NZ208339A - Preparation of insulin-like growth factor (igf) by recombinant dna technology - Google Patents

Description

208339 Priority Date [5 telsl: I Complete Specification Filed^'. - -&H Class: C. D~T7 J-^TI ] -l^-O j • - • .CQTlK.l. (iU., • ^ 1 • - • Publication Date: "* I P.O. Journal. No: . — j No.: Date: NEW ZEALAND PATENTS ACT. 1953 COMPLETE SPECIFICATION PREPARATION OF HUMAN IGF VIA RECOMBINANT DNA TECHNOLOGY sf/We. GENENTECH INC, a corporation of the State of Delaware (formerly California), USA, of 460 Point San Bruno Boulevard, South San Francisco, California 94080, United States of America hereby declare the invention for which/ we pray that a patent may ... be granted to rfp/us, and the method by which it is to be performed, ^ ^ ^ /v O to be particularly described in and by the following statement:- jig - 1 - \'2May'9S8 \\<* Field of the Invention This invention relates to tne preparation cf human IGF (insulin-like growth factor), in various fonns, via recombinant D\'A 5 technology- Notably, the present: invention provides for trie preparation of human IGF as a mature protein product of expression, processing, and secretion in a recombinant DMA modified host organism- This invention thus provides for the production, isolation, and use of human IGF, in its various forms, as well as to 10 the associated recombinant DNA technology by which it is prepared.

The present invention arises in part from the discovery of a novel system by which human IGF can be prepared by a recombinant host organism in the form of a discrete, mature protein. This is accomplished according to one aspect of the present invention by an expression system which permits the expression of the amino acid 2o sequence of human IGF fused with at least a portion of the yeast alpha factor signal sequence, followed by processing of said signal sequence, and secretion of mature human IGF protein into the medium supporting the host organism- Thus, this novel aspect of the present invention, it is believed for the first time, permits the 25 preparation, isolation, and utilization of human IGF as a discrete, mature protein. The present invention, in its broad compass, however, covers the preparation of the amino acid sequence of human IGF in other recombinant systems including bacteria and cell culture and includes, therefore, the expression of human IGF DrJA sequences 30 providing not only mature human IGF but also fusion product derivatives containing the amino acid sequence of IGF as the essential component. All such products have been found to be biologically active, hence useful as intended.

The term "mature human IGF" as used herein means human IGF 35 protein having an amino acid sequence corresponding to that o.p&V • a human IGF native to human tissue which protein is in a discrete form free from association with the N-terminus amino acid ^eq^^e 1 ^ derivable from the expression system used to prepare the pi^ein. 4y198s $ %,,£A " The publ ications and other material s hereof used to illuminate the background of the invention, and in particular cases, to provide additional details concerning its practice are incorporated herein by this reference and for convenience, are alphabctically and numerically referenced in the following text and respectively grouped in the appended jibl iography.

■JO Background of the Invention A. Human IGF (Insulin-like Growth Factor) Human IGF has been the subject of a fair amount of intensive 15 study by past workers. A body of literature has been developed related to various aspects of this protein or series of proteins (see references A through L).

Insulin-like growth factors I and II have been isolated from 20 human serum (A). The designation "insulin-like growth factor" or IGF was chosen to express tne insulin-like effects and the insulin-like structure of these polypeptides which act as mitogens on a number of cells- The complete amino acid sequences of IGF-I and IGF—11 have been determined (D,E). They are both single-chain 25 polypeptides with three disulphide bridges and a sequence identity of 49 and 47 percent respectively, to human insulin A and B chains. The connecting peptide or C region is considerably shorter than the one of proinsulin and does not show any significant homology to it.-(For a summary of earlier studies on the biological efforts of IGF, 30 see Reference F).

IGF-I and IGF—II are growth promoting polypeptides occuring in human serum and human cerebral spinal fluid. Their structure is homologous to proinsulin. IGF-I seems to be produced by the liver along with a specific IGF-binding protein both of which are ur^dsr • / . j' ' ■. 5 0390L/3 t 12 to* ^ I V 2083 39 <""S control of growth hormone. Thus, human IGF is considered to be an active growth promoting molecule that .mediates the effect of human growth hormone.

It was perceived that the application of recombinant Q.'ja jn/j associated technologies would be a most effective way of providing the requisite large quantities of high quality human IGF for applied use to human beings as a growth factor. The goal was to produce human IGF either as biologically active fusion protein, or more 10 importantly, as a mature protein, as products of recombinant DNA technology from a host organism. Such materials would exhibit bioactivity admitting of their use clinically in the treatment of various growth affected conditions.

B. Recombinant DMA Technology Recombinant QUA technology iias reacned the age of some sophistication. Molecular oiologists are able to recombine various QUA sequences with some facility, creating new DMA entities capable 20 of producing copious amounts of exogenous protein product in transformed microoes and cell cultures. The general means and methods are in hand for the in vitro ligation of various blunt ended or "sticky" ended fragments of ONA, producing potent expression vehicles useful in transfoming particular organisms, thus directing 25 their efficient synthesis of desired exogenous product. However, on t an individual product basis, the pathway remains somewhat tortuous ,and the science has not advanced to a stage where regular predictions of success can be made. Indeed, those who portend ~ * /successful results without the underlying experimental basis, do so 30 'with considerable risk of inoperability.

DMA recombination of the essential elements, i.e., an origin of replication, one or more phenotypic selection characteristics, an expression promoter, heterologous gene insert and remainder vector, 35 generally is performed outside the host cell. The resulting -Q&Qt 339 recombinant replicable expression vehicle, or plasmid, is introduced into cells by transformation and large quantities of the recomoinant vehicle obtained by growing the transformant. Where the gene is properly inserted with reference to portions which govern the 5 transcription and translation of the encoded DNA message, the resulting expression veiiicle is useful to actually produce the polypeptide sequence for which the inserted gene codes, a process referred to as expression. The resulting product may be obtained by lysing, if necessary, the host cell, in microoial systems, and 10 recovering the product by appropriate purification from other proteins.

In practice, the use of recombinant DMA technology can express entirely heterologous polypeptides--so-cal1ed direct expression—or ■j5 alternatively may express a heterologous polypeptide fused to a portion of the amino acid sequence of a homologous polypeptide. In tne latter cases, the intended bioactive product is sometimes rendered bioinactive within the fused, homologous/heterologous polypeptide until it is cleaved in an extracellular environment. 20 See references (M) and (14).

Similarly, the art of cell or tissue cultures for studying ."'•a genetics and cell physiology is well established. Means and methods are in hand for maintaining permanent cell lines, prepared by 25 successive serial transfers from isolate normal cells. For use in research, such cell lines are maintained on a solid support in liquid medium, or by gro.vtn in suspension containing support nutriments. Scale-up for large preparations seems to pose only - -mechanical proolems. For further background, attention is directed 30 to references (0) and (P).

Likewise, protein biochemistry is a useful, indeed necessary, adjunct in biotechnology. Cells producing the desired protein also produce hundreds of other proteins, endogenous products of the 35 cell's metabolism. These contaminating proteins, as well as other ^Set7^ compounds, if not removed from tne desired protein, could prove toxic if administered to an animal or r.unan in the course of therapeutic treatment with desired protean. Hence, the techniques of protein bicchemistry come to bear, allowing the design of 5 Separation procedures suitaDle for the particular system under1 consideration and providing a homogeneous product safe for intended use. Protein biochemistry also proves the identity of the desired product, characterizing it and ensuring that the cells have produced it faithfully with no alterations or mutations. This branch of 10 science is also involved in the design of bioassays, stability studies and other procedures necessary to apply before successful clinical studies and marketing can take place.

AftK Summary of the Invention The present invention is bds=a upon th— discovery ciiai: recombinant DMA technology can be used successfully to produce human IGF preferably in direct fonn and in amounts sufficient to initiate and conduct animal and clinical 20 testing as prerequisites to market approval. The product human IGF is suitable for use in all of -its forms as produced according to the present invention, viz. in t'ue prophylactic or therapeutic treatment of human beings for various growth associated conditions or diseases. Accordingly, the present invention, in one 25 important aspect, is directed to methods of treating growth conditions in human subjects using human IGF , and suitable pharmaceutical compositions thereof, prepared in accordance with the methods and means of the present invention. - The present invention further comprises essentially pure, mature human IGF, as a product of expression, processing, and secretion in a recombinant host organism. Such human IGF is free from association with N-terminus amino acid sequence derivable from the expression systems that can be employed to prepare the material.

Thus, while the present invention is directed to the prepaint Ton of /' ' 'V' ijZ 0390L/O r polypeptides comprising the amino acid sequence of IGF, a notable aspect of tne present invention involves the production of the mature human IGF directly into the medium of the recombinant host organism employed. Tne present invention is also directed to replicable DMA expression vehicles harboring gene sequences encoding human IGF in expressible form, to microorganism strains or cell cultures transformed with such vehicles and to microtia! or cell cultures of such transforma.nts capaole of producing amino acid sequences of human IGF. In still further aspects, the present invention is directed to various processes useful for preparing said genes sequences, DMA expression vehicles, microorganisms and cell cultures and specific emoodi.nents thereof. Still furtner, this invention is directed to the preparation of fermentation cultures of said microorganisms and cell cultures.

Brief Description of Che Drawings Figure 1 represents tne chemically synthesized DNA strands used in the construction of expression vectors for human IGF.

Figure 2 shows the completed double stranded DMA of Figure 1.

Figure 3 show the fragments of DMA of Figure 2 after restriction by £CoRI and PstI and 3am HI.

Figure 4 depicts the ligation of parts 1 and 2 of Figure 3 into PBR322. ~ ' Figure 5 show parts 3 and 4 of IGF-I right half.

Figure 6 depicts the ligation of parts 3 and 4 of Figure 5 into the vector of Figure 4.

Figure 7 shows a sequence of DMA and deduced fusion protein . containing IGF-I. 03 SOL/7 f- c / «# c J"\ ~ * • Figure 8 shows a sequence of DNA and deduced short fusion protein containing IGF-I.

Figure 9 depicts a plasmid used in tne present construction.

Figure 10 shows the DNA and protein sequence of IGF-I fused with alpha factor pre-pro sequence.

Figure II is a vector containing alpha factor promoter and 10 pre-pro sequence fused to IGF-I.

Figure 12 shows the yeast invertase signal fused to IGF-I.

Figure 13 shows the parental plasmid containing the yeast PGK 15 promotor.

Figure 14 depicts a yeast expression vector containing PGK promotor, invertase signal and human IGF-I gene.

Figure 15 is the synthetic DMA used to construct the coding sequence of mature human EGF.

Figure lb shows the coding sequence for human IGF-II.

Detailed Descriotion A. Definitions As used herein, "human IGF" denotes human 0390L/3 <,C, / v e 3/ V-' ^ *«> <J V . . insulin-like growth factor produced by microbial or cell cultures systems ano bioactive forms comprising the amino acid sequence corresponding to a human ibF otnerwise native to human tissue. Inis aetinition does not induce proinsulin or pre-proinsul in. Tne human IGF 5 proteins produced herein nave seen defined by means of DMA, gene, and deductive amino acid sequencing. It will be understood that inasmuch as natural allelic variations exist and occur from individual to individual, as demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, 10 suDstitutions, insertions, inversions, or additions of one or more amino acids of said sequences, the present invention is intended to embrace of all such allelic variations of the-two molecules involved. In addition, the location of and the degree of glycosylation depends upon the nature of the recomoinant host 15 organism employed and such variations as may occur are included within the ambit of tni s invention. Finally, the potential exists in the use of DrtA technology for the preparation of various derivatives of human IGF by simple modification of the underlying gene sequence for sucn molecules. Such modifications 20 could De accomplished by means of site directed mutagenesis of the underlying DMA, as an example. All such nodifications resulting in derivatives of human IGF are included within the scope of the present invention so long as the essential characteristic human IGF activities remain unaffected in kind.

"Essentially pure form" when used to describe the state of human IGF produced by this invention means that the proteins are free of proteins or other materials normally associated with" * human IGF when produced by non-recomdinant cells, i.e. in their "native" environments.

"Expression vector" includes vectors whicn are capaole of expressing DNA sequences contained therein, where such sequences are operably linked to other sequences capable of effecting their 35 expression, i.e., promotor/operator sequences. In sum, "expression 0390L/9 . /-> < A* % % n/ <w' vector" is given a functional definition: any DMA sequence which is capaole of effecting expression of a specified DrtA code disposed tnerein. In general, expression vectors of utility in reconoinant D.N'A techniques are often in tne form of "plasmids" which refer to 5 circular double stranded DNA loops which in their vector form, are not bound to the cnrcmosone. In tne present specification, "plasmid" and "vector" are used interchangably as the plasmid is the most commonly used form of vector. However, tne invention is intended to include such other fonns of expression vectors wnic.n 10 function equivalently ana which become known in the art subsequently - "Recombinant host cells" refers to cells which have been transformed with such vectors. Thus, the human IGF 15 molecules produced by such cells can be referred to as " recombinant human IGF1' B. Host Cell Cultures and Vectors The vectors and methods disclosed herein are suitaole for use in host cells over a wide range of prokaryotic and eukaryotic organisms.

In general, of course, prokaryotes are preferred for cloning of DMA sequences in constructing the vectors useful in the invention. 25 For example, £_. col i K12 strain 294 (ATCC No. 31445) is particularly useful- Other microbial strains which may be used include IE. col i strains such as £_- col i B, and E_. coli X1775 (mTCC No. 31537). The aforementioned strains, as well as E. coli U3110 (F~, x~, * prototrophic, ATCC rJo. 27325), bacilli such as Bacillus subtilus, 30 and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcesans, and various pseudomonas species may be used. These examples are, of course, intended to be illustrative rather than limiting. in general, plasmid vectors containing replicon and 0390L/10 11 203339 sequences which are derived from species compatible witn the host cell are used in connection with tnese hosts. The vector ordinarily carries a replication site, as well as marking sequences which are j/b capable of providing phenotypic selection in transformed cells. For example, E. col i is typically transformed using p3R 322, a plasmid derived from an £_. coli species (Bolivar, et al-, Gene 2: 95 (1977)). p3R322 contains genes for ampicillin and tetracycline resistance and tnus provides easy means for identifying transformed m? cells. The p8R322 plasmid, or other microbial plasmid must also contain, or be modified to contain, promoters which can oe used by the microbial organism for expression of its own proteins. Those promoters most commonly used in recombinant DNA construction include the s-lactamase (penicillinase) and lactose promoter systems (Chang et al, Nature, 275: 515 (1978), Itakura, et al, Science, 198: 1055 15 (1977); (Goeddel, et al Nature 281: 544 (1979)) and a tryptophan (1930); EPO Appl Publ Mo. 0035775). While these are the most commonly used, other microbial promoters have been discovered and utilized, and details concerning their nucleotide sequences have 20 been published, enabling a skilled worker to ligate tnem functionally with plasmid vectors (Siebenlist, et al, Cel1 20: 259 (1980)).

In addition to prokaryates, eukaryotic microbes, such as yeast 25 cultures may also be used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for -example, (Stinchcomb, et al, Mature, 282: 39 (1979); Kingsman et al, 30 Gene, 7: 141 (1979); Tschemper, et al, Gene, 10: 157 (1980)) is commonly used. This plasmid already contains the trpl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC lio- 44075 or PEP4-1 (Jones, Genetics. 85: 12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an i2 / 0 8 3 3 9 effective environment for detecting transformation ay growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the 5 promoters for 3-phosphoglycerate kinase (Hitzercan. et al., J. 3iol. Chem.. 255: 2073 (I98Q)) or ether glycolytic enzymes (Hess, et al, J. Adv. Enzyme Reg., 7: 149 (1963); Holland, et al, Biochemistry, 17: 4900 (1973)), such as enolase, glyceraloehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, 10 phosphofructokinase, glucose-5-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression 15 vector 3" of the sequence desired to be expressed to provide polyadenylation of the mRWA and termination. Other promoters, ./hicn have the additional advantage of transcription controlled by growth conditions are the promoter regions for alconol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated 20 with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and QBvOL/12 208339 galactose utilization (Holland, ibid.). Any plasmid vector containing yeast-compatible promoter, origin of replication and termination sequences is suitable.

In addition to microorganisms, cultures of cells derived froin multicellular organisms may also be used as hosts. In principle, any such cell cul ture is workable, whether from vertebrate or invertebrate culture. However interest has been greatest in vertebrate cells, and propogation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)]. Examples of such useful host cell lines are VErtO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, 3HK, COS-7 and MOCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to be expressed, along <vitn any necessary riDosome binding sites, RHA splice sites, polyadenylation site, and transcriptional terminator sequences.

For use in mannial i an cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers, et al, Nature, 273: 113 (1978) incorporated herein by reference. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind III site toward the 3gl I site located in the viral origin of replication. Further, it is also possible, and often desirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provide such control sequences are compatible with the host cell systems. lb -f> -7 O V O J ^ An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g. Polyoma, Adeno, VSV, 3PV, etc.) source, or may be provided by the iiost cell cnrcmosomdl replication 5 mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.

C. Methods Employed If cells without formidable cell wall barriers are used as host cells, transfection is carried out by the calcium phosphate precipitation method as descrioed by Graham and Van der £b, Virology, 52: 545 (1973). However, other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion 15 may also be used.

If prokaryotic cells or cells which contain substantial cell wall constructions are used, the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen, F.M. 20 et al Proc. Natl. Acad. Sci. (USA), 69: 2110 (1972).

Construction of suitaole vectors containing tne desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in 25 the form desired to form the plasmids required.

Cleavage is performed by treating with restriction enzyme (or enyzmes) in suitable buffer. In general, about 1 ug plasmid or DNA" fragments is used witn about 1 unit of enzyme in about 20 ^1 of 30 buffer solution. (Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.) Incubation times of about 1 hour at 37^C are workable. After 1ncubations, protein is removed by extraction with phenol and chloroform, and the nucleic acid is recovered from the aqueous fraction by precipitation with ethanol. 0390L/14 • 208339 If Dlunt ends are required, tne preparation is treated for 15 minutes at 15" with 10 units of Polymerase I (Klenow), phenol-chloroform extracted, and ethanol precipitated.

Size separation of the cleaved fragments is performed using 6 percent polyacry1 amide gel described by Goeddel, D., et al, Nucleic Acids Res., 8: 4057 (1980) incorporated herein by reference.

For ligation approximately equimolar amounts of tne desired 10 components, suitably end tailored to provide correct matching are treated with about 10 units T4 DNA ligase per 0.5 ug DMA. (When cleaved vectors are used as components, it may be useful to prevent religation of the cleavea vector &y pretreatment with bacterial alkaline phosphatase.) For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures are used to transform E. coli .<12 strain 294 (ATCC 31445), and successful transformants selected by ampicillin resistance where appropriate. Plasmids from the 20 transformants are prepared, analyzed Dy restriction and/or sequenced by the method of Messing, et al, Nucleic Acids Res., 9:309 (1981) or by the methoa of Maxam, et al, Methods in Enzymology, 65:499 (1980).

Examples The following examples are intended to illustrate but not to limit the present invention.

Synthesis and Expression of Human IGF—1 Enzymes were obtained from the following suppliers: New England 3iolabs: restriction enzymes, T4 DNA ligase Bethesda Research Labs: restriction enzymes, Bact. Alkaline 16 208339 Phos. 3oehringer-.-Ianniieim: E_. coli DNA Polymerase I (Klenow) P+L Biochemical s: Polynucleotide kinase, Terminal Nucleotidyl Transferase New England Nuclear: p3R322 toligo(dG)-tailed] DMA Reagents: BioRad: Sis Acrylamide, Acrylamide, TEAMED Sigma: Ammonium Persulfate Amersham: 10218 Y32? ATP >5000 Ci/smol; 10165 a32P dCTP >400 Ci/mmol.

Solutions and Media: IX T3E: .54^ Tris Base, 0.54 M Boric ■J5 Acid, .017 H Na., EDTA.

Difco: Yeast ;ii trogenous 3ase (YN3j; Tryptor.= , Yeast Extract; 8acto-Agar; Casamino Acids.

Autoradiography: Kodak X-0 mat AR XAR-2 Film Glass Beads: 0.45-0.50 m;>! B. Sraun Melsungen AG L3 medium (per liter): lOg rJaCl; 5g yeast extract; lOg tryptone; .17ml 'JaOH (50 percent) L3 Agar (per 1 iter): lOg tryptone; 5g yeast extract; .5g NaCl; 15g Sacto-Agar; adjusted to pH 7.5 with MaOH.

Anti biotics: Tetracycline (5 ug/ml) in all mediums; Ampicillin (20 ug/ml) in all mediums (plates or liquid) Qfrtttfto 17 * 2083 39 149 Medium {per liter): 6g NagHPO^ (anhydrous), ig NH^Cl; 3g KH^PO^; .5g MaCl ; 1 mM ngSO^,; 0.5 percent (w/v; glucose; 0.5 percent (w/v) Casamino Acids: .0001 percent Thiamine-HCl.

YNB-CAA (per liter): .7g Yeast Nitrogenous Base (witnout Amino Acids); 10 mg adenine; 10 mg uracil; 5g Casamino Acids; 20g Glucose.

YNS-CAA agar plates (per liter): Same as Y.M3-CAA + 30g agar.

Standard Ligation Conditions: -fold molar excess of insert (or 1 inker) to vector. IX T4 ■]5 DNA ligase buffer ana 400-800 U T4 DNA ligase; 14" - 12-16 hours.

StandarG Kination Conditions: IX Polynucleotide kinase buffer; 15 U polynucleotide kinase; 37" 50 minutes; followed by reaction termination by heating to 55" for 10 minutes.

IX Kinase 3uffer: 70 mrt Tris-HCl (pH 7.6); 10 mM MgCl^; 5 ml-l DTT IX T4 DNA Ligase Buffer: 50 itiM Tris-HCl (pH 7.8); 10 mM MgClgi 20 mM DTT; 1 raM rATP.

Construction, Strategy and Selection of a DMA Sequence.

The 1" protein structure of the human IGF-1 molecule has been determined (1). 8ased upon this protein sequence and the genetic code, a DNA sequence coding for mature human IGF-1 protein, including all possible base substitutions at any one base position, 35 was determined by computer analysis (Genentech Untrans Program).

O3S0t/t I m 7 2083^9 Using a restriction site analysis program (Genentech Asearcii Program), all potential restriction sites locates in all possiale DNA sequences consistently coding for the sane protein were found. Three sites internal to the coding sequence were selected: PstI, 5 3amril. and Avail. Two additional sites were placed at the ends, just outside of the coding sequence of the mature protein: one EcoRI site before the initiation codon, AUG, and the Sail site following the termination codon, TAG of the coding sequence. Tne choice of these sites facilitated the cloning of the coding sequence 10 if separate parts, eacn of which subsequently could be excised ana then assembled to form an intact synthetic IGF-1 gene. This construction involved the assembly of 4 parts, 2 parts forming the left half, 2 parts forming the right half. Each part consisted of two single strands of chemically synthesized DiiA (see Fig. 1). 15 Proposed synthetic fragments were also analyzed for internal complementarity.

The constructions used to generate these four parts employed the use of DNA Polymerase I repair synthesis of synthetic 20 oligonucleotide substrates having 9-10 bp stretches of complementary sequence at their 3' termini. In the presence of DNA Polymerase I (Klenow) and the four deoxynucleoside triphosphates, these primer-templates were extended to become full-length double-stranded DMAs. To prevent priming at locations other than the desired 25 portions as well as self-hybridizations, each set of single-stranded DNAs were analyzed by a computer program (Genentech Homology Program), and wherever possible, sequences which would have potentially led to hairpin loops, self-priming, or mis-priming, were eliminated by alternate codon usage. Each of these four 30 double-stranded DiJAs were synthesized to include 9-12 additional bp of non-IGF-1 coding DMA at each end (see Fig. 2). This additional DNA was included to allow generation of sticky ends by restriction enzyme digestion. The sticky ends thus formed facilitated the ligation of the double-stranded pieces to contiguous coding sections of the synthetic gene or into a cloning vehicle. 19 * 208339 The 9-12 extra bp of double stranded DMAoeyond the restriction site at the end of each part (see Fig. 2) allowed for the TdT-mediated formation of single-stranded oligodeoxycytidine strands at the 3' ends of each double-stranded DNA section. These 5 ol igodeoxycytidine tailed doubl e-stranded DNAs could tnen be anneal!ed into a complementary ol igodeoxyguanosine tailed PstI site of a cloning vehicle. Once cloned, and sequenced to ensure the correct base sequences, the parts could be easily isolated and ligated following restriction enzyme cleavage at the restriction 10 sites selected at the ends of each of the four parts, to form the intact synthetic IGF-1 gene.

The method used successfully here was similar to that described by Rossi £t a_l_. (23); however, attempts at the construction and •15 cloning of the IGF-1 coding sequence using tne Rossi _et aj_. method (23) -with only two base pairs of extra EUA beyond the restriction enzyme recognition sites repeatedly failed. The method employed here also differs from the Rossi et a]_- procedure (28) in that restriction sites placed at both ends of a double stranded ONA allow 20 for the convenience of cloning each double stranded DNA fragment, individually, by (dC)-tailing and annealling into a (dG)-tailed vector, a method which in practice requires less of the double ^ stranded DfJA than three-part ligations.

Chemical Synthesis Eight fragments, 43, 43, 46, 46, 46, 46, 54, and 46 bases in length (see Fig. 1), were chemically synthesized according to the ' method of Crea and Horn (2), the only change being the use of 30 mesitylene nitrotriazol e as the condensing agent rather than 2,4,6 Triisopropyl benzenesulfonylchloride tetrazole.

The syntheses of the fragments were accomplished from the appropriate solid support (cellulose) by sequential addition of the appropriate fully-protected dimer- or trimer-blocks. The cycles 029Qtft$ were carried out under the same conditions as described in the syntnesis of oligothymiailic acid (see Crea et , supra). The final polymers were treated with Dase (aqueous conc. NH-j) and acid (80 percent HoAc), the polymer pelleted off, and the supernatant 5 evaporated to dryness. The residue, dissolved in 4 percent aq. was washed with ethyl ester (3X) and used for the isolation of the fully deprotected fragment.

Purification was accomplished by electrophoresis using 20 10 percent polyacrylamide gels. The pure oligonucleotide was ethanol precipitated following gel elution. 225-285 pmoles of each chemically synthesized fragment was mixed with an equivalent amount of the complementary sing!e-stranded DNA 15 fragment (i.e. 1L+3L; 2L+4L; 1R+3R, 2R+4R) in the presence of deoxyribonucleoside triphospnates at a final concentration of 200 with the exception of dCT?. dCTP was added to a concentration of 5 3*? uM as a a ""P-labeled isotope with a specific activity of 1000-2000 Ci/mniol) to allow easy monitoring of the repair-synthesis reaction 20 product- The reactions were carried out in a buffer containing a final concentration of 50rnM Tris HCI pH 7.5; 20 m.M MgCl^; 20 mi-l DTT and 154 DNA Polymerase I (Klenow) in a reaction volume of 200 ui. Reactions were allowed to proceed at 4" for 12-18 iirs.

Upon completion, EDTA was added to a concentration of 25 mM.

Sample Duffer containing the mixes were phenol extracted, CHCl^ extracted 2X, and products were etOH precipitated. Pellets were taken up in .3 M NaOAc and the DNA reprecipitated with etOH. After-dissolving the pellets in H^O, tne 1L+3L and 2L+4L products were 30 then digested separately witil PstI in 100 ^1 reaction mixes containing IX PstI buffer (50mM (NFLJgSO^, 20 mM Tris HC1 pH 7.5, 10 mM MgCl2), and 70 U PstI. After 4 hrs, EDTA was added to a concentration of 10 mM, and the material was ethanol precipitated. Pellets were then taken up in .3 M NaOAc and 35 reprecipitated, then taken up in F^O. The Pstl-digested 1L+3L 21 7 0-8 3 ^ ^ product was digested with EcoRI at 37" in a 100 ^1 reaction mix IX EcoRI buffer (150 mM NaCl, 5 mM Tris HC1 pH 7.5, 6 mM MgCl^) and 70 U EcoRI. The PstI digested 2L+4L product was digested at 37" witn BainHI in a 100 yl reaction mix in IX BamHI Suffer (150 mM 'JaCl, 5 6 mM Tris HC1 pH 7.9, 6 mM MgCl^) and 70 U BamHI. After 4 hrs, EDTA v/as added to both mixtures, and sample buffer was added. They were electrophoresed on a 6 percent polyacrylamide slab gel. Six percent slab gels were cast with a mixture containing 6 percent (w/v) acrylamide (20 to 1 ratio of acrylamide to Bis acrylamide) IX 10 TBE, 1 percent APS and 0.1 percent TEMED. Reaction products were located on the gel oy autoradiography and the oand corresponding to the 45 bp EcoRl-PstI digested 1L+3L proauct (Part 1) (see Fig. 3) and the band corresponding to the 50 bp PstI-3amHI digested 2L+4L product (Part 2) (see Fig. 3) were excised from the gel, the 15 material electroeluted in 0.2X T8£, phenol extracted, CHCl^ extracted, and ethanol precipitated. Parts 1 and 2 were dissolved i n HgO.

Cloning Vector Prep.

Cloning vector was prepared oy digesting 20 ug p3R322 (15) with 50 U EcoRI and 50 U BamHI, in IX RI Buffer at 37" for 6 hr. After addition of EDTA to a concentration of 10 mM, sample buffer was added, and the mixture was run on a 5 percent polyacrylamide gel.

The gel was developed by staining 10' in H2O containing 5 ug/ml Et. Bromide, rinsing 2X in H^O and placing upon a UV transi11uminator (302 nM). the band corresponding to the ca. 3712 bp EcoRI-BamHI digested p3R322 molecules was cut from the gel. The-DNA was electroeluted from the gel slice, phenol extracted, CHCl^ extracted 2X, and ethanol precipitated. The pellet was dissolved in H2O and was ready for ligation.

Li gati on.

In a three-part ligation (see Fig. 4), in which the molar ratio 11 22 208339 of inserts to vector in the ligation reaction was approximately 10 to 1, parts 1 and 2 were ligated into the EcoRI-BamHI digested 322 vector in IX T4 DMA ligase buffer Icont. 50 mM Tris HC1 pH 7.3; 10 rn'1 MgClg, 20 niM DTT, i mM rATP) and "800 U T4 DNA ligase (MES).

Tne reaction was carried out at 14° for 12-15 hrs.

Transformations £_. col i strain 294 was used as the transf onuation host, using 10 the procedure of H. Dagert and S.D. Ehrlich (3). The transformed cells were plated on L3-agar plates containing ampicillin (20 yg/ml; LB-Ajnp-plates) and transformants were screened and grown in L8 medium containing ampicillin at 20 ng/ml ampicillin. Transformants were screened using a modification of the rapid miniscreen method of 15 Birnboim and Doly (4). Miniprep DNA prepared as such was digested witn EcoRI and SamHI and run on polyacry lamide slab gels. Several transformants which illustrated a ca. 218 bp EcoRI-BamHI insert were grown in large scale and plasmids from each were isolated and sequenced according to the procedure of Maxam and Giloert (5) to 20 confirm the correct chemical synthesis and construction. The p3R322 vector containing the complete correct left half sequence of IGF-1 was called IGF-1 LH 322 (see Fig. 5).

Cloning of Fragments of the Right Half of IGF-1.

Using tne identical conditions of DNA Polymerase I-mediated repair-synthesis, the two pairs of fragments comprising the right half of the synthetic IGF-1 were converted into double-stranded DfJAs. After the DNA Polymerase I reactions, and without enzymatic 30 digestion, the 1R+3R (Part III) and 2R+4R (Part IV) reactions were run on a 5 percent polyacrylamide slab gels. The 83 bp (Part III) and 91 bp (Part IV) bands were located by autoradiography and cut from the gel. After electroelution the ethanol precipitated double-stranded OMAs were dC-tailed (see Fig. 5) using the 35 procedures of Villa-Komaroff et al_. (6) and Rowenkamp and Firtel ""■08339 (7). Reactions were carried out in 50 ul vols, of IX tailing mix (cont. .2.'1 Pot. Cacodylate, 25 mM Tris HC1 pH 5.9, 2 mM DTT, .5 mM CoC^) and 22 ^m dCTP. After prewarming at 37" for 10* , the i50 second reaction was begun by the addition of 10-20 units of terminal nucleotidyl transferase and terminated by addition of EDTA followed hv nhoncl ^con, CHC1 sx^r^cclcn 2X, cijid Cwhunol precipi tdtion.

These oligo (dC) tailed Parts III and IV were then separately mixed witn equimolar amounts of oligo (dG)-tailed PstI cut p3R322 vector in 50 ul of IX annealling buffer (.1M NlaCl; 10 mM Tris HC1 pH 7.8, 1 mM EDTA) at a final DMA concentration of 1-2 ug/ml. After heating to 75"C, the mixes were gradually cooled to 4" over a period of 16 hr and the mix transformed into competent E_. col i 294 cells prepared according to the procedure of Oagert and Ehrlich (3). Transformed cells were plated on L3-Tetracycline-Agar plates and grown in L8-Tetracycline medium at tetracycline concentrations of 5 pg/ml. Tetracycline resistant transformants were picked and plated onto LB-Ampicillin-Agar plates to check for insertions at the PstI site. Several tetracycline resistant, Ampicill in-sensitive colonies for each Part 3 and 4 were mini screened and those exhibiting insertions at the PstI locus were grown in large scale and sequenced Dy the Maxam and Giloert technique (5) to confirm the correct DNA sequences of Parts 3 and 4-.

Construction of an Intact Synthetic HuIGF-1 Coding Sequence Preparation: Parts 3 and 4. - .

Parts 3 and 4 were separately removed from their vectors by digestions of 20 ug of each vector with Avail in IX Avail buffer (60 nv1 NaCl, 6 mM Tris-HCl (pH 8.0); 10 mM MgC^; 6 mM 2-mercaptoethanol) and 30 U of Avail. After 5 hr., at 37", EDTA was added to the 150 ul reactions to a concentration of 15 mM and tne material phenol extracted, CHC1^ extracted 2X and ethanol 24 m 208339 precipitated. The Part 3 pellet was then taken up in IX 3a:nHI buffer and digested in a volume of 150 yl with 30 U 3amHI at 37° for 4 hr. The pellet containing Part 4 was digested witn 30 I! Sail in 150 ul of IX Sail buffer at 37° for 4 hr.

Both digests were then run on o percent polyacrylamide slab gels and stained. The 51 bp band representing Part 3 and the 62 bp band representing Part 4 were removed from tne gels and the DNA electroelutea, phenol extracted, CHCl^ extracted 2X ana ethanol TO precipitated. Pellets were then taken up in H^O and were ready for 1igation.

Vector Preparation 20 ug of the IGF-1 LH 322 vector was digested with 50 U of BamHI and 50 U of Sail in a 200 ^1 reaction containing IX BamHI buffer at 37" for 6 hr. After addition of EDTA to a concentration of 15 mri, the digestion mix was run on a 6 percent polyacrylamide slab gel, ethidium bromide stained and the 3314 bp band excised from the gel.

After electroelution, phenol extraction, chloroform extraction and ethanol precipitation, the DNA pellec was taken up in H^O and was ready for ligation with Parts 3 and 4 in a three-part ligation. The ligation was performed under conditions described above for a 25 three-part ligation (see Fig. 7). Parts 3 and 4 were present in the ligation mix at a 10-fold molar excess of inserts to vector. The mix was transformed into competent _E. coli 294 cells prepared according to the Dagert and Ehrlich procedure (3) and plated onto" * LB-Ampicillin plates. Several transformants were mini screened and 30 two clones exhibiting a ca. 115 bp BamHI-Sall fragment were grown in large scale and their plasmids prepared. Both strands of the intact synthetic gene were sequenced by the Maxam-Gi1 pert technique (5) to confirm the correct sequence. The pBR322 plasmid containing the complete correct sequence coding for Human IGF-1 was called p3R322 35 HuIGF-1.

Q-3fJ0L/-2-4" do t 208339 Human IGF-1 Expression IGF-1 Fusion Expression in Bacteria Initial attempts were to obtain expression of IGF-1 as a fusion protein. To accomplish tnis, ootii the p.lJCV (9) and the pNCVsLE (10) expression vectors were used- (The oNCVsLE expression vector is 2 derivative of tne pfJCV vector and was prepared as follows: pMCV was treated v/ith Sgll, which cleaves at the 13 codon of the LE fusion. The site was converted to an ECoRl cleavage site using synthetic DNA, to give the expression vector plJCVsLE. The synthetic DNA introduced into the plasmid has the sequence: '-GATCCAGAATTC ' GATCGAATTCTG and this sequence was introduced into the plasmid: GATCCAGAATTC GTCTTAAGCTAG As a strategy to release the fused human IGF-1 protein from tne trp fusion protein, a linker was designed such that an enzymatic proteolysis method reported by Wunsch _et aj_. (8) could be applied to this expression system. To accomplish this, a DNA linker: ProAl a 5'-AATTCCCTGCCG -3' 3' GGGACGGCCAG-5' was chemically synthesized by standard methods (2) which when linked to the trp fusion protein and the IGF-1 gene, coded for the amino acid residues Proline and Alanine followed by Glycine and Proline which are the first two amino acid residues of IGF-1 and preceded by Proline and Alanine together comprise a recognition site for a collagenase isolated from Clostridium histolyticum (11,12). This enzyme reportedly acts at 30 such a site to cleave the alanine-glycine peptide bond.

To construct a DNA sequence coding for a fusion protein with a collagenase cleavage site, 30 ug pBR322 HuIGF-1 plasmid was cleaved v/ith 50 U BamHI and 50 U Pvul enzyme in 200 ul IX SamHI buffer at 37° for 5 35 hours. After addition of EDTA to a concentration of 15 mM, the reaction 208339 mix was chromatographed on a o percent polyacrylamide slab gel. The smaller PvuI-BamHI fragment ("725 bp) was isolated and digested with 40 U Avail in 150 yl IX Sau95I buffer (60 mM NaCl, 6 mM Tris-HCl pH 7.4, 15 mM MgClg, o mM 2-mercaptoethanol). After addition of EOTA to a 5 concentration of 15 nt'1, the resulting mix chromatographed on a 5 percent polyacrylamide slab gel. The smaller Sau96I-3amHl fragment ("86 bp) was extracted from the gel, phenol extracted, chloroform extracted 2X, and ethanol precipitated. This fragment was ready for ligation. 200 pmols of linker fragments were kinased with 100 LI polynucleotide kinase in 20 yl of IX polynucleotide kinase buffer (70 mM Tris-HCl (p.4 7.6); 10 mM MgC^; 5 mM DTT; 1 mM rATP) at 37° for 1 hour. The reaction was terminated by heating to 55"C for 5 minutes. 100 pmols of the kinased linker fragments were ligated to the 86 bp Sau96I-BamHI 15 fragment with 400 U of T4 DNA ligase in 30 yl of IX T4 DNA ligase buffer at 14° for 12-16 hours. The ligation reaction was terminated by addition of EDTA to a concentration of 15 mM followed oy phenol extraction, chloroform extraction 2X, and ethanol precipitation. The pellet was then taken up in IX 8amHI buffer and digested in a 100 yl reaction <n'tn 50 U 20 of EcoRI and 50 U of 3amHI at 37° for 6 hrs. After terminating the digestion with EDTA, the mixture was chromatographed on a 6 percent polyacrylamide slab gel and the newly created (~97 bp) EcoRI-BamHI fragment was extracted from the gel, and prepared for ligation. The vector to receive this new fragment was prepared by digesting 30 ug 25 p8R322 HuIGF-1 with 100 U of each EcoRI and BamHI In 200 ul of IX SamHI buffer at 37° for 8 hr. The reaction was terminated, chromatographed on a 6 percent polyacryl amide slab gel and the larger band (~3830 bp) representing the EcoRI-BamHI digested plasmid was isolated and tire -plasmid DNA extracted and prepared for ligation as above. In a 30 yl 30 ligation reaction containing a 10-fold molar excess of insert fragment tc vector, the EcoRI-BamHI fragment was ligated into the EcoRI-BamHI digested plasmid pBR322 HuIGF-1 under standard ligation conditions mentioned above. Competent E. coli 294, prepared as above (3), were usee as transformation hosts and the transformed cells were plated onto 35 LB-Ampicillin agar plates. Several transforrnants were picked, 033QW££ 27 2083 39 mini screened as aoove (4-), and two exhibiting an EcoRI-SamHI insertion were grown in large scale and their plasmids purified. Using the Maxam-Gi1bert procedure (5) the construction was sequenced to verify the correct synthesis and insertion of the EcoRI-Sau95I collagenase 1 inker.

This plasmid was called p3R322 HuSynIGF-1-M.

To prepare this EcoRI-Sall IGF-1 coding sequence for insertion into pNCV and pNCVsLE, 30 yg of p3R322 HuSynIGF-I-M was digested with 70 U of Sail in 200 jl of IX Sail Duffer (150 mM NaCI, o mM Tris-HCl (pH 7.9); o 10 niM <-1gC12; 6 nvt 2-mercaptoethanol) at 37" for 6 hours. After addition of EDTA to 15 mi, the mixture was phenol extracted, chloroform extracted 2X, and ethanol precipitated.

Using standard chemical synthesis procedures (2) a Sall-EcoRI linker ' TCGACGTACATG 3' 3' GCATGTACTTAA 5' was synthesized and 400 p.-nol s kinased, as above. 200 pmols of the kinased linker was ligated to the Sail digested pBR322 HuSynIGr-1-H 20 (prepared above) with 800 U T4 DNA ligase in 30 yl of IX ligation buffer for 12-15 hours at 14"C.

After termination of the reaction with EDTA, the mixture was phenol extracted, chloroform extracted 2X, and ethanol precipitated. The pellet 25 was then taken up in IX EcoRI buffer and digested with 100 U EcoRI in a volume of 200 ul for 8 hours at 37". After addition of EDTA to a concentration of 15 inM, the mixture was chromatographed on a 5 percent polyacrylamide slab gel. The gal was stained and the "230 bp band corresponding to the EcoRI-EcoRI HuIGF-1 fragment was extracted from the 30 9el, phenol extracted, chloroform extracted 2X, and ethanol precipitated. This fragment was ready for ligation into pNCV and pNCVsLE. pNCV and pNCVsLE were prepared for ligation by digestion of 20 ug of each v/ith 100 U EcoRI in 200 yl IX EcoRI buffer at 37" for 8 hours. After digestion, 200 U of bacterial alkaline phosphatase was 35 added to each reaction and the mixtures warmed to 65°C for 2 hours. EDTA o^yet-m- t 208339 was added to a concentration of 15 mM and the mixes were phenol extracted 3X, chloroform extracted 2X and then ethanol precipitated. These expression vectors were prepared for ligation.

Ligations of the EcoRI-EcoRI Human IGF-i fragment into the two expression vectors were performed in 30 ul reaction volumes in IX T4 DNA ligase buffer with 800 J T4 D.VJA ligase at 14" for 12-15 hours. The EcoRI-EcoRI fragment was present at a 10-fold molar excess to vector.

Competent E. coli 294 were prepared (3) (ATCC 31445) and used as transformation hosts for the ligations. Transformed cells were plated onto L3-agar plates containing tetracycline (5 yg/ml; L3-Tet-plates) and transformants were mini screened (4). Miniscreen plasmid DNA from transformants of the pMCV-IGF-1 construction were digested with both PstI 15 and Bglll to determine the orientation of the EcoRI fragment insertions. Two clones whose pi as,aids contained a ~570 bp 3glII-PstI fragment (as opposed to a ~690 bp fragment) were grown in large scale and their plasmids prepared. The construction was sequenced using the Maxam-Gilbert procedure (5) to confirm the correct insertion at the 2o junction of the trp fusion and IGF-1 protein coding sequences as well as retention of the desired reading frame. Plasmids v/ith the correctly inserted IGF-1 fragment were called pNCVLE-IGF-1. Transformants of the pMCV-sLE-IGF-1 construction were also mini screened by the same procedure (5), and the plasmid DMAs were digested with HincII and PstI. Two clones 25 exhibiting a ~150 bp HincII-PstI fragment (as opposed to a "105 bp HincII-HincII fragment) were grown in large scale and their plasmids prepared. Using the Maxam-Gi1bert techniques (5), the functions of the trp fusion and IGF-1 protein coding sequences were sequenced to ascertain proper orientation and retention of the proper reading frame. Those 30 plasmids possessing the correct insertion and proper reading frame were called pNCV-sLE-IGF-1.

To attempt expression of each of these constructions, two clones, one possessing pNCV-IGF-1 and the other possessing pNCV-sLE-IGF-1, were 35 inoculated into 10 ml M9-Tetracycl ine culture medium supplemented v/ith 3300L/23 29 2083 39 0.5 mg/ml Tryptophan. A clone containing pNCV-LE with no IGF-i gene insert was also inoculated into culture medium to provide as a negative control in assays.

After 12-15 hours growth at 37" with agitation, 0.5 ml of these cultures were used to inoculate 250 milliliters of M9-Tetracycline culture medium. After growing for 12-16 hours at 37* with agitation, thi cells were harvested by centrifugation at 5000 rpm for 10 minutes in a Sorvall GSA rotor. The refractile bodies were purified from the pelletei 10 cells by: a) suspending the host cells in a buffered solution of ionic strength suitable to solubilize most of the host protein, b) subjecting the suspension to cell wall/membrane disruption, c) centrifuging the disrupted suspension at low speed to form a pellet, optionally repeating the foregoing steps, and d) recovering the heterologous protein as 15 refractile bodies in the pellet (Reference 13). A small quantity of refractile particles of each of the three preparations was boiled in SOS and 2-mercaptoethanol containing sample buffer and run on SDS-polyacrylamide slab gels according to the Laemmli method (14). The size of the protein expressed by pNCV-IGF-1 (LE-IGF-1) was "28,570 20 Dal tons (see Figure 7), and ~9770 Dal tons for the pNCV-sLE-IGF-1 protein (sLE-IGF-1) (see Figure 8). These two expressed proteins were subjected to sol ubi 1 ization in 6M Guanidine-HCl followed by 50-fold dilution with dilute buffers. The final buffer for pNCV-IGF-i after dilution was 0.12 M Guanidine-HCl; .05 M Tris-HCl pH 8, 20 percent glycerol; 0.1 mg/ml BSA 25 .15 M MaCl; 0.1 nH EDTA and the final buffer after.dilution of the pNCV-sLE-IGF-1 refractile bodies was 0.14 M Guanidine-HCl; 25 mM Tris-HC pH 7.6; 10 mM CaC^- After spinning out particulate matter, the two solutions containing solubilized trp-IGF-1 fusion proteins were assayed by a radioimmune assay procedure of Furlanetto et al_. (23), as modified 30 by Hintz et al. (24). Both fusion proteins demonstrated activity in thi assay. A negative control prep was also included in the assay and the control exhibited no measurable activity. 03-U0L/2U sO 208339 Expression and Secretion in Yeast To avoid the necessity of refractile body purification and £91 solubilization, from bacterial cell lysates, yeast expression-secretion systems were sought as an alternative. Aside from the advantage of avoiding protein purification from cell lysates, coupled expression-secretion systems might obviate a subsequent in vitro processing step to remove a fused protein. Available were three yeast expression-secretion systems. These were: 1) yeast a factor (22), TO employing yeast a-factor promoter and preprosequence; 2) yeast invertase (15) consisting of tne invertase promoter and signal sequence; and 3) a hybrid, composed of the PGK promoter (25) and invertase signal (15).

Yeast Alpha-Factor Promoter Pre-Alpha Factor IGF-1 PIasmid Construction To obtain expression of IGF-1 using tne a factor promoter and preprosequence, a plasmid constructed oy Singh (22) was used. Plasmid ?65 (Fig. 9) possesses sequences of the a-factor promoter, a-factor preprosequence, yeast 2 micron terminator, the yeast Trp 1 gene, as well 20 as portions of the p3R322 plasmid. Due to the dearth of convenient restriction sites in the a-factor preprosequence, to insert the IGF-1 coding sequence, the identical ~230 bp EcoRI-EcoRI HuSynIGF-1-M fragment that was ligated into pNCV and pNCVsLE (as mentioned previously in bacterial construction) was used. This EcoRI-EcoRI fragment contained 25 the collagenase recognition site Proline-Alanine-Glycine-Proline, and allowed for collagenase digestion should IGF-1 be secreted as a fusion protein. The protein expressed in this construction (see Fig. 10) consists of the prepro a-factor protein fused to IGF-1. - - To insert the ~23G bp EcoRI-EcoRI fragment, the plasmid P55 was partially digested in IX EcoRI buffer with EcoRI, and then sized upon a 0.7 percent horizontal agarose gel. The band corresponding to the linearized singularly restricted plasmid was excised, eluted from the gel, and phenol extracted, chloroform extracted 2X, and then ethanol 35 precipitated. This DMA pellet was then taken up in 50 mM Tris-HCl (pH 8) #» 208 3 39 and treated with bacterial alkaline phosphatase under conditions to ensure 100 percent dephosphorylation of tne 5' protruding ends.

Following this treatment, the phosphatase activity was removed by first adding EOTA to a concentration of 15 oM, then extracting the QNA with phenol 3X, chloroform extracting 2X, and ethanol precipitating the vector. This material then contained linearized ?65 vector, digested with EcoRI in either of two locations: one, either at the EcoRI site upstream of the a-factor promoter and preprosequence, or at another, at the EcoRI site just downstream of the a-factor promoter and preprosequence. The ~230 op EcoRI-EcoRI IGF-1 fragment was ligated into the vector. The desired location of insertion was at the EcoRI site just downstream from the a-factor promoter and preprosequence.

The ligation was carried out under standard ligation conditions and 15 the transformation hosts were competent £. col i 294 prepared according to Dagert and Ehrlich (3). The transformed cells were plated onto L3-Arnp-Agar plates. Several transformants were mini screened according to the method of 3irnboim and Doly (4), and plasmid DNA prepared as such was digested both Sail ana HindiII in the appropriate buffers. One of 20 several clones which contained a plasmid with an ~110 bp EcoRI-Hindlll fragment was grown in large scale and its plasmid was purified. This plasmid, YEp9T a-factor EcoRI-EcoRI IGF-1 (see Fig. 11), was used to transform competent yeast strain 20B-12 (atrp pep4) cells according to the Hitzeman modification (19) of Hinnen et al_. (17) and Seggs et al. 25 (18) procedures.

Two such transformants, as well as a negative control transformant (with no IGF-1 insertion in the plasmid), were grown in suspension as were those of the yeast pre-invertase-IGF-l plasmid transformations. 30 Supernates were tested for secreted IGF-1 activity, as measured by the radioimmune assay procedure of Furlanetto et al_. (23) as modified by riintz £t £l_. (24). Both supernates of transformants having plasmids with IGF-1 inserts contained IGF-1 activity and the negative control supernate did not. One of these transformants was grown in large scale in a 10 35 liter fermenter and the supernate contained secreted IGF-1 activity at a ossot/tt 32 208339 peak level of ~3ug/ml. The IGF-1 activity of the fermentation supernate was also demonstrated by a placental membrane radioreceptor assay developed by Horner et aj_. (25).

Yeast Invertase Promoter Signal IGF-1 Plasmid Construction Based upon evidence of correct processing and secretion in yeast of proteins with heterologous signal sequences (16), the yeast invertase expression-secretion system became of interest. Attempted first was 10 expression of the yeast invertase signal protein fused to IGF-1 (Fig. 12), coupled with the processing and secretion of IGF-1, using the invertase promoter as a starting point for transcription.

The yeast invertase signal coding sequence was attached to the IGF-1 15 gene by the use of a Ncol-Hindlll ("400 bp) fragment containing the initiation ATG codon and 5' end of the signal DNA sequence, and 4 DNA fragments synthesized by standard procedures (2): ' AGCTTTCCTTTTCCTTTTGGC 3' 3* AAGGAAAAGGAAAACCGACCAA 5' ' TGGTTTTGCAGCCAAAATATCTGCAG 3' 3' AACGTCGGTTTTATAGACGTCCAG 5' The construction began with the isolation of the 90 bp AvaII-3amHI IGF-i left half fragment by Avail digestion of a ~730 bp PvuI-3amHI 25 fragment isolated from PvuI-3amHI digested p8R322-HtiSynIGF-l.

After phosphorylation of all four synthetic DNA fragments using standard kination conditions, the four synthetic fragments were mixed with the Avall-BamHI IGF-1 left half fragment and ligated using standard 30 ligation conditions. Following inactivation of the ligase by phenol and chloroform extraction 2X, the ethanol precipitated DNA pellet was dissolved and digested with Hindi11 and BamHI in the appropriate buffers- Newly constructed HindIII-3aniHI (ca. 140 bp) fragment was isolated and extracted from a 6 percent polyacrylamide gel. This 35 material was then ligated into Hindlll-SamHI digested p8R322 vector, 33 p> 2083^9 which had been first digested with HindiII, then 3amHI in the appropriate buffers, followed by purification of the 4014 bp vector fragment from a 6 percent gel.

The transformation host was competent £. col i 294 prepared by standard procedures (3) and the transformed cells were plated onto LB-Ampicillin agar plates. Several transformants were mini screened by the Birnboim-Doly procedure (4) and their plasmid DNAs digested with EcoRI and BamHI. Two plasmids containing a ~167 bp EcoRI-3amHI fragment 10 (i11ustrating the insertion of a 140 bp fragment into the Hindlll and BamHI sites) were grown in large scale and their plasmids prepared.

Using Maxam-Gilbert sequencing techniques (5), the entire 43 bp HindllI-AvalI section of DNA was sequenced to confirm the correct chemical synthesis and construction. The correctly constructed plasmid 15 was called p3R322-P-I-HuSynIGF HindlII-3amHI ("4154 bp).

To insert the right half of the IGF-1 gene, this newly created plasmid was digested with BamHI-Sall in the appropriate buffers and the larger fragment (~3o79 bp) was purified by gel fractionation. pBR322 20 HuSynlGF was digested with BamHI-Sall in the appropriate buffers and the 115 bp BamHI-Sall fragment correspond!'ng to the right half of the IGF-1 gene was isolated by gel fractionation. This 115 bp 8amHI-Sa1I IGF-1 right half fragment was then ligated into the SamHI-Sall digested p3R322-P-I-IGF-l LH HindlII-3amHI vector using standard ligation 25 conditions. Competent t. coli strain 294 prepared-according to Dagert and Ehrlich (3) were used as transformation hosts and transformed calls were plated onto L3-Amp-Agar plates. Several transformants were mini screened using standard techniques (4) and plasmid DMA prepared-as such was digested with EcoRI and Sail in the appropriate buffers and 30 those plasmids illustrating an insertion of the 3amHI-SalI fragment corresponding to the right half of IGF-1 were called p3R322 P-I-HuSynIGF-I Hi ndl11—Sal I. One of the clones containing the pBR322 P-I-IGF-1 Hindlll—Sa11 plasmid was grown in large scale and the plasmid was isolated. This plasmid was then digested with Hindlll and Sail in 35 the appropriate buffer to prepare a 255 bp Hi ndl11—Sal I fragment 08 containing all of the IGF-1 gene and the 3' portion of the yeast invertase signal coding sequence. This fragment of DNA was isolated by polyacrylamide gel fractionation and prepared for ligation by standard techni ques.

The ("400 op) Ncol-Hi ndl 11 fragment containing the 5' end of the DIJA sequence coding for the invertase signal as well as the yeast invertase promoter was created by fJcol and Hindlll digestion of plasmid YIpsp-LelFA (lo) in the appropriate buffers. The YIpsp-LelFA plasmid was first TO digested with Ncol to completion in the appropriate buffer, then phenol extracted, chloroform extracted 2X and ethanol precipitated. The linearized molecules were then taken up in IX Hindlll buffer and partially digested to generate the needed Ncol-Hindlll ("400 bp) fragment which contains an internal Hindlll restriction site. This Ncol-Hindlll 15 fragment was then isolated by gel fractionation and prepared for ligation using standard techniques.

To provide for a vector, plasmid pUC12-YI (EcoRI-BamHI) (16) was digested with Ncol and Sail in the appropriate buffers. After 20 purification by gel fractionation, the "2.5 kop vector was eluted from the gel and prepared for ligation by standard techniques- To perform the final construction, a three-part ligation was arranged using standard ligation techniques- The DNA used in the ligation included the Ncol-SalI-digested pUC12-YI (EcoRI-BamHI) (16), the "400 bp Ncol-Hindlll 25 and the "255 bp Hi ndl11-Sa11 fragments- After ligation, the material was transformed into competent E. col i 294 cells prepared according to Dagert et al_. (3). Transformed cells were plated onto L3-Amp-Agdr plates and several transformants were mim'screened using the procedure of Bi'fnboim and Doly (4). Plasmid DNA prepared as such was digested with Ncol and 30 Sail in the appropriate buffers and one of several clones containing plasmids exhibiting the insertion of a "625 bp Ncol-Sal I DNA fragment was grown in large scale and its plasmid was purified.

As a final step, this plasmid was linearized by digestion with Sail 35 in the appropriate buffer. Sall-EcoRI linker, prepared as mentioned p 20833 above, and kinased under standard kination condrftons, was ligat; 9 :ed to the linearized vector to convert the Sail ends to EcoRI ends using standard ligation conditions- After termination of the ligation reaction by addition of EDTA to 15 mrt, phenol extraction, chloroform extraction 2X 5 and ethanol precipitation, the D'JA pellet was dissolved in IX EcoRI buffer, and digested with EcoRI. Tne EcoRI digestion released a "1150 bp EcoRI fragment which contained the yeast invertase promoter, yeast invertase signal coding sequence and the IGF-1 coding sequence in one contiguous sequence. This material *as isolated as a "1150 bp band from 10 ^6 percent polyacrylamide slab gel after fractionation and prepared for ligation using standard procedures.

The yeast-£. coli shuttle vector to receive this EcoRI fragment was prepared by EcoRI digestion of plasmid YEp9T (15) to linearize the •J5 vector, followed by treatment of the EcoRI termini with bacterial alkaline phosphatase using conditions recommended by the manufacturer to produce 100 percent dephosphorylation of the 5' protruding ends. The phosphatase reaction was terminated by addition of EDTA to 15 mM and the mixture phenol extracted 3X, chloroform extracted 2X, and then the ONA 20 was ethanol precipitated. After redissolving the DNA pellet in IX ligation buffer, the vector was mixed with the EcoRI "1150 bp fragment and ligated under standard ligation conditions. Competent E. coli 294 cells prepared according to Dagert al_. (3) were used as "cransformatior hosts and the transformants were plated onto L3-Amp-Agar plates. To 25 determine the orientation of the insertion, several transformants were mim'screened using the method Sirnboim and Doly (4) and plasmid DNAs purified as such were digested with BamHI in the appropriate buffer. One of several transformants possessing plasmids which produced a 1.3- kb BamHI-BamHI fragment upon BamHI digestion (as opposed to a "475 bp 30 fragment) was grown in large scale and its plasmid was purified. This plasmid, called P.I.IGF-1 EcoRI-EcoRI P.I. Promoter was used to transform competent yeast cells prepared essentially according to the methods of Hinnen, A., et al_. (17), and Beggs, J.D. (IS), but with the modification: of Hitzeman (19). The yeast strain 208-12 (atrpl pep4) was used and was 35 obtained from the Yeast Genetics Stock Center. In this construction, thi 93-90L/35 2083 3^ expression of IGF-1 begins with transcription at tne invertase promoter and terminates in the yeast 2 micron sequence. The fusion protein expressed by this construction consisted of the yeast invertase signal fused to the IGF-1 protein, the combined molecular weight of which was 5 9S54 Dal tons. Another plasmid with the EcoRI fragment inserted in the reverse orientation was also used to transform competent yeast cells. In this construction, the IGF-1 was not provided with the yeast terminator.

Several transf onnants were picked and streaked on YN3-CAA agar 10 plates. Among these, three transformants were picked and inoculated into 10 ml of YN3-CAA grow-up medium, in shake flasks. A fourth culture was also started using a colony transformed with the same vector, but with the EcoRI fragment inserted into the vector in the reverse orientation. After 15-20 hours growth at 30", the cultures were sampled (1 ml) and 15 cleared of cells by spinning 5' in an eppendorf microfuge. Supernatants were taken off and assayed for secreted activity using the radioittmiine assay procedure of Furlanetto et al_. (23) as modified by Hintz et al. (24). The supernates of the three transformants demonstrated activities of 1.7 to 3.3 ng/ml of IGF-1 activity and the negative control showed no 20 activity. To determine intracellular activity, the pellets from 1 ml of culture were washed IX in 25 Tris-HCl (pr) 7.5), 1 mM EDTA ana then lysed by 3-4 minutes of vigorous vortexing in 0.5 Til of the above Tris-EDTA solution with 0.4 ml of glass beads.

Assay of the cell lysates demonstrated IGF-1 ac-tivities of 1.5-2.8 ng/ml in the three IGF-1 secreting transformants and no activity in the negative control transformant. The highest secretor of the three transformants was grown in a 5 liter fermentation and the secreted rGF-1 activity reached a peak of 74 ng/ml of supernate.

Yeast PGK Promoter Pre-Invertase IGF-1 Plasmid Construction One difficulty in the use of the invertase promoter was that it was subject to repression in the presence of glucose. Due to the 35 incompatibility of glucose with high levels of transcription initiation 0300L/3fr J7 208339 at the invertase promoter, the PGK promoter was sought as an alternative promoter, glucose, being the mainstay carbon source of fermentation processes.

To begin construction of the P&C promoter P.I.IGF-I construction, it was necessary to clone a fragment containing the entire invertase signal coding sequence. To do this, plasmid pLelF-A-Invertase Signal (16) was digested with Bglll and then 3ainHI in the appropriate buffers. This digestion released several fragments, one of which was a "625 bp ■JO BglII-3amHI fragment which was isolated from a 6 percent polyacrylamide slab gel and prepared for ligation using standard techniques. To clone this fragment, the pUC8 vector (20) was chosen as a cloning vehicle. pUC3 plasmid was digested with 3amHI in IX 3amHI buffer, treated with bacterial alkaline phosphatase to dephosphorylate the 5* termini, and •J5 then run onto and purified from a 5 percent polyacrylamide slab gel.

After standard preparation for ligation the BamHI digested vector was mixed with the above "625 Dp 3glII-3amHI fragment, and ligated under typical ligation conditions. The mixture was then transformed into 20 competent E_. col i 294 prepared by the Dagert et ^1_. method (3) and the transformed culture plated onto 13-Amp-Agar plates. Several transformant were picked and mim'screened using the 3imboim and Doly (4) technique. Miniscreen plasmid DMA was digested with EcoRI and an analytical gel of the digests illustrated two types of plasmids having EcoRI fragments 25 either "260 bp or "385 bp in length. One clone containing a "260 bp EcoRI fragment was grown in large scale and its plasmid purified. This plasmid was called pUC8 P.I. Promotor-Signai Bglll-SamHI.

A clone of this type was chosen because of the desired orientation of the inserted Bglll-BamHI fragment. What was needed from this plasmid was an "20 bp EcoRI-Hindlll fragment containing the ATG initiation codon and 5' end of the invertase signal coding sequence.

To construct the intact invertase signal coding DNA sequence, "150 bp 35 HindIII-3amHI fragment containing the 3' end of the signal sequence fused -G399fc/3? 208339 to the laft half of the IGF-1 gene was isolated from HindIII-3amHI digestion of plasmid p3R322 P.I. IGF-LH Hindlll-BaraHI ("4154 Dp). Isolation uas by polyacrylamide slab gel fractionation, and the DNA band corresponding to the "150 Dp fragment /vas excised and prepared for ligation using standard techniques.

To obtain the short ("20 bp) EcoRI-Hindlll fragment, the plasmid pUCS P.I. Promotor-Signal-3g1II-3amHI was digested with EcoRI in IX EcoRI buffer. This digestion released the "260 op EcoRI-EcoRI fragment which was isolated from a 6 percent polyacrylamide slab gel after fractionation of the digestion mixture. This "260 bp fragment was then digested with Hindlll in the appropriate buffer, causing the creation of two Hindlll-EcoRI fragments, one "20 bp and the other "240 bp in length.

After complete digestion, the digestion was terminated by addition of EDTA to 15 mM and the entire mix phenol extracted, chloroform extracted 2X, and then ethanol precipitated.

A vector was prepared by EcoRI-BamHI digestion of p3R322 (15) in the appropriate buffers followed by purification of the EcoRI-BamHI digested vector from a 5 percent polyacrylamide slab gel. After preparation for ligation using standard techniques, the vector was mixed with the "150 bp Hindlll-BamHI fragment (3' end of invertase signal + Left Half IGF-1), and the two Hindl11-EcoRI fragments (the "20 bp fragment containing the 5' end of the invertase signal coding sequence), and the entire mixture was ligated under standard ligation conditions. Competent E. col i 294 prepared according to Dagert and Ehrlicn (3) were used as transformation hosts for the ligation, and the transformed cells plated onto L3-Amp-Agar plates. Several transformants were mim'screened according to BirTiboim and Doly (4) and the purified miniscreen DMAs were digested with EcoRI and BamHI. One of several clones possessing an "170 bp EcoRI-BamHI fragment was grown in large volume and its plasmid purified. This plasmid contained the complete yeast invertase signal coding sequence fused to the left half of IGF-1 and was called P.I. IGF-1 L.H. RI-BamHI.

The desired "170 bp EcoRI-BamHI fragment was isolated from this 39 • 208339 plasmid by digestion of the plasmid with EcoTl and 3amHI in the appropriate buffers followed by slab gel fractionation of the reaction mix. Using standard techniques, the "170 bp band of DNA was prepared for m ligation. To complete the construction, the right half of IGF-1 was isolated as an "120 bp BamHI-EcoRI fragment from the plasmid P.I. IGF-1 EcoRI-EcoRI-P.I - Promoter by digestion with EcoRI and 3amHI in the appropriate buffers followed by elution from a gel slice after polyacrylamide slab gel fractionation of the digestion mixture. These f8®1} two fragments, the "170 bp EcoRI-3amHI and the "120 bp 3amHI-EcoRI, were ligated together in vitro under standard ligation conditions, witn both fragments present in roughly equimolar concentrations. This ligation mixture was then terminated by tne addition of EDTA to "15 mM followed by phenol extraction, chloroform extraction 2X, and ethanol precipitation. The DMA pellet was then taken up in IX EcoRI buffer and digested with 15 EcoRI. The digest was then run on a 6 percent polyacrylamide slab gel and the DNA band staining at "290 bp (as opposed to "340 bp and 240 bp) was excised and prepared for ligation using standard techniques- This "290 bp EcoRI-EcoRI fragment contained the entire yeast invertase signal coding sequence fused to the complete IGF-1 coding sequence.

To express this protein, it was necessary to select a yeast vector with a promoter. The PGK promoter of the plasmid YEplPT Small {see Fig. 13) was used. YEplPT Small was constructed as a derivative of YEplPT (21) by CI al and PvuII digestion of YEplPT in the appropriate buffers. 25 The protruding end was converted to a blunt end by use of DNA polymerase I (Klenow) under conditions recommended by the vendor. After blunting the Clal protruding ends, the blunt ends Clal and PvuII) of the ^ linearized vector were fused using T4 DNA ligase under standard ligation conditions. The resultant YEplPT small vector was "5.9 fcbp in size (or 3q "2.7 kbp smaller than YEplPT). Just as YEplPT, YEplPT small possesses the 2 micron origin and terminator, the PGK promoter, the TRP1 gene, and sequences from p8R322, including the 3-lactamase gene.

YEplPT Small was employed as a vector by insertion of the "290 bp 35 EcoRI fragment into the unique EcoRI site of the plasmid. EcoRI 06-90L-A32 40 208339 linearized YEplPT Snail vector was prepared oy EcoRI digestion of YEplPT small followed by bacterial alkaline phosphatase (SAP) treatment (to prevent religation of the complementary termini). The 3AP was removed by phenol extraction 3X, chloroform extraction 2X, and ethanol precipitation. Under standard ligation conditions, the "290 Dp EcoRI fragment was "ligated into tne vector.

Competent E. coli 294 prepared according to Dagert and Ehrlich (3) were used as transformation hosts and the transformed culture was plated onto LB-Amp-Agar plates. Several transformants were mim'screened by the Birnboim and Doly procedure (4) and miniscreen plasmid DriAs were digested with Hindlll in the appropriate buffer to determine the orientation of the insert. One of several transformants possessing a plasmid with a "400 bp Hindlll fragment was grown in large scale and its plasmid was ^5 purified. This plasmid was called YEplPT S-nall P.I. IGF-1 PGK promoter (see Fig. 14) and was used to transform competent yeast strain 203-12 (ATCC 20525) (gtrp pep4) cells employing the Hitzeman modification (19) of Hinnen et £l_. (17), and 3eggs et £l_. (18) procedures.

Several yeast transformants were grown in suspension in identical fashion as were those of the P.I. IGF-1 EcoRI-EcoRI P.I. promoter plasmid transformation and supernates were measured for activity determined by a radioimmune assay method of Furlanetto et al_. (23) as modified by Hintz et al_. (24). Shake flask supernates of three transformants contained 25 activities ranging from 38 to 53 ng/ml of supernate. Similarly, one of these transformants was selected and grown in larger scale, utilizing a 10 liter fermenter and the secreted IGF-1 activity in the supernate reached a peak of "780 ng/ml. This fermentation supernate was also-subjected to a radioreceptor assay (25) and was demonstrated to contain IGF-1 activity.

Mature Human IGF Production To construct a DMA sequence coding for the a-factor pre-pro protein 35 fused to the DMA sequence coding for mature IGF-I, an M-13 in vitro 0a501_/40 208339 mutagenesis technique was employed. (See Regin et al_., Proc. Acad.

Science (USA) 75, 4258; Hutchinson, _et _aT_., Journal 3io1ogical Chem. 253, 6551; Gilliam, et £l_., Gene 3, 81 and 99; Gill am, et aj_., Nucleic Acids Research 5, 2973; Adelman, et al_., D.'JA (June, 1983).) To construct the M-13 plasmid, tne plasmid Y£p9T a-factor ECoRI-ECoRI IGF-I (Figure 16) was digested with 3gl 11 and Sail and the ca. 1.5 Kbp fragment containing the a-factor promotor-signal fused to IGF-I was isolated by polyacryl ami de gel electrophoresis. This fragment was then ligated under standard ligation conditions to an MP-8 (3RD vector digested with 3amHl and Sal I, and treated witn bacterial alkaline phosphatase. This ligation mix was then transformed into competent JM101 cells prepared according to the method of Dagert and Ehrlich (3). These transformants were then mixed with non-coinpetent JM101 cells grown to log T5 phase, mixed with top agar and plated onto L3 agar plates. Several clear plaques were picked and sequenced using the M-13 diaeoxy sequencing tec'nnigue to confirm tiie presence of an insertion into the Sall-3amHl sites of the vector.

To perform the deletion according to the metnod above, a single strand of DNA of the sequence ' AGAGTTTCCGGACCT CTT TTATCCAAAG 3' was chemically synthesized by standard methods (2) and used to delete the DMA sequence ' GAGGCTGAAGCTCTAGAATTCCCTGCC 3' 3' CTCCSACTTCGAGATCTTAAGGGACGG 5' just preceding the IGF-I coding sequence of the a-factor promotor/signal IGF-I fusion sequence. This construction was then isolated as a replicative form, using a large scale plasmid preparation procedure from a JrflOl cell culture inoculated with this plasmid containing the deletion.

The isolated replicative form (10 mg) was then digested with Sail. -03$et/4dr 42 208339 Then phenol-chlorogform extracted and then ethanol precipitated and prepared for ligation. To this replicative for^ was ligated Sal I-ECoRl linkers. After ligation and inactivation of the ligase by phenol, chloroform extraction followed by ethanol precipitation, the material wa; digested with ~50 U ECoRI enzyme under standard conditions and then run onto a u percent polyacrylamide gel. The ca. 1.5 kop RI-£CcRI fragment released was isolated from the gel and prepared for ligation using standard conditions. 1Q Yeast vector was prepared by digestion of 10 mg YEP9T plasmid with 50 units of ECoRI followed by treatment with bacterial alkaline phosphatase. The digestion was then repeatedly phenol-chloroform extracted and then ethanol precipitated and prepared for ligation.

The ca. 1.5 kbp ECoRI-ECoRI fragment containing the deletion was thei ligated to the ECoRI-ECORI YEP9T vector and the ligation :nix was then transferred into competent 234 cells prepared according to the method of Dagert and Erhlich (3) and mim'screened using the method of Birnboin and Doly (4). DMA prepared was screened by degestion with ECoRI and those DMAs illustrating an insertion of the ca. 1.5 kbp fragment were used to transform competent yeast strain 203-12 (ATCC 20626) according to the modification of Hitzerman (19) of the Winner, et aj_., (17), and 3eggs, e; al., (18) procedures.

Transformants were then grown in shaker flasks -and supernates assaye and shown to have IGF-I activity by the radioimmune assay procedure of Furlanetto, et al_., (23) as modified by Hintz, et _al_., (24).

One of these clones were grown in large scale in a 10-liter fermento and IGF-I purified from the supernatant of this fermentation. This material was then subjected to amino terminal protein sequencing and shown to be mature IGF-I protein.

Human EGF is prepared in accordance with invention following analogous procedures as those described above. 0390W2 V Construction. Expression, and Secretion of Hu^an IGF-I I A double stranded DNA sequence coding for mature IGF-II was constructed fron a combination of synthetic and natural DrJA sequences ^Figure lb). This coding sequence, which did not contain an internal methionine, was attached to the TrpE leader protein coding sequence and was expressed as a fusion protein. Mature IGF—II was chemically cleaved from the purified fusion product by the action of CN3r upon a methionine residue preceding the first residue (alanine) of the mature protein.

The IGf-II coding sequence was also attached to the a-factor promoter/prepro sequence and after the appropriate deletion was made to bring the 3' end of the a-factor signal coding sequence adjacent to the 5' end of mature IGf-II coding sequence, the construction was inserted into the Yep91" vector and transformed into yeast. Resultant transformants expressed ana secreted mature human IGF-II. In the same manner, the sequence coding for mature IGF-II was attached to the preinvertase coding sequence. The resultant construction was inserted into YeplPT small and transformed into yeast. Transformants produced as such expressed and secreted mature human IGF-II.

Pharmaceutical Compositions The compounds of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the human IGF and human EGF or products hereof are combined in admixture with a pharmaceutical^ acceptable carrier vehicle. Suitable vehicles and their formulation, inclusive of other human proteins, e.g. human serum albumin are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin, which is hereby incorporated by reference.

Such compositions will contain an effective amount of the protein hereof together v/ith a suitable amount of vehicle in order to prepare pharmaceutically acceptable compositions suitable for effective administration.

Notwithstanding that reference has been made to particular preferred embodiments of the present invention, it will be understood that the present invention is not to be construed as limited to such ratheV to the lawful scope of the appended claims.

The terms "mature human IGF" and "human IGF" have the meanings given on page 2 and on pages 8 and 9 respectively. 0390L/44 -tD 208339 Bibliography A. Rinderknecht, £. W. et al., Proceedings Mational Academy of Sciences (USA) 73, 2355 (1975).

B. Rinderknecht, et _al_., Proceedings Mational Academy of Sciences (USA} 73, 4379 (1975).

C. Blundell, et aj_., Proceedings National Academy of Sciences (USA) 75, 1930 (1973).

D. Ri nderknecht, et _al_., Journal of Biological Chemistry 253, 2769 (1973), 2365 (1976).

£. Ri nderknecht, .et £l_., FEBS Letters 89, 283 (1978).

F. Zaph, et £l_., Metabol ism 27, 1803 (1978).

G. Hintz, et al., Journal of Clinical Endocrinology and Metabol ism 50, 405 (1980).

■J5 H. Blundell, et al., Mature 287, 781 (1930).

I. Hintz, et al_-, Journal of CI inical Endo. and Metaool ism 51, 672 (1980).

J. Baxter, et al., Journal of Clinical Endo. and Metabolism 54, 474 (1980).

K. Hintz, et al., Journal of Clinical Endo. and Metabolism 54, 442 (1982).

L. Schoe.nle, et al., Nature 295, 252 (1982).

M. Britisn Patent Application Publication No. 2007676A.

N. Wetzel, American Scientist 68, 664 (1980). 0. Microbiology, Second Edition, Harper and Row Publications Inc., Hagerstown, Maryland (1973), especially pages 1122 et sequence.

P. Scientific American 245, 106 (1981). 1. Rinderknecht, E. and Humbel, R.E., J. 3iol. Chem. 253, 3, 2759-2775 (1978>- 2. Crea, R. and Horn, T., Nucleic Acids Research 8, 2331-2348 (1980). 3. Dagert, M. and Ehrlich, S.D., Gene 6, 23-28 (1979). 4. Birnboim, H.C. and Doly, J., Nucleic Acids Research 7, 1513-1523 (1979). 5. Maxam, A. and Gilbert, W., Methods in Enzymology 65, 499 (1380). 0399t/«- 6. Vi n a-;<omaroff et a]_., Proc. Natl. Acad. Sci. USA 75. 3727 (1979). 7. Rowenkamp and Firtel, Sictyostelium Dev. Biol. 79, 409 (i960). 8. Wunscn, E. e_t aj_., Hoppe-Seyler's Z. Physio!. Chem. Bd. 352, S1235-1237 (Sept. 1931). 9. Haniatis, T. e_t jil_., Molecular Cloning, 425 (1982). iU. ;<leid, D.G., ?.'ew York Acad, of Sci., Annals, (in press) 11. Seifter, S. and Gallop, P.M., The Proteins, 2nd Ed- (H. Neurath, ed.) Vol. V, p. 659 (1965). 12. Nordwig, A., Leder 13, 10 (1952). 13. N2 Patent Specification 206615 14. Laenmli, U.K. Nature (London) 227, 630-635 (1970).

. Bolivar, F. et al_., Gene 2, 95 (1977). 16. Chang, C.N. (U.S.S.N. 05/433337, filed April 25, 1933). 17. Hinnen, A. et al_., Proc. Natl. Acad. Sci. USA 75, 1929-1933 (1978). 18. Beggs, J.D., Mature 275, 104-109 (1978). 19. Hitzeman, R.A. et al_. (refer to Docket 100/127) (1933), Patent: "Expression, Processing, and Secretion of Heterologous Protein by Yeast", p. 9-10.

. Capon, D. (refer to Bovine Interferon patent number) (1933). 21. Hitzeman, R.A. et al_., Science 219, 620-625 (1983). 22. Singh, A. (U.S.S.N. 06/438323, filed April 25, 1983). 23. Furlanetto, R.W., Underwood, L.E., Van Wyk, J.J., D'Ercole, A.J., J. Clin. Invest. 60, 648 (1977). 24. Hintz, R.L., Liu, F., Marshall, L.B., Chung, D., J. Clin. Endocrinol. Metab. 50, 405 (1980).

. Hitzeman, R.A. et £1_., Proceedings of the 3erkeley Workshop on Recent Advances in Yeast Molecular Biology: Recombinant DNA. U.C. Press, Berkeley, p. 173 (1982). ~ - 26. Horner, J.M., Liu, F., Hintz, R.A., J. Clin. Endocrinol. Metab. 47, 6, P. 1287 (1978). 27. Rossi, J.J., Zierzek, R., Huang, T., Walker, P.A., Itakura, K., J. 3iol. Chem. 257, 16, 5226 (1982). 0390L/46

Claims (22)

- 20833;) '""HAT WE CLAIM IS:

1. A process for producing human IGF comprising the steps of: preparing a replicable expression vector capable of expressing DNA encoding human IGF in a suitable prokaryotic or yeast host cell, said vector comprising DNA encoding human IGF, a control sequence compatible vith said prokaryotic or yeast host operably linked to said DNA encoding human IGF and capable of effecting expression thereof within the host ceil, a replication site to allow the vector to replicate automonously within said host cell and a marking sequence: transforming a prokaryotic or yeast host cell with said expression vector to obtain a recombinant host cell; culturing said recombinant host ceil under conditions permitting expression of said DNA to produce human IGF: and recovering said human IGF.

2. A process as claimed in claim 1 wherein the host is a prokaryote.

3. A process as claimed in claim 1 wherein the host is a yeast.

4. A process as claimed in any one of claims 1 to 3 wherein the vector is a plasmid.

5. A process as claimed in claim 3 wherein the vector includes DNA encoding an N-terminus pre-sequence derived from yeast alpha factor DNA such that upon expression of the DNA in a recombinant yeast host cell a polypeptide is produced which is processed by the host to remove the pre-sequence and to secrete the mature human IGF into the medium supporting the recombinant yeast host.

A process as claimed in any one of claims 1 to 5 wherein the DNA encoding human IGF codes for human IGF-I and comprises the nucleotide sequence of Figure 1. DNA

A process as claimed in any one of claims 1 encoding human IGF codes for human IGF-II an^''.comprises the^t^cleotide : oy^wiie f 61 irci? fc sequence of Figure 15. ij - 48 - 203339

8. Human IGF produced by a process as claimed in any one of claims 1 to 7.

9. Human IGF as claimed in claim 8 which is mature human IGF.

10. Human IGF as claimed in claim 8 produced in the form of a fusion protein.

11. Human IGF as claimed in any one of claims 8 to 10 which is human IGF-I.

12. Human IGF as claimed in any one of claims 8 to 10 which is human IGF-II.

13. An expression vector for use in the process of claim 1 comprising: DNA encoding human IGF: a control sequence compatible with a prokaryote or yeast host cell operably linked to said DNA encoding human IGF and capable of effecting expression thereof within the host cell: a replication site to allow the vector to replicate autonomously within said host cell: and a marking sequence.

14. An expression vector as claimed in claim 13 wherein the DNA encoding human IGF codes for human IGF-I.

15. An expression vector as claimed in claim 13 wherein the DNA encoding human IGF codes for human IGF-II.

16. An expression vector as claimed in any one of claims 13 to 15 which is a plasmid.

17. A recombinant host cell transformed with a vector as claimed in any one of claims 13 to 16 to be capable of expressing DNA encoding human IGF to produce human IGF.

18. A pharmaceutical composition comprising human IGF /as? Claimed M^Najiy one of claims 8 to 12. - 49 - M08339

19. A process as defined in claim 1 for producing human IGF substantially as herein described with reference to any example thereof.

20. Human IGF produced by the process of claim IS and having the characteristics herein described.

21. An expression vector as defined in claim 13 substantially as herein described with reference to any example thereof or as shown in the accompanying drawings.

22. A recombinant host cell as defined in claim 17 substantially as herein described with reference to any example thereof. GcAJ&ftJ T6CH 3y^Ws/Their authorised Agant A. J. PARK. Il SON