the periplasmic space. <br><br>
The "secretion" of the hMn-SOD in yeast mitochondria may be effected by placing the leader sequence for the yeast Mn-SOD gene directly before the hMN-SOD ■ ""> gene. <br><br>
30 <br><br>
Suitable leader sequences, for example those described by Marres C.A.M. et al., Eur. J. Biochem. 147, <br><br>
153-161 (1985) or derivatives thereof, may either be of natural origin or may be isolated from corresponding 35 eukaryotic cells (for example S. cerevisiae) or they may be produced synthetically. For example, a yeast-specific DNA presequence which is necessary i <br><br>
| <br><br>
O 223869 <br><br>
- 44 - <br><br>
for importing the hMn-SOD into the yeast mitochondrium may be obtained by ligating individual synthetic oligonucleotides. According to the invention, <br><br>
the complete presequence may be inserted between 5 the start codon ATG and the first codon for the first amino acid of the mature hMn-SOD (Lys, e.g. <br><br>
AAG) or any desired portion of an N-terminal end thereof, for example in formulae II, Ilia, Illb, <br><br>
Via, Vila, Vllb, VIII or IX. Similarly, a presequence 'w 10 of this kind may be incorporated directly after the ATG start codon and directly before the first codon of a DNA which is mutated from the genuine DNA sequence of hMn-SOD by sequence modifications and which codes for a protein with hMn-SOD activity. <br><br>
15 <br><br>
A leader sequence which can be used according to the invention for the purpose of importing an hMn-SOD into the yeast mitochondrium is shown in formula X which follows, in which the known sequence GCA GCT 20 (Marres, C.A.M. et al., 1985, loc. cit.) is substituted for GCT GCA (both triplets code for alanine) and a PvuII recognition site is created. <br><br>
/""N <br><br>
to* PvuII <br><br>
2 5 TTCGCGAAAAC AGCTGC AGCTAATTTAACC AAG AAGGGTGGTTTGTCATTGCTCT CCACCACAGCAAGGAGAACC <br><br>
Formula X <br><br>
30 Preferably, the leader sequence, for example as in formula X, may be contained in the Xhol/Xbal fragment of formula Via. This ensures that this 128 bp linker with the leader can be linked to the remaining hMn-SOD gene via the Xhol and Xbal 35 sites in such a way that the leader sequence is located immediately after the start ATG and immediately before the first amino acid (lysine) of the hMn-SOD <br><br>
**mt* <br><br>
~1 <br><br>
w cl 3 G 6 9 <br><br>
- 45 - <br><br>
I (formula XI). <br><br>
Xhol PvuII <br><br>
Start <br><br>
5 TCGAGTATACAATGTTCGCGAAAACAGCTGCAGCTAA CATATGTTACAAGCGCTTTTGTCGACGTCGATT <br><br>
TTTAACCAAGAAGGGTGGTTTGTCATTGCTC AAATTGGTTCTTCCCACCAAACAGTAACGAG <br><br>
Lysine <br><br>
TCCACCACAGCAAGGAGAACCAAGCACTCTTT AGGTGGTGTCGTTCCTCTTGGTTCGTGAGAAA <br><br>
15 GCCAGACTTGCCATACGACTACGGTGCT3' <br><br>
10 <br><br>
CGGTCTGAACGGTATGCTGATGCCACGAGATC -s Xbal <br><br>
20 <br><br>
Formula XI <br><br>
Purification of the hMn-SOD from cells may be carried out by known methods. <br><br>
It is to be understood that the polypeptides according 25 to the present invention include those isolated in substantially pure form from naturally occurring sources and those prepared by genetic engineering. However, it is not intended to include within the scope of the invention polypeptides, isolated from 30 naturally occurring sources, which have a lysine residue at position 29, glutamine residues at positions 42, 88, 109 and 129 and which do not contain a glycine and a tryptophan residue at positions 124 and 125 respectively corresponding to formulae IVa 35 and/or IVb. <br><br>
C 22 3 o6 9 <br><br>
- 46 - <br><br>
Legend to the Figures: <br><br>
Fig. 1: EcoRI fragment from clone BS8 with the 532 bp long coding region from 5 amino acid 22 of mature hMn-SOD, the <br><br>
51 bp 3' ut region and the sequence portions of the linker. The potential N-glycosylation sites (overlined), <br><br>
the single Thai and BamHI sites (underlined) 10 are shown. <br><br>
Fig. 2: Schematic strategy for construction of plasmid HSOD4 which contains the synthetic 5' end of the hMn-SOD gene 15 as an Xhol/Ncol fragment. <br><br>
Fig. 3: Restriction maps of plasmids HSOD2 <br><br>
and HS0D3 and plasmid HSOD4 constructed therefrom. <br><br>
J 20 <br><br>
4 <br><br>
Fig. 4: Construction of a plasmid (HSOD6) with the complete cDNA for hMn-SOD, as an XhoI/EcoRI fragment. <br><br>
O <br><br>
25 Fig. 5: Preparation of the Thal/EcoRI fragment of hMn-SOD cDNA from clone BS8. <br><br>
1 <br><br>
Fig. 6: Construction of plasmid pl54/2 which contains the ADHI promoter as a 1500 bp 30 BamHI/XhoI fragment. <br><br>
Fig. 7: Construction of plasmid pl50/2 with the units of ADHI promoter and ADHII terminator (336 bp Xbal/Hindlll fragment) 35 needed for the expression of hMn-SOD. <br><br>
C 22 3 8 6 9 <br><br>
/O <br><br>
- 47 - <br><br>
Fig. 8: Preparation of the final plasmids (pKHl and pKH2) with the ADHI promoter or ADHIk promoter and the ADHII terminator, by further insertion of the hMn-SOD cDNA via the XhoI/EcoRI site. The plasmid pKH2 corresponds to pKHl except that pRH2 contains the ADHIk promoter instead of the ADHI promoter. <br><br>
10 Fig. 9: Construction of the expression cassette <br><br>
HSOD7 with the shortened, approximately 400 bp long ADHI promoter (ADHIk). <br><br>
Construction with the ADHI promoter of the original length is effected <br><br>
15 starting from pKHl in analogous manner. <br><br>
Fig. 10: Construction of plasmids with the URA3 gene located inside the yeast Mn-SOD gene as a marker in various orientations relative to -j 20 the Mn-SOD gene (S0DY7, SODY8) in order to <br><br>
; prepare a yeast Mn-SOD mutant suitable for expression. The gene transplacement in the corresponding yeast strain (DBY747) was carried Q out with SODY7 and SODY8. <br><br>
25 <br><br>
_ Fig. 11: Detection, by gel electrophoresis, of the expression of hMn-SOD via plasmids pWS490A and pWS49lA in the yeast strain WS30-5g. O) Track 1: WS30-5g/pWS490Al, Track 2: WS30-5g/ <br><br>
^ 30 PWS490A2, Track 3: WS30-5g/pWS49lAl, Track 4: <br><br>
WS30-5g/pWS49lA2, Track 5: WS21-1(SODl), contains yeast Mn-SOD, Track 6: WS30-5g, <br><br>
Tracks 7 to 10: hMn-SOD from liver (0.3 meg Track 8, 1.2 meg Track 9, 3.0 meg Track 10). <br><br>
35 The numbers 1 and 2 following the names of the plasmids indicate different transformants with the same plasmids. <br><br>
1 <br><br>
o <br><br>
22 3 8 6 9 <br><br>
- 48 - <br><br>
Pig. 12: Analysis of the Mn-SOD activity in yeast extracts which contain the expression plasmids pE024-AB, pE025-AC and pE026-AC, separating the proteins in polyacrylamide 5 gel and subsequently staining their activity with o-dianisidine by known methods: a=WS30-5g, b»WS30-5g/pE024-AB, C=WS30-5g/pE025-AC, d=WS30-5g/pE026AD, e=marker (0.15 meg human liver Mn-SOD). <br><br>
w 10 <br><br>
Pig. 13: Analysis of the activity of recombinant human Mn-SOD in the mitochondria or in the cytoplasm of 6 different yeast transformants, by gel-electrophoretic 15 separation of the protein and subsequent activity staining with o-dianisidine by known methods (CP-Extr. = cytoplasm extract, MC-Extr. = mitochondria extract): <br><br>
20 a=marker, 0.15 meg human liver Mn-SOD <br><br>
b=CP-Extr. WS30-5g pWS490A without MC-leader c=MC-Extr. " " <br><br>
d=CP-Extr. " pE024-AB with MC-leader Q e=MC-Extr. " " <br><br>
25 f=CP-Extr. " pWS49lA without MC-leader g=MC-Extr. " <br><br>
h=CP-Extr. " pE025-AC with MC-leader i=MC-Extr. * * » <br><br>
j=CP-Extr. " pWS550A without MC-leader 30 k=MC-Extr. <br><br>
l=CP-Extr. " pE026-AD with MC-leader m=MC-Extr. " " " <br><br>
n=free trace o=marker, 0.075 meg human liver Mn-SOD <br><br>
35 <br><br>
w <br><br>
- 49 - <br><br>
2Z o 8 6 9 <br><br>
Fig. 14: Elution diagram (Example 15, Step 5) <br><br>
of the chromatography of the hMn-SOD according to the invention after precipitation with (NH4)2S04 (Example 15, Step 4) <br><br>
using a Mono S cation exchange column (Pharmacia). <br><br>
Fig. 15: SDS polyacrylamide gel (15%, silver colouration) of hMn-SOD probes after various purification stages. <br><br>
1= 4 mcl of marker (LMW-Pharmacia) 1:50 <br><br>
2- 10 meg crude extract <br><br>
3= 10 meg after ammonium sulfate precipitation 4= 9 meg after chromatography on Mono S <br><br>
5= 1.5 meg after chromatography on 6= 5 meg hydroxylapatite <br><br>
The following examples, which are not intended to restrict the invention, illustrate the invention in detail. <br><br>
Materials used: <br><br>
Unless otherwise stated in the Examples which follow, the following materials, solutions, plasmids, vectors and microorganisms are used: <br><br>
ADHI promoter: DSM 4013 (pES103), deposited on <br><br>
(1500bp BamHI/XhoI) 27.2.87 <br><br>
ADHI promoter, shortened to: <br><br>
(PWS323E), filed on 27.2.87 <br><br>
DSM 4016 <br><br>
(400bp BamHI/XhoI) <br><br>
J ' <br><br>
£.£. 0 <br><br>
- 50 - <br><br>
ADHII terminator: DSM 4014 (pGD2), deposited on (336 bp Xbal/Hindlll) 27.2.87 <br><br>
BamHI buffer: <br><br>
150 mM NaCl, 6 mM Tris-HCl pH 7.9, 6 mM MgCl2, 100 mcg/ml BSA <br><br>
O <br><br>
CORE buffer: <br><br>
50 mM Tris-HCl pH 8.0, 10 mM MgCl2/ 50 mM NaCl <br><br>
10 Denaturing solution: 0.5 M NaOH, 1.5 M NaCl <br><br>
O <br><br>
Denhardt solution: (50x) <br><br>
15 <br><br>
E. coli C600: <br><br>
20 E. coli JM101: <br><br>
HIGH buffer: <br><br>
25 <br><br>
1 g polyvinylpyrrolidone, MW 360,000, 1 g Ficoll, <br><br>
1 g bovine serum albumin (BSA) ad. 100 ml H20 <br><br>
F~, supE44, thil, thrl, leuB6, lacYl, tonA21, X" (ATCC 23724) <br><br>
supE, thi, /^(lac-pro AB), <br><br>
[F', traD36, proAB, lacIqZ,AMl5] <br><br>
100 mM NaCl, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM Dithiothreitol (DTT) <br><br>
30 <br><br>
HincII buffer: 10 mM Tris-HCl pH 7.5, 60 mM <br><br>
NaCl, 10 mM MgCl2, ImM 2-mercapto-ethanol, 100 mcg/ml BSA <br><br>
Hybridising solution: like pre-hybridising solution but without salmon sperm DNA <br><br>
Klenow reaction 35 solution: <br><br>
22 mcl DNA/H20, 2.5 mcl 10 x NTR buffer (0.5M Tris-HCl pH 7.2, 0.1M MgS04, 1 mM DTT, 500 mcg/ml BSA) per 1 mcl <br><br>
--- <br><br>
• n <br><br>
D <br><br>
Lambda buffer: <br><br>
LB agar: <br><br>
- 51 - <br><br>
22 <br><br>
2 mM dATP, dGTP, dCTP, dTTP, 2.5 U Rlenow fragment (0.5 mcl) <br><br>
100 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM EDTA <br><br>
LB liquid medium, 15 g/1 Bacto-Agar (Difco) <br><br>
10 LB liquid medium: <br><br>
10 g/1 Bacto-Tryptone (Difco), 5 g/1 yeast extract (Difco), 5 g/1 NaCl, 10M NaOH ad. pH 7.4 <br><br>
Ligation solution: <br><br>
15 <br><br>
66 mM Tris-HCl pH 7.6, 10 mM MgCl2, 5 mM DTT, 1 mM ATP, 1U T4-DNA ligase <br><br>
Neutralising solution: 0.5M Tris-HCl pH 7.5, 1.5M NaCl <br><br>
20 Nitrocellulose filter: Schleicher & Schuell, <br><br>
membrane filter BA 85 <br><br>
25 <br><br>
Nrul buffer: <br><br>
Prehybridising solution: <br><br>
30 <br><br>
50 mM KC1, 50 mM NaCl, 50 mM Tris-HCl pH 8.0, 10 mM MgCl2 <br><br>
5 x SSC, 5 x Denhardt solution, 50 mM Na-phosphate buffer pH 6.8, 1 mM Na2P407, 100 mcM ATP, 0.1% SDS, 30-100 (50) mcg/ml denatured, ultrasound-treated salmon sperm DNA <br><br>
pUCl8: <br><br>
35 <br><br>
PURA3: <br><br>
Pharmacia <br><br>
DSM 4015, deposited on 27.2.87 <br><br>
«££ <br><br>
.. . <br><br>
CD <br><br>
r> <br><br>
22 5869 <br><br>
- 52 - <br><br>
S. cerevisiae DBY747: a, leu2, his3, trpl/ ura3 <br><br>
(Yeast Genetic Stock Centre, Berkeley) <br><br>
5 SC-URA mediums <br><br>
10 <br><br>
0.67% BYNB (Difco), 2% glucose, 2% 50 x AS mix (containing per litre: 1 g histidine, 6 g leucine, 2.5 g tryptophan, 4 g lysine, 1.2 g adenine, 2 g arginine, 1 g methionine, 6 g phenylalanine, 5 g threonine, 6 g isoleucine) <br><br>
Smal buffer: <br><br>
15 <br><br>
10 mM Tris-HCl pH 8.0, 20 mM KC1, 10 mM MgCl2, 10 mM 2-mercaptoethanol, 100 mcg/ml BSA <br><br>
20 <br><br>
SphI buffer: <br><br>
10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2, 10 mM 2-mercaptoethanol, 100 mcg/ml BSA <br><br>
O <br><br>
25 <br><br>
SSC (20x): SSPE (20x) : <br><br>
3.0M NaCl, 0.3M Na3-citrate, pH 7.0 <br><br>
3.6M NaCl, 0.2M Na2HP04, 20 mM EDTA, with NaOH (10N) ad. pH 7.4 <br><br>
TE buffer: <br><br>
10 mM Tris-HCl pH 8.0, 1 mM EDTA <br><br>
30 <br><br>
Thai buffer: <br><br>
Top agarose: <br><br>
50 mM Tris-HCl pH 8.0, 10 mM MgCl2 <br><br>
LB liquid medium, 0.7% agarose (Seaken FM-agarose) <br><br>
Prewash solution: <br><br>
35 <br><br>
1M NaCl, 50 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.1% SDS <br><br>
c 223869 <br><br>
- 53 - <br><br>
Example 1. Construction of a cDNA gene bank <br><br>
Dice-sized pieces of fresh human placenta tissue were shock-frozen in liquid nitrogen and the tissue CD 5 was powdered at below -80°C. The RNA was then extracted from the powdered tissue material using the procedure described by Chirgwin, J.M. et al. <br><br>
and then prepared (Chirgwin, J.M. et al., Biochemistry 18, 5294-5299, 1979). <br><br>
O 10 <br><br>
The poly(A)+RNA was prepared from the resulting RNA using the method of Aviv, H. and Leder, P. <br><br>
(Proc. Natl. Acad. Sci. USA 69, 1409-1412, 1972). <br><br>
The cDNA was synthesised using a "cDNA synthesis 15 system" (Amersham RPN 1256). <br><br>
^ Packaging was carried out with Gigapack (Vector <br><br>
Cloning Systems). All other procedural steps for cloning into the EcoRI site of XgtlO were carried -j 20 out as prescribed by Huynh T.V. et al. (DNA Cloning <br><br>
Vol. 1, D.M. Glover ed., IRL Press, Chapter 2, 1985) except that E. coli C 600 was used as the <br><br>
! "plating bacteria". The titre of the XgtlO phage <br><br>
DIO <br><br>
representing the cDNA gene bank was 1.2 x 10 25 pfu/ml, the number of independent clones 1 x 10^. <br><br>
Example 2. Amplification of the XgtlO gene bank <br><br>
A suitable E. coli yeast strain (C600, genotype 30 F-, supE44, thil, thrl, leuB6, lacYl, tonA21, lambda-(M.A. Hoyt et al., 1982, Cell 31, 5656) was pre-cultivated overnight at 37° in LB medium supplemented with 0.2% maltose. <br><br>
35 This overnight culture was centrifuged for 5 min at 3000 rpm and resuspended in ice cold 10 mM MgSO^ solution so that the ODgQ0nm was T^e <br><br>
- 54 - <br><br>
22 <br><br>
cells thus prepared were stored at 4°C and could be used for a week. <br><br>
12x200 mcl of Mg cells were mixed, in sterile test 5 tubes, with a phage suspension (50000 pfu of the cDNA gene bank per plate) and incubated at 37°C for 20 min. Then 6-7 ml of molten top agarose adjusted to a temperature of 42°C (containing 10 mM MgS04, final concentration) were pipetted into 10 each test tube, mixed and poured out onto 12 agar plates (13.5 cm in diameter) preheated to 37°C with 10 mM MgS04 and the plates were incubated at 37°C for 6-12 hours. <br><br>
15 Example 3. Primary screening to identify recombinant X-phages a. Preparation of the nitrocellulose filters <br><br>
20 After incubation the plates thus prepared were cooled to 4°C. Nitrocellulose filters numbered with a pencil were placed on the surface of the plates and their positions on the plates were marked with pin pricks. About 1 min after being thoroughly 25 wetted, the filters were carefully removed again, placed in denaturing solution and incubated for 1 min at room temperature (RT). They were then neutralised in neutralising solution for 5 min at RT and incubated for 30 sec in 2xSSPE, again 30 at RT. <br><br>
Up to 3 further extracts were prepared from each plate, with the filters being left on the plate 30 sec longer each time. The positions of the 35 pin pricks were transferred accurately to the next filters. <br><br>
n <br><br>
V <br><br>
- 55 - <br><br>
22 3 8 6 9 <br><br>
The filters were dried in air, lying on filter paper, and the DNA was fixed at 80°C by baking for 2 hours. The plates were kept until the results of the following hybridisation were obtained. <br><br>
32 <br><br>
b. Preparation of the P-labelled probes <br><br>
The synthetic oligonucleotide mixtures were prepared using a 381A DNA synthesiser (Applied Biosystems), C 10 purified by polyacrylamide gel electrophoresis <br><br>
(20% in 8M urea, T. Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982, page 173 ff) and desalinated over Sephadex G50 (Pharmacia) The DNA probes thus synthesised are complementary 15 to RNA base sequences which code a) for amino acids 39-46 or b) for amino acids 200-207 (D. Barra et al., Oxy Radicals and their scavenger Systems, Vol. 1, 336-339, 1983) and have the following base sequences: <br><br>
20 <br><br>
25 <br><br>
CCC <br><br>
a) 5' TG ITA TT TC TC IGT IAC ITT 3' <br><br>
TTT <br><br>
AC A <br><br>
b) 5' TC IGT IAC TT TC CCA TT IAT 3' <br><br>
G T G <br><br>
wherein A, G, C and T represent the corresponding 30 nucleotides and I represents inosine. <br><br>
The chemically synthesised DNA probe mixtures were each dissoved in water at a concentration of 20 pM/mcl. <br><br>
35 Reaction mixture: <br><br>
O p <br><br>
20-100 pM gamma P-ATP (^3000Ci/mmol, Amersham), <br><br>
22 3 8 6 9 <br><br>
lyophilised from ethanolic solution, 20-100 pmol oligonucleotide, 1 mcl 10 x kinase buffer (0.7M Tris-HCl pH 7.6, 0.1 M MgCl2/ 50 mM dithiothreitol, <br><br>
10 units T4 polynucleotide kinase (BRL), water 5 ad. 10 mcl. <br><br>
The reaction lasted 60 min at 37°C and was stopped by the addition of 25 mM EDTA. Any radioactivity not incorporated was removed by exclusion chromatography 10 using a 1 ml Biogel P6-DG (Biorad) column produced in a 1 ml one-way syringe. TE buffer was used as eluant. <br><br>
c. In situ hybridisation <br><br>
15 <br><br>
In order to remove any residual agarose and bacteria from the nitrocellulose which would cause considerable background radiation during hybridisation, the filters were incubated in a sufficient volume of 20 prewash solution at 65°C, whilst being tilted for a period ranging from some hours to overnight. <br><br>
In order to saturate non-specific binding sites for DNA on the nitrocellulose filters, these filters were incubated for 1-12 hours at 37°C in the prehybridising 25 solution which had earlier been degassed ijn vacuo. <br><br>
The radioactively labelled DNAs used for hybridisation g <br><br>
(about 1 x 10 cpm/mcg) were added to the required quantity of degassed hybridising solution which 30 was preheated to 37°C. In order to keep the concentration of the DNA probe as high as possible in the hybridising solution, only just enough hybridising liquid to keep the filters just covered with liquid was used. Hybridisation lasted for 12-18 hours at 37°C. <br><br>
35 <br><br>
The nitrocellulose filters were then rinsed three times in 6xSSC and 0.05% SDS (4°C) by the method of <br><br>
o <br><br>
- 57 - <br><br>
22 3 8 <br><br>
I <br><br>
Wood et al., (Proc. Natl. Acad. Sci. Vol 82, 1585-1588, 1985) and similarly washed at 4°C for 2x30 rain. The filters were then rinsed three times at room temperature (RT) in a freshly prepared solution ^ 5 containing 3M tetramethylammonium chloride (Me4NCl), <br><br>
50 mM Tris-HCl pH 8, 2 mM EDTA and 0.05% SDS, washed 2x30 min at RT and finally washed 3x30 min at 49°C (oligonucleotide mixture a)) or at 52°C (oligonucleotide mixture b)) , dried in air (oligonucleotide mixture b)) <br><br>
/"""X <br><br>
10 and stuck to paper. X-ray films were exposed for 2-8 days at -70°C using an "intensifying screen". <br><br>
Example 4. Plaque purification <br><br>
15 Since no individual plaques could be isolated in the first search, with the high density of plaques used, the recombinant lambda phage were purified by several successive searches whilst the plaque density was simultaneously reduced. After development 20 of the autoradiograms, regions were isolated from the agar plate (of 3 primary screenings carried out, of 28 regions, 2 were positive, of 35 regions 1 was positive and of 15 regions 5 were positive), <br><br>
which yielded a positive hybridising signal on the 25 two nitrocellulose filters which had been hybridised in duplicate. The desired site was pricked out of the agar using the sharp end of a sterile Pasteur pipette and transferred into 0.3-0.6 ml of lambda buffer (100 mM Tris-HCl pH 7.5, 10 mM MgCl0 and 30 1 mM EDTA). However, SM buffer may also be used (Maniatis T., Molecular Cloning, 1982, page 70). <br><br>
After the addition of one drop of chloroform, the phages were left to diffuse out of the agar overnight at 4°C and each individual phage suspension was 35 plated out again in several dilutions. Another nitrocellulose filter was prepared from plates having 300-100 plaques and this extract was then hybridised <br><br>
58 - <br><br>
22 386 <br><br>
against both DNA probes. This procedure was repeated, <br><br>
and individual plaques were followed up, until all the plaques on a plate gave a positive hybridisation signal. <br><br>
Example 5. Analysis of the phage clones obtained a. Titration of X-phaqe <br><br>
10 The phage suspensions were diluted with lambda buffer in dilution steps of 1:10, mixed by tilting several times, and plated out. After incubation at 37°C the plaques formed on the bacterial lawn were counted and the titre (plaque forming units 15 (pfu)) was determined. The titre for the purified phage suspensions was 2.2-8.6 x 10 1,0 pfu/ml. <br><br>
b. Preparation of lambda phage DNA <br><br>
20 After isolation and titration of the inherently homogeneous phage clones, they were plated in a density of 2 x 10® pfu/13.5 cm of Petridish (with culture medium of composition: 1.5% agarose, 10 g/1 tryptone, 5 g/1 yeast extract, 5 g/1 NaCl, 25 10 mM MgSO^, and 0.2% glucose) with 200 mcl of C600 Mg cells (4 ODggg), incubated for 5 hours at 37°C and then cooled to 4°C. Elution of the phage was effected by covering the plates with 8 ml of lambda buffer and a few drops of chloroform 30 and tilting gently at 4°C overnight. The supernatant purified by centrifuging (15000 rpm, 15 min, 4°C) was finally removed and the phage were pelleted by centrifuging at 50000 rpm (Beckman Ti50 rotor) for 30 min at RT. After the addition of 500 mcl 35 of lambda buffer and incubation with ribonuclease A (RNase A, 10 mcg/ml) and deoxyribonuclease (DNase, 1 mcg/ml), for 30 min at 37°C, the salt concentration <br><br>
- 59 - <br><br>
22 3 8 6 <br><br>
was increased by the addition of 25 mcl of 0.5M EDTA, 12 mcl of 1M Tris-HCl pH 8.0 and 6.5 mcl of 20% SDS and the enzymes present were deactivated by incubating at 70°C for 15 min. After extracting ^3) 5 once with phenol and twice with chloroform/isoamyl alcohol (24:1) in equal volumes the DNA was precipitated by the addition of 0.1 vol. 3 M sodium acetate, pH 5.2, and 2 vol. of alcohol, then centrifuged off, washed with 70% alcohol, dried and taken up ^3 10 in 50 mcl of TE buffer. <br><br>
c. Restriction analysis <br><br>
2 mcl of DNA solution were incubated with 5 units 15 of EcoRI in HIGH buffer for 2 hours at 37°C, the fragments obtained were separated on a 1% agarose gel (T. Maniatis et al., 1982, pl49ff) under a voltage of 1-5 volts per cm, the fragments with lengths ranging from 500 to 1000 base pairs were 20 eluted from the gel (G.M. Dretzen et al., Anal. <br><br>
Biochem. 112, 295-298, 1981) and finally subjected to sequence analysis. <br><br>
d. Sequence analysis <br><br>
25 <br><br>
Subcloning of the restriction fragment into a vector (Bluescribe M13+ or M13-, Vector Cloning Systems (C. Yanisch-Perron et al., Gene 33, 103-119, 1985)) suitable for sequence determination according to 30 Sanger (F. Sanger et al., Proc.Natl. Acad.Sci. <br><br>
74, 5463-5467, 1977; F. Sanger et al., FEBS-Letters 87, 107-111, 1978) was carried out by the usual methods for effecting the restriction and ligation of DNA fragments and transformation of E. coli 35 host cells (T. Maniatis et al., 1982, Molecular Cloning, Cold Spring Harbor Press, pl04, 146ff, 396; DNA-Cloning, IRL-Press 1985, Vol. 1, chapter <br><br>
n o <br><br>
22 3 8 6 9 <br><br>
- 60 - <br><br>
6). In this way 100 ng of isolated EcoRI-cDNA fragments were inserted, via EcoRI sites, into the correspondingly prepared dsDNA form (replicative form, 50 ng) of the vector (by incubation for 2 5 to 12 hours at 14°C in 10 mcl of ligation solution) and with this recombinant construction (entitled BS3, BS5, BS8, BS9, BS12, BS13, BSXIII) competent E. coli cells (strain JM 101) were transformed. The single strand DNA of the recombinant phages ^ 10 was isolated and sequenced according to Sanger. <br><br>
The sequences read were processed using suitable computer programmes (R. Staden, Nucl. Acid. Res. 10, 4731-4751, 1982). The isolated clone 8 (BS8) contains the coding sequence from amino acid 22 15 of the mature enzyme (Pig. 1). <br><br>
Example 6. Construction of an expression cassette <br><br>
In order to express the hMn-SOD in yeast, it is 20 necessary to complete the isolated cDNA and to construct an expression cassette, the ADHI promoter being used in its original length (about 1500 bp, Methods in Enzymology, Vol. 101, Part C, 192-201, ^ 1983) or in shortened form (ADHIk, about 400 bp), <br><br>
25 and the ADHII terminator (Dr. R. Beier and E.T. <br><br>
Young, Nature 300, 724-728, 1982). <br><br>
a. Completion of the gene <br><br>
30 In order to complete the gene according to the reported amino acid sequence (D. Barra et al., <br><br>
J. Biol. Chem. 259, 12595-12601, 1984), since the isolated cDNA clone 8 lacks the bases corresponding to the 21 amino acids (AA) at the N terminus, and 35 taking into account the yeast codon selection (P.M. Sharp et al., Nucl. Acids.Res. 14, 5125-5143, 1986), two pairs of oligonucleotides were constructed <br><br>
O 22 386 9 <br><br>
- 61 - <br><br>
and synthesised (381A DNA synthesiser, Applied Biosystems) as the Xhol-Xbal fragment (OPl, corresponding to formula Via) or the Xbal-Ncol fragment (0P2, corresponding to formula VIb). OPl was inserted (3 5 via Xhol/Xbal into the plasmid V17 (obtained from pUC18 (J. Vieira and J. Messing, Gene 19, 259, <br><br>
1982) after HincII restriction and insertion of Xhol linkers (New England Biolabs, d(CCTCGAGG)) <br><br>
and Smal restriction of the resulting plasmid pES102 10 with subsequent insertion of Ncol linkers (New England Biolabs, d(CCCATGGG)) (Fig. 2), whilst OP2 was inserted via Xbal/Ncol. <br><br>
In order to do this, 4 meg of V17 DNA were digested 15 with 10 units of Xbal and Ncol or Xhol and Xbal in 40 mcl of CORE buffer for 2 hours at 37°C and purified by gel electrophoresis (0.7% agarose, <br><br>
see above). 5 mcl portions of the synthesised single strands of OPl or 0P2 (10 pM/mcl in each 20 case) were mixed together, incubated for 10 minutes at 65°C and slowly cooled to RT. 1/10 thereof was ligated with 50 ng of doubly cut vector (Xhol/Xbal for OPl and Xbal/Ncol for 0P2) under the conditions described above (plasmids HS0D2 and HS0D3, Fig. 2) . <br><br>
25 Finally, HSOD2 and HSOD3 were combined to form plasmid HSOD4 via Scal/Xbal (i.e. after double digestion with Seal and Xbal in CORE buffer for 2 hours at 37°C) after purification and isolation ^ of the cut vectors by gel electrophoresis and ligation <br><br>
30 under the conditions described above (cloning of the oligo pairs OPl and OP2) (Figs. 2, 3). This plasmid HSOD4 was prepared to receive the Thal/EcoRI cDNA fragment by Ncol restriction, followed by Klenow fill-in and EcoRI restriction: 5 meg of 35 DNA were incubated for several hours at 37°C in 50 mcl of HIGH buffer with 18 units of Ncol, the cut DNA was purified by gel electrophoresis, then isolated and half of it was incubated in 30 mcl <br><br>
- 62 - <br><br>
22 3 8 6 9 <br><br>
of Klenow reaction solution for 1 hour at RT. <br><br>
After the reaction had been ended by the addition of 2 mcl of 0.5 M EDTA and the reaction solution had been incubated at 70°C for 10 minutes the DNA was purified by gel electrophoresis, isolated and re-cut with 7.5 units of EcoRI in 20 mcl of HIGH buffer, purified again and isolated. (Fig. 5) <br><br>
The Thal/EcoRI cDNA fragment was prepared as follows: <br><br>
Competent E. coli host cells (strain JM 101) were transformed with the plasmid BS8 which contains the isolated cDNA clone 8 (see above) and the plasmid was prepared under suitable conditions (T. Maniatis et al., 1982, page 368). <br><br>
After restriction with Thai (10 meg of plasmid were digested in 40 mcl of Thai buffer with 25 units of Thai for 8 hours at 60°C), recutting the 759 bp Thai fragment with EcoRI (see above), followed by purification by gel electrophoresis and isolation of the corresponding fragment, the Thal/EcoRI fragment thus obtained (Fig. 4) was combined with the correspondingly prepared plasmid HSOD4 to form HSOD6 (Fig. 5) (about 100 ng of fragment were ligated with 50 ng of cut vector in 10 mcl of ligation solution (see above)). Plasmid HS0D6 thus contains the complete cDNA for hMn-SOD including Met. The reading frame is retained. <br><br>
b. Construction of the expression cassette <br><br>
Plasmid HSOD6 was doubly digested with Xhol and EcoRI (5 units/meg of DNA) in CORE buffer, the Xhol fragment (gene) was isolated and inserted into the plasmid PKHl or PKH2 via XhoI/EcoRI. The plasmids PKHl and PKH2 were prepared as follows <br><br>
i 1 <br><br>
22 3 8 6 <br><br>
- 63 - <br><br>
(Figs. 6, 7, 8) : after Smal restriction (1 meg of plasmid was digested with 5 units of Smal in Smal buffer for 2 hours at 37®C), purification and isolation, Bglll linkers were inserted in plasmid 5 PES 103, which contains the ADHI promoter as a 1500 bp BamHI-XhoI fragment in PES 102 (PES 102 is a pUC18 derivative which contains in the HincII cutting site an Xhol linker, the construction of the BamHI-XhoI fragment being described in "Methods 10 in Enzymology" 101, 192-201) (T. Maniatis et al., <br><br>
1982, page 396) . The plasmid thus obtained (P154/1, Fig. 6) was converted into plasmid 154/2 by EcoRI restriction (see above), Klenow fill-in (see above) and religation (1 meg of DNA was incubated in 40 mcl 15 of ligation solution (see above) overnight at 14°C) (Fig. 6). <br><br>
Also starting from plasmid pES103, the linker -Xhol.EcoRI. Xbal.Hindlll- (Fig. 7, synthesised using a 381A 20 DNA synthesiser) was inserted after double digestion with Xhol and Hindlll in CORE buffer. This linker contains the sequence <br><br>
TCGAGGAATTCTCTAGAA 25 CCTTAAGAGATCTTTCGA. <br><br>
The ADHII terminator was inserted in the resulting plasmid 150/1 via Xbal/Hindlll (double digestion in CORE buffer) (plasmid 150/2 (Fig. 7)). The 30 ADHII terminator was obtained as follows: plasmid pMW5 ADHII (Washington Research Foundation) was digested with Hindlll (CORE buffer) then with SphI (in SphI buffer) and the isolated 605 bp fragment was cloned into the vector V18 and an Xbal linker 35 (Biolabs, CTCTAGAG) was incorporated in the HincII cutting site (for ligation see above). A 335 bp long Xbal/SphI fragment was ligated into pUC18 <br><br>
22 3 3 6 0 <br><br>
- 64 <br><br>
(Xbal/SphI) (pGD2). <br><br>
The vector V18 was obtained by incorporating a Hindlll linker in pUC18 in the Smal site and the 5 Hindlll site is missing from its original location, so that the multicloning site in V18 runs as follows; EcoRI.SstI.Kpnl.HindiII.BamHI.Xbal.Sail.PstI.SphI <br><br>
Finally, after double digestion with Xbal/Hindlll C 10 in CORE buffer the ADHII terminator was isolated by the usual methods (see above). Plasmid 150/2 j thus contains the units necessary for gene expression, <br><br>
apart from the gene which is to be inserted via XhoI/EcoRI, namely approximately 1500 bp (promoter), 15 7 bp (Xhol linker), 6 bp (EcoRI linker), 7 bp (Xbal i <br><br>
| linker), 329 bp (terminator). These units were <br><br>
^ then inserted into the vector 154/2 (Fig. 8) via <br><br>
BamHI/Hindlll (double digestion in CORE buffer). <br><br>
In the resulting plasmid PKHl (Fig. 8) the ADHI 20 promoter was analogously replaced by the shortened promoter ADHIk as the BamHI/XhoI fragment (412 bp) | (PKH2, Fig. 9). <br><br>
I <br><br>
- T&k. <br><br>
Finally, the complete cDNA gene (see above) cut out of HSOD6 was inserted into both plasmids via XhoI/EcoRI (see above). The resulting plasmids HSOD7/1 and HSOD7/2 (Fig. 9 shows only HSOD7/2) <br><br>
differ from one another only in the different promoters ADHI and ADHIk (see above). The expression cassettes thus prepared were inserted into the correspondingly prepared and freely obtainable yeast transformation vectors YEpl3 (J.R. Broach et al.. Gene £}, 121-133, 1979, ATCC 37115), pJDB207 (DSM 3181, deposited on 28.12.84), pEAS102 (see above), YIp5 (K. Struhl et al., Proc. Natl. Acad. Sci. USA 7j5, 1035-1039, 1979, ATCC 37061) via the cutting sites BamHI and Hindlll, via Bglll/Hindlll (after double digestion <br><br>
25 <br><br>
30 <br><br>
35 <br><br>
V •i. <br><br>
w <br><br>
65 - <br><br>
22 <br><br>
8 69 <br><br>
of the plasmids in CORE buffer and isolation of the expression cassettes excised). <br><br>
Example 7. preparation of a yeast Mn-SOD mutant 5 suitable for expression <br><br>
The gene for yeast Mn-SOD (A.P.G.M. van Loon et al., Gene 26, 261-272, 1983) is contained as a BamHI fragment in the vector PL 41 (Fig. 10) and 10 the sequence has been published in full (C.A.M. <br><br>
Marres et al., Eur.J.Biochem. 147, 153 - 161, 1985). <br><br>
After restriction with BamHI (2 meg plasmid were digested with 5 units in 150 mM NaCl, 6 mM Tris-HCl pH 7.9, 6 mM MgClj, 100 mcg/mcl bovine serum 15 albumin for 2 hours at 36°C) the 2045 bp long BamHI fragment which contains the gene was purified as usual by gel electrophoresis and isolated and subcloned via BamHI into the vector VO (pUCl8, but with no Hindlll cutting site). <br><br>
20 <br><br>
The vector VO was obtained by cutting 1 meg of pUCl8 with Hindlll (CORE buffer), isolating the linearised fragment from the gel by known methods, 0^ filling in the projecting ends with 2 U Klenow polymerase <br><br>
25 (ligase buffer + 0.2 mM dNTP) and religating after 30 minutes at RT by the addition of 2 U T4-DNA ligase overnight at 14°C. <br><br>
The plasmid S0DY1 (Fig. 10) was purified by Nrul 30 restriction (1 meg of plasmid were digested with 5 units of Nrul in Nrul buffer for 2 hours at 36°C) by gel electrophoresis and changed to SODY3 (Fig. 10) by the insertion of a Hindlll linker (CAAGCTTG) (Fig. 10). Finally, the URA3 gene (obtained from 35 pURA3) was inserted into the Hindlll cutting site: <br><br>
4 meg of S0DY3 were digested with 20 units of Hindlll for 2 hours at 37°C in CORE buffer and dephosphorylated: <br><br>
22 <br><br>
3 3 t <br><br>
Cr <br><br>
- 66 - <br><br>
40 mcl of HjO, 10 mcl of 1 mM EDTA, 5 mcl of 1M Tris-HCl pH 9.5, 1 mcl of 100 mM spermidine, 1 mcl of calf intestinal alkaline phosphatase (CIAP, <br><br>
1 mg/ml H20) were added to 40 mcl of digestion 5 mixture and the whole was incubated at 36°C. After 15 minutes, a further 1 mcl of CIAP were added and the mixture was incubated for another 15 minutes. The dephosphorylated vector was also purified by agarose gel electrophoresis. 2 meg of plasmid 10 pURA3 were cut with Hindlll (see above) and a 1.2 kb fragment which contains the yeast gene URA3 was also isolated and inserted into the prepared vector (see above). <br><br>
15 The resulting plasmids S0DY7 and SODY8 contain the URA3 gene within the yeast Mn-SOD gene and differ in the orientation of the URA gene relative to the Mn-SOD gene (Fig. 10) . <br><br>
20 The orientation of the URA3 gene relative to the Mn-SOD gene can be determined, since the URA3 gene contains an asymmetric PstI site. <br><br>
A "gene transplacement" was carried out (Methods 25 in Enzymology 101, 202-211 and 211-228) with the plasmid SODY7 and S0DY8 in the strain DBY 747 (genotype a, leu2, his3, trpl, ura3, Yeast Genetic Stock Centre, Berkeley). The strain DBY 747 was transformed with the BamHI fragment from SODY7 and S0DY8 (J.D. 30 Beggs, Nature 275, 104, 1978). To do this, 20 meg of SODY7 or SODY8 were cut with 50 U BamHI in 200 mcl of BamHI buffer (150 mM NaCl, 6 mM Tris-HCl pH 7.9, 6 mM MgCl2, 1 mM DTT) and the entire digestion mixture (without separating off the pUC portion) 35 was extracted with phenol (Maniatis, T. et al.. <br><br>
Molecular Cloning, 1982, page 458ff) and concentrated by ethanol precipitation (addition of 20 mcl of <br><br>
22 5 <br><br>
- 67 - <br><br>
3 M sodium acetate pH 5.5, 500 mcl of ethanol). <br><br>
The DNA was taken up in 10 mcl of water and used directly for the transformation of yeast. <br><br>
The transformants were selected for uracil prototrophy. <br><br>
Individual transformants were cultivated overnight in 5 ml of SC-URA medium at 28°C. The cells were harvested by centrifuging, lysed by the method of van Loon et al. (Proc.Natl.Acad.Sci. USA 83, 3820-3824, 1986) and tested for their content of Mn-SOD. The measurement of Mn-SOD and Cu/Zn-SOD by gel electrophoresis were carried out by existing methods (Ch. Beauchamp and I. Fridovich, Anal. <br><br>
Biochem. 4j4, 276-287, 1971; H.P. Misra and I. <br><br>
Fridovich, Arch.Biochem.Biophys. 183, 511-515, <br><br>
1977; B.J. Davis, Ann. NY Acad. Sci. Vol. 121, <br><br>
404-427, 1964). The method which proved best was the separation of the proteins followed by negative staining with nitroblue tetrazolium (B.J. Davis, 1964; Ch. Beauchamp and I. Fridovich, 1971). It is possible to increase the sensitivity by staining with dianisidine (H.P. Misra and I. Fridovich, 1977). A spectrophotometric assay (Hyland, K. <br><br>
et al., Anal. Biochem. 135. 280-287, 1983) with alkaline dimethylsulphoxide as the Oj- generating system and with cytochrome c as "scavenger". <br><br>
Mn-SOD on the one hand and Cu/Zn-SOD on the other hand are distinguished by the addition of KCN (see above and M. Ysebaert-Vanneste and W.H. Vanneste, Anal.Biochem. 107, 86-95, 1980). The strains SODY7/2, SODY7/6, SODY7/8 and SODY7/10 contained no Mn-SOD activity. <br><br>
1 <br><br>
{far o <br><br>
C5 <br><br>
10 <br><br>
22 38 <br><br>
- 68 - <br><br>
Example 8. preparation of the expression vectors <br><br>
The expression cassettes described in Example 6b were cut out of the plasmids HSOD7/1 and HSOD7/2, respectively, as Bglll/Hindlll fragments (in each case, 2 meg of plasmid DNA in the CORE buffer, 2 hours at 37#C with 10 U of enzyme). Similarly, 1 meg of YEpl3, pJDB207 and pEAS102 were each cut with Hindlll-BamHI (digestion conditions as described above). <br><br>
50 meg of vector DNA and 200 meg of insert were ligated in ligase buffer (as described) with 1 U ligase overnight at 14°C and used to transform the E. coli strain HB101. The following Table contains 15 the names of the corresponding plasmids. <br><br>
Table 1: Names of the expression vectors <br><br>
Vector Insert: HS0D7/1 HSOP7/2 <br><br>
20 <br><br>
YEpl3 PWS550A pWS37lA <br><br>
PJDB207 PWS490A pWS372A <br><br>
PEAS102 PWS491A pWS373A <br><br>
25 Example 9. Preparation of a yeast strain (WS30-5g) suitable for transformation <br><br>
A yeast strain was prepared which contains, in addition to the genetic markers described for the 30 yeast strain SODY7/2, a mutation in one of the lysosomal chief proteases (which can activate other lysosomal proteases by their activity) and thus releases fewer proteases when the yeast cells are broken up (mutation pep4) (E.W. Jones et al., Genetics 35 102, 665-677, 1982). <br><br>
The Mn-SOD-deficient strain SODY7/2 was crossed with the <br><br>
cs <br><br>
© <br><br>
o <br><br>
2* <br><br>
3S$ <br><br>
t - 69 - <br><br>
£ <br><br>
| protease-deficient strain WS20-25 (o leu2 his3 trpl ura3 <br><br>
p i pep4) and the resulting haploids were investigated for <br><br>
5 their genetic markers (P. Sherman et al.. Methods in i <br><br>
Yeast Genetics, Cold Spring Harbor, N.Y., 1972). <br><br>
** <br><br>
The resulting strain WS30-5g (leu2 his3 trpl pep4 sodl) is readily transformable and fulfils the 1 desired conditions. <br><br>
10 Such crossing may also be carried out with equally good results with other well known and easily obtainable yeast strains, for example with 20 B-12 (Yeast Genetic Stock Center, Berkeley). <br><br>
15 Example 10. Yeast transformation and expression in yeast <br><br>
The yeast strain SODY7/2 was transformed with the plasmids pWS37lA, pWS372A and pWS373A (J.D. Beggs, 20 Nature 275, 104-109, 1978) and the transformants were investigated for their expression. <br><br>
To achieve this, a pre-culture of the transformants was prepared in SC-LEU liquid medium (analogous 25 to the SC-URA medium described, except that it additionally contains 2.4 g of uracil but no leucine) (shaking at 300 rpm at 28°C overnight). 100 mcl thereof were inoculated into 4 ml of YP5%D (1% <br><br>
Bacto yeast extract, 2% Bacto peptone, 5% glucose) 30 and cultivated overnight (like the pre-culture). <br><br>
The cells were harvested and lysed as already described in Example 7. The quantity of crude extract corresponding to 1 ml of culture was transferred to the activity gel. The activity test was carried out as described 35 in Example 7. <br><br>
The yeast strain WS30-5g (leu2 his3 trpl pep4 sodl) <br><br>
- 70 - <br><br>
22 3 8 6 9 <br><br>
was transformed with the plasmids pWS550A/ pWS490A/ <br><br>
pws4yia. The preparation of' the pre-culture and culture and the measurement of the hMn-SOD activity were carried out as described above. <br><br>
The expression of the plasmids PWS490A, pWS491A in yeast strain WS30-5g is documented by Fig. 11. <br><br>
O <br><br>
The quantity of MnSOD measured in the yeast under these conditions corresponded to approximately 0.5 mg/litre of culture. <br><br>
Example 11. Synthesis of a linker containing the yeast leader DNA sequence i <br><br>
Six different oligonucleotides EBI 656/ EBI 636, EBI 643/ EBI 646/ ESI 660 and EBI 638 of the following sequenoes and lengths ebi 656: <br><br>
5' 3 <br><br>
tcgactatacaatgttcgcgaaaacagctqcagctaattta <br><br>
41bp <br><br>
EBI 636: <br><br>
5' 3' <br><br>
tcttggttaaattagctgcagctgttttcgcgaacattgtatac <br><br>
44bp edi 643: <br><br>
5' 3 <br><br>
accaagaagggtggtttgtcattgctctccaccacagcaaggagaacc 4 8 bp ebi 64$: <br><br>
5' 3 <br><br>
agtgcttggttctccttgctgtggtggagagcaatgacaaaccaccct 4 8 bp <br><br>
EBI 660: <br><br>
5' 3* <br><br>
aagcactctttgccagacttgccatacgactacggtgct <br><br>
39bp <br><br>
EBI 638: <br><br>
5' 3 " <br><br>
ctagagcaccgtagtcgtatggcaagtctggcaaag <br><br>
36bp <br><br>
o <br><br>
22 38 <br><br>
- 71 - <br><br>
were prepared using a 381 A DNA synthesiser (Applied Biosystems), as described in 3b. <br><br>
The oligonucleotides EBI 636, EBI 643, EBI 646 5 and EBI 660 were phosphorylated for the subsequent ligase reaction at their 5* ends under the following conditions: <br><br>
Reaction mixture No. 1 2 mcl EBI 636 (=100pmol) 10 1 mcl 10 x linker kinase buffer <br><br>
3 mcl lOmM ATP <br><br>
1 mcl T4 polynucleotide kinase, Biolabs lOU/mcl <br><br>
3 mcl of water <br><br>
15 <br><br>
Reaction mixture No. 2 Analogous to No. 1 but with <br><br>
2 mcl (100 pmol) of EBI 660 <br><br>
Reaction mixture No. 3 2 mcl oligonucleotide EBI 643 20 (=100 pmol) <br><br>
2 mcl oligonucleotide EBI 646 (=100 pmol) <br><br>
1 mcl 10 x linker kinase buffer <br><br>
3 mcl 10mM ATP <br><br>
25 1 mcl T4 polynucleotide kinase (10 units) <br><br>
1 mcl water <br><br>
10 x linker kinase 0.7 M Tris-HCl pH 7.6 30 buffer: 0.1M MgCl2 <br><br>
0.05M DTT (dithiothreitol) <br><br>
35 <br><br>
The reaction lasted 30 minutes at 37°C. The T4 polynucleotide kinase was then deactivated by heating to 100°C. <br><br>
o o <br><br>
22 38 6 j <br><br>
- 72 - <br><br>
| The oligonucleotides EBI 656 and EBI 638 which <br><br>
I are intended to form the 5' ends of the finished <br><br>
5 128bp long DNA insert (formula XI) were not phosphorylated, <br><br>
1 in order to avoid the formation of multimeric DNA <br><br>
5 inserts in the subsequent ligase reaction. <br><br>
A composition of the desired linkers from the individual oligonucleotides was achieved according to the following plan: <br><br>
10 <br><br>
EBI656 P EBI643 P EBI660 <br><br>
EBI636 P EBI646 P EBI638 <br><br>
! 15 2 mcl (=100pmol) of EBI656 were added to reaction <br><br>
! mixture No. 1 and 2 mcl of EBI 638 (=100pmol) were i <br><br>
| added to reaction mixture No. 2 for the annealing <br><br>
| reaction (hybridisation of the complementary oligo- <br><br>
! nucleotides with each other). Reaction mixture <br><br>
20 No. 3 already contains 2 complementary oligonucleotides (EBI 643, EBI 646). All 3 reaction mixtures were heated to 100°C for 2 minutes and slowly cooled in a water bath. <br><br>
25 The short double-stranded DNA fragments produced in reactions Nos. 1 to 3 were ligated together as follows: <br><br>
10 mcl of reaction mixture No. 1 (EBI 636 + EBI 656) 30 10 mcl of " No. 2 (EBI 660 + EBI 638) <br><br>
10 mcl of " No. 3 (EBI 643 + EBI 646) <br><br>
3 mcl 10 mM ATP <br><br>
1 mcl DNA ligase, Boehringer Mannheim, 7 Units/mcl The reaction lasted for 15 hours at 4°C. <br><br>
35 <br><br>
The DNA was separated according to size on 1% agarose gel and the desired DNA fragment of formula XI <br><br>
t <br><br>
| W ^ ^ 0 w Q <br><br>
J <br><br>
C <br><br>
u <br><br>
- 73 - <br><br>
| 128 bp long was eluted from the gel (G.M. Dretzen <br><br>
! et al., Anal. Biochem. 112. 295-298, 1981). <br><br>
O Example 12. Construction of the expression vectors <br><br>
5 containing the leader DNA sequence <br><br>
Plasmid HS0D6 was doubly digested with Xhol and Xbal (5 units/meg of DNA) in CORE buffer in the usual way and the 128 bp long linker (Xhol - mitochondrial 10 leader - Xbal) was inserted therein by known methods (pE022-A). The hMn-SOD gene now provided with the mitochrondrial yeast leader DNA sequence was doubly digested with Xhol - EcoRI (5 units per meg of DNA) in the CORE buffer and inserted via 15 Xhol - EcoRI, in pKHl (Example 6b, Fig. 8) (pE023-A). <br><br>
The expression cassette thus prepared was inserted, analogously to Example 8, via Bglll/Hindlll (after double digestion of the plasmids in CORE buffer i 20 and isolation of the expression cassette cut out) <br><br>
into the correspondingly prepared yeast transformation vector YEpl3, pJDB207 and pEAS102 via the cutting ^ sites BamHI and Hindlll. Table II which follows <br><br>
W denotes the plasmids thus obtained. <br><br>
25 <br><br>
Table 2: Titles of the expression vectors <br><br>
Vector Name of plasmid <br><br>
30 pJDB207 PE024-AB <br><br>
PEAS102 PE025-AC <br><br>
YEpl3 PE026-AD <br><br>
Example 13. Yeast transformation and expression 35 in yeast <br><br>
The yeast strain WS30-5g (Example 9) was transformed <br><br>
■ m 22 3 8 6 g <br><br>
- 74 - <br><br>
with the plasmids listed in Table 2 and the transformants were tested for their expression (Example 10). <br><br>
For fermentation of the transformed yeast strain O 5 WS30 -5g a pre-culture having the following composition was cultivated with a magnetic stirrer and with aeration, until an optical density = 0.01 <br><br>
was achieved: 6.7 g/1 yeast nitrogen base w/o amino acids (Difco), 10 g/1 glucose, 0.16 g/1 arginine, (3 10 0.25 g/1 lysine, 0.06 g/1 tryptophan, 0.08 g/1 <br><br>
methionine, 0.03 g/1 cysteine, 0.10 g/1 histidine, 0.16 g/1 tyrosine, 0.17 g/1 phenylalanine, 0.16 g/1 threonine, 0.18 g/1 isoleucine, 0.21 g/1 valine, 0.40 g/1 glutamic acid, 0.21 g/1 glycine, 0.02 g/1 15 of cystine, 0.15 g/1 alanine, 0.20 g/1 asparaginic acid, 0.20 g/1 proline, 0.15 g/1 serine, 0.10 g/1 asparagine, 0.20 g/1 glutamine, 25 mg/1 adenine, <br><br>
50 mg/1 uracil. <br><br>
20 The subsequent main culture having the composition: 8.0 g/1 (NH4)2 S04, 2.56 g/1 (NH4)2HP04, 1.16 g/1 KC1, 0.60 g/1 MgS04 . 7 H20, 0.56 g/1 CaCl2 . 2H20, <br><br>
0.04 mg/1 biotin, 80 mg/1 m-inositol, 40 mg/1 Ca-pantothenate, 8 mg/1 thiamine, 2 mg/1 pyridoxine, <br><br>
25 3.1 mg/1 CuSC>4 . 5 H20, 19 mg/1 FeCl3.6 H20, 12 mg/1 ZnS04.7 H20, 14 mg/1 MnS04.H20, 5 mg/1 H3BC>3, 1 mg/1 KI, 2 mg/1 Na2 Mo04.2 H20, 1 g/1 yeast extract, <br><br>
0.2 g/1 uracil, 0.1 g/1 adenine, 0.5 g/1 citric (^) acid, 15 g/1 glutamic acid, 0.2 g/1 histidine, <br><br>
30 0.5 g/1 tryptophan, 100 g/1 glucose was produced in the 201 fermenter (CHEMAP). For this purpose, <br><br>
5% of the quantity of pre-culture was used as the inoculum and cultivation was effected with stirring (1000 rpm), aeration (0.5 vvm) and at a constant 35 pH (5.0) at 28°C in a 201 fermenter. <br><br>
ft i <br><br>
o <br><br>
22 3 8 6 9 <br><br>
- 75 - <br><br>
| After the glucose content had fallen to 50 g/1, <br><br>
| a further 50 g/1 of glucose were added and fermentation <br><br>
\ was continued until the glucose content was 10 g/1 <br><br>
\ (which happened after 45 hours). The fermentation <br><br>
» _ <br><br>
; O 5 li<3uor was then cooled, centrifuged and the biomass was frozen. The yield of biomass was 18 g/1 of <br><br>
• the wet cell weight. <br><br>
The expression of the plasmid pE024-AB, pE025-AC 10 and pE026-AD in yeast strain WS30-5g is documented in Fig. 12. <br><br>
" i j Example 14. Yeast mitochondria preparation <br><br>
- ] <br><br>
' f <br><br>
• 15 In order to determine whether the insertion of <br><br>
I <br><br>
j the yeast mitochrondrial leader sequence before the hMn-SOD gene causes the protein to be imported j into the mitochondria, yeast mitochondria were <br><br>
' prepared and the Mn-SOD activity in the mitochondria <br><br>
-j 20 and in the cytoplasm was analysed. <br><br>
V. <br><br>
Yeast mitochondria were prepared by a modified form of the method of G. Daum et al., Journal Biol. Chem., 257, 13028-13033, 1982. A pre-culture of 25 the transformants in SC-LEU liquid medium (Example 10) was cultivated by shaking (300 rpm) at 28°C overnight. 25 ml were inoculated into 225 ml of YPD medium and cultivated overnight, like the pre-culture. "*i"S The cells were generally measured at an optical <br><br>
30 density of 5-7 at 600 nm and harvested by centrifuging (Sorval, 6500 rpm, 5 min.). The cells were washed once with 100 ml of water. The cell pellet was suspended in 1 M mannitol, 20 mM KPi (KH2P04/K2HP04) pH 7.4 (1 ml per 300 mg of cell weight) and 1 mg/ml 35 of zymolase (Miles, MW 500) was added. Spheroplasts were produced by slowly shaking for 2 hours (50 rpm) at 28°C. <br><br>
iwnkwi1. <br><br>
o <br><br>
22 3 8 6 0 <br><br>
I - 76 - <br><br>
The spheroplasts were harvested by centrifuging (3000 rpm, 5 min./ Hereaus Christ Bench Centrifuge) and washed once with 1 M mannitol, 20 mM KP^ pH 7.4/ 1 mM PMSP (phenylmethylsulphonylfluoride). 5 The supernatant was discarded and 1 to 2 pellet volumes of glass beads (diameter 0.1 mm) were added. <br><br>
The cells were lysed by stirring for 1 minute and suspended in 2.5 ml of 0.65 M mannitol/ 1 mM 10 EDTA/ 1 mM PMSP. Whole cells and cell debris were w <br><br>
centrifuged at 2000 rpm for 5 minutes (Hereaus Christ Bench Centrifuge). The mitochondria were then obtained from the supernatant by centrifuging (Sorval, J-21, 12000 rpm/ 10 min.). The supernatant 15 contains the cytoplasm and was removed in order to be investigated later for hMn-SOD activity. The reddish-brown mitochondrial pellet was washed with the above-mentioned buffer (white cytoplasmic constituents were rinsed away) and the mitochondria 20 were suspended in 2.5 ml of the same buffer. Any impurities were removed by centrifuging again (Hereaus Christ, Bench Centrifuge, 4000 rpm, 5 min.) and the mitochondria were pelleted from the supernatant in a second centrifugation (Sorval J-21, 12000 rpm, 25 10 min.). The mitochondria were lysed with glass beads, in a manner similar to the method for lysing yeast cells (van Loon et al., Proc.Natl. Acad.Sci. USA j}3, 3820-3824/ 1986) and tested for their content of Mn-SOD in activity gel (Fig. 13). <br><br>
30 <br><br>
Example 15. Purification of the hMn-SOD according to the invention <br><br>
The recombinant hMn-SOD was isolated from the strain 35 WS30-5g/pE024-AB (yeast vector pJDB207) via several steps. <br><br>
• a 22 3869 <br><br>
- 77 - <br><br>
Step Is Cell disintegration <br><br>
The cell mass (Example 13) was washed in 10 ml of distilled water per gram of wet weight and centrifuged (3 5 for 15 minutes at 16000 x g. The precipitate was resuspended in Na, K-phosphate buffer (50 mM, pH 7.0) in the ratio 1:3 (w/v). The cells were then lysed in a continuously operating cell mill (Dynomill KDL; Bachofer, Basel, Switzerland; 0.6 1 grinding 10 container, water-cooled) using glass beads (0.1 mm in diameter) at a flow rate of 6 litres per hour. <br><br>
The cell extract was centrifuged for 15 minutes (16000 x g, 4°C) and the precipitate was discarded. <br><br>
15 Step 2: Polyethyleneimine precipitation <br><br>
A 5% (w/v) aqueous polyethyleneimine solution (pH 8.0) <br><br>
was added with stirring to the supernatant from step 1 until a final concentration of 0.5% was 20 achieved (polyethyleneimine, Serva, Heidelberg). <br><br>
The mixture was then stirred for a further 30 minutes and the precipitate was centrifuged off at 16000 x g (30 minutes). <br><br>
G <br><br>
f \ <br><br>
25 Step 3: Heat precipitation <br><br>
The supernatant from step 2 was heated in steel beakers with stirring in a hot water bath (80°C) to 60°C and cooled to room temperature again in 30 an ice bath. Any protein precipitated was removed by centrifuging (10,000 x g, 10 min., 4°C). <br><br>
Step 4: Ammonium sulphate precipitation <br><br>
35 <br><br>
The supernatant from step 3 was brought to 20% saturation with solid ammonium sulphate and the <br><br>
i <br><br>
O <br><br>
o <br><br>
- 78 - <br><br>
223869 <br><br>
r~N io precipitate was removed by centrifuging (10,000 x g, 15 min., 4°C). The ammonium sulphate concentration was then increased to 90% and the precipitate was obtained by centrifuging (10,000 x g, 15 min., 4°C). The sediment was taken up in a little MES buffer (morpholino ethanesulphonate buffer, 50 mM, pH 6.0; 2-morpholino ethanesulphonic acid of Sigma, Deisenhofen) and dialysed overnight against the same buffer. <br><br>
Step 5: Cation exchange chromatography <br><br>
| A Mono S column (Mono S HR 5/5, Pharmacia, Sweden) <br><br>
was equilibrated with 5 column volumes of MES buffer. <br><br>
t j 15 After the column had been charged with the extract <br><br>
' from step 4, any unbound proteins were washed away <br><br>
■j with 5 column volumes of MES buffer. The hMn-SOD <br><br>
according to the invention was then e±uted in a linear gradient of 0 - 50 mM NaCl in MES buffer <br><br>
| 20 (20 column volumes). Fractions which contained s <br><br>
Mn-SOD activity were combined and dialysed against Na, K phosphate buffer (5 mM, pH 7.0). <br><br>
The native yeast SOD enzymes (Mn-SOD, CuZn-SOD) 25 can be separated off in this purification step. Fig. 14 shows an elution diagram. <br><br>
Step 6: Adsorption chromatography on hydroxylapatite <br><br>
30 A hydroxylapatite column (HA Ultrogel, IBF, Villeneuve-la-Garenne, France) equilibrated with phosphate buffer (5 mM, pH 7.0) was charged with the dialysate from step 5 and the hMn-SOD according to the invention was eluted with a linear gradient (20 column volumes) 35 of 5 - 300 mM of Na, K-phosphate, pH 7.0. <br><br>
O <br><br>
® 79 22 3 8 <br><br>
The degree of purity of hMn-SOD achieved in the individual purification steps was monitored by reductive SDS-polyacrylamide gel electrophoresis (Fig. 15). <br><br>
5 <br><br>
Example 16. Characterisation of the hMn-SOD according to the invention <br><br>
The hMn-SOD according to the invention, purified 10 as in Example 15, was analysed by gel permeation HPLC, reverse phase HPLC, N-terminal sequencing, SDS-gel electrophoresis, native gel electrophoresis and isoelectric focusing and compared with natural hMn-SOD. <br><br>
15 <br><br>
20 <br><br>
a. Gel permeation HPLC: <br><br>
Column: Water protein pack I 125, 2 x (7.8 x 300 mm), <br><br>
10 mem particle diameter Eluant: 0.5 M Na2S04, 0.02 M NaH2P04, pH 7.0, 0.04% <br><br>
Tween 20, 25% propyleneglycol Flux: 0.5 ml/min Detection: UV absorption, 214 nm <br><br>
25 Natural hMn-SOD or hMn-SOD according to the invention show the main peak of the SOD tetramer at a molecular weight of 70,000 and 76,000, respectively, calibration being effected by means of four standard proteins. Within the experimental degree of error of this 30 method, these values can be regarded as identical. <br><br>
b. Reverse phase HPLC <br><br>
35 <br><br>
Column: Bakerbond WP Clg, 4.6 x 250 nm, 5 mem particle diameter, 30 nm pore diameter Eluant A: 0.1% trifluoroacetic acid in water <br><br>
~1 <br><br>
Vj <br><br>
- 80 - <br><br>
22 3 8 §f <br><br>
Eluant B: 0.1% trifluoroacetic acid in acetonitrile Gradient: 20% B for 2 min., 20 - 68% B in 24 min, <br><br>
68% B for 10 min., 68-20% B in 1 min Flux: 1.0 ml/min <br><br>
5 Detection: UV absorption, 214 nm and 280 nm <br><br>
Both natural hMn-SOD and hMn-SOD according to the invention show a retention time of just 21 minutes (20.7 and 20.9 min respectively). <br><br>
10 <br><br>
c. N-terminal sequencing <br><br>
A peak of hMn-SOD according to the invention, desalinated by reverse phase HPLC, was sequenced. Sequencing 15 was carried out using a gas phase sequenator made by Applied Biosystems (Model 470 A) with the program 02RPTH. With an initial quantity of 0.8 nM, it was possible to sequence up to amino acid 20. 100% agreement was found with the expected sequence 20 (of natural protein and cDNA). The leader sequence for transporting into the mitochondria had been split off completely. <br><br>
\ d. SDS gel electrophoresis <br><br>
^ 25 <br><br>
Separating gel: 15% acrylamide Stacking gel: 4% acrylamide <br><br>
Staining: silver staining according to B.R. Oakley et al. (Analyt. Biochem. 105, 361-363, 1980). 30 Gel measurements: 0.75 mm (8 x 10 cm) <br><br>
Running conditions: 60 min, 150 V <br><br>
The SDS gel electrophoresis was carried out substantially according to the method originally described by 35 U.K. LSmmli (Nature 227, 680-685, 1970). In the preparation of the samples for hMn-SOD, the samples were mixed with DTT as the reducing agent and boiled. <br><br>
-i \ <br><br>
o <br><br>
- 81 - <br><br>
22 38 $g <br><br>
I hMn-SOD occurred on the SDS gel mainly as a monomer j with M approximately 25,000. Depending on the <br><br>
\ completeness of the reduction, the tetramer with <br><br>
1 M approximately 90,000 can also be detected. Pig. 15 <br><br>
5 shows a 15% SDS polyacrylamide gel after silver <br><br>
''■w'' <br><br>
staining. <br><br>
e. Native gel electrophoresis <br><br>
10 Separating gel: 7.5% native PAGE according to Davis, B.J. V~" (Ann. NY Acad. Sci. 121, 404-427, 1964) <br><br>
Stacking gel: 2% acrylamide + sucrose Gel dimensions: 0.75 mm (8x10 cm) <br><br>
Running conditions: 75 min, 150V (const.) <br><br>
15 Staining: Coomassie Blue by known methods and activity staining with o-dianisidine i according to Misra, H.P., Fridovich, <br><br>
I. (Arch. Biochem. Biophys. 183, 511-515, 1977) <br><br>
20 <br><br>
The hMn-SOD according to the invention obtained after hydroxylapatite chromatography showed a uniform band located in the same position after electrophoresis, both with Coomassie Blue staining (quantity of 25 hMn-SOD applied: 0.3 meg) and also after activity staining with o-dianisidine (quantity of hMn-SOD applied: 75, 30 or 15 ng). <br><br>
f. Isoelectric focusing <br><br>
30 <br><br>
pH range: 3.5-9.5 <br><br>
Gel plates: LKB, PAG plate (1 mm x (9 x 10 cm)) <br><br>
Electrode solutions: 1 M phosphoric acid (anode) <br><br>
1 M sodium hydroxide solution (cathode) 35 Cooling temperature: 7°C <br><br>
Quantity of sample: 4.0 or 6.5 meg <br><br>
° . ,2. 22 3 8 6 9 <br><br>
Running conditions: pre-focusing 500 Vh focusing 3000 Vh in all Staining: Coomassie Blue, activity staining with o-dianisidine <br><br>
5 <br><br>
pi * 8.15 was determined as the isoelectric point. <br><br>
% <br><br></p>
</div>
Claims (56)
1. A polypeptide in substantially pure form which has the enzymatic, biochemical and immunological properties o£ human manganese superoxide dismutase (hMn-SOD) and which is prepared by genetic engineerin7.<br><br>
2. A polypeptide as claimed in claim 1 which occurs free from native glycosylation.<br><br>
3. A polypeptide as claimed in claim 1 or claim 2 • which contains the amino acid methionine before the first amino acid of the N-terminus.<br><br>
4. A polypeptide as claimed in any one of the preceding claims which additionally contains a mitochondrial leader peptide positioned before the first amino acid of the hMn-SOD (Lys).<br><br>
5. A polypeptide as claimed in any one of the preceding claims which is in correctly processed form.<br><br>
6. A polypeptide as claimed in any one of the preceding claims which contains the amino acid sequences according to formulae IVa or IVb.<br><br>
7. A polypeptide according to claim 1 substantially as described herein.<br><br>
8. A DNA sequence which codes for all or a substantial part of a polypeptide as claimed in any of claims<br><br>
1 to 7.<br><br>
C<br><br>
O'<br><br>
10<br><br>
2238(5'.V<br><br>
- 84 -<br><br>
9- A DNA sequence which codes for a premature hMn-SOD which can be imported into a mitochondrium and is correctly processed to yield the mature polypeptide as claimed in any of claims 1 to 7.<br><br>
10. A DNA sequence as claimed in claim 8 or claim 9 which contains the genetic information for an hMn-SOD and an amino-terminal leader or signal sequence.<br><br>
11 • A DNA sequence as claimed in claim 10 which contains the genetic information for hMn-SOD directly preceded by a DNA sequence which is a mitochondrial leader or signal sequence.<br><br>
12 . A DNA sequence as claimed in claim 11 wherein the mitochondrial leader or signal sequence originates from yeast.<br><br>
20
13. A DNA sequence as claimed in any one of claims 8 to 12 in which the composition corresponds to the order: translation start signal (ATG), mitochondrial leader or signal sequence, DNA sequence for hMn-SOD and at least one stop codon.<br><br>
25<br><br>
15<br><br>
14„ A DNA sequence as claimed in any one of claims 8 to 13 which corresponds to the nucleotide sequences according to formulae la, lb, II, Ilia, Illb, Va, Vb, ry Via, VIb, Vila, Vllb, VIII or IX, optionally linked to<br><br>
30 a sequence according to formula X or XI, or a degenerate variation thereof.<br><br>
15. A DNA sequence which hybridises with a DNA sequence as claimed in any one of claims 8 to 14 35 under stringent conditions, said DNA sequence being of synthetic, semi-synthetic or natural origin and accordingly being related_jto--«""cl^^ sequence as claimed in any one djf <piiaift)J^---tt>"14 ahd mutations<br><br>
\- Sc'i'l-'iS—<br><br>
2238G9<br><br>
- 85 -<br><br>
thereof of any kind, and coding for all or a substantial part of a polypeptide as claimed in any one of claims 1 to 7.<br><br>
16. A DNA sequence as claimed in claim 8 substantially as described herein.<br><br>
17. A replicating vector having at least one selection marker and/or having a recognition site for at least one restriction enzyme outside the replication origin and outside other essential gene areas, optionally inside a selection marker,<br><br>
which contain a DNA sequence as claimed in any one of claims 8 to 16.<br><br>
18. A replicating vector as claimed in claim<br><br>
17 which is of viral origin.<br><br>
19. A replicating vector as claimed in claim<br><br>
18 which is of lambda phage origin.<br><br>
20. a replicating vector as claimed in claim 18 which is XgtlO or M13 phage.<br><br>
21.. A replicating vector as claimed in claim 17 which is of plasmidic origin.<br><br>
22.. A replicating vector as claimed in claim 17 substantially as described herein.<br><br>
23. a plasmid containing a DNA sequence as claimed in any one of claims 8 to 16 wherein said plasmid carries an expression cassette containing said DNA sequence, is capable of transforming prokaryotic and eukaryotic host cells in stable manner, is replicable in at least one of said host cells and the genetic information for hMn^SOD'IcoAtained therein<br><br>
4<br><br>
223869<br><br>
- 86 -<br><br>
is correctly transcribed and translated.<br><br>
24. A plasmid as claimed in claim 23 which is a YEpl3, pJDB207/ pEASl02 or YIp5 derivative.<br><br>
5<br><br>
25. A plasmid as claimed in claim 23 which is a pUC plasmid derivative.<br><br>
26. A plasmid as claimed in claim 25 which is 10 a pUC18 derivative.<br><br>
27• A plasmid as claimed in any one of claims 23 to 26 which contains an expression cassette with promoter elements, initiation codon, mitochondrial 15 leader or signal sequence, hMn-SOD structural gene,<br><br>
stop codon and terminator, all in the correct orientation relative to the direction of reading.<br><br>
28. a plasmid as claimed in claim 27 wherein<br><br>
20 the promoter of the expression cassette contained therein is the complete, approximately 1500 bp long ADHI promoter or the shortened, approximately 400 bp long ADHIk promoter and the terminator therein is the ADHII terminator.<br><br>
25<br><br>
29. The plasmids designated pWS490A, pWS49lA,<br><br>
PWS550A, PWS371A, pWS372A, pWS373A, pE024-AB, pE025-AC and pE026-AD.<br><br>
30 30. a plasmid as claimed in claim 23 substantially as described herein.<br><br>
31. A host cell transformed with a DNA sequence as claimed in any one of claims 8 to 14.<br><br>
j*01**.<br><br>
35<br><br>
32. A host cell transformed with a replicating vector as claimed in any one of claims 17, to 22,<br><br>
2238(5 9<br><br>
*/<br><br>
- 87 -<br><br>
which replicates and expresses said replicating vector, imports the synthesised hMn-SOD into its own mitochondria and processes and accumulates ^ it intracellularly.<br><br>
/-v J<br><br>
5<br><br>
33. A host cell as claimed in claim 32 transformed with a plasmid as claimed in any one of claims 23 to 30.<br><br>
10 34.. A host cell as claimed in any one of claims 31 to 3 3 which is a prokaryote.<br><br>
35. A host cell as claimed in claim 34 which is an Enterobacteriaceae, Bacillaceae or apathogenic 15 Micrococcaceae.<br><br>
36. A host cell as claimed in claim 35 which is E. coli.<br><br>
20
37. A host cell as claimed in claim 36 which is E. coli C600 or E. coli JM 101.<br><br>
1<br><br>
38. A host cell as claimed in any one of claims (3 31 to 33 which is a eukaryote.<br><br>
25<br><br>
39. a host cell as claimed in claim 38 which is a yeast.<br><br>
40. A host cell as claimed in any one of claims 30 31 to 33 which is a mammalian cell.<br><br>
41. A host cell as claimed in claim 31 substantially as herein described.<br><br>
35
42. A process for preparing hMn-SOD wherein<br><br>
^<br><br>
223800<br><br>
- 88 -<br><br>
I<br><br>
i a. the mRNA is isolated from human tissue<br><br>
! +.<br><br>
] and the poly(A) RNA is prepared,<br><br>
*<br><br>
b. the double stranded cDNA is synthesised 5 from this poly(A) RNA and a cDNA gene bank is constructed therefrom,<br><br>
c. a complete or partial DNA sequence coding for hMn-SOD is identified and isolated<br><br>
(7y 10 from the said cDNA bank by means of at least one DNA probe derived from the amino acid sequence of the hMn-SOD,<br><br>
d. this DNA sequence is optionally completed 15 up to the start or stop codon,<br><br>
e. a mitochondrial leader or signal DNA sequence is positioned directly after the start codon (ATG) of the hMn-SOD<br><br>
20 gene and before the first codon (Lys)<br><br>
coding for hMn-SOD,<br><br>
f. with this complete DNA sequence coding for hMn-SOD, equipped with a leader or<br><br>
25 signal peptide, a suitable expression cassette, depending on the host cell, is constructed consisting of a promoter, initiation signal, hMn-SOD gene with (3 leader or signal sequence, stop codon<br><br>
30 and terminator,<br><br>
g. this expression cassette is incorporated into an expression vector or plasmid,<br><br>
35 h. this expression vector, which contains the hMn-SOD gene equipped with a leader or signal se.quetrc.e7 used to transform<br><br>
$<br><br>
■' r.l<br><br>
o<br><br>
G<br><br>
G<br><br>
10<br><br>
- 89 -<br><br>
a host cell,<br><br>
i. the hMn-SOD synthesised and correctly processed by this transformed host is extracted from mitochondria and then purified.<br><br>
43. A process as claimed in claim 4 2 wherein the human tissue used is placenta tissue.<br><br>
44. A process as claimed in claim 42 or claim 43 wherein the DNA sequence used is as claimed in any one of claims 8 to 16.<br><br>
15 45. A process as claimed in any one of claims 42 to 44 wherein the DNA probes used in step c correspond to the formulae Va and Vb.<br><br>
46. a process as claimed in any one of claims<br><br>
20 42 to 45 wherein the mitochondrial leader or signal DNA sequence used in step e corresponds to formula X.<br><br>
47. A process as claimed in any one of claims 42 to 46 wherein the vector or plasmid used is<br><br>
25 as claimed in any one of claims 17 to 30.<br><br>
3238 (}!):■<br><br>
48. A process as claimed in any one of claims 42 to 47 wherein the host cell used is as claimed in any one of claims 31 to 41.<br><br>
30<br><br>
49. A process as claimed in any one of claims 42 to 4 8 wherein a correctly processed hMn-SOD<br><br>
can be directly prepared having the enzymatic, biochemical and immunological properties of hMn-SOD.<br><br>
50. a process as claimed in any one of claims 42 to 49 wherein a r»r>i-i-or-My liw^-son<br><br>
W.Z. PATENT<br><br>
dec 1990 pfcesveQ-<br><br>
35<br><br>
- 90 -<br><br>
corresponding to the amino acid sequences according to formulae IVa or IVb can be prepared.<br><br>
51. A process as claimed in claim42 substantially as described herein.<br><br>
52. A polypeptide encoded by a DNA sequence as claimed in any one of claims 8 to 16.<br><br>
53. A polypeptide whenever prepared by a process as claimed in any one of claims 4 2 to 51.<br><br>
54. A polypeptide as claimed in any one of claims 1 to 7, 52 or 53 for use in therapy.<br><br>
55. A pharmaceutical composition containing,<br><br>
in addition to one or more pharmaceutically inert excipient and/or carrier, an effective quantity of at least one polypeptide as claimed in any one of claims 1 to 7, 52 or 53.<br><br>
56. A solid or liquid foodstuff comprising a polypeptide as claimed in any one of claims 1 to 7, 52 or 53 in an amount sufficient for increasing the shelf-life thereof.<br><br>
BOEHRINGER INGELHEIM INTERNATIONAL GMBH<br><br>
</p>
</div>
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19873708306 DE3708306A1 (en) | 1987-03-14 | 1987-03-14 | Human manganese superoxide dismutase (hMn-SOD) |
DE8717695 | 1987-05-26 | ||
DE19873722884 DE3722884A1 (en) | 1987-07-10 | 1987-07-10 | Human manganese superoxide dismutase (hMn-SOD) |
DE8744038 | 1987-12-24 |
Publications (1)
Publication Number | Publication Date |
---|---|
NZ223869A true NZ223869A (en) | 1991-07-26 |
Family
ID=27433861
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ22386988A NZ223869A (en) | 1987-03-14 | 1988-03-11 | Genetically engineered production of human manganese superoxide dismutase |
Country Status (1)
Country | Link |
---|---|
NZ (1) | NZ223869A (en) |
-
1988
- 1988-03-11 NZ NZ22386988A patent/NZ223869A/en unknown
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5589371A (en) | Human manganese superoxide dismutase (hMn-SOD) | |
Lübben et al. | An archaebacterial terminal oxidase combines core structures of two mitochondrial respiratory complexes. | |
JP2592444B2 (en) | Method for producing polypeptide | |
CA2050601C (en) | Production in bacteria and yeast of hemoglobin and analogues thereof | |
US6183985B1 (en) | High level expression of proteins in yeast | |
EP0804587B1 (en) | Mutant luciferases | |
US5674706A (en) | High level expression of proteins in yeast | |
HU207533B (en) | Process for clowning superoxide dismutase, expressing them in microorganisma and improving enzyme-yeald of microorganismus cultures | |
ES2356127T9 (en) | AOX MUTANT PROMOTERS 1. | |
US5541098A (en) | Urate oxidase activity protein, recombinant gene coding therefor, expression vector, micro-organisms and transformed cells | |
US5260204A (en) | Human manganese superoxide dismutase (hMn-SOD) | |
FI88407C (en) | DNA MOLEKYL, TRANSFORMER JAESTCELLER OCH FOERFARANDE FOER FRAMSTAELLNING AV HUMAN-LYSOZYM | |
AU636637B2 (en) | Urate oxidase activity protein, recombinant gene coding therefor, expression vector, micro-organisms and transformed cells | |
FI92601B (en) | Method for secretion of useful proteins from yeasts | |
Patil et al. | Cloning, nucleotide sequence, overexpression, and inactivation of the Escherichia coli 2-keto-4-hydroxyglutarate aldolase gene | |
JP3009679B2 (en) | Pectin lyase expression system | |
Chen et al. | Expression, purification, and characterization of a recombinant 5-lipoxygenase from potato tuber | |
NZ223869A (en) | Genetically engineered production of human manganese superoxide dismutase | |
US5710033A (en) | Superoxide dismutase cloning and expression in microorganisms | |
Knust et al. | Expression and secretion of pea-seed lipoxygenase isoenzymes in Saccharomyces cerevisiae | |
Seaton et al. | Expression of human ferredoxin in Saccharomyces cerevisiae: mitochondrial import of the protein and assembly of the [2Fe-2S] center | |
DE3744038A1 (en) | Human manganese superoxide dismutase (hMn-SOD) | |
SU1741610A3 (en) | Method for obtaining human @@@-dismutase | |
DE3722884A1 (en) | Human manganese superoxide dismutase (hMn-SOD) | |
DE3717695A1 (en) | Human manganese superoxide dismutase (hMn-SOD) |