NO176844B - Enzymatically active analogues of a Bacillus subtilisin, nucleic acid, host cell, method of improving the heat and pH stability of such a subtilisin, and detergent composition comprising such analog - Google Patents

Description

The background of the invention

The present invention generally relates to heat-stable and pH-stable analogues of the enzyme Bacillus subtilisin, as well as nucleic acids and host cells for the production of such analogues. The present invention particularly relates to analogues of Bacillus subtilisin with a substitution for Asn<218>, as well as nucleic acids and host cells for the production of such analogues.

The term subtilisin denotes a group of extracellular alkaline serine proteases produced by various Bacillus species. These enzymes are also called Bacillus serine proteases, Bacillus subtilisins or bacterial alkaline proteases.

The Bacillus subtilisin molecules consist of a single polypeptide chain of either 274 residues (for Carlsberg-type subtilisin produced by Bacillus licheniformis,

and for the subtilisin produced by Bacillus strain DY) or 275 residues (for subtilisin of type BPN<1>, produced by Bacillus amyloliquefaciens, and the aprA gene product from

Bacillus subtilis). When comparing amino acid sequences

in subtilisin from different strains of Bacillus, the sequence of subtilisin BPN' is used as a standard. Based on

a list of sequences which gives the greatest degree of homology between subtilisin Carlsberg and subtilisin BPN', it is referred to e.g. to the serine in the active site of the first-mentioned subtilisin as serine 221, although it is located at position 220 in the amino acid sequence. On the same basis, position 220 in the amino acid sequence of subtilisin Carlsberg can be said to "correspond" to position 221 in subtilisin BPN'.

See e.g. Nedkov et al., Hoppe-Seyler<*>s Z. Physiol. Chem., 364, 1537-1540 (1983). 'The X-ray structure of subtilisin BPN' [Wright et ;al., Nature, 221, 235 (1969)] revealed that the geometry of the catalytic site of subtilisin, comprising Asp^, His^^ ;221 ;and Ser , is nearly identical to the geometry of the active site of mammalian serine proteases (e.g. chymotrypsin); which includes the residues Asp"*"^, His^ and Ser^"^. However, the overall differences between Bacillus serine proteases and mammalian serine proteases indicate that these are two un-

related families of proteolytic enzymes.

In the family of Bacillus subtilisins, complete amino acid sequences are available for four subtilisins: Carlsberg, [Smith et al., J. Biol. Chem., 243, 2184-2191

(1968)]; BPN<1> [Markland et al., J. Biol. Chem., 242, 5198-5211 (1967)]; the aprA gene product [Stahl et al.,

J. Bacteriol., 158, 411-418 (1984)]; and DY [Nedkov et al., supra). Subtilisin Carlsberg and subtilisin BPN' (sometimes referred to as subtilisin Novo) differ in 84 amino acids and an additional residue in BPN' (subtilisin Carlsberg lacks an amino acid residue corresponding to residue 56

in subtilisin BPN'), Smith et al., supra. Subtilisin DY is 274 amino acids long and differs from subtilisin Carlsberg in 32 amino acid positions and from subtilisin BPN<1> with 82 amino acid substitutions and one deletion (subtilisin DY lacks an amino acid residue corresponding to residue 56 in subtilisin BPN<1>), Nedkov, et al., supra. The amino acid sequence of the aprA gene product is 85% homologous to the amino acid sequence of subtilisin BPN', Stahl, et al., supra. It thus appears that there is extensive homology between amino acid sequences of serine proteases from different strains of Bacillus. This homology is complete in certain areas of the molecule and particularly in the areas that play a role in the catalytic mechanism and in substrate binding. Examples of such mutual variations in sequence are the primary and secondary

T. v,v, 125 T 126 127 ~, 128 substrate binding sites, respectively. Ser -Leu -Gly -Gly and Tyr 104, and the sequence around the reactive senn (221) ^ 218 219 220 0 221 Mq4_222 223

Asn-Gly-Thr-Ser-Met-Ala

Subtilisin molecules have some unique stability properties. They are not completely stable at any pH value, although they are relatively resistant to denaturation with urea and guanidine solutions, and enzyme activity is retained for some time even in a solution of 8 M urea. In solutions at a pH below 4, subtilisin rapidly and irreversibly loses its proteolytic activity. Gounaris et al., Compt. Clear. Trot. Lab. Carlsberg, 35, 37 (1965) showed that the acid deactivation of subtilisin is not due to a general charge effect, and assumed that it is due to other changes in the molecule, such as protonation of histidine residues in the inner, hydrophobic parts of the molecule. In solution at pH above 5, Bacillus serine proteases undergo gradual irreversible inactivation at a rate that increases with temperature and pH. The mechanisms of this inactivation are not fully known, but there are indications that self-dissolution is at least partially responsible for enzyme instability in this pH range.

The use of proteases in industrial processes requiring the hydrolysis of proteins has been limited due to enzyme instability under operating conditions. E.g. thus, incorporation of trypsin into laundry detergents (eg "Bio-38") to facilitate removal of proteinaceous stains was very unsuccessful, undoubtedly a result of enzyme instability under washing conditions. It was not until around 1960, after the introduction of the use of bacterial alkaline proteases which are more compatible with detergents, that proteases became commonly used in the detergent industry.

For practical reasons, many industrial processes are carried out at temperatures that are above the stability range of most enzymes. It is therefore reasonable to assume that highly heat-stable proteases will not only be beneficial for certain industries, such as detergent production and skin depilation, which already require stable proteases, but may be useful in industries that use chemical agents to hydrolyze proteins, e.g. e.g. hydrolysis of vegetable and animal proteins for the production of soup concentrates.

However, it should be pointed out that although heat inactivation may be the most important way of inactivating enzymes,

factors other than heat, such as extreme pH values and extreme values of oxygen content and denaturants, can have a decisive effect on limiting the use of proteases in industrial processes. It is therefore desirable to obtain proteases which are characterized by improved stability under the operating conditions used in various industries. Such a goal can be achieved either

through research for new, more stable wild-type enzymes, or through stabilization of proteases that are already known to exist.

Although the Bacillus-derived alkaline proteases are more compatible with detergent compositions than were the pancreatic proteases, they are still not ideal in all respects.

During the last few years, there have been major changes in detergent mixtures, particularly in the replacement of phosphates with alternative detergent builders, and in the development of liquid laundry detergents to meet environmental and consumer requirements. These changes create a need for changes in traditional detergent enzymes. More specifically, it has become desirable to use proteolytic enzymes that provide greater storage stability in liquid laundry detergent mixtures, as well as stability and activity in wider pH and temperature ranges.

In one attempt to produce modified subtilisins for use in detergent compositions, as described in European Patent Application No. 130,756, mutations in the subtilisin from Bacillus amyloliquefaciens (B. amyloliquefaciens) in Tyr<-1>, Asp<32>, Asn<155 >, Tyr<1>04, Met<222>, Gly166, His64, Gly169, Phe<1>89, Ser33, Ser221, Tyr217,

Glu^6 and/or Ala''"52 determined to give altered stability, altered conformation or to have changes in the "processing gene" of the enzyme. In this context, mutation of Met 222 to Ala, Cys (a mutant that also exhibits a sharper pH optimum than wild type) or Sees to result in improved

166 oxidation stability. Substitution of Gly with Ala, Asp, Glu, Phe, Hys, Lys, Asn, Arg or Val appears to change the kinetic parameters of the enzyme. However, none of the mutations have been described to give analogues with greater stability at high temperatures or stability over a wider pH range than the wild-type enzyme.

In the second method, it appears that the pH dependence of subtilisin can be changed, as described in Thomas et al., Nature, 318, 375-376 (1985), by changing

9 9 100

an Asp to Ser in Asp -Gly in subtilisin BPN'. This change represents a change of a surface charge

14-15 Angstroms from the active seat. The procedure to

s Thomas et al. however, does not give an indication of improvement when no change is made in surface charge, as is the case when one uncharged residue is substituted for another.

3 Summary of the invention

The present invention provides analogs of Bacillus serine protease products that are characterized by improved pH and heat stability, which makes them particularly

usable in detergent mixtures, as well as in other processes

5 which requires the use of protease. Enzymatically active analog of a Bacillus subtilisin, where the Bacillus subtilisin has an amino acid sequence comprising an Asn-Gly sequence according to the present invention is characterized in that the analog has a

amino acid sequence where the residues in the Asn-Gly sequence have been removed 3 or are replaced by a residue of another amino acid.

It should be noted that the term "subtilisin" as used herein is used to refer to the fully formed, secreted form of the enzyme lacking leader sequences cleaved from the completed enzyme before or during

<5> the excretion.

Analogues of a Bacillus subtilisin according to the present invention which are currently preferred have an amino acid sequence where positions comprising an Asn-Gly sequence in the Bacillus subtilisin do not comprise an Asn-Gly-<5> sequence in the analogue, and in particular where the are fewer Asn-Gly sequences than in the Bacillus subtilisin. Most preferably, a position corresponding to position 218 in the amino acid sequence indicated in Table 1 does not comprise an asparaginyl residue, but comprises

rather a residue of another amino acid, preferably one

<5> amino acid selected from serine, valine, threonine, cysteine, glutamine and isoleucine. To the extent that replacement of asparagine with certain amino acids can give rise to inter-

ference with the conformation in the active site, (e.g. on

(due to steric hindrance which may be introduced through the presence of an aromatic amino acid or changes in tertiary structure, such as may be introduced through the presence of a proline), substitution with such amino acids will usually be less preferred. To the extent that replacement of asparagine with other amino acids can introduce a charged group (e.g. aspartic acid) in the vicinity of the active site, such substitution will likewise be less preferred. An example of a currently preferred embodiment of an analog according to the present invention,

is a [Ser 218] analog of the aprA gene product. Alternative embodiments of the analogues within the scope of the invention.

the exceptions are those where Asn in subtilisin BPN<1> or in the aprA gene product is replaced preferably by a serine, and where glycine residues in positions 110 and/or 219 are replaced by other amino acid residues. Other subtilisins also include substitution of Asn in residue 62 or Gly in residue 63 in the subtilisins Carlsberg or DY in the present invention.

A nucleic acid according to the present invention has codons which code for a polypeptide analogue as described above.

A host cell according to the present invention which can express an enzymatically active analogue of a Bacillus subtilisin is characterized in that it comprises a nucleic acid which codes for an analogue of Bacillus subtilisin with an amino acid sequence where a residue in a position corresponding to position 218 in the amino acid sequence described in Table 1, does not include an asparaginyl residue. In such a cell, the nucleic acid encoding the subtilisin analogue can be chromosomal or extrachromosomal. The host cell is preferably selected from a strain deficient in secreted proteases, which enables easy isolation of analogous compounds.

A detergent mixture according to the present invention comprises an enzymatically active analogue of a Bacillus subtilisin with an amino acid sequence comprising an Asn-Gly sequence, characterized in that one or both residues of the Asn-Gly sequence have been removed.

A method for improving the heat and pH stability of subtilisins according to the present invention is characterized by the fact that a residue in the Asn-Gly sequence is removed or one or both residues in the Asn-Gly sequence are replaced with another amino acid, and in particular exchange the asparagine residue at the position in the amino acid sequence of subtilisin corresponding to position 218 in the amino acid sequence indicated in Table 1.

Brief description of the drawings

Figure 1 schematically shows the cyclization of Asn-Gly residues, such as those found in positions 218 and 219 in subtilisin indicated in Table 1, whereby anhydro-aspartylglycine is formed, and also shows base-catalyzed hydrolysis thereof. Figure 2 is a partial restriction map for an aprA gene containing an EcoRI-Kp_nI gene fragment from Bacillus subtilis (B. subtilis) strain QB127 and comprises a partial restriction map for the aprA gene and flanking sequences. Figure 3 is a partial restriction map for a plasmid pAMBll. Figure 4 is a flow chart showing the steps in construction of pAMB113, a plasmid that directs synthesis of [Ser] 218-subtilisin from B. subtilis host cells. Figure 5 is a partial restriction map for the plasmid pAMB30.

Detailed description

Bacillus serine proteases undergo irreversible inactivation in aqueous solutions at a rate that is largely dependent on temperature and pH. At pH values below 4 or above 11, the rate of inactivation is very fast, while the rate at pHs between 4.5 and 10.5,

although much slower, increases as the solution becomes more alkaline. At all pH values, it generally applies that the higher the temperature, the faster the rate of subtilis inactivation.

A conserved sequence, Asn-Gly, at positions 109-110

and particularly in positions 218-219 in Bacillus subtilisins is here identified as a main factor responsible for pH instability in these substances. The sequence Asn-Gly in proteins and peptides undergoes easy cyclization under various conditions so that the ring-shaped imide-anhydroaspartylglycine is formed [Bornstein et al., Methods in Enzymol., 4_7, 132-145 (1977)], as shown in figure 1. This cyclic imide is sensitive to base-catalyzed hydrolysis which preferentially yields a non-naturally occurring, (3-aspartyl peptide bond. Moreover, the cyclic imide derived from Asn-Gly can serve as a target for specific cleavage of subtilisin. Indeed, it has specific cleavage of proteins in Asn-Gly linkages with alkaline hydroxylamine has become common practice in the preparation of protein fragments for use in amino acid sequencing [Bornstein et al., supra].

Formation of a cyclic imide and/or (3-aspartyl-glycyl peptide at Asn 218 -Gly in subtilisin can be predicted to cause irreversible inactivation of the enzyme. This prediction is based on the proximity between the unstable Asn-Gly element and a reactive serine located in position 221. A computer analysis of protein structures led to the assumption that rearrangement of Asn 218 -Gly 219 either to anhydroaspartyl-glycyl or to [3-aspartyl-glycyl results in a displacement of the side chain in Ser <221> away from the position which it must consume for the enzyme to be active.

218 219 To eliminate the unstable element, Asn -Gly ,

218

from the subtilisin molecule, one can either replace Asn with any other amino acid or asparagine, and/or

219

change Gly to any amino acid other than glycine. In a similar way, modification of the unstable Asn-Gly element in positions 109-110 is expected to provide advantages for the stability of analogues according to the invention.

219

The observed interspecific variation in Gly in subtilisins and in subtilisin-like enzymes [e.g. Cucumisin from the melon Cucumis Melo L. Var Prince, Kaneda

et al., J. Biochem., 95, 825-829 (1984); and proteinase K,

a subtilisin-like serine protease from the fungus Tritirachium album, Jany et al., Biol. Chem. Hoppe-Seyler, 366, 485-492

(1985)], and the assumption that if Gly 219 were any other residue than glycine, its side chain could interfere with the binding of a substrate to the enzyme, the change of Asn 218 in place of Gly <219> for the removal of the unstable Asn 218 -Gly <219-> sequence highly preferred.

Based on theoretical considerations and on collection and analysis of data from sequencing, asparagine at position 218 was replaced with serine in the presently preferred embodiment of the present invention which is described in the illustrative examples below. This selection was based in part on the observation that the amino acid sequence surrounding the reactive serine in cucumisin, a subtilisin-like enzyme from melon fruit, has the sequence Ser-Gly-Thr-Ser-Met (Kaneda et al., supra). Proteinase K has the same sequence around the active site, see Jany et al., supra. However, it should be emphasized that the selection of serine as a replacement for Asn 218 does not preclude that the same goal, i.e. elimination of the unstable element Asn<218 >Gly <219> is achieved through replacement of asparagine at position 218 with another amino acid. It is preferred that an uncharged, aliphatic amino acid, such as valine, threonine, cysteine,

218

glutamine or isoleucine, replacing Asn

Because of the ability to secrete substantial amounts of proteins and because they are currently used to produce detergent proteases, Bacillus microorganisms constitute a preferred host for recombinant production of the [Ser 218] subtilisin of the present invention. Because most Bacillus species secrete alkaline and neutral proteases, it is preferred that mutations are introduced into the genes for endogenous alkaline and neutral proteases in B. subtilis so that the mutated subtilisin can be produced and secreted by B. subtilis in a medium free of other proteases. The present invention thus also provides mutant strains of B. subtilis which are blocked with regard to the synthesis of endogenous proteases, but which retain the ability to synthesize and secrete subtilisin analogues, such as [Ser 218]-subtilisin.

As described further below, the pH and heat stability, and the stability in detergent mixtures, of [Ser 218]- aprA gene product subtilisin was found to be much greater than that of wild-type aprA gene product subtilisin.

The production of a stable subtilisin analogue according to the present invention comprises the following methods: 1. Isolation of the representative subtilisin gene aprA from B. subtilis. 2. Cloning of the aprA gene on a vector that allows the use of oligonucleotide site-directed mutagenesis to produce desired modifications. 3. Site-directed mutagenesis and sequencing of the resulting DNA to confirm the presence of the desired mutation. 4. Construction of an expression vector to direct the synthesis of the mutated enzyme in B. subtilis. 5. Construction of mutant B. subtilis strains that do not synthesize subtilisin and neutral protease. 6. Isolation of the enzyme in the extracellular culture medium and purification thereof. 7. Determination of stability and activity characteristics of the isolated product. 8. Practicing methods for inserting the gene encoding the improved enzyme into the chromosome of a B. subtilis strain previously mutated to block synthesis of endogenous proteases.

In example 1, the aprA gene that codes for subtilisin is isolated from the B. subtilis genome. In Example 2, the aprA gene is subjected to site-directed mutagenesis. In example 3, an expression vector containing the mutated aprA gene is constructed. In Example 4, two mutant strains of B. subtilis are constructed that do not produce any detectable extracellular proteases. Example 5 describes methods for integrating a mutated aprA gene into the chromosome of B. subtilis. In Example 6, wild-type and mutant aprA subtilisins are isolated and purified. Examples 7-10 compare the heat stability of [Ser 218]-subtilisin with the heat stability of the wild-type aprA gene product and with the heat stability of a commercial BPN<1> product.

Example 1

B. subtilis strain QB127 (trpC2 leuA8 sacU 200)

[Lepesant et al., Molec. Gen. Genet., 118, 135-160 (1982)]

was obtained from the Bacillus Genetic Stock Center at Ohio State University, Columbus, Ohio. This strain overproduces extracellular serine and metalloproteases, α-amylase and levansucrase compared to isogenic sacU<+->strains due to the pleiotropic effect of the sacU 200 mutation [Lepesant et al., in Schlessinger, D., ed., Microbiology, 1976, American Society for Microbiology, Washington, D.C.,

p. 65 (1976) ]. Strain QB127 was therefore considered to be a suitable source of DNA for the isolation of the aprA gene encoding subtilisin.

Genomic DNA was isolated from cells of B. subtilis strain QB127 using a published method [Saito et al., Biochim. Biophys. Acta, 72^ 619-629 (1963)].

Purified chromosomal DNA was completely digested with the EcoRI restriction endonuclease.

DNA fragments were separated on a low melting point agarose gel by electrophoresis, and fragments in the 4.4-8.0 kilobase (kb) range were isolated using a standard DNA isolation procedure recommended by the supplier. These fragments were ligated into pCFM93 6 deposited as No. 53,413 at the American Type Culture Collection,

12301 Parklawn Drive, Rockville, Maryland, January 13, 1986, an Escherichia coli (E. coli) "walkaway" plasmid which exhibits higher copy number at elevated temperatures and confers kanamycin resistance.

The vector was digested with EcoRI and dephosphorylated with calf intestinal alkaline phosphatase before ligation.

Ligation products were introduced into E. coli C600 (available as A.T.C.C. 23724 from American Type Culture

Collection, 12301 Parklawn Drive, Rockville, Maryland), and kanamycin-resistant host cells were selected after overnight incubation on L-agar supplemented with 10 µg/ml kanamycin. Plasmid DNA copy number was increased by incubating host cells at 42°C for 4 hours. Colonies were then transferred to nitrocellulose filters and processed using a published method referred to as colony hybridization [Grunstein et al., Proe. Nati. Acad. Pollock. (US), 72. #3961

(1975)] .

A probe was used to sort colonies containing the subtilisin gene on pCFM936. The probe [synthesized by the chemical phosphite method of Beaucage et al., Tetrahedron Letters, 22., 1859-1862 (1981)] had the nucleotide self

(1) 5' GCGCAATCTGTTCCTTATGGC 3'

which corresponds to the amino terminus of the aprA gene product (Wong et al., Proe. Nati. Acad. Sei. (USA), 81, 1184-1188 (1984); Stahl et al., J. Bacteriol., 158, 411-418 (1984).A hybridization temperature of 55°C was used and 5 positive colonies were identified out of a total of 400. The plasmid DNA from one of the positive colonies was designated pCFM936 apr2.

Plasmid pCFM936 apr2 was digested with EcoRI alone,

with HindIII alone and with EcoRI and HindIII in combination. The sizes of the EcoRI fragments in the subtilisin gene were consistent with those described in Stahl et al., supra, but several HindIII sites were discovered that are otherwise undescribed. As described in Example 3, two of the HindIII sites were used for genetic manipulations of the subtilisin gene.

It was determined that a large 6.5 kb EcoRI fragment

of B. subtilis QB127 genomic DNA carried the aprA gene, its regulatory sequences and unrelated flanking sequences by verifying that restriction enzyme solutions were consistent with the results reported by Stahl et al., supra. This was confirmed by DNA sequencing

using the dideoxy chain termination method [Sanger et al., J. Mol. Biol., 143, 161-178 (1980)]. A 3.0 kb EcoRI-Kpnl-sub fragment of the 6.5 kb E_coRI fragment,

as illustrated in Figure 2, was also found to contain the aprA gene, its regulatory sequences and unrelated flanking sequences. Although the Kpnl-EcoRI fragment is reported to be 2.5 kb in length in the text of Stahl et al., and the accompanying text of Figure 1, comparison of the scale of Figure 1 and the true-to-scale drawing of the fragment reveals that, even in Stahl et al. the KpnI-EcoRI fragment is substantially larger than 2.5 kb.

A cloning vector for Bacillus host systems,

plasmid pAMBll, was constructed as follows. Plasmid pTG402 (Northern Regional Research Laboratories, United States Department of Agriculture, Peoria, Illinois, strain number NRRL B-15264) was partially digested with the RsaI restriction endonuclease. Fragments were ligated into M13 mp!8 (available from Bethesda Research Laboratories, Gaithersburg, Maryland, as catalog number 8227SA) previously digested with HincII. Ligation products were introduced into E. coli JM103 (available from Pharmacia, Inc., Piscataway, New Jersey, as catalog number 27-1545-01) by transformation [Mandel et al., J. Mol. Biol., 5_3, 154

(1970)]. Bacteriophage plaques were sprayed with 0.5M catechol (prepared in distilled water) to detect the functional expression of the xylE gene derived from pTG402. The xylE gene encodes catechol-2,3-dioxygenase and is useful for detecting promoters in a variety of organisms. Zukowski et al., Proe. Nati. Acad. Pollock. (USA), 8i0, 1101-1105

(1983).

The xylE gene was then transferred as a 1.0 kb EcoRI

to Pstl fragment of E. coli/B. subtilis plasmid pHV33 (available from the American Type Culture Collection as A.T.C.C. 39217) [Primrose et al., Plasmid, 6, 193-201

(1981)] obtained from R. Dedonder (Institut Pasteur, Paris, France). The pHV33 plasmid had previously been digested with EcoRI and Pstl so that the xylE-containing fragment would inactivate an ampicillin resistance gene when ligated into this region. The resulting plasmid, pAMB21, contains a functional xylE gene in E. coli host cells, but requires the addition of a promoter for xylE to be expressed in B. subtilis host cells. E. coli cells containing pAMB21 are resistant to tetracycline (15 µg/ml) and chloramphenicol (20 µg/ml), while B. subtilis cells containing pAMB21 are resistant only to chloramphenicol (5 µg/ml). The toop transcription termination sequence of bacteriophage lambda was then transferred from plasmid pCFM936 (on a 400 base pair Pst.I-BglII fragment) into the unique PstI site in pAMB21. A synthetic nucleotide with the sequence 5' GATCTGCA 3' was constructed to ligate the BglII end of the toop fragment to the Pstl site in the vector pAMB21. The resulting plasmid was designated pAMB22 and had properties identical to pAMB21, except that a transcription terminator was included. The pAMB22 plasmid is useful for the detection of strong promoters that are functional in B. subtilis.

The 1.4 kb EcoRI-Bglll fragment in DNA from pAMB22 containing xylE and toop was isolated from a low melting point agarose gel after limited fragment electrophoresis. The 1.4 kb DNA fragment was ligated into pBD64 (available from the Bacillus Genetic Stock Center, number 1E22) which had previously been digested with EcoRI and BamHI. The resulting 5.3 kb plasmid, pAMBll, contains the polylinker sequence Ml3m.pl8 (EcoRI, Sstl, Xmal, Sma, BamHI, and XbaI) upstream of the xylE gene followed by toop, as shown in Figure 3. The pAMBll plasmid is in able to replicate in B. subtilis and confers host cell resistance to chloramphenicol (5 ug/ml) and/or kanamycin (5 ug/ml).

As illustrated in Figure 4, the purified EcoRI-KpnI fragment containing aprA was cloned into pAMBll, thereby creating pAMBll. Ligation products were introduced into B. subtilis MI112 ( arg-15 leuB thr5 recE4 ) (available from the Bacillus Genetic Stock Center as No. 1A423) using the protoplast transformation method [Chang et al., Mol. Gen. Genet., 168, 111-115 (1979)]. B. subtilis MI112 without plasmid DNA is protease-competent (Prt<+->phenotype), but secreted amounts of subtilisin are rather small. Chloramphenicol-resistant (Cm ) transformants were transferred onto L-agar plates supplemented with 1.5% (w/v) skimmed milk and 5 µg/ml chloramphenicol, and then incubated at 37°C.

After overnight incubation (approximately 16 hours), colonies of MI112 containing the new recombinant plasmid (designated pAMB111) produced a clear ring surrounding each colony. Rings were formed by the proteolytic action of subtilisin on the casein component of the skimmed milk medium supplement. MI112 containing the pAMBll vector alone had no visible ring after 16 hours although a faint ring eventually developed after 40 hours at 37°C. Cells carrying pAMBlll can be clearly distinguished from cells carrying pAMBlll by a difference in ring size. The cloning of the aprA gene in a fully functional form was thus shown to have led to the high level of production and secretion of subtilisin by B. subtilis.

Example 2

As further illustrated in Figure 4, it was 3.0 kb

large EcoRI-KpnI genome fragment, the isolation of which is described in Example 1, digested with HindIII to produce three fragments: (1) a 1.1 kb EcoRI-HindiII fragment carrying genetic regulatory sequences for aprA gene expression, "pre-pro " region of the gene required for extracellular export of subtilisin, and the DNA sequence encoding the first 49 amino acids of fully formed subtilisin; (2) a 1.1 kb HindIII-HindIII fragment carrying DNA sequences encoding amino acids 50-275 (carboxyl terminus) of subtilisin along with a transcription termination sequence and 3' non-coding sequences; and (3) a 0.8 kb HindIII-KpnI fragment containing 3<1> non-coding sequences.

The 1.1 kb fragment flanked by HindIII sites was cloned into the single HindIII site in bacteriophage M13 mp!8 for DNA sequence determination purposes and site-directed mutagenesis. One of the recombinants, designated M13 mp_18 apr2,

provided the single-stranded template DNA required for site-directed mutagenesis

of the aprA gene.

The coding region of the aprA gene was sequenced, and the results of the sequence are reproduced in Table 1 below. It should be noted that the definite identity of the first 5 codons in the leader region can be attributed to the report of Stahl et al., supra, and Wong et al., supra, regarding sequence information for the aprA gene, and that there are codon sequence differences relative to Stahl et al., supra, in amino acid positions 84 and 85 which may be the result of sequencing errors by the authors of the reference Stahl et al., or which may be the result of a difference in the nucleotide sequences of the strains used. Specifically, Stahl et al., supra, report

a codon GTT (which codes for valine) at amino acid position 84, while the codon GTA (which also codes for valine) appears in Table 1. Stahl et al., supra, also reports a codon AGC (which codes for serine) at amino acid position 85, in contrast to the codon GCG (which codes for alanine) in Table 1.

Site-directed mutagenesis was performed using a standard method. Norrander et al., Gene, _26, 101-106

(1983). Single-stranded DNA from M13 mp!8 apr2 was hybridized to the mutagenic primer

(a) 5' GGCGCTTATAGCGGAAC 3'

which was synthesized using the chemical phosphite method (Beaucage et al., supra). The synthetic primer was homologous to codons for amino acids 216-220 of subtilisin, except for a single base change in the codon for amino acid 218 (AGC instead of AAC). Such a change enabled the mutagenic reaction to substitute a serine codon at position 218 instead of the original asparagine codon at this position.

The synthetic primer was hybridized to M13 mp!8 apr2 DNA at 65°C before slowly cooling to room temperature (approximately 22°C). Polymerization followed for 2 h at 15°C in a reaction mixture consisting of 12.5 µl hybridized DNA solution, 2.5 µl 10 mM each of dATP, dGTP, dCTP and dGTP, 2.0 µl 12 mM ATP, 0, 1 µl Klenow DNA polymerase, 0.1 µl T4 DNA ligase and 13 µl sterile distilled water. The resulting double-stranded, covalently closed, circular DNA was introduced into E. coli JM103 by transfection.

Bacteriophage plaques were then transferred to "Gene Screen" hybridization membranes. Plaques containing DNA with the desired base change were identified by hybridization to radioactively labeled (7-32P) synthetic oligonucleotide (2) used for the above-described reaction with mutagenic primer. Hybridization was performed at a limiting temperature (52°C) so that only DNA carrying the Ser 218 mutation would hybridize to the synthetic

218 oligonucleotide. The presence of the Ser mutation in the aprA gene on DNA from a single purified plaque, designated M13 mp_18 apr2 [Ser]<218>, was confirmed by DNA sequencing by the method of Sanger et al., supra.

Example 3

To express [Ser 218]-subtilisin in B. subtilis, a suitable plasmid carrier was constructed by digesting pAMBIII with HindIII. The 1.1 kb segment carrying most of the aprA gene was removed by religation of HindIII digests of pAMBIII at a concentration of approximately 1 µg/ml. This resulted in the formation of pAMBHO as illustrated in Figure 4. The pAMBllO plasmid carries genetic regulatory sequences for expression of the subtilisin gene, the "pre-pro" region required for secretion of subtilisin, and the DNA sequence encoding the 3<1-> non-coding region in fully formed subtilisin, and the first 49 amino acids in fully formed subtilisin. Lacking DNA encoding amino acids 50-275, pAMBllO does not synthesize subtilisin when introduced into B. subtilis host cells. Subtilisin is synthesized only after introduction of the remainder of a subtilisin gene, either the naturally occurring DNA sequence or an analog coding sequence, such as a sequence encoding [Ser 218]-subtilisin.

218 Double-stranded DNA from M13 mp!8 apr2 [Ser] was resolved with HindIII. A 1.1 kb fragment carrying

218

The aprA gene segment with the Ser mutation was then ligated into pAMBllO which had previously been digested with HindIII. Ligation products were introduced into B. subtilis by transformation as in Example 1 above. Ligation of the 1.1 kb HindIII in the correct orientation (as confirmed by DNA sequencing by the method of Sanger et al., supra) for expression of the mutated gene resulted in the construction of pAMBH3, a plasmid that directed synthesis and secretion of [Ser 218]-subtilisin from B. subtilis host cells.

Example 4

As most Bacillus species secrete alkaline and/or neutral proteases into the surrounding culture medium, it is preferred that mutations are introduced into endogenous alkaline and neutral protease genes in B. subtilis to block their synthesis so that mutated subtilisin genes can produce mutated subtilisins when introduced in the mutant cell,

which will then be secreted into a medium free of other proteases which are likely to interfere with the isolation of intact subtilisin analogues. Two mutant B. subtilis strains BZ24 and BZ25, which do not produce any detectable extracellular proteases, were constructed as follows.

First, a plasmid carrier capable of replicating in E. coli but not in B. subtilis unless integrated into the chromosome of B. subtilis by homologous recombination was constructed as follows.

Plasmid pBD64 (Bacillus Genetic Stock Center, number 1E22) was completely resolved with Hpall, whereby three fragments of size 2.95 kb, 1.0 kb and 0.75 kb were obtained. These fragments were then ligated as a mixture to plasmid pBR322 (A.T.C.C. No. 37017) which had previously been resolved with ClaI. Ligation products were introduced into E. coli C600 (available from the American Type Culture Collection as A.T.C.C. No. 23724) by transformation [Mandel et al.,

J. Mol. Biol., 52, 154 (1970)]. Selection was made for cells resistant to chloramphenicol (20 ug/ml) and ampicillin (50 ug/ml). Plasmid DNA from 12 transformants was prepared using an alkaline extraction procedure [Birnboim et al., Nucleic Acids Res., 1_,

1513-1523 (1979)], then resolved with HindIII and EcoRI in combination to verify the presence of one or more fragments introduced. One such plasmid,

designated pAMB30, was found to carry the 1.0 and 0.75 kb HpaI fragments from pBD64 in the ClaI site of pBR322. These fragments contain the gene for chloramphenicol acetyl transferase (eat) which is functional in E. coli and B. subtilis. Resolutions with Bglll and, separately, with Sau3A, confirmed the identity and orientation of the cat gene on pAMB30, as shown in Figure 5.

As pAMB30 lacks an origin of replication sequence that is functional in B. subtilis, it cannot replicate as an autonomous replicon in B. subtilis host cells. On the other hand, pAMB30 contains the pBR3 22 -derived origin of replication functional in E. coli,

and the plasmid can therefore be propagated in E. coli host cells. Plasmid pAMB30 is useful in at least 2 ways. Firstly, a fragment of DNA containing a functional origin of replication in B. subtilis can be detected when cloned into pAMB30, so that the plasmid will autonomously replicate in the extrachromosomal state. Second, plasmid pAMB30 can be integrated into the genome of B. subtilis at a homologous site between chromosomal DNA and DNA from B. subtilis cloned into pAMB30. Such an event has been repeatedly demonstrated in the past [Haldenwang et al., J. Bacteriol., 142, 90-98 (1980); Young, J.Gen. Microbiol., 129,

1497-1512 (1983)] using plasmid carriers similar to, but not identical to, pAMB30.

Plasmid pAMB21 (described in Example 1) was digested with EcoRI and PstI to isolate the xylE gene on a 1.0 kb fragment. The fragment was ligated into pAMB30 which had previously been digested with EcoRI and PstI. Ligation products were introduced into E. coli C600 by transformation. Selection was made for chloramphenicol-resistant (20 µg/ml) host cells that were sensitive to ampicillin (50 µg/ml) due to the introduction of the xylE fragment from pAMB21 into the ampicillin resistance structural gene of pAMB30. The resulting plasmid pAMB30/21 has properties identical to pAMB30, but additionally has a functional xylE gene.

Plasmid pAMB10 carrying the aprA gene in which a region coding for the last 226 amino acids of fully formed subtilisin has been removed was digested with EcoRI and KpnI. The 1.9 kb fragment of B. subtilis DNA containing genetic regulatory sequences for aprA gene expression, the "pre-pro" region, the DNA sequence encoding the first 49 amino acids of fully mature subtilisin, and 3' non-coding sequences, were ligated into pAMB30/21 which had previously been digested with EcoRI and KpnI. Ligation products were introduced into E. coli C600 by transformation. Plasmid DNA from several transformants was isolated using the alkaline extraction method of Birnboim et al., supra, and the presence of the introduced 1.9 kb fragment was verified using several restriction endonuclease solutions. One such plasmid, designated pAMB301, was retained for further use.

B. subtilis strain BGSC1A274 (Bacillus Genetic Stock Center) carries a mutation in the npr site and is unable to produce extracellular neutral protease. The plasmid pAMB301 was integrated into the genome of B. subtilis BGSC1A274 by transformation of competent cells [Spizizen, Proe. Nati. Acad. Pollock. (USA) , 44^, 1072-1078

(1958)]. Selection was made for chloramphenicol-resistant (5 ug/ml) host cells which were then transferred using sterile toothpicks to L-agar supplemented with 1.5%

(w/v) dry skimmed milk and (5 ug/ml) chloramphenicol. Those cells that did not form a clear ring around the colony lacked the ability to produce extracellular neutral and serine proteases due to the combination of the npr mutation together with the newly introduced aprA mutation. The aprA mutation was a deletion of the last 226 amino acids in mature subtilisin due to the replacement of the wild-type aprA gene with the deletion version carried on pAMB301. One such strain, designated BZ24, has the Npr Apr Cm<r-> phenotype, and therefore produces no detectable extracellular neutral protease or extracellular alkaline protease, and is resistant to chloramphenicol at 5 µg/ml. Southern blotting [Southern, J. Mol. Biol., 9^8, 503-517 (1975)] was used to confirm the deletion in the aprA gene on the chromosome of B. subtilis BZ24. Cultivation of B. subtilis BZ24 in anti-biotic medium No. 3 (Penassay Broth.) in the absence of anti-biotic selection for approximately 32 generations led to the isolation of a derivative strain of BZ24 in which the cat gene conferring chloramphenicol resistance to host cells , had been lost due to the instability of the BZ24 chromosome. Such a phenomenon has previously been observed in similar experiments [Stahl et al., J. Bacteriol., 158, 411-418 (1984)]. A chloramphenicol-sensitive derivative of BZ24 was designated BZ25.

B. subtilis BZ25 has the Npr Apr~ phenotype and therefore produces no detectable extracellular neutral protease or extracellular alkaline protease. Southern blotting was used to confirm the deletion in the aprA gene on the chromosome of B. subtilis BZ25.

As B. subtilis BZ25 does not produce any detectable extracellular neutral protease or subtilisin,

it is a useful host strain for the introduction of plasmid DNA, such as pAMBll3, for the production of mutated subtilisins that can be secreted into the surrounding culture medium that is free of other proteases.

B. subtilis BZ25 produces no detectable extracellular proteases when culture supernatants are analyzed as described below. B. subtilis BZ25/pAMBll3, which is BZ25 containing plasmid pAMBH3 (introduced by the protoplast transformation method of Chang et al., supra) produces substantial amounts of [Ser 218]-subtilisin when culture supernatants are analyzed as described.

Example 5

Integration of the [Ser<218>] subtilisin gene into the chromosome of B. subtilis was thought to provide an efficient way to increase genetic stability of this mutant gene.

Such a method also avoids the need for chloramphenicol in the fermentation medium, which is otherwise needed for the application of selective pressure to maintain plasmid DNA

in the extrachromosomal state. Therefore, the [Ser 218] subtilisin gene, together with its genetic regulatory sequences and flanking DNA homologues of the B. subtilis chromosome, was isolated from a low melting point agarose gel after electrophoresis of pAMBll3 that had been resolved with EcoRI and Pstl in combination. The 4.0 kb EcoRI-PstI fragment (illustrated in Figure 4) was then ligated into pAMB30 (illustrated in Figure 5) which had been digested with EcoRI and PstI in combination. Ligation products were introduced into

E. coli HB101 (A.T.C.C. No. 33694) by transformation. Selection was made for cells resistant to chloramphenicol (20 ug/ml). Plasmid DNA from four transformants meeting the above criteria was isolated using the alkaline extraction method of Birnboim et al., supra, and then resolved with EcoRI and Pstl in combination. All four plasmids contained the 4.0 kb insert and the 5.6 kb remaining portion of pAMB30.

One such plasmid, designated pAMB302, was purified and stored for further use.

Repeated attempts to integrate plasmid pAMB302 into the chromosome of B. subtilis BZ25 using the competence method [Spizizen, supra] were unsuccessful. This may be because the BZ25 cells did not become competent using the method used. pAMB302 was therefore introduced into B. subtilis BZ25 cells using the protoplast transformation method of Chang et al., supra. This is believed to be the first demonstration that the protoplast transformation method is successful in achieving integration of heterologous DNA in Bacillus. This result is particularly significant in that research strains where integration has been achieved were chosen on the basis of transformation by the competence method. Strains that may be unable to become competent, and especially industrial strains that were not selected on the basis of transformation by the competence method, may be more likely to be unable to become competent.

Selection was for chloramphenicol-resistant cells (5 ug/ml) which were then transferred with sterile toothpicks to L-agar supplemented with 1.5% (w/v) skimmed milk and 5 ug/ml chloramphenicol. Cells were incubated overnight at 37°C. Clear rings of different diameters were observed around the Cm<r> colonies. This indicates that subtilisin was produced and secreted by these cells. An attempt was made to isolate plasmid DNA from eight of these colonies using the alkaline extraction method. No plasmid DNA was detected on agarose gels that were stained with ethidium bromide (1 µg/ml) to visualize DNA after electrophoresis. The absence of the extrachromosomal plasmid DNA in the subtilisin-producing Cm<r> cells was a strong indication that pAMB302 had been integrated into the chromosome of B. subtilis.

Several colonies obtained from this experiment were isolated and designated BZ28, BZ29, BZ30, BZ31, BZ32 and BZ33. Each strain was grown overnight at 37°C with vigorous shaking in brain/heart infusion medium (BHI) supplemented with 5 vag/ml chloramphenicol. Culture supernatants were analyzed for subtilisin activity. B. subtilis strains BZ28, BZ29, BZ30, BZ31, BZ32 and BZ33 all produced subtilisin and secreted it into the surrounding culture medium, with some strains producing more than others. The amount of subtilisin observed in the culture medium was directly proportional to the size of the ring observed on the skimmed milk L-agar plates. As the amounts of subtilisin secreted by these cells differed, it was postulated that either more copies of pAMB302 were integrated into the chromosome or that a copy number increase for the gene had occurred [Young, J. Gen. Microbiol., 129, 1497-1512 (1983); Albertini et al., J. Bacteriol., 162, 1203-1211 (1985)].

Example 6

Wild-type subtilisin from BZ25/pAMBllll and [Ser<218>]-subtilisin from BZ25/pAMBll3 were isolated and purified as follows. Each culture fluid was centrifuged at 15,000 g for 30 minutes, and protein in the clear supernatant was precipitated with (NH 4 ) 2 SO 4 (350 g per liter). The precipitate was collected by centrifugation, and after trituration with 75% acetone, it was filtered and dried under a vacuum.

To further purify the enzyme, the dried precipitate was dissolved in water, and the solution was filtered and then dialyzed against 0.02M sodium phosphate buffer at pH 6.3. The dialyzed solution was passed through a column (2.5 x 15 cm) of carboxymethylcellulose at a rate of 2 ml per minute. minute. After washing the column with 0.02 M sodium phosphate (pH 6.3), the enzyme was eluted with the same buffer containing 0.15 M NaCl. Peak fractions were pooled, and protein from the fractions containing the enzyme, identified by a color change in a sample of the fraction mixed with succinyl-L-alanyl-L-alanyl-L-propyl-L-phenylalanyl-p-nitroanilide, was precipitated by the addition of 2.5 parts by volume of acetone. The precipitate was collected by centrifugation and then dissolved in 0.005 M calcium acetate (approx. 1 ml per 10 mg). The resulting solution was dialyzed at 4°C against water and then lyophilized.

Example 7

As the present invention relates to the stabilization of Bacillus subtilisin, an analysis of enzyme stability and quantification thereof was carried out.

Most enzymes exert their biological activity, i.e. catalysis of chemical reactions, only within a

narrow pH and temperature range. Moreover, even under optimal conditions, the enzyme will retain its activity only if the polypeptide chain is folded in a way that forms the so-called natural conformation. The natural form of an enzyme is

thermodynamically more stable than the denatured or unfolded form by an average of 10-15 kilocalories per mol. Abolition of the folding of the natural structure often occurs when the enzyme is exposed to extreme pH values or temperatures, or to certain concentrations of chemicals, such as detergents, urea and organic solvents. Removal of these denaturants often results in spontaneous refolding of the peptide chain to the native form and in restoration of the original enzyme activity.

Irreversible loss of enzyme activity can occur due to cleavage of the polypeptide chain or due to modification of certain amino acid side chains, especially if these modifications change the natural architecture of the enzyme's active site. Examples of such modifications include the deamidation of asparaginyl and glutaminyl residues, the oxidation of methionyl residues and the hydrolytic cleavage of cysteine, whereby a residue of thio-cysteine and one of dehydroalanine are formed. The present invention provides a further example in the form of the irreversible inactivation through cyclization of Asn-Gly sequences.

When the enzyme preparation comprises several enzymatic forms that inactivate at different rates, and/or when the inactivation process occurs through a number of mechanisms, the inactivation kinetics are complicated. For most enzyme preparations at a suitable pH and temperature range, however, the thermal inactivation follows first-order kinetics, i.e. that the remaining enzyme activity decreases as a function of time along an exponential disintegration curve. Under these conditions, the half-life ^Tl/2^ ^ or the enzyme is independent of the original enzyme concentration and can be calculated as:

where A^ and A2 are the enzyme activities at the times resp. t^ and t2.

All else being equal, the half-life of an enzyme in solution is usually shorter at higher temperatures.

To compare the heat stability of the [Ser 218] aprA gene product subtilisin with the heat stability of wild-type aprA gene product subtilisin and subtilisin BPN', solutions of these enzymes (1 mg/ml) were prepared in 0.1 M sodium glycinate buffer at pH 10.0. The solutions were incubated at 52°C, and after various periods of time, aliquots (20 µl) were taken out and mixed with 900 µl of 0.2% casein solution in 0.1 M tris buffer at pH 8.30. As a control, the substrate solution (casein) was incubated with 20 µl of enzyme buffer. The hydrolysis of casein at room temperature was determined after 15 minutes with the addition of 200 µl of 10% trichloroacetic acid. The hydrolyzate was separated from the precipitated protein by centrifugation, and the ultraviolet (UV) absorp-

sion coefficient at 280 nm compared to the control,

was measured using an 8451A diode array spectrophotometer. Substrate concentration was such that enzyme activities were directly proportional to the UV absorption coefficients at 280 nm reported in Table 2. In this table, values in parentheses represent percentages of initial enzyme activities. The last column in Table 2 shows the calculated half-life for the three enzymes, and it can be seen that the half-life of the mutated [Ser 218] aprA gene product is more than three times longer than the natural aprA gene product and subtilisin BPN<1> under the tested conditions.

Example

To determine the heat stability of subtilisins in the presence of detergents, the liquid laundry detergent 'ERA Plus' was used after dilution with water (1:9) and complete inactivation of the original protease activity by heating to 65°C for 30 minutes. pH of the resulting detergent solution was 7.50. Using casein analysis and the method described in Example 7, the stabilities of [Ser 218] aprA gene product, wild-type aprA gene product and subtilisin BPN<1> were tested in the detergent at 45° C. The results are shown in Table 3 where the enzyme activities are expressed as percentages of original enzyme activities Again the half-life of the subtilisin analogue was in the order of magnitude three times greater than the natural products under the test conditions.

The results in the table above show that the [Ser 218] analog of the aprA gene product exhibits greater stability than the wild-type aprA gene product or subtilisin BPN' in "ERA Plus" which, at a pH of 7.5, can be described as a cationic to neutral detergent and which have probably been formulated to be compatible with the incorporation of detergent enzymes. However, these results do not ensure that the [Ser 218] aprA gene product will be compatible with all commercial detergent compositions currently available, e.g. those that have been formulated to be used without detergent enzymes. In the initial trials with a 2% (w/v) solution of Tide®, which can be described as an anionic to neutral detergent with a pH higher than 8.5 and which does not contain detergent enzymes in the mixture, subtilisin exhibited BPN<1 > greater stability than the wild-type and [Ser <218> ]- aprA gene products. However, in the same test, the [Ser <218>] aprA gene product showed greater stability than the wild-type aprA gene product. Although the different relative effects of the [Ser 218] aprA gene product and subtilisin BPN1

in "ERA Plus" and Tide<®> has so far not been explained, the experimental results suggest that correct formulation of detergent mixtures is a prerequisite for optimal action of enzymes included in such mixtures. What has been clearly demonstrated is that the [Ser <2>18] aprA gene product consistently has properties that are better than the properties of the wild-type aprA gene product, and it is believed that analogues of subtilisin Carlsberg and BPN' according to the present invention will also have greater stability than the corresponding wild-type enzyme.

Example 9

Using succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanyl-p-nitroanilide as substrate and the rate of increase of absorption coefficient at 405 nm due to release of p-nitroaniline [Del Mar et al ., Anal. Biochem., 99, 316-320 (1979)] to measure enzyme activity, the heat stabilities of [Ser 218] aprA, wild-type aprA and subtilisin BPN' in 0.1 M sodium phosphate buffer at pH 7.5 were determined as follows.

Enzyme solutions with approx. 0.5 Anson units per liters were incubated at 40 and 50°C, and at various times aliquots (20 µl) were withdrawn and diluted in 180 µl of ice-cold 0.1 M sodium phosphate buffer at pH 7.5. 10 µl of the thus diluted sample was mixed with 8 90 µl of 1 mM succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanyl-p-nitro-anilide in 0.1M Tris-HCl, pH 8.2, and the absorption coefficients at 405 nm were measured every 15 seconds for 5 minutes on an 8451A diode array spectrophotometer. Remaining enzyme activities after different incubation times were expressed in Table 4 and Table 5 as percentages of the corresponding initial activities. The procedure was then repeated in 0.1 M sodium phosphate buffer at pH 9.0, and the results are reproduced in tables 6 and 7.

Example 10

To test pH stability for the [Ser 218] analogue, the procedure according to Example 7 was carried out at pH 4.8 and room temperature, and the results are reproduced in Table 8.

Although the present invention has been described using preferred embodiments, it is to be understood that modifications and improvements will occur to those skilled in the art. E.g. the sequence Asn-Gly occurs at other points in subtilisins, such as in residues 109 and 110 in the aprA gene product and subtilisin BPN', and in residues 62 and 63 in subtilisin Carlsberg and in subtilisin DY. It is therefore expected that substitution of residues other than Asn and Gly at these respective sites can also improve stability. Similar improvements in stability are expected for such substitutions made in other enzymes that have the Asn-Gly sequence, and in other proteins that include this sequence. Furthermore, it is expected that a subtilisin analogue according to the present invention has better properties than wild-type subtilisins in detergent mixtures, such as those described in e.g. U.S. Patents Nos. 3,732,170, 3,749,671 and 3,790,482;

For practical reasons, many industrial processes are carried out at temperatures that are above the stability range of most enzymes. Although detergent applications have been highlighted, it is therefore believed that thermo-stable proteases of the present invention are not only beneficial to certain industries, such as detergent and skin depilation, which already require stable proteases,

but may also be applicable in industries that use chemical agents to hydrolyze proteins, e.g. hydrolysis of vegetable and animal proteins for the production of soup concentrates.

Claims (24)

1. Enzymatically active analogue of a Bacillus subtilisin, wherein the Bacillus subtilisin has an amino acid sequence comprising an Asn-Gly sequence, characterized in that the analogue has an amino acid sequence where the residues in the Asn-Gly sequence have been removed or replaced by a residue of another amino acid. 2. Analog according to claim 1, characterized in that an asparaginyl residue in the Asn-Gly sequence is replaced by a residue of another amino acid. 3. Analog according to claim 1, characterized in that an asparaginyl residue in the Asn-Gly sequence is replaced by a residue of an amino acid from the group consisting of serine, valine, threonine, cysteine, glutamine and isoleucine. 4. Analog according to claim 3, characterized in that the asparaginyl residue in the Asn-Gly sequence is replaced by serine. 5. Enzymatically active analog of a Bacillus subtilisin, characterized in that the enzymatically active analog has an amino acid sequence where an asparaginyl residue that naturally occurs in a position corresponding to position 218 in the amino acid sequence described in table l# is replaced with a residue of another amino acid . 6. Analog according to claim 5, characterized in that an asparaginyl residue in the position is replaced by a residue of an amino acid from the group consisting of serine, valine, threonine, cysteine, glutamine and isoleucine. 7. Analog according to claim 6, characterized in that a seryl residue has replaced the asparaginyl residue. 8. Analog according to claim 5, characterized in that the analogue is an analogue of a naturally occurring Bacillus subtilisin in a strain selected from the group consisting of subtilisin Carlsberg, subtilisin DY, subtilisin BPN' and aprA gene product. 9. Analog according to claim 8, characterized in that all the residues apart from the residue in position 218 comprise amino acid residues as described in table 1. 10. Nucleic acid which codes for an enzymatically active analogue of Bacillus subtilisin, where the Bacillus subtilisin has an amino acid sequence comprising an Asn-Gly sequence, characterized in that codons which code for one or both residues of the Asn-Gly sequence, is removed or is replaced with codons that code for a different amino acid residue. 11. Nucleic acid according to claim 10, characterized in that it codes for a polypeptide where an asparaginyl residue in a position corresponding to position 218 in the amino acid sequence described in table 1 is replaced by a residue of another amino acid. 12. Nucleic acid according to claim 11, characterized in that the second amino acid is a member of the group consisting of serine, valine, threonine, cysteine, glutamine and isoleucine. 13. Nucleic acid according to claim 12, characterized in that the residue in the position comprises a seryl residue. 14. Nucleic acid according to claim 13, characterized in that all amino acid residues in all positions in the amino acid sequence of the analogue, except for position 218, comprise amino acid residues as described in table 1. 15. Host cell capable of expressing an enzymatically active analog of a Bacillus subtilisin, characterized in that it comprises a nucleic acid which codes for an analogue of Bacillus subtilisin with an amino acid sequence where a residue in a position corresponding to position 218 in the amino acid sequence described in table 1 does not comprise an asparaginyl residue. 16. Host cell according to claim 15, characterized in that the residue in the position comprises a residue of an amino acid from the group consisting of serine, valine, threonine, cysteine, glutamine and isoleucine. 17. Host cell according to claim 16, characterized in that the residue in the position comprises a seryl residue. 18. Host cell according to claim 17, characterized in that all residues in all positions except 218 comprise amino acid residues described in table 1. 19. Host cell according to claim 18, characterized in that the host cell is deficient in secreted proteases other than subtilisin. 20. Host cell according to claim 15, characterized in that the nucleic acid is extrachromosomal. 21. Host cell according to claim 18, characterized in that the nucleic acid is chromosomal. 22. Method for improving the heat and pH stability of an enzymatically active Bacillus subtilisin with an amino acid sequence comprising an Asn-Gly sequence, characterized in that a residue in the Asn-Gly sequence is removed or one or both residues in Asn -The Gly sequence is replaced with another amino acid. 23. Detergent mixture comprising an enzymatically active analogue of a Bacillus subtilisin, where the Bacillus subtilisin has an amino acid sequence comprising an Asn-Gly sequence, characterized in that one or both residues in the Asn-Gly sequence have been removed. 24. Enzymatically active analogue of a Bacillus subtilisin, characterized in that the enzymatically active analogue has an amino acid sequence with fewer Asn-Gly sequences than is present in the Bacillus subtilisin.