NZ218631A

NZ218631A - Single chain angiogenic factor protein and methods for its production

Info

Publication number: NZ218631A
Application number: NZ218631A
Authority: NZ
Inventors: David A Moscatelli; Daniel B Rifkin; Andreas Sommer
Original assignee: Synergen Inc
Priority date: 1985-12-17
Filing date: 1986-12-15
Publication date: 1991-07-26
Also published as: WO1987003885A1; DK424387D0; EP0226181B1; FI93843C; ES2056787T3; ATE107315T1; FI93843B; IE863281L; JPH10262668A; AU7629991A; PT83939B; IL80944A; NO177859B; EP0226181A3; DK424387A; AU650649B2; FI882891A0; NO873437L; PT83939A; KR880700820A

Abstract

An angiogenic factor is disclosed which is a purified, single-polypeptide-chain protein having at least one active site possessing an activity selected from the group consisting of mitogenic activity, chemotactic activity, the ability to stimulate protease synthesis and combinations thereof. This angiogenic factor exhibits substantial homology to and is immunologically equivalent to the native angiogenic factor isolatable from human placental tissues. The amino acid sequence of this angiogenic factor is also disclosed. In addition, a method for isolation of the purified angiogenic factor from human placental tissues is set forth. Pharmaceutical preparations incorporating this angiogenic factor are described.

Description

<div id="description" class="application article clearfix"> New Zealand Paient Spedficaiion for Paient Number £18631 218&31 NOORAWMGS priority ,..!L.:.%:Sk Com,c,r*r» Soectfteatlon &tef: CtoS.i; {rv SS^S* A ^~\7 t-sySl t>3- .....«•••• »«■■.» (•»«iV«<* PuDJicaimrc Daze: . P.O. Journal, No: TOT ssi No.: Date: NEW ZEALAND PATENTS ACT, 1953 COMPLETESPECIFICATION c HUMAN ELfiCENTA ANGIOGENIC FACTOR CAPABLE OF STIMULATING CAPILLARY ENDOTHELIAL CELL PROTEASE SYNTHESIS, ENA SYNTHESIS AND MIGRATION O X/We. SYNERGEN, INC., a corporation of Colorado, U.S.A., of 1885 33rd Street, Boulder, Colorado 80301, U.S-A-, hereby declare the invention for which X / we pray that a patent may be granted to xbk/us, and the method by which it is to be performed, to be particularly described in and by the following statement: - 1 - (followed by Page 1A) 218631 * : i :l t o o 10 15 v>-> 20 25 Mr omen >n hendouon jowojuiett 4 Dunne*. on.o. c.ioooa BACKGROUND OF THE INVENTION Angiogenic factors have been defined as proteins which possess a variety of properties, namely the ability to (1) increase the rate of endothelial cell proliferation; (2) increase endothelial cell protease synthesis; (3) stimulate endothelial cell migration toward the protein location; and (4) cause in vivo capillary proliferation. In particular, it has been observed that substances classified as angiogenic factors can be mitogenic by J affecting DNA synthesis in endothelial cells, thus increasing the » ; rate of endothelial cell proliferation and the rate at which new j blood vessels are formed. Interrelated with this property is the ability of angiogenic factors to increase protease synthesis by endothelial cells. These proteases include plasminogen activator (PA) and col-lagenase. Specifically, the angiogenic factors are able to stimulate synthesis of PA and latent collagenase where the PA can convert zymogen plasmin into active plasmin, a protease of wide specificity, which in turn can convert latent collagenase into | active collagenase. These two proteases, active plasmin and I } active collagenase, are capable of degrading most of the proteins -IA- n Oj! f 17 JANi990^ N <> r» * . t - * * 113^31 D 10 15 20 25 lu» ornecs ican. Henderson aabow. Carrett 8 Duntneb. y% n sti»cct m.w. «tMOTON.e.c.4eoo« in surrounding tissues, thus allowing increased invasion of various tissues, such as .capillary endothelial cells. Moreover, angiogenic factors are chemotactic for certain cells, particularly capillary endothelial cells, i.e. they induce these cells to migrate toward the angiogenic factor. With these properties in mind, it has been postulated that the isolation of an angiogenic factor would allow creation of a therapeutic substance capable of increasing the blood supply- to an organ. For instance, subsequent to certain myocardial infarctions it would be desirable to stimulate regeneration of the blood supply to the heart interrupted as a result of the infarction or to stimulate re-growth of vessels in chronic obstructions. In addition, the use of an angiogenic factor may stimulate healing in decubitus ulcers, surgical incisions and slowly healing wounds, particularly in geriatric and diabetic patients. Moreover, the application of this material to burns may improve the rate and degree of healing. Therefore, a purified angiogenic factor suitable for therapeutic applications in humans has been sought. Additionally, some scientists believe that study of a substance capable of stimulating blood vessel growth may lead to processes for which the blood supply to a cancerous tumor might be inhibited, thus starving the cancer. Previously, although a class of proteins had been identified which have been referred to as "angiogenic factors," these proteins were primarily isolated from non-human sources. It is -2- 21863 1 I ,i •| | believed that, angiogenic factors isolated from non-human sources •» ; would not be suitable-for use as therapeutic agents in humans due : to the potential for adverse immunological reaction in response ! to a foreign protein. Moreover, it had not been demonstrated whether these non-human proteins individually possessed the four identified properties of an angiogenic factor identified above or whether the observed properties were attributable to the interactions between a combination of proteins. r | Indeed, various proteins which have been found to have endo thelial cell mitogenic properties have been divided into two ' classes: endothelial cell growth factor-like molecules which are , eluted from heparin-Sepharose with 1 M NaCl and which have an < •| acidic pi; and fibroblast grovth factor-like molecules which bind '• more strongly to heparin-Sepharose and which have a basic pi. In i addition, the present inventoss believe that there is a third : species of angiogenic factor, that described as "angiogenin" in . papers recently published by Vallee et al. of Harvard Medical School, in Biochemistry. 1985, Vol. 24, pgs. 5480-5499. It is believed that angiogenin, while possessing some properties of a ! true angiogenic factor, is a distinct species in that it lacks I | mitogenic properties. In the face of this patchwork of research, the present inventors sought and discovered a human angiogenic factor, classifiable as an FGFbasio vhich is substantially homologous to : that isolatable from human placental tissue, which, in a single 21863 % molecule, has. the above-identified properties, i.e., is mitogenic, chemotactic, and capable of stimulating protease synthesis as well as capable of causing in vivo capillary proliferation. Furthermore, the present inventors sought to isolate this angiogenic factor in a substantially purified form from human placental tissues. The amino acid sequence of this isolated angiogenic factor has now been determined. It is believed that the determination of this amino acid sequence will allow identification of ONA probes for use in and obtaining genomic or cDNA sequences useful in recombinant-DNA methods for the synthesis of angiogenic factors. SUMMARY OF THE INVENTION The present invention relates to angiogenic factors generally, and more specifically, to those angiogenic factors classifiable as FGFbasic* In particularly, this invention relates to an FGFfeasxc angiogenic factor which is substantially equivalent to that isolatable from human placental tissues, and which has mitogenic and chemotactic properties and which is capable of inducing protease synthesis and, in vivo, causes capillary proliferation. An object of the present invention is to provide purified forms of an angiogenic factor which possess these properties. An additional object of the present invention is the determination of the amino acid sequence of such an angiogenic factor. A further object of the present invention includes providing purified forms of FGFfeasic vhich would be valuable as pharmaceutical 21863 li i preparations exhibiting mitogenic and chemotactic properties ' along with the ability to stimulate protease synthesis. I Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description or may be learned from practice of the invention. These objects and advantages may be realized and attained by means of the instrumentalities and combinations particularly pointed out in the appended claims. To achieve the objects and in accordance with the purposes of the present invention, an angiogenic factor is disclosed which has at least one active site possessing an activity selected from ' the group consisting of mitogenic activity, chemotactic activity, ; the ability to stimulate protease synthesis, and combinations thereof. The human or synthetic angiogenic factor is classifiable as an FGF^asic and exhibits substantial homology to the native angiogenic factor isolatable from human placental tissue. It should be noted that, while it is preferred that the angiogenic factor itself be capable of stimulating protease syn-; thesis, the term "protease," as used herein, includes active or j precursor forms. Examples of such precursor forms include latent ; or pro-collagenase. Moreover, it is possible that some angio- i genie factors may be isolated that are encompassed within the ; scope of the present invention but which do not directly stimu-j late protease synthesis. These angiogenic factors, however, do i cause biological responses which in turn stimulate protease : i i i ... .. 218631 c 10 15 20 25 ? j synthesis. Thus, the angiogenic factors of the present invention ! ; either directly or indirectly stimulate protease synthesis. A particularly preferred angiogenic factor according to the present invention has the"following core amino acid sequence: L-Y-C-K-N-G-G-F-F-L-R-1 -H-P-D-G-R-V-D-G-V-R-E-K-S- () -P-H-1 -K-L-Q-L-Q-A-E-E-R-G-V-V-S-1 -K-G-V-C-A-N-R-Y-L-A-M-K-()-D-G-()-L-L-A-()-K-()-V-T-()-E-()-F-F-F-E-()-L-E-S-N-N-Y-N-T-Y-R-()- In addition, peptides having the sequences K-L-G-S-K-T-G-P-G-Q-K-A-r-L-F-L-P-M-S-A-K and Y- ( )-S-W-Y-V-( )-L-( ) are present in the polypeptide outside the core sequence. In the sequences depicted herein, open parentheses indicate the presence , of a single amino acid residue that is not completely identified. i : Another particularly preferred angiogenic factor has the follow-i ing sequence: G-T-M-A-A-G-S-1-T-T-L-P-A-L-P-E-D-G-G-S- i G-A-F-P-P-G-H-F-K-D-P-K-R-L-Y-C-K-N-G-G-F-F-L-R-1 -H-P-D-G-R-V-D-G-V-R-E-K-S-D-P-H-1 -K-L-Q-L-Q-A-E-E-R-G-V-V-S-1 -K-G-V-C-A-N-R-Y-L-A-M-R-E-D-G-R-L-L-A-5-K-C-V-T-D-B-C-P-F-F-E-R-L-E-S-N-N-Y-N-T-Y-R-S-R-K-Y-T-S-W-Y-V-A-L-K-R-T-G-Q-Y-K-L-G-S-K-T-G-P-G-Q-K-A-1-L-F-L-P-M-S-A-K-S. The amino acids represented by the foregoing abbreviations are set forth in the Description of the Preferred Embodiments below. >n hendejuon abov. cajuutt 3 Dunne* > m smccr.M.w. •motom. o. c. ioooi -6- 218^1 I I i Furthermore, to achieve the objects and in accordance with ; the present invention-, a substantially purified form of the na-. tive angiogenic factor isolatable from human placental tissue is disclosed. Additionally, to achieve the objects and accordance with the purposes of the present invention, pharmaceutical compositions containing, as at least one of the active ingredients, an angiogenic factor in accordance with the present invention as set forth herein are disclosed. It is to be understood that both the fore'going general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. DESCRIPTION OF THE PREFERRED EMBODIMENTS References will now be made in detail to the presently preferred embodiments of the invention, which, together with the following examples, serve to explain the principles of the invention. As noted above, the present invention relates to an angiogenic factor which has been isolated in purified form. Preferably, the angiogenic factor of the present invention is a single-polypeptide-chain protein which is substantially homologous to, immunologically equivalent to, and, most preferably, biologically equivalent to, native angiogenic factor isolatable from human placental tissues. By "biologically equivalent," as used throughout this specification and claims, it is meant that 21B&3 \ o ls^ 10 15 ■O 20 25 lm» orriccs -mecas. Henderson jM*ABOW. CARRETr a Dunne*. ins H srwcrr.M.w. «shim0r0*i. e. c. ioom the composition of the present invention possesses mitogenic and chemotactic properties and is capable of inducing protease synthesis in the same manner, but not necessarily to the same degree, as the native angiogenic factor. By "substantially homologous," as used throughout the ensuing specification and claims, is meant a degree of homology to the native angiogenic factor in excess of that displayed by any previously reported, purified, substantially homologous angiogenic factor composition. Preferably, the degree of homology is in excess of 50%, preferably €0%, and more preferably 75%, vith particularly preferred proteins being in excess 85% or 90% homologous vith the native protein. The degree of homology as described above is calculated as the percentage of amino acid residues found in the smaller of the tvo sequences that align vith identical amino acid residues in the sequences being compared vhen four gaps in a length of 100 amino acids may be introduced to assist in that alignment as set forth by Dayhoff, M.o. in Atlas of Protein Sequences and Structure, Vol. 5, page 124 (1972), National Biochemical Research Foundation, Washington, D.C., specifically incorporated herein by references. As described herein, the angiogenic factor of the present invention is either isolated from a human source or is a synthetic polypeptide. The term "synthetic" polypeptide is intended to mean an amino acid sequence vhich has not previously been isolated from nature in a substantially purified form. In applying -8- 218^31 G 10 15 20 25 ;j this definition, "synthetic" encompasses, among others, poly- i ' peptides created by recombinant-DNA methods or synthesized in r whole or in part in vitro. In particular, synthetic polypeptides are contemplated in which 1 or 2 amino acids differ from those set forth in the preferred sequences set forth below. The preferred angiogenic factor of the present invention has been discovered in human placental tissue extracts and, for the first time, has been isolated in a purified form. For the purposes of the present application, "pure form" or "purified form," . when used to refer to the angiogenic factor disclosed herein, > shall mean substantially free of other proteins which are not angiogenic factors. Preferably, the angiogenic factor of the i i ! present invention is at least 50% pure, more preferably 70% pure and even more preferably 80% or 90% pure. Additionally, the angiogenic factor of the present invention has been isolated from various tumor and normal cells. These in-• elude SK-Hepl cells, HeLa cells and K562 cells, as well as human i embryonic lung fibroblasts. The angiogenic factor of the present invention may be iso-j lated in pure form from human placental tissues by the method < comprising: (a) collecting human placental tissues; (b) isolating I the angiogenic factor from the human placental tissues by fractionating the proteinaceous material in the tissues; (c) identi-- fying the fractions which possess angiogenic factor activity; and I '■ (d) concentrating the fractions exhibiting the angiogenic factor ■jecan Henderson . . . jiabow. carrett • activity. & Dunne* | TT% « »n»ccr.«.w. , ^•(motqm. o. c.ioqo* -9- 21863 In a preferred embodiment, the proteinaceous material present in the human placental tissues is fractionated using a combination of heparin affinity chromatography, ion exchange chromatography and, optionally, gel permeation chromatography. The angiogenic factor discussed herein may also be isolated through the use of monoclonal antibodies with a specificity for the placental proteins. In this embodiment, antigen is bound to a matrix (resin) containing monoclonal antibodies against the placental protein and non-antigenic proteins are removed by washing the resin with buffer. The antigen is then removed from the antibody by the use of a buffer of either high or low pH, or high ionic strength, or chaotropic agents, alone or in combination with a change in temperature. Fractions thus obtained are screened for the presence of angiogenic factor activity. -Preferably, this is accomplished in part by evaluating the effect on PA and collagenase synthesis by incubating appropriate endothelial cell cultures, preferably mammalian capillary endothelial cells, in the presence of the angiogenic factor and assaying the medium for latent collagenase and the cells for PA. The amount of protease produced by the cells stimulated by the angiogenic factor may also be determined by immunological methods such as ELISA or RIA assays or immuno-precipitation methods. The mitotic ability of the angiogenic factor is preferably measured by incubating appropriate endothelial cells, preferably -10- 218&31 I j| mammalian capillary endothelial cells, in the presence of the ' angiogenic factor and-a radiolabelled nucleotide, preferably ■ ^-^^i-iododeoxyuridine (^^I-dU). The amount of ^®I-dU incorporated into trichloroacetic acid insoluble material is then measured as indicative of the extent of DNA synthesis. The chemotactic abilities of an angiogenic factor are preferably demonstrated by incubating an appropriate endothelial cell culture, preferably mammalian capillary endothelial cells, in the presence of the angiogenic factor and measuring cell motility in an appro-priate vessel, preferably a modified Boyden chamber. As noted above, the present inventors have succeeded in : isolating an angiogenic factor from human placental tissues in a ! hitherto unavailable, purified form. Isolation of this protein in a purified form vas a prerequisite step to the correct i sequencing of the protein and-to the developnent of pharmaceuti- i cal compositions containing the angiogenic factor. A preferred angiogenic factor of the present invention has the following core amino acid sequence: L-Y-C-K-N-G-G-F-F-L-R-1 -H-P-D-G-R-V-D-G-V-R-E-K-S-() -P-H-I-K-L-Q-L-Q-A-E-B-R-G-V-V-S-I-K-G-V-C-A-N-I R-Y-L-A-M-K-()-D-G-()-L-L-A-()-K-()-V-T-()-E-()-F- [ F-F-B- ( ) -L-E-S-N-N-Y-N-T-Y-R- ( ) - I | In addition, peptides having the sequences K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K and Y- ()-S-W-Y-V-()-L-() ; are present outside the core sequence. Another particularly pre-| ferred angiogenic factor has the following sequence: 218^>3 1 o 10 15 20 25 cam orrtccs jecan. hendemon habow. gajlrett a DUNKER 77s m stftcct.m.w. /••■••otom.o. e. iooos ton so G-T-M-A-A-G-S-I-T-T-L-P-A-L-P-E-D-G-G-S-G-A-F-P-P-G-H-F-K-D-P-K-R-L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-X-S-D-P-H-I-K-L-Q-L-Q-A-E-E-R-G-V-V-S-I-K-G-V-C-A-N-R-Y-L-A-M-K-E-D-G-R-L-L-A-S-K-C-V-T-D-E-C-F-F-F-E-R-L-E-S-N-N-Y-N-T-Y-R-S-R-K-Y-T-S-W-Y-V-A-L-K-R-T-G-Q-Y-K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K-S. The foregoing abbrevations correspond to the standard abbreviations for amino acid residues as set forth in, for example. Biochemistry by A.L. Lehninger, 2nd ed., Worth Publishers, Inc., New York (1975), pg. 72. It is believed that the activity of the claimed angiogenic factors is not affected if any or all of the fifteen, sixteen, seventeen, or eighteen N-terminal amino acid residues are removed from the intact polypeptide. Thus, it is intended that all of these abbreviated sequences are encompassed in the present invention. Moreover, the extension of the amino acid sequence by the addition of up to 110 amino acids to the N-terminal amino acid of the intact polypeptide are also contemplated. It is also contemplated that additions of polypeptide chains •' to the C- or N- terminus of the present angiogenic factor will be i ! within the scope of the present invention. In particular, poly- i ' peptide chains may be joined to either terminus through protein fusion techniques. These additional polypeptides may serve to -12- 218^31 10 15 o 20 O' 25 im omcis ■iecas. Henderson jiabov. Garrett a Dunner >m>motom. e. c. *ooo« IOaiM)*MM enhance the pharmacological efficacy of the instant angiogenic ' factors. For example, the polypeptide may, by fusion with other polypeptides, be made more capable of retaining its activity in the presence of low pH or high temperature, or the resultant polypeptide may possess a longer circulating life, greater resistance to degradation or increased ability to be transported across the intestinal epithelia. However, it should be noted that, in these alterations, the variation to the amino acid sequences should not be such as to provoke an adverse immunological response in the organism to < which the angiogenic factor is administered where such adverse | response would be determined to be of such detriment to the or-| ganism that the benefits derived from the angiogenic factor would not be warranted. The methods of determining whether a biological molecule would provoke such an adverse immunological response are known to those of ordinary skill in the art. The angiogenic factor of the present invention and its analogs as disclosed herein are contemplated for human and veter-• inary uses in the form of pharmaceutical products possessing i mitogenic or chemotactic properties or having the ability to stimulate protease synthesis. It is expected that pharmaceutical preparations containing, as at least one of active ingredients, one of the present angiogenic factors would also contain appro-j priate, pharmaceutical^ acceptable carriers, diluents, fillers, I | binders and other excipients depending on the dosage form -13- 218631 o 10 15 O 20 25 uw omeu -ecan. Henderson arabov. Carrett & Dunnes. itt* ft stitcct.n.w. ^MiMorow. o. c. *ooo« toil 2*3-«a»0 j contemplated.. For oral administration, steps must be taken to prevent degradation of the active protein in the digestive tract. ( Enteric coated dosage forms are thus contemplated as one form suitable for oral administration. If parenteral administration is chosen, the preparation may contain a water or saline solution or other pharmaceutical^ acceptable suspension agent. Generally, it would be preferred that a preparation intended for parenteral administration contain sodium chloride in sufficient concentrations to make the overall preparations isotonic to body fluids. It is also contemplated that the pharmaceutical preparations containing the angiogenic factor of the present invention be administered locally, as by injection or topical application, for treatment of wounds, surgical incisions or skin ulcers. Additionally, incorporation of the angiogenic factor into a slow release implant device is contemplated for administration to regenerate the blood supply to the heart after a myocardial infarction. The calculations necessary to determine the appropriate dosage for treatment of each of the above-mentioned disorders and appropriate for use vith the described delivery methods are routinely made by those of ordinary skill in the art and are within the ambit of tasks routinely performed by them without undue experimentation, especially in light of standard assays and the assays disclosed herein. These dosages may be ascertained through use of established assays for determining dosages utilized in conjunction with appropriate dose-response data. -14- _-^,»«!» "simw-jw^ 21863 ! It is understood that the application of the teachings of i the present invention-to a specific problem or environment will i be within the capabilities of one having ordinary skill in the art in light of the teachings contained herein. Examples of the products of the present invention and representative processes for their isolation and manufacture appear in the following examples. Example 1 Purification of a Human Angiogenic Factor from Placenta Tissues. A. Protein Purification j Term human placentas were frozen at -20*C after delivery. ! The frozen placentas were broken into small pieces, ground with ! an electric food chopper (General Slicing, Walden, NT), and ho-. mogenized in a food processor-*- After homogenization, all subsequent steps were performed at 4°C. The homogenized placentas were diluted vith cold 20 mM Tris, pH 7.5, 3 raM EDTA and were sonicated for 10 min. at 50 W (model 185 sonicator, Branson Sonic . Power Co., Plainviev, NY). Generally, 1 kg of frozen placenta , yielded 2 liters of sonicate. The sonicate was brought to pH 4 vith EC1, incubated at this pH for 2 min, followed by neutralization vith NaOK. NaCl vas added to a final concentration of 0.5 M and the sonicate vas cen-trifuged at 10,000 x g for 60 min. The supernatant was loaded on an 85 x 153 mm column of heparin-Sepharose (Pharmacia, < i I ; -15- 21863 1 i i I ; Piscatavay, NJ) equilibrated with 0.5 M NaCl/3 mM EDTA/20 mM Tris, pH 7.5. The column was washed with the same buffer and was eluted with 2 M NaCl/3 mM EDTA/20 mM Tris, pH 7.5. The eluate was diluted with 3mM EDTA/20 mM Tris, pH 7.5 until the conductivity was 24 mmho and loaded on a second heparin-Sepharose column (16 x 190 nun). The column was washed with 0.7 M NaCl in 3 mM EDTA/20 mM Tris, pH 7.5, and was eluted with a 0.7 to 2 M NaCl gradient in the same buffer. Fractions were assayed for protease-inducing activity and the active fractions were concentrated on a third heparin-Sepharose column (12 x 75 mm). This column was washed first with 0.8 M NaCl in 3 mM EDTA/20 mM Tris, pH 7.5 and then vith 0.2 M i ; NaCl in 0.1 M sodium phosphate, pH 6.0 and was eluted vith 2 M NaCl in 0.1 M sodium phosphate, pH 6.0. The active fractions from the third heparin-Sepharose column were diluted with 20-times their volume of 0.1 M sodium phosphate, pH 6.0. The solution was clarified by centrifugation at 10,000 x g for 30 min and was loaded on a 9 x 72 mm column of CM-Sephadex C-50 (Pharmacia) equilibrated vith the same buffer. The column vas sequentially eluted with 0.15, 0.5, and 2 M NaCl each in 0.1 M sodium phosphate, pH 6.0, and the fractions were assayed for protease-inducing activity. The 0.5 M NaCl eluate of the CM-Sephadex column, which contained the protease-inducing activity, was concentrated on a 0.5 ml heparin-Sepharose column. This column vas eluted vith - 8631- o VL-/ ; sequential 0.5 ml washes vith 2 M NaCl in 60 mM sodium phosphate, l ' pH 6.0. All activity-was eluted in the first 1 ml. This eluate j was run on an FPLC Superose-12 column (Pharmacia) in 2 M NaCl, 60 mM sodium phosphate, pH 6.0 with a flow rate of 0.5 ml/min. An angiogenic factor within the scope of the present claims was isolated from this eluate. This angiogenic factor is referred to in part in this example as the "protein" or "proteins." B. Characterization of Protein and Confirmation 10 of Angiogenic Factor Properties i l. Na0odS04-PAGE ! NaDodS04 polyacrylamide gels vith 3% stacking gels and 10 to | 18% gradient resolving gels vere prepared and run according to ' the procedure of Laemmli as set forth in Nature 277: 680-685 15 j (1970), specifically incorporated herein by reference. Proteins vere detected vith the silver stain procedure of Wray et al. as set forth in Anal. Biochem. 118: 197-203 (1981). The active I I ; fractions from this column contained a single band on ; NaDodSC>4-PAGE vith a molecular veight of 18,700. 20 j 2. • Protein determination Protein concentrations vere determined vith the Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA) using bovine serum albumin as a standard. The sequence information for this i protein is set forth in Example 4. iCAN. HENDEJUON \BOW CARXETT d Dunn tit * N CCT.M.W. IMOTON. o. c. *ooo« -17- 218^31 Mitogenic Properties - "bj.iododeoxyuridine ij 10 incorporation Bovine capillary endothelial (BCE) cells vere isolated from the adrenal cortex of recently slaughtered yearling cattle by the method of Folkman et al. as reported in Proc. Natl. Acad. Sci. USA 76: 5217-5221 (1979), specifically incorporated herein by reference. Cells vere grovn to confluence in alpha Minimal Essential Medium (MEM) containing 10% (v/v) calf serum and supplemented vith medium conditioned by mouse sarcoma 180 cells as described by Gross et al. in J. Cell Biol. 95: 974-981 (1982), specifically incorporated herein by reference. When cultures reached confluence, the medium vas changed to MEM containing 5% calf serum and no conditioning factors. Confluent cultures of BCE cells vere maintained in MEM vith 5% calf serum for 7 days. The medium vas then replaced vith fresh MEM containing 5% calf serum and varying concentrations of purified placenta angiogenic factor. After 20 h, the medium vas replaced vith Oulbecco's Modified Eagle's medium containing 5% calf serum and 0.3 uCi/ml 125I-iododeoxyuridine (2000 Ci/nunole, Nev England Nuclear, Boston, MA). After a 16 h incubation in labelling medium, labelling vas terminated by vashing the cells W vith cold phosphate buffered saline. Incorporation of ^•^^I-iodo- ; deoxyuridine into acid insoluble material vas determined by " incubating the cells in cold 5% trichloroacetic acid (TCA) for 30 min, vashing tvice vith 5% TCA and distilled vater. The TCA in- ;<^°HENDtJuoN . soluble material vas solubilized in 0.25 N NaOH and counted in a 4abov. caiutztt adunne*. Packard 5210 gamma scintillation counter. i ft itmct. m.w. 9 15 20- 7i ft srvcrr.m.w. -•maroN. o. e. aooo« 40*1 -18- 218631 o 4. Migration assay Migration assays-were performed in 200 ul blind wells (Nucleopore, Pleasanton, CA) according to the method of Castellot as described in Proc. Natl. Acad. Sci. USA 79:5597-5601, specifi-S cally incorporated herein by reference, using 5 urn pore size polycarbonate PVP-free filters precoated with gelatin and fibronectin. Ten-fold serial dilutions of the purified protease-inducing factor in MEM containing 0.5% fetal calf serum were placed in the bottom wells. The filters vere then inserted and 10 5 x 10* BCE cells in 200 ul MEM vith 0.5% fetal calf serum vere added to the upper veils. After a 4 h incubation at 37°C, the medium in the upper veils vas removed and cells on the upper surfaces of the filters vere gently scraped off vith a cotton svab. Then the filters vere removed, dried at room temperature, and 15 stained vith Wright-Giemsa stein (Baker Chemical Co., Phillipsburg, NJ). The total number of cells on the lover filter surface vas counted under a light microscope (400X magnification) . 5. Assays for the induction of PA and collagenase 20 Confluent cultures of BCE cells that had been maintained for at least two days in MEM containing 5% calf serum vere changed to fresh MEM containing 5% calf serum and the substance to be test-! ed. After incubation at 37*C for 24 h, the medium vas collected from the cultures and vas assayed for collagenase as described by 25 Moscatelli et al. in Cell 20: 343-351 (1980), specifically >n. Henderson asov. Garrett 3 dunner y it imckt.n.w. «*4to«. o. c. sooo* oat -19- 218^31 10 15 20 25 can. Henderson abow. CaHRETT a Dunne*. ■% ft sntcrr.M.w. motom . o. c. tooo* iOtl incorporated herein by reference. All collagenase was in a latent form and was activated with trypsin to detect activity. The cell layers from these same cultures vere washed twice with cold phosphate-buffered saline and were extracted with 0.5% (v/v) Triton X-100 in 0.1 M sodium phosphate, pH 8.1, and the cell extracts were assayed for PA activity as described by Gross et al.. supra. Experiments have demonstrated that the amount of PA in cell extracts is proportional to the amount found in conditioned medium. One unit of protease-inducing activity vas defined as the amount necessary to give half the maximal stimulation of PA and collagenase synthesis. Example 2 Purification of an angiogenic factor from Human Placental Tissue. The method of Example 1 -vas folloved to obtain an eluate loaded onto the second heparin-Sepharose column. This column was washed vith 0.95 M NaCl in 3mM EDTA/20mM Tris, pH 7.5, and was eluted vith 2M NaCl in the same buffer. The 2M eluate vas dialyzed against 0.2M NaCl/20mM MES, pH 6.0. The dialysate vas clarified by centrifugation at 100,000xg for 60 min. and vas loaded on a Mono-S column in a Fast Protein Liquid Chromatography (FPLC) system. The column vas vashed vith 0.2M NaCl/20 mM MES, pH 6.0, and vas eluted vith a 0.2 to 2M NaCl gradient in 20mM MES, pH 6.0. Fractions vere assayed for protease-inducing activity. The protease-inducing activity eluted at 0.45 to 0.6 M NaCl. -20- 10 15 20 25 2.1363 1 JCAN. HENDEMON 4BOW. GMUUTT # ounnek • « tnicn.N.tt. . 3tom. o. c. «ooo« -—11 IM-MtO Example 3 Purification of -an Angiogenic Pactor From Hepatoma Cells. All the purification steps, except the FPLC steps, were per-: formed at 4°C. SK-Hep-1 cells (American Type Culture Collection 1 (ATCC) Accession No. HTB 52) from confluent monolayers vere ■ scraped into cold PBS and pelleted by centrifugation at 400xg for I 10 min. The cell pellet vas suspended in 10 vol of PBS/0.5 M | NaCl and sonicated for 3 min at 50 vatts vith a Branson Sonicator j (Plainviev, N.Y.). The extract vas centrifuged (10,000xg, 1 h), ! ' and the supernatant vas collected. The pellet vas resuspended in 1 vol of PBS/0.5 M NaCl, sonicated and centrifuged. The tvo supernatants vere pooled and passed through a 28 x 75 mm column of heparin-Sepharose (Pharmacia, Piscatavay, NJ) equilibrated vith PBS/0.5 M NaCl. The column vas vashed vith 0.5 M NaCl/3 mM EDTA/ 100 mM Tris? pH 7.5 and eluted vith a 0.5 to 2 M NaCl gradient in the same buffer. Fractions vere assayed for PA-inducing activity, and the active fractions vere pooled and diluted vith 3 mM EDTA/ 20 mM Tris, pH 7.5 until the conductivity vas 20 mmho. The active material vas then passed through a second heparin-Sepharose column (10 x 75 mm) equilibrated vith 0.5 M NaCl in 3 mM EDTA/ 20 mM Tris, pH 7.5. The column vas vashed first vith 0.5 M NaCl and then vith 0.9 M NaCl in 3 mM EDTA/ 20 mM Tris, pH 7.5, and vas eluted vith a 0.9 to 2 M NaCl gradient in the same buffer. The active fractions vere concentrated on a -21- I \ 21863 1 o 10 15 20 UWIOWICI?^ jhcan. Henderson | jubov. oxrett j » ounnex. j 771 a stocct. h.w. ^•iHoran.o.c.aeoe* , j loai »]-u«o ! j third heparin-Sepharose column (7 x 85 mm), which was washed with : 0.5 M NaCl and then eluted with 2 M NaCl, both in 20 mM MES, pH I 6.0. The active fractions from the third heparin-Sepharose column were diluted 1:10 with 20 mM MES, pH 6.0, and the solution was clarified by centrifugation at 100,000xg for 1 h. The same was then loaded on a Mono-S FPLC column (Pharmacia) equilibrated vith 0.2 M NaCl/ 20 mM MES, pH 6.0. The column was washed with 0.2 M NaCl and elution was achieved with a multilinear gradient of NaCl (0.2 to 2 M in 20 mM MES, pH 6.0). The fractions were assayed for PA-inducing activity and the 1 active fractions were pooled and purity vas determined by NaOod . SO4-PAGE. 1 ! Example 4 i The Determination of the amino acid sequence of placental » ! angiogenesis factor (PAF) isolated from human placenta. A. LYS-C Peptides Purified PAF in 20 mM MES, pH 6.0, 0.5 M NaCl vas obtained j by the method of Example 2, above. The native protein vas sub-! jected to digestion vith endoproteinase Lys-C as follows: A re- i action mixture containing 2 nmoles of native protein in 350 ul of 20 mM MBS, pH 6.0, 0.5M NaCl vas adjusted to pH 8.7 by addition of 15 ul of 2 M NH4HCO3, pH 9.0. 1.17 units of endoproteinase Lys-C (Boehringer) vas added and digestion vas carried out at 37°C for 7 hrs. and 30 min. 2-mercaptoethanol vas then added to a final concentration of 1% (v/v) and inctjbation continued for 15 -22- o 10 15 20 25 218631 jC*n. Henderson .abov. Cajuuit a Dunne*. 4inotqn.o.c.xooo* min. at 37°C. Trifluoroacetic acid (TFA) was added to a final concentration of 0.1%'(v/v) prior to the fractionation of the digestion mixture by reverse phase high performance liquid i chromatography (KPLC) using a Synchros RP-8 column. The peptides ' were eluted from the column (flow rate 1.0 ml/min.) with 0.1% TFA ; in water (5 min.) followed by a linear gradient of acetonitrile f ! made 0.1% in TFA (0 - 60% acetonitrile in 60 min.). The elution I I of peptides was monitored at A215 and A28O and appropriate frac-| tions vere collected manually. A peptide eluting at 19% acetonitrile was sequenced by automated Edman degradation and gave the following sequence: (K ) -N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K In this and folloving sequences, an amino acid residue depicted vithin parentheses is a residue vhich has not been unambiguously identified. ~~ A peptide eluting at 19.8% acetonitrile vas sequenced and gave the folloving result: (K)-G—V-( )-A-H-( ) -Y-L-(A)-M-K-(E) -D-G-Another peptide fran the same digest eluted at 17.5% acetonitrile and gave the folloving amino acid sequence: (K)-L-Q-L-Q-A-E-E-R-G-V-V-S-1 -K A peptide that eluted at 26% acetonitrile vas subjected to automated Edman degradation and gave the folloving amino acid sequence : (K)-(C)-V-T-(D)-E-(C)-F-F-F-E-( )-L-E-S-N-N-Y-N-(T)- -23- 218631 i > J Two additional peptides that eluted together at 16% ! acetonitrile were collected as a mixture and then repurified i i prior to sequencing. The collected peptide mixture was dried under vacuum, then resuspended in 100 ul of 50 mM Tris-HCl, pH 8.5, 8 M urea. Twenty nmoles of dithiothreitol (DTT) was added and the reduction of possible disulfide bonds was allowed to proceed for 15 min. at 37°C. The peptides were then : carboxymethylated by addition of 60 nmoles of ^H-iodoacetic acid . and the mixture was incubated for 20 min. in the dark at room ; temperature. An additional 60 nmoles of DTT was added followed | by a 30 min. incubation at room temp, and the reaction mixture i was adjusted to 0.1% in TFA prior to refractionation by HPLC | using an Altex C-3 reverse phase column. The peptides vere eluted (flov rate 1 ml/min.) from the column vith 0.1% TFA in i ! water (5 min.) followed by a-linear gradient of acetonitrile made 0.1% in TFA (0-60% acetonitrile in 120 min.). ! The peptide eluting at 13% acetonitrile vas subjected to < automated Edman degradation and gave the folloving sequence: l (K) -G-V-C-A-N-R-Y-L-A-M-K i ' j B. SMP-Peotxdes Additional peptides vere generated by digestion of the native PAF protein vith mouse submaxillary protease. A solution containing 2 nmoles of protein in 350 ul of 20 mM MES, pH 6.0, 0.5 M NaCl vas adjusted to pH 8.0 by addition of 25 ul of 1 M NaHC03, pH 9.0. Suboaxillaris protease (3.6 ug) vas O 10 15 20 25 21863 1 .-cas. Henderson «abow. carrett 8 dunner st% a stscct.m.w. **vom. o. c. <ooo« .toait»3-«*«o added and the digestion was allowed to proceed for 24 hrs. a-37°c. 90 nmoles of DTT were added and the incubation at 37°c continued for 30 min. Carboxymethylation of the peptides was achieved by the addition of 360 nmoles of ^H-iodoacetic acid and incubation at room temperature for 20 min. in the dark. 360 nmoles of DTT were then added and the reaction mixture vas adjusted to 0.1% (v/v) in TFA, prior to fractionation of the I Ipeptide mixture by RP-8 HPLC as described above. ! A mixture of peptides eluting at 12% acetoftitrile vere collected in one fraction, dried down and resuspended in 100 ul of 50 mM Tris-HCL, pH 8.0, 8 M urea and then refractionated by HPLC ;iusing an Altex C-3 column and the same elution schedule as described above for the repurification of Lys-C peptides. Two peptides eluting at (a) 14.8% acetonitrile and (b) 15.3% acetonitrile were subjected to-automated Edman degradation and gave the folloving amino acid sequences: a) (R)-G-V-V-( )-I-K-G-V-C-A-N- b) (R)-L-V-C-K-N-G-G-F-F- Several peptides vere generated by digestion of the native PAF vith S. aureus protease (V8). One nmole of protein in 500 ul of 20 mM Tris-ECl, pH 7.5, 2M NaCl vas desalted by HPLC using an RP-8 reverse phase column. The salt free, protein-containing fraction vas dried dovn, resuspended in 50 ul of 50 mM acetic acid, pH 4.0 and 1 ug of V8 protease vas added. Digestion vas alloved to proceed for 18 hrs. at 37°C. Peptides vere then -25- 21863 1 10 15 20 can. henderson abov. carrett a dunnek. -s « •t»cct. w.w. ztom.o. c.aooo* fractionated by HPLC using an RP-8 reverse phase column as described above. A peptide eluting at 17% acetonitrile was subjected to automated Edman degradation and gave the following amino acid sequence: (E)-K-S-( )-P-H-I-K-L-Q-L-( )-A-E An additional peptide from the V8 digest that eluted at 20% acetonitrile was also sequenced and gave the following result: (E)-( )-(G)-( )-L-L-A-( )-K- A V8 peptide eluting at 21% acetonitrile was sequenced with the following result: (E)-S-N-M-Y-N-T-Y-R-(S)- Ordering of all the amino acid sequences listed above leads to a core sequence for the human basic fibroblast growth factor as follows: — L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K- S-( ) -P-H-1 -K-L-Q-L-Q-A-E-E-R-G-V-V-S-1 -K-G-V-C-A-N- R-Y-L-A-M-K-( )-D-G-( )-L-L-A-( )-K-()-V-T-( )-E-( )-F- F-F-E-( )-L-E-S-N-N-Y-N-T-Y-R-( )- Additional peptides were isolated and subjected to automated Edman degradation. These amino acid sequences are outside the core amino acid sequence listed above. A peptide eluting at 13% acetonitrile upon fractionation of the submaxillar is digest (see above) gave the following amino acid sequence: K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K -26- 71863 1 A LYS-C peptide eluting at 20% acetonitrile gave the following amino acid sequence: Y-( )-S-W-Y-V-( )-L-( ) Example 5 Identification of Characteristics of the Angiogenic Factor that Make it Suitable for Clinical Use as a Therapeutic Agent. We have demonstrated that the factor from placenta, isolated by the method of Examples 1 or 2, and the factor isolated from hepatoma cells have all three of the in vitro properties predicted for an angiogenic factor. First, at concentrations in the range of 0.1 to 10 ng/ml, the molecule stimulates the synthesis of PA and latent collagenase in BCE cells. The PA can convert the zymogen plasminogen to active plasmin, a protease of wide specificity. The plasmin can also convert latent collagenase to active coliagenase. Thus, under the influence of low concentrations of this factor, capillary endothelial cells can generate at least two proteases which are able to degrade most of the proteins in the surrounding tissues, which would allow the cells to penetrate the tissues. The purified molecule stimulated PA and collagenase synthesis in BCE cells in a dose-dependent manner (Fig. 3A). All collagenase was in an inactive from. Collagenolytic activity was detected after trypsin treatment. Both PA and latent collagenase are stimulated in parallel. Half maximal stimulation occurred with a concentration of protease-inducing factor of 1 ng/ml. The -27- 218631 basal amount of PA and collagenase produced by untreated cells varied from experiment to experiment, and, thus, the extent of stimulation also varied, with very high concentrations of the protease-inducing factor, the stimulation of PA synthesis was reduced as vere the chemotactic and mitogenic activities. Incubation of BCE cells for 24 hours vith concentrations of the protease inducing factor that induced PA and collagenase altered the morphology of the cells from their typical cobblestone appearance to a more elongated, spindle-shaped appearance. Second, the factor is chemotactic for BCE cells. In vivo, capillary endothelial cells, therefore, vould be stimulated to migrate tovard the source of the factor. The addition of the factor at concentrations between 0.001 and 0.1 ng/ml stimulated BCE cell chemotaxis in blind veil chambers. With higher concentrations, stimulation of chemotaxis did not occur. Increased cell movement from the upper chamber to the lover chamber vas detected only vhen the lover chamber contained a higher concentration of factor than the upper chamber, demonstrating that true chemotaxis vas occurring. Chemokinesis accounted for no more than 25% of the observed increased motility. Third, the factor is mitogenic for BCE cells. Figure 3B demonstrates that addition of the protease-inducing factor to I cultures of BCE cells stimulated the incorporation of ^^I-iodo-deoxyuridine into ONA in a dose-dependent manner. At higher concentrations of protease inducing factor, this stimulating effect -28- 218631 was significantly reduced. Stimulation of 12^I-iododeoxyuridine incorporation was ach-ieved with the same concentrations of factor which were able to induce PA and collagenase. We have previously determined that, with crude placenta sonicate, increased incorporation of 125I-iododeoxyuridine into DMA correlates with other measurements of mitogenesis. Thus, this factor behaves as a bona fide endothelial cell mitogen. Thus, a single purified molecule seems to have the ability to induce PA and collagenase in BCE cells, to stimulate their replication, and to stimulate their motility. Example 6 Angiogensis Activity Using the method of Dunn et al.. as published in Anat. Rec. 199: 33-42 (1981), for determining angiogensis, the angiogensis factor of Example 2, when placed on a chick chorioallantoic membrane, stimulated angiogensis in 81% of the eggs at a dose of 65ng. Example 7 a) N-Terminal Amino Acid Sequence of PAF Human placental angiogenesis factor vas purified as described previously (see Examples 1 and 2). The purified protein in 20 mM MES buffer, pH 6.0 and 500 mM NaCl vas desalted by high performance liquid chromatography using an RP-8 reverse phase column. Two-hundred fifty to five hundred pinoles of desalted protein vas applied to an ABI 470A gas-phase protein sequencer 21863 1 c o 10 15 20 25 .-CAN. HENDEJUON AA30V. GUUtEIT & Dunne*. /n ■ tracer. n. w. -4INOTOW. O. C.MOM •oaia»a-««so for automatic. Edman degradation. The resultant PTH amino acids vere identified by high performance liquid chromatography using a cyano reverse phase column. These experiments resulted in the establishment of an N-terminal amino acid sequence for PAF as follovs: G-T-M-A-A-G-S-I-T-T-L-P-A-L-P-E In addition, the N-terminal PAF amino acid sequence just described vas also identified by automated Edman degradation of a Lys-C peptide that eluted at 23% acetonitrile in the chromatographic system described in Example 4, A. b) C-Terminal Amino Acid Sequence of PAP A C-terminal PAF peptide vas isolated from the PAF Lys-C digest as described in Example 4. The peptide eluted at 22% acetonitrile. Automated Edman degradation of this peptide gave the folloving amino acid sequence: A-I-L-F-L-P-M-S-A-K-S Combining sequence data from (i) example 4; (ii) the N-terminal amino acid sequence of PAF; (iii) the C-terminal amino acid sequence of PAF; and (iv) cDNA, a complete amino acid sequence for PAF is as follovs: 1. PAF form 1 G-T-M-A-A-G-S-1 -T-T-L-P-A-L-P-E-D-G-G-S-G-A-F-P-P-G-H-F-K-D-P-K-R-L-Y-C-K-N-G-G-F-F-L-R-1 -H-P-D-G-R-V-D-G-V-R-E-K-S-D-P-H-1 -K-L-Q-L-Q-A-E-E-R-G-V-V-S-1 -K-G-V-C- -30- 218631 o 10 15 20 25 Um Offset can. hcnotmon a>ov. CAfucerr ft DUNNCR « « •Tf»<CT. N w. •••row. o. C. IOOO* Ott A-5I-H-Y-L-A-M-K-2-D-G-S-L-L-A-S-X-C-V-T-D-2-C-F-F-?-E-H-L-S-S-W-Sr-Y-»-T-Y-R-S-R-K-Y-T-S-W-Y-V-A-L-X-R-T-G—Q-Y-K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K-S. 2. PAF form 2: N-terainallr blocked PAF From a number of experiments in which purified and intact PAF was subjected to au tana ted Sdaan degradation, it became evident that a fraction of the applied protein (50-80%) is not degraded in the Edman procedure. It is concluded that there exists a fraction of PAF protein ! molecules that are *-terminally blocked. The nature of the blocking group is most clearly determined ! by the study of purified amino terminal PAF peptides. Amino terminal peptides from enzymatic degradations of PAF (see example 4) are identified by amino acid -analysis. They may also be identified by paper electrophoresis or thin layer chromatography followed by staining vith the chlorine/o-tolidine reagent as described by (Reindel, F. and Hoppe, W. (1954) in Chem. Ber. 87, 1103-1107 specifically incorporated herein by reference. j (Blocked peptides are not detected vith ninhydrin (apart from a ■ weak development of colour vith the side-chains of lysine resi-! dues) unless first hydrolyzed.) In addition, small, N-terminally blocked PAF peptides may be isolated by chromatography of acidified therstolysin or pepsin PAF digests on Dovex 50, X2 (K* form) as described by Narita et al. -31- n- 21863 1 (1975) in Protein Sequence Determination, pp. 30-103, Springer-Verlag, Berlin, Heidelberg, New York or by chromatography on Sulphoethyl-Sephadex as described by Kluh, I. (1979) in Coll. Czech. Chem. Comm. (Engl. Ed.), 44, 145-147, both 5 of which are specifically incorporated herein by reference. The structure of the short blocked peptides is determined by a variety of standard procedures and methods. For example, see Allen, G. (1981) in Sequencing of Proteins and Peptides; North Holland Publishing Company, Amsterdam, New York, Oxford or refer-10 ences discussed therein, which are specifically incorporated herein by reference. These procedures and methods include digestion of the N-terainally blocked peptides vith carboxypeptidases, proglutamate aminopeptidase, hydrazinolysis, mass spectrometry, nuclear magnetic resonance spectrometry, gas chromatography, and 15 fast-atom bombardment mass spectrometry as described by Boissel et al. (1985) Proc. Natl. Acad. Sci. USA, 82, 8448-8452. -*\ 3. PAF form 3: Truncated and Extended PAF It has been shovn that bovine kidney fibroblast grovth factor (FGF) lacks a number of amino acids from the N-terminus 20 (Baird, A. et al. (1985); Regul. Pept; in press) (Gospodarovicz, 'O D. (1986) Meth. Enzymol., in press). The truncated fibroblast i grovth factor retains its ability to bind to the FGF receptor, as i! j shovn by Neufeld, G. and Gospodarovicz, D. (1985) in J. Biol. Chem. 260. 13860-13868, indicating that the N-terminus of the protein does not play a crucial role in the interaction of FGF -jecan. hendouon . «xabov. okrstr 8 dunne*. 7ts « stocct.m.w. .MiNaTow.o.e.aooo* —32— 21863| o ' vith its cell surface receptor. Therefore, is anticipated that both truncated and extended forms of PAF will retain receptor binding activity. The maximum N-terminal PAF deletion or extension that still allows for biological PAF activity remains to be 5 determined. Example 8: A cDNA Clone of PAF SK-HEP-1 cells vere grown in Eagles Minimal Essential Media supplemented with 10% fetal calf serum, non-essential amino acids and Pen-Strep. RNA was isolated from cells using the NP-40 lysis 10 procedure as described by Maniatis et al. in Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Nev York, 1982, pg. 191-193), specifically incorporated herein by reference. Poly (A)* mRNA vas selected by oligo dT chromatography (BRL) using the procedure of H. Aviv and P. Leder described in IS Proc. Natl. Acad. Sci. USA 69,-1972, 1408 specifically incorporated herein by reference. Five ug of mRNA vas used to synthesize 8 ug of double stranded cONA using oligo dT primed 1st strand synthesis and RNase H-DNA polymerase mediated 2nd synthesis as described by Gubler and Hbffman in Gene, 25 (1983) 20 263-269, specifically incorporated herein by reference. Amersham •Reagents vere used in this procedure. The folloving reactions, unless othervise stated, vere done according to manufacturers specifications. This cDNA vas blunt ended using 10 units T4 DNA Polymerase (Amersham). EcoRI sites vere protected vith 400 units 25 EcoRI methylase (Nev England Biolabs) and 100 mM S-adenosyl ican. Henderson abow. Garrett a dunner y% « srwcer.N.w. - 3TON.O.C.tOOO« -33- 218631 methionine. An equal mass amount of EcoRI linkers (New England Biolabs, 8 mer) were attached with 1 unit T4 ONA ligase (Promega Biotec). Excess linkers were removed by digesting with 200 units EcoRI (New England Biolabs) and 100 ng of this cONA was ligated into 1 ug of EcoRI-digested, alkaline phosphatase-treated lambda gt-10 ONA (Vector Cloning Systems). The ONA was the packaged in vitro (Vector Cloning Systems) and when plated on coli. C600 HFLa yielded 8.2 X 10s recombinants. Design of Oligonucleotide Probes Two mixed sequence oligonucleotide probes vere used for the isolation of the SK-HEP-1 cDNA clone. The probes consist of pools of all possible DNA sequences for a given amino acid sequence. Probes vere made to selected amino acid sequences in the core PAF amino acid sequence described in this application. Probe #5 vas made to hybridize to DNA coding for the amino acid sequence Ile-Lys-Gly-Val-Cys-Ala, and is a 17-mer consisting of 192 sequences: #5 He Lys Gly Val Cys Ala 5* ATZ AAN GGX GTX TGY GC 3* 192-fold degenerate, 17 mer 2 18631 Code X « A, T, G or C M » A or G Y » T or C 2 » T, C or A Probe #8 was made to hybridize to DNA coding for the amino acid sequence Tyr-Cys^Lys-Asn-Gly-Gly-Phe, and is a 20 mer consisting of 256 sequences: #8 Tyr Cys Lys Asn Gly Gly Phe 5* TAY TGY AAN AAY GGX GGX TT 3-' 256-fold degenerate, 20 mer Both probes vere synthesized on em Applied Biosystems DNA synthesizer. They vere gel purified and radiolabeled vith £ ^-^2P] ATP (Amersham) using T4 polynucleotide kinase (Pharmacia) to a specific activity of 4-6 X 10® cpm/pmol. Hybridization temperatuces vere chosen to be 2°C below the calculated Tm for the most AT-rich member of each pool as described by S.V. Suggs et al., (Developmental Biology Using Purified Genes (eds. D.O. Brow and C.F. Fox), 683-693 (1982) Academic Press, Nev York), specifically incorporated herein by reference. The final vash vas done at the calculated Tm for the most AT-rich member of the pool (i.e., 2°C above the hybridization temperature). Screening The cDNA library vas plated at a density of 50,000 plaques per 150 mm Luria-Bertoni agar plate vith coli C600 HFLa cells -35- 218^3 1 © ,o, 10 15 20 .25 il iOM. Henderson \80"». oxaett 8 Dunne*. M4TQN. O. C.*000« ot» Jtl*U10 and NZCYM top agarose (0.7%). Phage DNA was transferred to duplicate nitrocellulose filters (Schleicher and Schuell, BA 85) : and prepared for hybridization as described by Benton and Davis in Science, 196: (1979) 180-182, specifically incorporated herein by reference. The filters were prehybridized at 48°C for 2 hours in a solution containing 6X SSC (20X SSC is 3M NaCl, 0.3 M Sodium Citrate, pH 7.5), 2X Denhardts Solution (100X Denhardts Solution is 2% Ficoll, 2% Polyvinyl pyrrolidone and 2% BSA), 0.1% SDS, 0.05% Sodium Pyrophosphate and 100 mg/ml yeast tRNA. Probe : #8 was added at 0.2 pmol/ml and allowed to hybridize for 16 hours. After hybridization, the filters vere washed as follows: j 3 times for 15 minutes each in 6X SSC and 0.1% SDS at ambient ' temperature followed by a final 8 minute wash at 50°C. The fil-I ters were then dried and autoradiographed for 24 hours on Kodak ' XAR5 film and one "lightening_4>lus" intensifying screen at -70°C. Plaques giving positive signals on duplicate filters vere picked for purification. Those plaques vere tested vith probes #5 and #8 in second round of purification and a plaque hybridizing to both probes vas chosen as the best candidate to code for the angiogenesis factor. DNA vas prepared from this phage by plate lysates and for-mamide extraction as described by R.W. Davis, D. Botstein, and ! J.R. Roth in Advanced Bacterial Genetics: A Manual for Genetic Engineering (Cold Spring Harbor Laboratory, Nev York, 1980), specifically incorporated hereby in reference. An EcoRI digest of -36- o o 10 15 20 c?5 118631 ua orrtccf nnecan. kenoouon rarabov. Camlett 8 Dunns* i7ts « «t*cct.n.w. :mmotom.o. e.tooo« »Oti this DNA released a 1.1 kb insert as sized in 1% agarose gel. This insert was purified out of a 5% acrylamide gel for .j subcloning as described by Maniatis et al., supra, at 173-178. The insert was ligated into EcoRI digested Bacteriophage M13 mp 19 RF DNA and its sequence was determined using the dideoxy-nucleotide method of Sanger~et al. described in J. Mol. Biol. 94, . 441 (1975), specifically incorporated herein by reference. Analysis of the sequence obtained showed an open reading frame i 1 encoding the primary structure of PAF. ♦ Based on protein sequence data (see Example 7) and published ; FGF information (Esch et al. (1985); Proc. Natl. Acad. Sci. USA i j 82# 6507-6511) it appears that several active PAF forms may be i ! produced: Form 1 PAF (see also Example 7) may be produced from l j this DNA by initiation of translation at some point 5* to the se- « • quence AGTMAA... and subsequent post-translational cleavage of ! the AG bond by a process yet to be established. In addition, a i form 3 PAF may be produced by initiation of translation at the | MAA sequence, since this is a consensus initiation site (M. i : Kozak, Microbiol. Rev. 1983, Vol. 47, 1-45) vith optional proteolytic removal of the Methionine. Form 3 PAF may also be produced by initiation at other functional initiation sites. These sites are readily discernable to one of ordinary skill in the art, particularly in light of the teachings contained herein. In addition, post-translational processing of the initial translation product may then follov, although such processing is not -37- 21863 1 required. Form 2 PAF may be produced from form 1 or form 3 of ; PAF by an as yet unknown process leading to blockage of the free ■ amino group at the N-terminus. Example 9: Expression of PAF The principle of the expression of PAF is as follows. A 1.1 kb EcoRI fragment isolated from the lambda gtlO clone can be subcloned into the plasmid pUC9. That fragment contains all of the PAF coding sequence. Two smaller fragments from this subclone are of utility in constructing expression systems. One is a 367 bp Aval to BamHI fragment which contains amino acid residues 17 through 137 of the PAF coding sequence, counting the GTMAA residues of the placental form 1 protein as 1-5. The other is a 405 bp Ncol to BamHI fragment which contains amino acid residues 4 through 137 of the PAF coding sequence. Synthetic adaptors can then be attached~to complete the coding sequence at both ends of these restriction fragments to provide translational initiation, termination, or coupling sequences and to supply the sequences necessary for attachment to the appropriate expression vector. PAF isolated from human placenta contains a sequence which starts with GTMAA. The cDNA clones isolated from SK-Hep-1 cells indicates that other forms of PAF may be synthesized starting at least 100 amino acids upstream of the GTMAA sequence, or starting with MAA. The placental form was chosen for expression in yeast (S. cerevisiae) and bacteria (E. coli). The potential SK-Hep-1 -38- O 10 15 20 2 18631 form and any other amino terminally truncated form can be expressed by minor modifications of the procedures described below that should be obvious to one skilled in the art. They consist of altering the synthetic adaptors used to attach the amino terminal end of the cDNA fragment (either the Ncol site or the Aval site) to the expression vectors. Alternatively, plasmids expressing truncated forms can be constructed from the GTMAA forms described below by oligonucleotide-directed deletion mutagenesis (as described by M. Inouye, K. Nakamura, S. Inouye, and Y. Masui in "Nucleic Research Future Development," K. Mizobuci, J I. Watanabe, and J.D. Watson, eds.. Academic Press, New York, pp. ■I ; 419-436, 1983, specifically incorporated herein by reference). | Adaptors | The following adaptors were synthesized on an Applied 1 ! Biosysterns ONA synthesizer and gel purified. The 5* ends were ■ phosphorylated with T4 polynucleotide kinase (Pharmacia). Pairs i of complementary oligonucleotides were annealed as follows to . form the double stranded adaptor. Equimolar amounts of each j oligonucleotide were added to a solution of 50mM NaCl, lOmM Tris j pH 7.5 and lmM EDTA. This solution was heated in a boiling water i bath. The water bath was then removed from heat and allowed to cool to ambient temperature over two hours. The following is a list and description of the adaptors used. u» ornct^ ^ | iCAN. Henderson , abow. Carrot- i 8 Dunne*. *T»CCT.«.W. n«tqm.o.c.soo«t -39- PAP Adaptors Cor attachment to the -factor promoter of yeast NH3 terminal adaptors! «1, GT Porn HlndllI »1A 5' AGCTTGGATAAGAGAGGGAC 3' To Ncol site of site of PAP -factor fllB 3' ACCTArrCTCTCCCTOOTAC 5' 12, GOOH terminal adaptors BaaHI «2A 5' QATCTAAAACAflQACCTOGQCAGAAAGCTATACTTrTrCTTCCAATGTCrQCTAAQAGCTGATAAQCC 3' To Sail site of site of PAP I2B 3' ATTTTQTCCTGGACCCGTCTTTCOATATGAAAAAGAAOOTTAGAGACOATTCTCGACTATTCGGAGCT 5' -factor -40- l Uliill o o o o o Adaptors Cor Expression in Ej. coli For cytoplasmic production 13 NH3 terminal adaptors Cor GT Corm 13a Pvul site 5' CAAOGAOAAATAAATGGGGAGCATGGCAGCCGGGAGCATCACCACGCTGCCCGCCTTGC 3* Aval site lb of~Omp 3* TAGCTCCTCTTTATTTACGCCTGGTAGCGTCGGCCCTCGTAGTGGTGCGACGGGCGGAACGGGCT 5' of PGR Qmp EcoRI to Pvul fragment 5' AATTCGATATCTCGTTQGAGATATrCATGACGTATTTTGGATGATAA^GAGGCGCAAAAAATGAAAAAGACAGCTATCGCGAT 3' 3' GCTATAaJUaCAACCTCTATAAGTACTQCATAAAACCTACTATTGCTCCGCGTrTTTrACTTTrTCTGTCGATAGCGC 51 14, COOH terminal adaptor; BamHI liA 5' GATCTAAAACAGGACCTGQQCAQAAAGCTATACTTmCTTCCAATGTCTGCTAAGAGCTGACTGCA 3' to PstI site of site of pCJ-1 PAP MB 3' ATTTTGTCCTGGACCCGTCTTTCGATATGAAAAAaAAGGTTACAGACGATTCTCGACTG 5' -41- 00 LA (...) o o o 0 Adaptors Cor Secretion of PAF In Ej, coll using the Omp leader sequence NH3 terminal adaptors 15 GT Corn: I5a 5* CCGGGACCATGGCAGCCGGGAGCATCACCACGCTGCCCOCCTTGC 3' To Aval Site 61 PAF 15b 3' GGCCCTGGTACCGTCGGCCCTCGTAGTGGTGGGACGGGCGGAACGGGCT 5* Both oC these adaptors will be ligated to the Gap leader described below. 5' AAnCGATATCTCGTTGGAGATATTCATOACGTATTTTQaATaATAA(iGAGGCGCAAAAAATaAAAAAGACAGCTATCGCGATCGCAGTGGC 3' GCTATAGAGCAACCTCTATAAGTACTGCATAAAACCTACTARGCTCGGCGTTTTTrACTrTTTCTGTCGATAGCGCTAGCGTCACCG ACTGGCTGGTT7CGCTACCGTAGCGCAGG 31 TGAOCaAOCAAAGOQATGGCATCGCGTOC S• 14, COOH terminal adaptor! BattHI I4A 5' GATCTAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGACTGCA 3' To PstI site of site oC pCJ-1 PAP I4B 3* ATrTTGTCCTGGACCCGTCTTTCGATATGAAAAAGAAGGTTACAGACGATrCTCGACTG 5' -42- 09 a* LA O 0 176 206 GGG ACC ATG GCA GCC GGG AGC ATC ACC ACG CTG CCC GCC TTG CCC GAG GAT GGC GGC AGC Gly Thr Met Ala Ala Gly Ser lie Thr Thr Leu Pro Ala Leu Pro Glu Asp Gly Gly Ser 236 266 GGC GCC TTC CCG CCC GGC CAC TTC AAG GAC CCC AAG CGG CTG TAC TGC AAA AAC GGG GGC Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Lys Asn Gly Gly 296 326 TTC TTC CTG CGC ATC CAC CCC GAC GGC CGA GTT GAC GGG GTC CGG GAG AAG AGC GAC CCT Phe Phe Leu Arg lie His Pro Asp Gly Arg Val Asp Gly Val Arg Glu Lys Ser Asp Pro 356 386 CAC ATC AAG CTA CAA CTT CAA GCA GAA GAG AGA GGA GTT GTG TCT ATC AAA GGA GTG TGT His He Lys Leu Gin Leu Gin Ala Glu Glu Arg Gly Val ^al Ser lie Lys Gly Val Cys 416 446 GCT AAC CGT TAC CTG GCT ATG AAG GAA GAT GGA AGA TTA CTG GCT TCT AAA TGT GTT ACG Ala Asn Arg Tyr Leu Ala Met Lys Glu Asp Gly Arg Leu Leu Ala Ser Lys Cys Val Thr 476 506 GAT GAG TGT TTC TTT TTT GAA CGA TTG GAA TCT AAT AAC TAC AAT ACT TAC CGG TCA AGG Asp Glu Cys Phe Phe Phe Glu Arg Leu Glu Ser Asn Asn Tyr Asn Thr Tyr Arg Ser Arg 536 566 AAA TAC ACC AGT TGG TAT GTG GCA CTG AAA CGA ACT GGG CAG TAT AAA CTT GGA TCC AAA Lys Tyr Thr Ser Trp Tyr Val Ala Leu Lys Arg Thr Gly Gin Tyr Lys Leu Gly Ser Lys 596 ACA GGA CCT GGG CAG AAA GCT ATA CTT TTT CTT CCA ATG TCT GCT AAG AGC TGA Thr Gly Pro Gly Gin Lys Ala He Leu Phe Leu Pro Met Ser Ala Lys Ser End 213631 Example 9: Construction of Yeast Expression Plasmin A plasmid, pGS185, derived from pUC 8 but lacking the restriction sices in the polylinker from the Hind III site to the Smai site, was constructed by digesting pUC 8 with Hind III, ligated it to a Hind III/SmaI adaptor (Amersham, Cat. No. DAI006) which does not reconstruct the Hind III site, digesting with Smat and ligating in dilute solution (1 ng/ml) followed by transforma~ tion of E. coli JM 83. The correct plasmid, was identified by digesting plasmid DNA isolated from transformants with EcoRI, Smai or Hind III. A transformant containing a plasmid that lacked the Hind III site but contained the EcoRI site and Smai site was identified in this manner. An EcoRI fragment containing yeast MFXl gene was purified by gel electrophoresis from the plasmid pCY17 as described by J. Kurgan and I. Herskowitz in Cell 30:933 (1982) and ligated into EcoRI cut pGS185. This ligation mixture was used to transform E. coli HB101, selecting for ampicillin resistance. Plasmid DNA vas isolated from transformants and the presence of the correct insert confirmed by digests of the DNA with EcoRI. This is plasmid pGS285. Plasmid pGS285 was digested to completion with Hind III and religated under dilute conditions (1 ng/ml) to eliminate three of the four internal Hind III sites in the MP 1 gene as noted by Kurjan and Herskowitz, ibid. The correct construct was selected as described above. This is plasmid pGS385. -44- o 10 15 20 25 218^31 j*n. Hendbuon war. Omuiett a Dunne* , ft •tftcct. m m. 4T&M.0. c.sooe* For site-directed mutagenesis, the MF 1 gene vas removed from pGS385 by digestion vith EcoRI. gel purified (1.5 Kb) and ligated to EcoRI digested M13 mpl8 RF. The ligation mixture vas used to transform EL coli 71-18 and clones containing the MF 1 gene in the correct orientation vere identified by hybridization to the [32P] labeled MFo<l gene. The MF 1 sequence vas changed from GTA TCT TTG GAT AAA AGA to GTA AGC TTG GAT AAA AGA using standard site directed in vitro mutagenesis methods described by Zoller and Smith (Methods in Enzymology, Vol. 100, 1983, Academic Press, Inc., p. 468). The sequence of the mutant -factor gene, MF -H, vas confirmed by dideoxy sequencing. The MFgene vas removed by digesting the RF form of the } Ml3 mpl8 clone vith EcoRI. gel-purifying the resulting 1.5 Kb EcoRI fragment by acrylamide gel electrophoresis and ligating it to EcoRI cut pGS185. The resulting ligation mixture vas used to transform E^ coli HB101 and colonies containing the plasmids vith the MF -K gene vere identified by hybridization vith ^2p labeled 1.5 Kb EcoRI fragment containing the MFoc-H gene. This plasmid is designated pGS286. The PAF gene vas inserted into pGS286 as follovs. Adaptors j #1 and #2 vere ligated to the PAF Ncol/BamHI fragment. The ligation mixture vas electrophoresed on a polyacrylamide gel and PAF ONA vith the attached adaptors identified by an increase in MW. This correctly adapted ONA fragment vas eluted from the gel, and -45- 218&3 1 10 15 20 25 »w ornecs an Henderson sow gak.r-ett - Dunner. * STRICT M W OTOM O C IOOO« 'J) IS3-««IO was ligated to Hind Ill/Sail digested pGS286. EL coli HB101 was transformed with the ligation mixture and ampicillin resistant colonies were selected. Transformants containing plasmids with the correct insert were identified by hybridization with adaptor 1A and 2A, radio labelled by incubation with [^--^P]ATP and T4 polynucleotide kinase. A plasmid constructed and isolated in this manner has been designated pGS286-PAF. This plasmid contains the MF H gene fused, in frame, to the PAF gene at the Hind III site in the "pre-pro" region of the MF H gene. Such constructs, when placed in yeast, have been demonstrated to direct the synthesis, processing and secretion of heterologous proteins as shown by A.J. Brake et al.. 1981 (PNAS (USA) 81:4642). The EcoRI fragment containing the fusion of the MF H gene and PAF is pGS286-PAF. This fragment was isolated by digestion with EcoRI and polyacrylamide_gel electrophoresis. It was made blunt ended with T4 DNA polymerase and PstI adaptors (Pharmacia) were attached with T4 DNA ligase. The fragment was then ligated into PstI digested vector pCl/1 (A.J. Brake et al. 1981) (PNAS, (USA) 81:4642) and EL coli HB101 transformed with the ligation mix and TETr colonies were selected. Correct constructs were identified by hybridization to the PAF gene. This plasmid was introduced into Sj. cerevisiae DBY 746 (Yeast Genetic Stock Center, Berkeley, CA), vith the tvo micron DNA plasmid deleted as described by Toh-E and Wickner (Journal of Bacteriology, 145, -46- I 218631 1981, 1421-1424), by standard transformation protocols. Trans-! formants expressing PAF were selected by their reactivity with j affinity purified anti PAF IgG. Example 10: Periolasmic Secretion in E. coli To regulate the expression of PAF in a form suitable for export to the periplasm of coli. the following regulatory elements were used: a tac promoter on plasmid pCJ-1 for initiation of transcription at high levels; a lac operator on plasmid pCJ-1 for transcription regulation; a lac repressor (lac 1^), encoded on the chromosome of E^ coli strain JM107. To facilitate periplasmic export of PAF, ONA coding for the Omp A leader peptide vas attached to the DNA coding for PAF in such a way that the C-terminal Ala of this peptide will be fused to the N-terminal Gly of PAF form 1 in such a vay that the Ala-Gly bond of the initial product vill be cleaved by the E^ coli leader peptidase to yield the mature PAF. The coli secretion vector vas constructed as follovs. Adaptors #5 and #4 vere ligated to the PAF Aval/BamHI fragment. ONA of the correct size vas eluted from a polyacrylamide gel and ligated to the Omp A leader DNA and EcoRI/PstI digested M13 mpl9 RF. coli JM-107 vere transformed vith the ligation mix. Transformants containing the PAF gene vere detected by restriction mapping and the sequence of the construct vas confirmed by dideoxy sequencing. The EcoRI/PstI fragment containing the PAF n * < 10 15 20 25 218*>3t iCAN. henderson <abov. Garrett a OUNNCK. Tt « STftCCT.M.W. «i*»OTeM. o. e. iooo« IOIlt»S*MM gene was isolated from the RF DNA by restriction with EcoRI and PstI and elution from a polyacrylamide gel. This was ligated | into EcoRI/PstI digested pCJ-1 and coli JM107 were transformed ! with the ligation mixture. Colonies producing PAF were selected by growth on Tet plates and inununoscreening vith affinity purified anti-PAF IgG. Example 11: Cytoplasmic Expression in E. coli To regulate the expression of PAF in a form such that the • PAF remains in the JL coli cytoplasm, the following operational • elements were used: the tac promoter on plasmid pCJ-1; the lac | operator of the plasmid pCJ-1 and the lac repressor (lac l3) on ! , the chromosome of coli strain JM107; a consensus Shine-| Dalgarno sequence; and, to initiate a high level of translation, i a fragment of the Omp A leader peptide to be used as a translational coupler. The translational coupling sequence comprises the ONA coding for the translation initiation region of the Omp A gene, the first eight amino acids of the Omp A leader peptide, ! the consensus Shine-Oalgarno sequence described above and a translational terminator. The translational coupling sequence is | to be inserted between the lac operator and the translation < initiation site of the PAF gene, overlapping the latter. (The | features of the translational coupler are incorporated on the DNA sequence shovn vith the adaptors for secreted expression in E. coli.) -48- : t 218&31 The PAF gene was incorporated into the pCJ-1 plasmid with the translational coupler as follows. Adaptor #3 and the Omp A translational coupler were attached to the PAF Aval/PstI fragment : from the M13 mp!9 construct described in Example 10. This fragment was purified from a polyacrylamide gel. This fragment was i then ligated into EcoRI/Pst I "digested M13 mpl9 RF and the liga- I • tion mix used to transform E^. coli JM 107 cells. Plaques con-i taining the the PAF gene fusion were chosen by restriction mapping. The sequence of the construct was then confirmed by dideoxy sequencing. The BcoRI/PstI fragment containing the PAF gene fusion was eluted from a polyacrylamide gel and ligated into EcoRI/PstI digested pCJ-1 and E^ coli JM107 cells were transformed vith the ligation mix. Colonies showing tetracycline resistance were selected and PAF production was confirmed by ! immunoscreening vith affinitupurified anti-PAF IgG. | It vill be apparent to those skilled in the art that various modifications and variations can be made to the processes and products of the present invention. Thus, it is intended that the ' present invention cover these modifications and variations of this invention provided they come vithin the scope of the appended claims and their equivalents. Example 12: Cytoplasmic Expression in E.coli The Ml3 and mpl9 secretion construct described in Example 10 vas digested vith Nrul and Ncol and the large fragment vas eluted © 10 218631 i from a gel. Adaptor #6 was then ligated into the Nrul/Ncol cut DNA. E. coli strain JM107 was transformed vith the ligation mix. Plaques containing the PAF gene fusion vere confirmed by dideoxy sequencing. The EcoRI/PstI fragment containing the PAF gene fusion vas eluted from a polyacrylamide gel and ligated into EcoRI/PstI digested pCJ-1 and E. coli JM107 cells vere transformed vith the ligation mix. Colonies shoving tetracycline resistance vere selected and PAF production vas confirmed by immunoscreening vith affinity purified anti-PAF IgG. Adaptor #6 #6a Nrul site 5' CGATCAAGGAGAAATAAATGGGGAC 3* To Ncol #6B OF Omp 3' GCTAGTTCCTCTTTATTTACCCCTGGTAC 5* site of PAF iw. Henderson xw. GMutrrr > Dunne*. . ■ tracn.N.w. 4tom.o.e.iooo« ^*1 t*3-4«so -50- </div>

Claims

<div id="claims" class="application article clearfix printTableText"> 2 18631 Example 13; Identification of mRNA Total RNA was isolated from the following cell lines: SK HEP-1 human hepatoma cells, human embryonic lung (HEL) cells, RPMI 7272 human melanoma cells and mouse sarcoma 180 cells. Poly A plus minus messenger RNA (mRNA) was then isolated using oligo (DT) cellulose chromatography. Fifteen micrograms of poly A plus minus RNA from each of the above cell lines was separated by electrophoresis on a 1.25 percent agarose/formaldehyde gel. These RNAs were transferred to a zeta-probe membrane. A cDNA probe to human basic FGF from SK HEP-1 human hepatoma cells 32 (FGF15, the EcoRI insert) was labeled with P-DCTP by the NICK 8 translation procedure to a specific activity of 8.64 X 10 32 cpm/ug. Hybridization of the P-BFGF cDNA probe to the transferred RNA was carried out in 50 percent formamide, 6X SSC, 2X Denhardt's solution, 1 percent SDS, 0.05 percent sodium pyrophosphate and 175 ug/ml tRNA for 16 hours at 42° C. The zeta-probe membrane was then washed in 1 liter each of 0.5X SSC/1 percent SDS, 0.2X SSC/1 percent SDS, 0.1X SSC/1 percent SDS for 15 minutes at 65° C and in 0.1X SSC/1 percent SDS for 15 minutes at 70° C. The membrane was then dried and autoradiography carried out for 1 and 3 days at -80° C. SK HEP-1 cells, HEL cells and RPMI 7272 cells each contained four species of RNA having sizes of 8.0 KB, 4.3 KB, 2.3 KB and 1.0 KB which hybridized to the cDNA probe described above. The cDNA probe did not hybridize to any RNA species from mouse sarcoma 180 cells. * 21863 1 WHATT -f/WE CLAIM IC: WBkT -^jgatfWEer -£S:

1. An angiogenic factor comprising a purified, human or synthetic single-chain polypeptide protein exhibiting substantial homology to the native angiogenic factor isolatable from human placental tissue, wherein said angiogenic factor has at least one active site possessing an activity selected from the group consisting of mitogenic activity, chemotactic activity, the ability to stimulate protease synthesis, and combinations thereof.

2. An angiogenic factor comprising a purified, single- i (jpolypeptide-chain protein having at least one active site I possessing mitogenic and chemotactic activity and the ability to 1 | stimulate protease synthesis, said protein exhibiting substantial ' j !! homology to the native angiogenic factor isolatable from human lj placental tissues. j i

3. The angiogenic factor of claim 1 wherein said angio-genie factor has at least one active site possessing chemotactic .j activity and which has the ability to stimulate protease synthe- • i • :• sis. :j

4. The angiogenic factor of claim 1 wherein said angio- !| !| genie factor has at least one active site possessing mitogenic activity and the ability to stimulate protease synthesis.

5. The angiogenic factor of claim 1 wherein said angiogenic factor is isolated from human placenta in a substantially '! purfied form. !l LAW OFFICES ! < ican. Henderson !> *abow. Garrett 8 Dunner .; IIOIKr.N.O. ' o. c. spoe« - 52 - -4 -A 18^31 J

6. An angiogenic factor protein comprising a purified, single-polypeptide-chain protein having at least one active site possessing mitotic and chemotactic activity and the ability to stimulate protease synthesis, wherein said protein comprises in part the amino acid sequences: L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K-S-()-P-H-I-K-L-Q-L-Q-A-E-E-R-G-V-V-S-I-K-G-V-C-A-N-R-Y-L-A-M-K-()-D-G-()-L-L-A-()-K-()-V-T-()-E-( ) - F-F-F-E-()-L-E-S-N-N-Y-N-T-Y-R-()-; j K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K; and i Y-( )-S-W-Y-V-( )-L-{ ).

7. An angiogenic factor protein comprising a purified, single-polypeptide-chain protein having at least one active site possessing mitotic and chemotactic activity and the ability to stimulate protease synthesis, wherein said protein comprises in part the amino acid sequence: G-T-M-A-A-G-S-I-T-T-L-P-A—L-P-E-D-G-G-S-G-A-F-P-P-G-H-F-K-D-P-K-R-L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K-S-D-P-H-I-K-L-Q-L-Q-A-E-E-R-G-V-V-S-I-K-G-V-C-A-N-R-Y-L-A-M-K-E-D-G-R-L-L-A-S-K-C-V-T-D-E-C-F-F-F-E-R-L-E-S-N-N-Y-N-T-Y-R-S-R-K-Y-T-S-W-Y-V-A-L-K-R-T-G-Q-Y-K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K-S.

8. An angiogenic factor protein wherein the amino acid sell quence of the protein differs from the sequence in claim 7 by one I i • f ;i j! law orriccs |i amino acid residue. <(ecan. Henderson i1 arabcw. Garreit 8 Dunner i j 77% k stkcct.n.w. 1 mimctom.o. c.zoooa tzowzsa-easo - 53 - -V18631

9. An angiogenic factor protein wherein the amino acid sequence of the protein differs from the sequence in claim 7 by two amino acid residues.

10. The angiogenic factor protein of claim 7 wherein said protein is N-terminally blocked.

11. A method for obtaining an angiogenic factor in pure form from tissue comprising: (a) collecting tissue capable of producing the i ! angiogenic factor; jj (b) isolating the angiogenic factor from the tissue by I! fractionating the proteinaceous material in the tissue; (c) identifying the fractions which possess angiogenic I factor activity; and j (d) concentrating the fractions exhibiting angiogenic l factor activity wherein the angiogenic factor I : comprises single-chain polypeptide protein • exhbiting substantial homology to the native angiogenic factor isolatable from human placental tissue wherein said angiogenic factor has at least one active site possessing an activity selected from the group consisting of mitogenic activity, chemotactic activity, ability to stimulate protease synthesis, and combinations thereof. ... 218631 n

12. The method of claim 11 wherein the tissue capable of producing the angiogenic factor is human placental tissue.

13. A method for the production of angiogenic factor wherein said angiogenic factor comprises a single-chain polypeptide exhibiting substantial homology to the native angiogenic factor isolatable from human placental tissue wherein said angiogenic factor has at least one active site possessing an activity selected from the group consisting of mitogenic activity, | chemotactic activity, the ability to stimulate protease synthe-.. sis, and combinations thereof, comprising: .j ' (a) isolating a DNA sequence encoding the angiogenic factor; (b) inserting the DNA sequence into a vector capable of expression in a host microorganism; (c) transforming the vector containing the DNA sequence into a host microorganism capable of expressing the angiogenic factor; (d) expressing the angiogenic factor from the transformed microorganism; and (e) in either order, isolating and purifying the expressed angiogenic factor.

14. The method of claim 13 wherein the host microorganism !« !' is transformed with pGs286-PAF. k/wvorriccs ican. Henderson .bout. Garrett & Dunner -r * STitcrr n.w. oroN.o.c.zoooe r ifi f 17 JAN1990 ' - 55 - ?!8631

15. The method of claim 13 wherein the DNA sequence encodes a protein containing the amino acid sequence: L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K-S-()-p-H-I-K-L-Q-L-Q-A-E-E-R-G-V-V-S-I-K-G-V-C-A-N-R-Y-L-A-M-K-()-D-G-()-L-L-A-()-K-()-V-T-()-E-()-F-F-F-E-()-L-E-S-N-N-Y-N-T-Y-R-()-; K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K; and Y-( )-S-W-Y-V-( )-L-( ).

16. The method of claim 13 wherein the DNA sequence encodes : a protein containing the amino acid sequence: G-T-M-A-A-G-S-I-T-T-L-P-A-L-P-E-D-G-G-S- G-A-F-P-P-G-H-F-K-D-P-K-R-L-Y-C-K-N-G-G-F-F-L-R-I-H-P-D-G-R-V-D-G-V-R-E-K-S-D-P-H-I-K-L-Q-L-Q-A-E-E-R-G-V-V-S-I-K-G-V-C-A-N-R-Y-L-A-M-K-E-D-G-R-L-L-A-S-K-C-V-T-D-E-C-F-F-F-E-R-L-E-S-N-N-Y-N-T-Y-R-S-R-K-Y-T-S-W-Y-V-A-L-K-R-T-G-Q-Y-K-L-G-S-K-T-G-P-G-Q-K-A-I-L-F-L-P-M-S-A-K-S.

17. The method of claim 13 wherein the host organism is E_.

18. The method of claim 13 wherein the host organism is a yeast.

19. An angiogenic factor as claimed in any one of claims 1 to 5 substantially as herein described.

20. An angiogenic factor protein as claimed in any one of claims 6 to 10 substantially as herein described.

21. A method of producing an angiogenic factor substantially as herein » ! described with refe^gm | coli. ByJJ»s/Their authorised Agent A.J. PARK & SON Per:— </div>