NO20130821A1 - Determination of virulence of the disinfectant pancreatic necrosis virus in fish - Google Patents
Determination of virulence of the disinfectant pancreatic necrosis virus in fish Download PDFInfo
- Publication number
- NO20130821A1 NO20130821A1 NO20130821A NO20130821A NO20130821A1 NO 20130821 A1 NO20130821 A1 NO 20130821A1 NO 20130821 A NO20130821 A NO 20130821A NO 20130821 A NO20130821 A NO 20130821A NO 20130821 A1 NO20130821 A1 NO 20130821A1
- Authority
- NO
- Norway
- Prior art keywords
- virulence
- ipnv
- fish
- amino acid
- pancreatic necrosis
- Prior art date
Links
- 230000001018 virulence Effects 0.000 title claims abstract description 26
- 241000251468 Actinopterygii Species 0.000 title claims abstract description 18
- 241000700605 Viruses Species 0.000 title description 12
- 208000009663 Acute Necrotizing Pancreatitis Diseases 0.000 title description 2
- 206010058096 Pancreatic necrosis Diseases 0.000 title description 2
- 239000000645 desinfectant Substances 0.000 title 1
- 241000710921 Infectious pancreatic necrosis virus Species 0.000 claims abstract description 29
- 230000003321 amplification Effects 0.000 claims abstract description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 16
- 125000003275 alpha amino acid group Chemical group 0.000 claims abstract description 11
- 238000000034 method Methods 0.000 claims abstract description 10
- 101710081079 Minor spike protein H Proteins 0.000 claims abstract description 8
- 238000012163 sequencing technique Methods 0.000 claims abstract description 6
- 239000002773 nucleotide Substances 0.000 claims abstract description 5
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 5
- 125000001500 prolyl group Chemical group [H]N1C([H])(C(=O)[*])C([H])([H])C([H])([H])C1([H])[H] 0.000 claims abstract description 4
- 230000003612 virological effect Effects 0.000 claims abstract description 4
- 125000003295 alanine group Chemical group N[C@@H](C)C(=O)* 0.000 claims abstract description 3
- AYFVYJQAPQTCCC-UHFFFAOYSA-N Threonine Natural products CC(O)C(N)C(O)=O AYFVYJQAPQTCCC-UHFFFAOYSA-N 0.000 claims description 3
- 239000004473 Threonine Substances 0.000 claims description 3
- 125000000341 threoninyl group Chemical group [H]OC([H])(C([H])([H])[H])C([H])(N([H])[H])C(*)=O 0.000 claims description 3
- AYFVYJQAPQTCCC-GBXIJSLDSA-N L-threonine Chemical group C[C@@H](O)[C@H](N)C(O)=O AYFVYJQAPQTCCC-GBXIJSLDSA-N 0.000 claims description 2
- 239000000203 mixture Substances 0.000 abstract description 7
- 235000019688 fish Nutrition 0.000 description 19
- 239000000243 solution Substances 0.000 description 5
- VYPSYNLAJGMNEJ-UHFFFAOYSA-N Silicium dioxide Chemical compound O=[Si]=O VYPSYNLAJGMNEJ-UHFFFAOYSA-N 0.000 description 4
- 235000001014 amino acid Nutrition 0.000 description 4
- 125000000539 amino acid group Chemical group 0.000 description 4
- 239000000872 buffer Substances 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 239000000523 sample Substances 0.000 description 4
- 229920000936 Agarose Polymers 0.000 description 3
- 239000007984 Tris EDTA buffer Substances 0.000 description 3
- 150000001413 amino acids Chemical class 0.000 description 3
- 238000012512 characterization method Methods 0.000 description 3
- 238000006243 chemical reaction Methods 0.000 description 3
- 210000003734 kidney Anatomy 0.000 description 3
- 238000013508 migration Methods 0.000 description 3
- 230000005012 migration Effects 0.000 description 3
- 239000011550 stock solution Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- QNAYBMKLOCPYGJ-REOHCLBHSA-N L-alanine Chemical compound C[C@H](N)C(O)=O QNAYBMKLOCPYGJ-REOHCLBHSA-N 0.000 description 2
- 235000004279 alanine Nutrition 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- BASFCYQUMIYNBI-UHFFFAOYSA-N platinum Chemical compound [Pt] BASFCYQUMIYNBI-UHFFFAOYSA-N 0.000 description 2
- 238000002360 preparation method Methods 0.000 description 2
- 102000004169 proteins and genes Human genes 0.000 description 2
- 239000012266 salt solution Substances 0.000 description 2
- 239000000377 silicon dioxide Substances 0.000 description 2
- 229960005486 vaccine Drugs 0.000 description 2
- 101710132601 Capsid protein Proteins 0.000 description 1
- 101710094648 Coat protein Proteins 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 102100021181 Golgi phosphoprotein 3 Human genes 0.000 description 1
- 101710125418 Major capsid protein Proteins 0.000 description 1
- 101710141454 Nucleoprotein Proteins 0.000 description 1
- 101710083689 Probable capsid protein Proteins 0.000 description 1
- ONIBWKKTOPOVIA-UHFFFAOYSA-N Proline Natural products OC(=O)C1CCCN1 ONIBWKKTOPOVIA-UHFFFAOYSA-N 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 239000013614 RNA sample Substances 0.000 description 1
- 241000277263 Salmo Species 0.000 description 1
- 241000277289 Salmo salar Species 0.000 description 1
- 241000277331 Salmonidae Species 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 210000000234 capsid Anatomy 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000011217 control strategy Methods 0.000 description 1
- 238000009795 derivation Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 230000001747 exhibiting effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000013213 extrapolation Methods 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 238000009830 intercalation Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 239000012139 lysis buffer Substances 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 230000001717 pathogenic effect Effects 0.000 description 1
- 229910052697 platinum Inorganic materials 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000002904 solvent Substances 0.000 description 1
- 230000001131 transforming effect Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 210000002845 virion Anatomy 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
En fremgangsmåte for å bestemme virulens i det infeksiøse pankreatiske nekrose virus (IPNV), Sp serotype, i en fiskeprøve som omfatter: (a) bestemmelse av tilstedeværelsen av IPNV i en fiskepopulasjon ved å ta en vevsprøve fra den samme og velge de prøver som har større viral belastning; (b) ekstrahering av RNA fra prøvene valgt i trinn (a); (c) amplifisering av den adskilte region av VP2 proteinet som inneholder rester 271 og 221 fra et eluat av RNA ekstrahert i trinn (b) ved anvendelse av de følgende prime re: IPNa1: GGGACGTCATTGTCAAGGCC og IPNs7: CGTCCGCCTAGAGGACGAGAC'; (d) rensing av amplifiseringsproduktene oppnådd i trinn (c); (e) sekvensering av det rensede amplifiseringsprodukt fra trinn (d), translasjon av nukleotidsekvensen oppnådd i en aminosyresekvens; og (f) identifikasjon av tilstedeværelsen avtreonin- eller prolin-restene i stilling 217 og av alaninresten i stilling 221 i aminosyresekvensen oppnådd i trinn (e), for å etablere henholdsvis meget høy eller medium virulens av IPNV. Blandingen av primere, IPNa1: GGGACGTCATTGTCAAGGCC og IPNs7: CGTCCGCCTAGAGGACGAGAC.A method for determining virulence in the infectious pancreatic necrosis virus (IPNV), Sp serotype, in a fish sample comprising: (a) determining the presence of IPNV in a fish population by taking a tissue sample from the same and selecting the samples that have greater viral load; (b) extracting the RNA from the samples selected in step (a); (c) amplifying the separated region of the VP2 protein containing residues 271 and 221 from an eluate of RNA extracted in step (b) using the following primers: IPNa1: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC '; (d) purifying the amplification products obtained in step (c); (e) sequencing the purified amplification product from step (d), translating the nucleotide sequence obtained into an amino acid sequence; and (f) identifying the presence of the afreonine or proline residues at position 217 and of the alanine residue at position 221 in the amino acid sequence obtained in step (e), to establish very high or medium virulence of IPNV, respectively. The mixture of primers, IPNa1: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC.
Description
Bestemmelse av virulens av det infeksiøse pankreatiske nekrose virus i fisk Determination of virulence of the infectious pancreatic necrosis virus in fish
Oppfinnelsens område Field of the invention
Foreliggende oppfinnelse angår en fremgangsmåte for å bestemme virulens av det infeksiøse pankreatiske nekrose virus (IPNV), Sp serotype, og de relaterte primere. The present invention relates to a method for determining the virulence of the infectious pancreatic necrosis virus (IPNV), Sp serotype, and the related primers.
Teknikkens stand State of the art
Det infeksiøse pankreatiske nekrose virus (IPNV) er det etiologiske middel til en verdensomspennende fordelt sykdom som forårsaker alvorlige økonomisk tap ved oppdrett av laksefisk, hovedsakelig i unge individer. VP2 protein er det viktigste og overveiende kappeprotein som danner kapsidet i IPN viruset. Molekylære undersøkelser foreslår at variasjoner, spesifikt i aminosyrestillinger 217 og 221 i VP2 proteinet ville være direkte relatert til virulensen i Sp serotype isolater. De virus som koder for treoninresten i stilling 217 og alanin i 221 er kjennetegnet ved at de er meget virulente. De isolater som har en sammensetning av aminosyrerester prolin i 217 og alanin i 221, har medium virulens, mens isolatene med treonin i stilling 221 og en ubestemt aminosyrerest i stilling 217 har lav virulens. The infectious pancreatic necrosis virus (IPNV) is the etiological agent of a worldwide distributed disease that causes severe economic losses in salmonid farming, mainly in young individuals. VP2 protein is the most important and predominant coat protein that forms the capsid in the IPN virus. Molecular investigations suggest that variations, specifically in amino acid positions 217 and 221 in the VP2 protein would be directly related to the virulence of Sp serotype isolates. The viruses that code for the threonine residue in position 217 and alanine in 221 are characterized by being very virulent. The isolates that have a composition of amino acid residues proline in 217 and alanine in 221 have medium virulence, while the isolates with threonine in position 221 and an undetermined amino acid residue in position 217 have low virulence.
Der eksisterer et behov for en metode for å bestemme virulensen i IPNV viruset, Sp serotype, så vel som for primere nødvendig for å utføre nevnte metode. There exists a need for a method to determine the virulence of the IPNV virus, Sp serotype, as well as for primers necessary to perform said method.
Ett formål med den foreliggende oppfinnelse er å tilveiebringe en fremgangsmåte for å bestemme virulensen av IPN viruset i prøver fra felt-fisksom bærer viruset. På denne måten kan en ekstrapolering av virusets adferd i populasjonen gjennomføres, som vil brukes som mål for kontrollstrategien som bør foretas av selskapet som eier fisken. One purpose of the present invention is to provide a method for determining the virulence of the IPN virus in samples from field fish carrying the virus. In this way, an extrapolation of the behavior of the virus in the population can be carried out, which will be used as a target for the control strategy that should be carried out by the company that owns the fish.
Et annet formål med den foreliggende oppfinnelse er å karakterisere stammene av IPN viruset som er blitt anvendt ved fremstillingen av kommersielle vaksiner, og disse felt-stammer, for å evaluere overensstemmelsen derav. Another purpose of the present invention is to characterize the strains of the IPN virus that have been used in the production of commercial vaccines, and these field strains, in order to evaluate their conformity.
I tillegg tilveiebringer den foreliggende oppfinnelse et system av primere som skal anvendes for bestemmelsen av IPN virusets virulens. In addition, the present invention provides a system of primers to be used for the determination of the virulence of the IPN virus.
Kort Beskrivelse av figurene Short description of the figures
Figur 1 viser oppstillingen av sekvensene og sammenhengen av typen av aminosyrerestene i stillinger 217 og 221 i VP2 proteinet, hovedsakelig på dødeligheten av fisk eksperimentelt inokulert med en kommersiell vaksine. Utledning av aminosyresekvensen fra en nukleotidsekvens oppnådd ved sekvensering av en partiell region av genet som koder for VP2 proteinet. Figur 1 viser den følgende region av IPN virus genet som anvendes for bestemmelse av virulensen av IPNV: Figure 1 shows the arrangement of the sequences and the relationship of the type of amino acid residues in positions 217 and 221 in the VP2 protein, mainly on the mortality of fish experimentally inoculated with a commercial vaccine. Derivation of the amino acid sequence from a nucleotide sequence obtained by sequencing a partial region of the gene that codes for the VP2 protein. Figure 1 shows the following region of the IPN virus gene used for determining the virulence of IPNV:
I Figur 2: Multippel oppstilling av aminosyresekvenser av klinisk tilfeller fra 6 fiskekulturer (Fisk 1, Fisk 2, Fisk 3, Fisk 4, Fisk 5 og Fisk 6) og et kommersielt virion (kom. vaks.). I Figure 2: Multiple array of amino acid sequences of clinical cases from 6 fish cultures (Fish 1, Fish 2, Fish 3, Fish 4, Fish 5 and Fish 6) and a commercial virion (com. wax.).
Beskrivelse av oppfinnelsen Description of the invention
Foreliggende oppfinnelse angår en fremgangsmåte for å bestemme virulens i det infeksiøse pankreatiske nekrose virus (IPNV), Sp serotype, i en fiskeprøve som omfatter: (a) bestemmelse av tilstedeværelsen av IPNV i en fiskepopulasjon ved å ta en vevsprøve fra den samme og velge de prøver som har større viral belastning; (b) ekstrahering av RNA fra prøvene valgt i trinn (a); (c) amplifisering av den adskilte region av VP2 proteinet som inneholder rester 271 og 221 fra et eluat av RNA ekstrahert i trinn (b) ved anvendelse av de følgende primere: IPNal: GGGACGTCATTGTCAAGGCC og IPNs7: CGTCCGCCTAGAGGACGAGAC; (d) rensing av amplifiseringsproduktene oppnådd i trinn (c); (e) sekvensering av det rensede amplifiseringsprodukt fra trinn (d), translasjon av nukleotidsekvensen oppnådd i en aminosyresekvens; og (f) identifikasjon av tilstedeværelsen av treonin- eller prolin-restene i stilling 217 og av alaninresten i stilling 221 i aminosyresekvensen oppnådd i trinn (e), for å etablere henholdsvis meget høy eller medium virulens av IPNV. The present invention relates to a method for determining the virulence of the infectious pancreatic necrosis virus (IPNV), Sp serotype, in a fish sample which comprises: (a) determining the presence of IPNV in a fish population by taking a tissue sample from the same and selecting the samples that have a higher viral load; (b) extracting RNA from the samples selected in step (a); (c) amplification of the separated region of the VP2 protein containing residues 271 and 221 from an eluate of RNA extracted in step (b) using the following primers: IPNal: GGGACGTCATTGTCAAGGCC and IPNs7: CGTCCGCCTAGAGGACGAGAC; (d) purifying the amplification products obtained in step (c); (e) sequencing the purified amplification product from step (d), translating the nucleotide sequence obtained into an amino acid sequence; and (f) identifying the presence of the threonine or proline residues at position 217 and of the alanine residue at position 221 in the amino acid sequence obtained in step (e), to establish, respectively, very high or medium virulence of IPNV.
Foreliggende oppfinnelse angår også en blanding av primere for å bestemme virulens i det infeksiøse pankreatiske nekrose virus (IPNV), Sp serotype, i en fiskeprøve som omfatter den syntetiske sekvens IPNal: GGGACGTCATTGTCAAGGCC og den syntetiske sekvens IPNs7: CGTCCGCCTAGAGGACGAGAC. The present invention also relates to a mixture of primers to determine the virulence of the infectious pancreatic necrosis virus (IPNV), Sp serotype, in a fish sample comprising the synthetic sequence IPNal: GGGACGTCATTGTCAAGGCC and the synthetic sequence IPNs7: CGTCCGCCTAGAGGACGAGAC.
Detaljert beskrivelse av oppfinnelsen Detailed description of the invention
Fra prøver tatt fra baksiden av nyren ("anterior kidney" AK) i fisk med en akutt, alvorlig eller subklinisk medisinsk tilstand forårsaket av IPNV, bestemmes initialt tilstedeværelsen av IPNV i en fiskegruppe med omtrent 10 til 20 fisk, for å etablere en utbredelse. Av de analyserte prøver velges den som har en større viral belastning for å gjennomføre genetisk karakterisering. From samples taken from the back of the kidney ("anterior kidney" AK) in fish with an acute, severe or subclinical medical condition caused by IPNV, the presence of IPNV is initially determined in a fish group of approximately 10 to 20 fish, to establish a prevalence. Of the analyzed samples, the one with a greater viral load is selected to carry out genetic characterization.
Ekstraksjonen av genetisk materiale av RNA typen fra AK blir kort utført ved anvendelse av den følgende prosedyre; prøven fra baksiden av nyren plasseres inne i en pose og macereres med en gummihammer. Deretter tilsettes nok PBS buffer til å nå en passende turbiditet (ekvivalent til nr. 5 i McFarland skalaen). 200 pl taes ut tilsettes til et Eppendorf rør inneholdende 500 pl av Trizol (Invitrogen) eller RNEt løsningsmiddel (Omega Biotek). Blandingen homogeniseres og deretter tilsettes 100 pl kloroform og den homogeniseres igjen inntil oppnåing av en løsning med et melkeaktig utseende. Den sentrifugeres ved 13000 rpm i 3 minutter og 200 pl tas fra den (transparente) toppfasen og overføres til et rør inneholdende 400 pl TRK lysisbuffer (som tilhører det totale RNA kit). 600 pl av 75% etanol tilsettes til denne blandingen og den homogeniseres. Til slutt overføres alt til en silikakolonne med et samlerør og sentrifugeres ved 13000 rpm i 1 min, den eluerte løsning kastes og samlerøret anvendes igjen. Deretter tilsettes 700 pl buffer I og løsningen sentrifugeres ved 13000 rpm i 1 min, den eluerte løsning kastet og kolonnen sentrifugeres igjen ved 13,000 rpm i 1 min for å tørke den samme. Til slutt overføres kolonnen til et på forhånd merket Eppendorf rør og 50 pl nuklease-fritt vann tilsettes til kolonnen og sentrifugeres ved 13000 rpm i 1 min; røret med eluatet lagres og kolonnen kastet. The extraction of genetic material of the RNA type from AK is briefly carried out using the following procedure; the sample from the back of the kidney is placed inside a bag and macerated with a rubber mallet. Then enough PBS buffer is added to reach an appropriate turbidity (equivalent to no. 5 in the McFarland scale). 200 µl is taken out and added to an Eppendorf tube containing 500 µl of Trizol (Invitrogen) or RNEt solvent (Omega Biotek). The mixture is homogenized and then 100 µl of chloroform is added and it is homogenized again until a solution with a milky appearance is obtained. It is centrifuged at 13000 rpm for 3 minutes and 200 µl is taken from the (transparent) top phase and transferred to a tube containing 400 µl TRK lysis buffer (which belongs to the total RNA kit). 600 µl of 75% ethanol is added to this mixture and it is homogenized. Finally, everything is transferred to a silica column with a collection tube and centrifuged at 13,000 rpm for 1 min, the eluted solution is discarded and the collection tube is used again. Then 700 µl buffer I is added and the solution is centrifuged at 13,000 rpm for 1 min, the eluted solution is discarded and the column is centrifuged again at 13,000 rpm for 1 min to dry it. Finally, the column is transferred to a pre-labeled Eppendorf tube and 50 µl of nuclease-free water is added to the column and centrifuged at 13000 rpm for 1 min; the tube with the eluate is saved and the column discarded.
RNA eluert fra RNA ekstraksjonstrinnet anvendes for å utføre amplifisering av den adskilte region av VP2 inneholdende rester 217 og 221. Amplifiseringen blir for eksempel utført med et kommersielt kit, i dette tilfellet anvendes SuperScript® III One-Step RT-PCR System med Platinum® Taq DNA Polymerase (Invitrogen) hvortil det tilsettes de følgende primere IPNal = GGGACGTCATTGTCAAGGCC og IPNs7 = RNA eluted from the RNA extraction step is used to carry out amplification of the separated region of VP2 containing residues 217 and 221. The amplification is carried out, for example, with a commercial kit, in this case the SuperScript® III One-Step RT-PCR System with Platinum® Taq is used DNA Polymerase (Invitrogen) to which are added the following primers IPNal = GGGACGTCATTGTCAAGGCC and IPNs7 =
CGTCCGCCTAGAGGACGAGAC. CGTCCGCCTAGAGGACGAGAC.
Kort fremstilles en rekke reaksjoner basert på antallet prøver som skal analyseres. For eksempel for fremstilling av 10 amplifiseringsreaksjoner, blir mikroplater svarende til dette antall reaksjoner fremstilt og stamløsningen fremstilles som beskrevet i kittet; den følgende tabell viser volumene av hver komponent for fremstilling av stamløsningen: Briefly, a number of reactions are prepared based on the number of samples to be analyzed. For example, for the preparation of 10 amplification reactions, microplates corresponding to this number of reactions are prepared and the stock solution is prepared as described in the kit; the following table shows the volumes of each component for the preparation of the stock solution:
Deretter plasseres 23 pl av stamløsningen i hvert av mikrorørene og 2 pl av den tidligere ekstraherte RNA prøven tilsettes til hvert. Deretter plasseres rørene i en sanntid thermosykler med den følgende termiske profil eller plan: Then 23 µl of the stock solution is placed in each of the microtubes and 2 µl of the previously extracted RNA sample is added to each. The tubes are then placed in a real-time thermocycler with the following thermal profile or plan:
1 cyklus: 50°C, 15 minutter 1 cycle: 50°C, 15 minutes
1 cyklus: 95°C, 20 sekunder 1 cycle: 95°C, 20 seconds
40 syklusere: 95°C, 10 sekunder 55°C, 15 sek<*>, fluorescensavlesning 40 cyclers: 95°C, 10 seconds 55°C, 15 sec<*>, fluorescence reading
1 syklus: 25°C, 30 sekunder 1 cycle: 25°C, 30 seconds
Ved slutten av amplifiseringen utføres elektroforese. Dette blir utført i en 2% agarosebærer (2 gram agarose i 100 ml TE buffer), som tillater å utføre en differensiell migrering av de amplifiserte PCR-produkter. Prøvene lastes på en bærer som i sin tur nedsenkes i et kammer inneholdende TE buffer, et saltløsningsmedium, hvortil det påføres et elektrisk potensiale som genererer migreringen av amplifikasjonsproduktene. Produktene migrerer mot den positive polen fordi det genetiske materialet har negativ ladning og TE bufferen genererer saltløsningsmediet for generering av det potensielle differensial og for generering av migrering. Produktene kjører i nesten omtrent 15 minutter. Etter dette fjernes agarosen fra elektroforesekammeret og plasseres på en UV bord. Når agarosegelen fremstilles, plasseres et interkalerende element blir plassert som ved interkalering i DNA i nærvær av UV genererer et fluorescerende signal som kan observeres visuelt. Når et enkelt fluorescerende signal i form av et bånd observeres ved en høyde på omtrent 250 pb, svarer det til den spesifikke amplifikasjon dannet ved IPNal og IPNs7 primere (IPNal = GGGACGTCATTGTCAAGGCC og IPNs7 CGTCCGCCTAGAGGACG AGAC). Båndet skjæres ut ved hjelp av en skalpell og DNA inneholdt i det utskårede fragment blir renset med et kommersielt kit. I dette tilfellet anvendes for eksempel Minelute gel ekstraksjonskittet (Qiagen). Kort blir det utskårede båndet (omtrent 30 mg) plassert i et Eppendorf rør, 300 pl av QG Buffer tilsettes og blandingen inkuberes ved 50°C i 15 minutter. Etter inkubering, tilsettes 100 pl isopropanol og blandingen homogeniseres. Løsningen overføres til silika- kolonnen og den sentrifugeres ved 13000 rpm i 1 minutt. Eluatet fjernes og 300 pl av QG buffer tilsettes til kolonnen og man sentrifugerer igjen ved 13000 rpm i 1 minutt. Deretter gjennomføres en vasking med 600 pl PE buffer og man sentrifugerer ved 13000 rpm i 1 minutt. Eluatet fjernes og kolonnen tørkes ved sentrifugering ved 13000 rpm i 2 minutter. Kolonnen overføres til et Eppendorf rør på 1,5 mi og 15 pl av BE elueringsbuffer tilsettes til kolonnen og man sentrifugerer ved 13000 rpm i 1 minutt. Kolonnen fjernes og det rensede amplifiseringsprodukt forblir i Eppendorf røret. At the end of the amplification, electrophoresis is performed. This is carried out in a 2% agarose carrier (2 grams of agarose in 100 ml TE buffer), which allows a differential migration of the amplified PCR products to be carried out. The samples are loaded onto a carrier which in turn is immersed in a chamber containing TE buffer, a salt solution medium, to which an electrical potential is applied which generates the migration of the amplification products. The products migrate towards the positive pole because the genetic material has a negative charge and the TE buffer generates the salt solution medium for generating the potential differential and for generating migration. The products run for almost 15 minutes. After this, the agarose is removed from the electrophoresis chamber and placed on a UV table. When the agarose gel is prepared, an intercalating element is placed which, when intercalated into DNA in the presence of UV, generates a fluorescent signal that can be observed visually. When a single fluorescent signal in the form of a band is observed at a height of about 250 pb, it corresponds to the specific amplification formed by IPNal and IPNs7 primers (IPNal = GGGACGTCATTGTCAAGGCC and IPNs7 CGTCCGCCTAGAGGACG AGAC). The band is excised using a scalpel and the DNA contained in the excised fragment is purified with a commercial kit. In this case, for example, the Minelute gel extraction kit (Qiagen) is used. Briefly, the excised band (approximately 30 mg) is placed in an Eppendorf tube, 300 µl of QG Buffer is added and the mixture is incubated at 50°C for 15 minutes. After incubation, 100 µl isopropanol is added and the mixture is homogenized. The solution is transferred to the silica column and it is centrifuged at 13,000 rpm for 1 minute. The eluate is removed and 300 µl of QG buffer is added to the column and centrifuged again at 13,000 rpm for 1 minute. A wash is then carried out with 600 pl PE buffer and centrifuged at 13,000 rpm for 1 minute. The eluate is removed and the column is dried by centrifugation at 13,000 rpm for 2 minutes. The column is transferred to a 1.5 ml Eppendorf tube and 15 µl of BE elution buffer is added to the column and centrifuged at 13,000 rpm for 1 minute. The column is removed and the purified amplification product remains in the Eppendorf tube.
Når amplifiseringsproduktet er renset, sendes det for sekvensering til et selskap som tilveiebringer denne service, så som Macogen i Korea eller Biogenetics i Chile. Nevnte selskaper genererer elektroniske sekvenseringsfiler som kan analyseres med en kommersiell programvare. I dette tilfellet, anvendes vektor NTI 10 programvaren, som tillater at disse filene leses og redigeres. Programvaren har mange bioinformatikk verktøy, blant hvilke man finner translasjonen av en nukleotidsekvens til en aminosyresekvens. Dette blir utført ved kun transformering av DNA triplettene til deres tilsvarende aminosyre, den genetiske kode; Figur 1. Once the amplification product is purified, it is sent for sequencing to a company that provides this service, such as Macogen in Korea or Biogenetics in Chile. Said companies generate electronic sequencing files that can be analyzed with commercial software. In this case, the vector NTI 10 software is used, which allows these files to be read and edited. The software has many bioinformatics tools, among which one finds the translation of a nucleotide sequence into an amino acid sequence. This is done by simply transforming the DNA triplets into their corresponding amino acid, the genetic code; Figure 1.
Deretter identifiseres restene relatert til virulens med søking etter den spesifikke og konserverte LLP aminosyresekvensen for posisjonering og identiteten til stillinger 217 og 221 er relatert til det som er beskrevet i forsøkene utført i Shivappa RB, H Song, K Yao, A Aas-Eng, O Evensen, V Vakharia. 2004. Molecular characterization of Sp serotype strain of infectious pancreatic necrosis virus exhibiting difference in virulence. Dis Aquat Org 61, 23-32, og som nevnt i innledningen, kan en kombinasjon av aminosyrer i disse stillinger være forbundet med en grad av virulens. Next, the residues related to virulence are identified by searching for the specific and conserved LLP amino acid sequence for positioning and the identity of positions 217 and 221 is related to that described in the experiments performed in Shivappa RB, H Song, K Yao, A Aas-Eng, O Evensen, V Vakharia. 2004. Molecular characterization of Sp serotype strain of infectious pancreatic necrosis virus exhibiting difference in virulence. Dis Aquat Org 61, 23-32, and as mentioned in the introduction, a combination of amino acids in these positions may be associated with a degree of virulence.
Formålet med analysen er for å se virulensen til viruset og hvorledes den er relatert til den tilstand som presenteres. For eksempel hvis et virus med rester med lav virulens erkarakterisertog tilstanden har lav dødelighet, vil der for en fremtidig hendelse med et virus som har samme rester kunne dannes en vurdering angående en sannsynlighet for tilstandens adferd basert på den tidligere dannede informasjon. The purpose of the analysis is to see the virulence of the virus and how it is related to the condition presented. For example, if a virus with residues of low virulence has been characterized and the condition has low mortality, then for a future event with a virus that has the same residues, an assessment can be formed regarding a probability of the condition's behavior based on the previously formed information.
Eksempelvis viser figur 2 en multippel oppstilling av aminosyresekvenser, hvor stillinger 217 og 221 er belyst. Sekvensene som har forkortelsene Fisk 1, 2, 3, 4, 5 og 6 svarer til kliniske tilfeller fra 6 fiskekulturer som reporterte om høy dødelighet (i området mellom 30-50%), som samsvarte med typen av aminosyrerestene i stillinger 217 og 221. På denne måten, for en fremtidig hendelse, når disse aminosyrer er funnet i en genetisk karakterisering av patogenet ved begynnelsen av kliniske hendelser, vil det være mulig å beregne den forventede dødelighet basert på den historiske og genetiske informasjon. For example, Figure 2 shows a multiple arrangement of amino acid sequences, where positions 217 and 221 are illuminated. The sequences with the abbreviations Fish 1, 2, 3, 4, 5 and 6 correspond to clinical cases from 6 fish cultures that reported high mortality (in the range between 30-50%), which matched the type of amino acid residues in positions 217 and 221. In this way, for a future event, when these amino acids are found in a genetic characterization of the pathogen at the beginning of clinical events, it will be possible to calculate the expected mortality based on the historical and genetic information.
Bibliografi Bibliography
Santi N, V Vakharia, O Evensen. 2004. Identification of putative motifs involved in the virulence of infectious pancreatic necrosis virus. Virology 322, 31-40. Santi N, V Vakharia, O Evensen. 2004. Identification of putative motifs involved in the virulence of infectious pancreatic necrosis virus. Virology 322, 31-40.
Shivappa RB, H Song, K Yao, A Aas-Eng, O Evensen, V Vakharia. 2004. Molecular characterization of Sp serotype strain of infectious pancreatic necrosis virus exhibiting difference in virulence. Dis Aquat Org 61, 23-32. Shivappa RB, H Song, K Yao, A Aas-Eng, O Evensen, V Vakharia. 2004. Molecular characterization of Sp serotype strain of infectious pancreatic necrosis virus exhibiting difference in virulence. Dis Aquat Org 61, 23-32.
Song H, N Santi, O Evensen, V Vakharia. 2005. Molecular determinants of infectious pancreatic necrosis virus virulence and cell cultura adaption. J Virol 79, 10289-10299. Roberts RJ, MD Pearson. 2005. Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. J Fish Dis 28, 383-390. Song H, N Santi, O Evensen, V Vakharia. 2005. Molecular determinants of infectious pancreatic necrosis virus virulence and cell culture adaptation. J Virol 79, 10289-10299. Roberts RJ, Pearson MD. 2005. Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. J Fish Dis 28, 383-390.
Claims (4)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CL14172010 | 2010-12-10 | ||
| PCT/CL2011/000074 WO2012075597A1 (en) | 2010-12-10 | 2011-12-09 | Determination of the virulence of infectious pancreatic necrosis virus in fish |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| NO20130821A1 true NO20130821A1 (en) | 2013-06-26 |
Family
ID=46206504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NO20130821A NO20130821A1 (en) | 2010-12-10 | 2013-06-12 | Determination of virulence of the disinfectant pancreatic necrosis virus in fish |
Country Status (5)
| Country | Link |
|---|---|
| AU (1) | AU2011340099A1 (en) |
| CA (1) | CA2821012A1 (en) |
| GB (1) | GB2499962A (en) |
| NO (1) | NO20130821A1 (en) |
| WO (1) | WO2012075597A1 (en) |
-
2011
- 2011-12-09 AU AU2011340099A patent/AU2011340099A1/en not_active Abandoned
- 2011-12-09 WO PCT/CL2011/000074 patent/WO2012075597A1/en active Application Filing
- 2011-12-09 CA CA2821012A patent/CA2821012A1/en not_active Abandoned
- 2011-12-09 GB GB1311626.4A patent/GB2499962A/en not_active Withdrawn
-
2013
- 2013-06-12 NO NO20130821A patent/NO20130821A1/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| GB2499962A (en) | 2013-09-04 |
| GB201311626D0 (en) | 2013-08-14 |
| CA2821012A1 (en) | 2012-06-14 |
| AU2011340099A1 (en) | 2013-07-11 |
| WO2012075597A1 (en) | 2012-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wise et al. | Comparative sequence analysis of the distal one-third of the genomes of a systemic and an enteric ferret coronavirus | |
| Baker et al. | The overlapping RNA-binding domains of p33 and p92 replicase proteins are essential for tombusvirus replication | |
| Forslund et al. | Improved detection of cutaneous human papillomavirus DNA by single tube nested ‘hanging droplet’PCR | |
| O'Guinn et al. | Field detection of eastern equine encephalitis virus in the Amazon Basin region of Peru using reverse transcription-polymerase chain reaction adapted for field identification of arthropod-borne pathogens | |
| Cano-Gómez et al. | Analyzing the genetic diversity of teschoviruses in Spanish pig populations using complete VP1 sequences | |
| Lozano et al. | Characterization of arenaviruses using a family-specific primer set for RT-PCR amplification and RFLP analysis: its potential use for detection of uncharacterized arenaviruses | |
| Borschensky et al. | Mutations in the 3c and 7b genes of feline coronavirus in spontaneously affected FIP cats | |
| Puthavathana et al. | Typing of hantaviruses from five continents by polymerase chain reaction | |
| Leifer et al. | Escape of classical swine fever C-strain vaccine virus from detection by C-strain specific real-time RT-PCR caused by a point mutation in the primer-binding site | |
| Malandraki et al. | One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees | |
| Bedarida et al. | Identification of viral DNA (Anelloviridae) in a 200-year-old dental pulp sample (Napoleon's Great Army, Kaliningrad, 1812) | |
| Callens et al. | Highly sensitive detection of swine vesicular disease virus based on a single tube RT-PCR system and DIG-ELISA detection | |
| Butkovic et al. | Evolution of anelloviruses from a circovirus-like ancestor through gradual augmentation of the jelly-roll capsid protein | |
| Zhou et al. | Rovac is the possible ancestor of the Russian lapinized vaccines LK-VNIVViM and CS strains but not the Chinese strain (C-strain) vaccine against classical swine fever | |
| Gouvea et al. | Hepatitis E virus in Nepal: similarities with the Burmese and Indian variants | |
| JP2011078358A (en) | Method for detecting norovirus | |
| Bennett et al. | Butcherbird polyomavirus isolated from a grey butcherbird (Cracticus torquatus) in Queensland, Australia | |
| Osaki et al. | Nucleotide sequence of a mitochondrial RNA virus from the plant pathogenic fungus, Helicobasidium mompa Tanaka | |
| Phong et al. | Sequence analysis of Malaysian infectious bursal disease virus isolate and the use of reverse transcriptase nested polymerase chain reaction enzyme-linked immunosorbent assay for the detection of VP2 hypervariable region | |
| NO20130821A1 (en) | Determination of virulence of the disinfectant pancreatic necrosis virus in fish | |
| de Villiers et al. | Identification of new papillomavirus types | |
| Neill et al. | Recombination with a cellular mRNA encoding a novel DnaJ protein results in biotype conversion in genotype 2 bovine viral diarrhea viruses | |
| AU741656B2 (en) | Non-B non-C non-G hepatitis virus gene, polynucleotide, polypeptide, virion, method for separating virion, and method for detecting virus | |
| RU2560422C2 (en) | Means of obtaining preparations for diagnosing rickettsiosis caused by rickettsia slovaca | |
| Navarro et al. | An improved Taura syndrome virus (TSV) RT-PCR using newly designed primers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FC2A | Withdrawal, rejection or dismissal of laid open patent application |