NL8701021A - HUMANE T-PA (U-PA) SUBSTITUTION-MUTANT PROTEINS, CODING RECOMBINANT DNA, TRANSFECTED HOST CELLS, PREPARATION OF THE MUTANT PROTEINS, AND PHARMACEUTICAL PREPARATIONS. - Google Patents

Description

h

Nw 9130

Title: human t-PA (u-PA) substitution mutant proteins, encoding recombinant DNA, transfected host cells, preparation of the mutant proteins, and pharmaceutical preparations.

The invention relates to the construction of a recombinant DNA molecule and the expression of the recombinant DNA molecule in host cells. The invention also relates to a method of preparing human substitution mutants, which are composed of a segment of the glycoprotein tissue-type plasminogen activator (t-PA) and a segment of the glycoprotein urokinase (u-PA). The invention also relates to pharmaceutical preparations with an anti-thrombotic effect.

The theoretical idea underlying the present invention, namely based on data on the chromosomal structure of the t-PA gene (exon-intron distribution) and the supposed secondary structure of the t-PA protein, the deletion- , substituting and mutating autonomic structural and functional domains of t-PA, has already been laid down in a previous patent application (ff. Pannekoek et al., European Patent Application 86200223.5 t-PA deletions.

The human glycoprotein tissue-type plasminogen activator (t-PA) is a serine protease, which is synthesized in vascular endothelial cells, as well as in various cell lines such as the Bowes melanoma cell line (Rifkin et al., 1974; Rijken et al ,, 1980) . t-PA plays an essential role in fibrinolysis, the process responsible for solubilizing and therefore removing a blood clot. The enzyme t-PA catalyzes the conversion of the zymogen plasminogen into the active serine protease piasmin. Piasmine is the enzyme considered primarily responsible for lysing 870102 1 ψ -2- Μ * of the major protein component in blood clots, n.1. fibrin. In the absence of fibrin, t-PA has only very low plasminogen activator activity, while in the presence of fibrin the activity of t-PA is accelerated by a factor of 100 to more than 1000. Due to this property of t-PA, piasmin is generated almost exclusively on the fibrin surface of a clot, avoiding systemic circulation of piasmin in the circulation. Such observations have drawn attention to t-PA as a useful anti-thrombolytic. However, the large-scale isolation of t-PA from the natural environment (blood plasma) would encounter significant practical and logistical problems due to the low concentration (approximately 1 ng per ml). Recombinant DNA techniques can offer a solution here, in order to produce relatively large quantities. Indeed, it has been shown that t-PA synthesized using these techniques represents a useful preparation for the treatment of patients affected by myoard infarction (Verstraete et al., 1985; Williams et al., 1986). However, the intravenous administration of an effective dose of t-PA in these studies requires relatively large amounts and, in some cases, may lead to degradation of components other than fibrin and to unwanted bleeding tendencies. The need to administer large amounts of t-PA in anti-thrombotic therapy is particularly related to the rapid clearance of t-PA in vivo (half-life is several minutes).

This phenomenon is attributed to interaction with a hepatic component, through which t-PA is removed from circulation (Emeis et al., 1985), and by inactivation via complexation with serine protease inhibitors, in particular with the endothelial plasminogen activator inhibitor PAI. -1 (Sprengers and Kluft, 1987). Therefore, it is desirable that molecular variants of t-PA be developed that exhibit a more effective anti-thrombolytic activity than 870102 <-3-t-PA, for example, because such variants are less efficiently inhibited by PAI-1.

Before describing the construction of such molecular variants and their properties, the structural and biological properties of t-PA will be briefly summarized.

t-PA is synthesized as a single-chain molecule and can be converted into a two-chain molecule by piasmin, by breaking a single arginine-isoleucine peptide bond (Wallén et al., 1980). Two-chain t-PA consists of an amino-terminal "heavy" chain (H; 38 kD) and a carboxy-terminal "light" chain (L; 34 kD), which are held together by a single disulfide bond.

Starting from a purified t-PA preparation obtained from conditioned medium from cultured Bowes melanoma cells, the complete amino acid sequence as well as the position of the asparagine-linked glycosylation has been determined (Pohl et al., 1984).

The construction and isolation of a recombinant DNA molecule that carries the complete genetic information for t-PA (so-called "full-length t-PA copy DNA or cDNA) was first reported in 1983 (Pennica et al., 1983 The production of biologically active recombinant t-PA by transfected tissue culture cells has also been reported (Goeddel et al., 1983).

In the former studies it has been established that t-PA as a so-called. "precursor" protein is synthesized, which consists of 562 amino acids. Determination of the amino-30 sequence of the amino terminus of native t-PA

Bowes melanoma cells showed that t-PA occurs in two natural variants (Pohl et al., 1984). The S variant consists of 527 amino acids, while the L variant is composed of 530 residues. In conclusion, a 35 amino-terminal segment of either 32 or 35 amino acids is cleaved from the precursor protein to generate 87 (1021. F -4- two types of t-PA. There is no evidence that other properties on the S- and the L variant must be attributed.

Based on homology between the amino acid sequence 5 of t-PA with that of other plasma proteins, a model has been proposed for the secondary structure of t-PA (Pennica et al., 1983; Banyai et al., 1983). In this model, different structural segments, which show homology to other plasma proteins, have been assembled into a assembled molecule, possibly built up from autonomous structural domains. The elucidation of the structure of the chromosomal t-PA gene (Ny et al., 1984) has supported this hypothetical model. This study showed that the proposed structural domains are encoded exactly by either a single exon or a set of adjacent exons. The H chain of the t-PA protein is then composed as follows (from the amino-terminus): a. The signal peptide, followed by the pro-sequence, 20 segments corresponding to the pre-pro part of serum, among others albumin (Patterson and Geiler, 1977; Lawn et al., 1981).

b. the so-called "finger" (F) domain, which is homologous to the described type I fingers of fibronectin (Sekiguchi 25 et al., 1981; Petersen et al., 1983).

c. The "epidermal growth factor-like" (EGF or E) domain, which has structural similarities to both human and mouse EGF (Savage et al., 1972; Gregory and Preston, 1977).

30 d. Two so-called "kringle" domains (K1 and K2), which are characterized inter alia by corresponding positions of three "internal" disulfide bonds. The kringle structure had previously been described for piasmi-nogeen, which bears five such structures (Sottrup-Jensen 35 et al., 1978).

The carboxy-terminal L chain of t-PA shows f 7 β 1 n <5 1 "* Ir? * ·. · * G * -5- homology with the" family of trypsin-like "serine proteases. demonstrated in our laboratory that this part of the t-PA molecule contains the catalytic center for the plasminogen activator activity 5 and is also the main interaction site for the physiological inhibitor of t-PA, the endothelial plasminogen activator inhibitor PAI-1 (MacDonald et al., 1985; Van Zonneveld et al., 1986a).

The aforementioned model for the secondary structure 10 of t-PA suggests that the proposed autonomous structures may also represent autonomous functions. This hypothesis has received important support through research conducted in our laboratory (European Patent Application 86200223.5 H. Pannekoek et 15 al., T-PA deletions; Van Zonneveld et al., 1986b). In this study, t-PA cDNA deletion mutants were constructed and the mutant proteins encoded by such t-PA cDNAs were subsequently expressed by transfection of so-called no. mouse Ltk cells with the corresponding 20 t-PA cDNA, from which a defined portion of the cDNA has been deleted. The results of this study showed that the ability to strongly accelerate the plasminogen activator activity of t-PA due to the presence of fibrin is mediated by two discrete domains of the t-PA molecule, i.e. the finger domain (F) and the kringle domain K2. Also, the accelerating action of fibrin on t-PA activity could be correlated with the fibrin binding property of t-PA, which is also mediated by the aforementioned two discrete domains.

It could be concluded that at least the H chain of the t-PA protein is composed of structural domains that have an autonomous function. This inference opens the possibility of combining specific properties of this molecule with other molecules to obtain 35 new substitution mutants, which store a new combination of properties and B? 0? 1 y -6- is expressed in a functional manner.

The invention relates to the construction of cDNAs encoding substitution mutants of t-PA, in which a constant part of the t-PA cDNA constructed in our laboratory is fused with a different part of a (partial) cDNA encoding the so-called Human urokinase (u-PA) B chain (Verde et al., 1984). It is the object of this to construct a recombinant DNA molecule encoding a fusion protein 10 in which properties of both t-PA and u-PA are represented. Urokinase (u-PA), like t-PA, is a plasminogen activator and is isolated from urine or conditioned medium from various cultured cell lines. Two different forms of urinary u-PA have been identified, n.1. a high molecular weight (HMW u-PA; 54 kD) and a low molecular weight (LMW u-PA; 33 kD) form, both of which have plasminogen activator activity. LMW u-PA is considered to be a proteolytic degradation product of HMW u-PA. The amino acid sequence of both HMW u-PA 20 and LMW u-PA, as well as the position of asparaginin-linked glycosylation sites, has been fully elucidated (Günzler et al., 1982a; Günzler et al., 1982b; Steffens et al., 1982) . HMW u-PA consists of two chains linked by a single disulfide bond. The amino terminal chain (A chain) contains 157 residues (1 to 157) and the carboxy terminal chain (B chain) contains 253 amino acids (159 to 411). LMW u-PA also consists of two chains, which are linked in the same manner and in the same place as HMW u-PA by a disulfide bond. The amino terminal chain (A1) consists of 22 residues (136 to 157) and the carboxy terminal B chain is identical to the B chain of HMW u-PA (159 to 411).

The construction and isolation of a recombinant DNA molecule, which carries the complete genetic information for human u-PA (so-called u-PA cDNA) and the expression of biologically active u-PA, synthesized in Escherichia 8? C; 1-7 coli bacteria transformed with a plasmid carrying u-PA cDNA has been described (Heyneker et al., 1983).

The nucleotide sequence of full-length u-PA cDNA was determined in these studies so that the amino acid sequence could be deduced from this. u-PA is synthesized as a precursor molecule consisting of 431 amino acids. The 20 amino acid amino-terminal segment, which probably has a signal peptide function, is removed. The amino acid sequence of the remaining 10411 residues corresponds to the sequence determined for a u-PA preparation purified from urine (Günzler et al., 1982a and 1982b; Steffens et al., 1982).

Independently of the above study, a u-PA cDNA 15 has been constructed by Blasi and co-workers (Verde et al., 1984), which carries at least the genetic information for the B chain of human u-PA. This recombinant DNA molecule has been used in the present application for the construction of "t-PA substitution mutant cDNAs", while another part is derived from the full length t-PA cDNA constructed on our laboratory (Van Zonneveld et al. 1986b). The "u-PA cDNA" construct (Verde et al., 1984) is not entirely composed of cDNA as two ("unspliced") introns are also present on this DNA. It is plausible that the construction of this (partial) u-PA CDNA started from a messenger RNA (mRNA) preparation, which contained mRNA still containing introns. The presence of these two introns in the u-PA cDNA makes it necessary to use eukaryotes or tissue culture cells of eukaryotes as host cells in expression studies, since prokaryotes such as Escherichia coli will not be able to extract these introns from the corresponding mRNA. to eliminate.

The u-PA protein, like the t-PA protein, can be considered as a molecule composed of a number of discrete domains, each of which performs an autonomous function. From the observation # that both HMW u-PA and LMW u-PA have plasminogen activator activity, it can be deduced that the B chain carries the catalytic center of u-PA. The conclusion is consistent with the observation that the B chain shows homology to the family of trypsin-like serine proteases, a conclusion also drawn for the L chain of t-PA. In addition, it has been determined that the amino-terminal fragment (called ATF), which extends from amino acids 1 to 135, has an autonomous function in the binding of HMW u-PA to a receptor 10 on the outer membrane of a monocytic cell line ( Stoppelli et al., 1985).

Urokinase (u-PA) has been widely used as an anti-thrombolytic. However, u-PA exhibits a property that seriously hinders such applications.

Unlike t-PA, u-PA has substantial plasminogen activator activity in the absence of fibrin. As a result of this property, when circulating in vivo, both circulating and fibrin-bound plasminogen is converted indiscriminately into piasmin.

Systemic formation of piasmin results in proteolytic degradation of fibrinogen and of the blood coagulation factors Factor V and Factor vm, possibly resulting in serious bleeding complications.

The inventors have now succeeded in constructing and expressing two different human molecules (substitution mutant cDNAs) in host cells. In addition to a vector portion, these recombinant DNA molecules contain a DNA sequence encoding the major portion of the H chain of t-PA and a DNA sequence encoding at least the entire B chain of u-PA. The object of this is to add the property that the plasminogen activator activity of t-PA is strongly accelerated by the interaction of the kringle 2 (K2) domain and the finger (F) domain of t-PA with fibrin, to the plasminogen. activator activity of u-PA, which is located on the B chain of u-PA. Hereby 87 6 1 n-p 1. V In. It should be emphasized once again that the plasminogen activator activity of u-PA, in the absence of fibrin ("basal activity"), is significantly higher than the basal activity of t-PA.

Furthermore, the invention is embodied in a method of preparing human t-PA (u-PA) substitution mutant proteins, wherein host cells are cultured in a manner known per se, which have been transfected using such recombinant DNA. and the human t-PA (u-PA) substitution mutants thereof produced by the host cells are recovered.

These human t-PA (u-PA) substitution mutant proteins are more active plasminogen activators than t-PA, in the presence of fibrin according to in vitro experiments and are also less sensitive to the physiological inhibitor of t-PA, i.e. the endothelial plasminogen activator inhibitor (PAI-1).

The invention is also embodied in a pharmaceutical composition affecting blood clotting and / or fibrinolysis, comprising human t-PA (u-PA) substitution mutant proteins obtained by such a method, as well as in host cells, which due to transfection using a recombinant DNA molecule as defined above, are able to produce human t-PA (u-PA) substitution mutant proteins.

It will be detailed below how the human t-PA (u-PA) substitution mutant cDNAs were constructed and expressed. These two mutants were constructed in a manner that took into account: a) The number of amino acids (arbitrary 14 residues) separating kringle 2 (K2) of t-PA from the arginine-isoleucine peptide bond broken by piasmin , Resulting in two chain t-PA (Pennica et al., 1983), or 1/8 i: 1 -10-b) The number of amino acids (arbitrarily 27 residues) separating the single kringle of u-PA from the lysine -isoleucin peptide bond, which is broken by piasmin, resulting in two chain u-PA (Heyneker et al., 5 1983).

Construction of t-PA substitution mutant cDNAs

Starting materials for the constructs were two recombinant DNA plasmids. Plasmid pSV2 / t-PA contains the complete genetic information (cDNA) for human t-PA and the nucleotide sequence of this plasmid has been fully established (Mulligan and Berg, 1981; Van Zonneveld et al, 1986b). In addition, use was made of the plasmid pHUK-1, which contains a partial cDNA encoding at least the B chain of human u-PA (Verde et al., 1984). The nucleotide sequence of plasmid pHUK-1 has also been fully elucidated (Okayama and Berg, 1983;

Verde et al., 1984). The numbering of restriction sites in t-PA cDNA are taken from Pennica et al. (1983), while the numbering of restriction sites in u-PA DNA and cDNA are indicated by Verde et al. (1984).

The DNA of plasmid pSV2 / t-PA was completely digested with the restriction endonuclease PstI and then partially digested with the restriction endonuclease EcoRI, in order not to "cut" the restriction site for EcoRI at position 1273. As a result of this digestion, a restriction fragment could be isolated, corresponding to the t-PA cDNA segment from EcoRI 30 (position 801) to PstI (position 1312) (Fragment A).

The DNA of plasmid pHUK-1 was completely digested with the restriction endonucleases PstI and EcoRI. As a result of this digestion, a restriction fragment could be isolated, corresponding to the u-PA (c) DNA segment 35 from PstI (position 386) to EcoRI (position 727) (Fragment B) · f:?. $ <-11 -

The DNA of the vector, being the replicative double-stranded form of the bacteriophage M13mp8 (Vieira and Messing, 1982), was completely digested with the restriction endonuclease EcoRI. The now linear vector 5 was mixed with Fragments A and B and using the enzyme DNA ligase a recombinant DNA construct was prepared, consisting of the above three components, fusing the Pst I end of t-PA (position 1312) with the PstI end of 10 u-pa (position 386) and the two EcoRI ends (position 801 of t-PA and position 727 of u-PA) are fused with both EcoRI ends of M13mp8. This construct was called M13mp8 / t-PA: ju-PA.

Starting from the single-stranded form of the DNA i5 of the bacteriophage M13mp8 / t-PA: u-PA were used with the aid of the so-called no. "outlooping" method (Kramer et al., 1984) constructed two deletion mutants, according to the considerations set forth previously. To this end, two so-called synthesized "primers", each of 36 nucleotides in length. The nucleotide sequence is indicated below:

Primer I 5 'GATGTGCCCTCCTGCTCCCAGTGTGGCCAAAAGACT 3'

(amino acids) DVPSCS QCGQK T

25

Primer II 5 'GATGTGCCCTCCTGCTCCGGAAAAAAGCCCTCCTCT 3'

(amino acids) D VPSCSGKKPSS

N.B.The corresponding amino acids are indicated with the one-letter code.

30

The 5 'terminal half of both primers (18 nucleotides) are identical to the base pairs 958 through 975 of t-PA cDNA, which encode the amino acids aspartic acid (D), valine (V), proline (P), serine (S), cysteine (C) and serine (S). The 3 'terminal half of primer 35 I corresponds to base pairs 677 through 698 of u-PA DNA and encode the amino acids glutamine (Q), cysteine £ 01021 -12- (C), glycine (G), glutamine (Q), lysine (K) and threonine (T). The 3 'terminal half of primer II corresponds to the base pairs 638 to 655 of u-PA and encode the amino acids glycine (G), lysine (K) f lysine (K), proline 5 (P), serine (S ) and serine (S).

Using the "outloop" method, in which single-stranded DNA of the bacteriophage Ml3mp8 / t-PA :: u-PA was hybridized with either primer I or primer II and then synthesized a double-stranded hetero-10 duplex in vitro, followed by transformation of suitable Escherichia coli bacteria, the desired deletions were made This section deleted a segment of t-PA cDNA containing, inter alia, the EcoRI restriction site at position 1273 and the PstI restriction site at 1312. The segment u-PA, which was deleted, it contains, inter alia, the restriction site for PstI at position 386. For both constructions it is now possible, after purification of the double-stranded form of the mutated M13mp8 / t-PA :: u-PA, to isolate an EcoRI restriction fragment, which 20 deletion. Using primer I, the length of this fragment is 222 base pairs (Fusion fragment A), and using primer II, the length of this fragment is 261 base pairs (Fusion) ragment B).

In the subsequent steps of the constructions, the fusion fragments on the 5 'side are fused with the contiguous full-length t-PA cDNA t-PA cDNA and on the 3' side, the fusion fragments are fused with the contiguous u-PA (c DNA from the plasmid pHUK-1. To this end, the DNA of the plasmid pSV2 / t-PA (Van Zonneveld et al., 1986b) was completely digested with the restriction enzymes HindII and EcoRI, thereby isolating a restriction fragment extending from the HindII restriction site at the vector portion of pSV2 / t-PA and the EcoRI place at position 35 801 in the t-PA cDNA portion. PHUK-1 also became DNA

(Verde et al., 1984) completely digested with the restriction endonuclease PstI and partly with the restriction 8701021-13-endonuclease EcoRI, avoiding "cutting" the EcoRI restriction site at position 1364. Thus, an EcoRI-Pstl fragment could be isolated, corresponding to positions 727 and 1969 for EcoRI 5 and Pstl at pHUK-1, respectively. The vector used for the following construction is the plasmid pUC19, which was digested with the restriction endonucleases Hindlll and Pstl (Yanisch-Peron et al., 1985).

The Fusion fragment A (222 base pairs; EcoRI ends) was mixed with the HindIII-EcoRI fragment from pSV2 / t-PA, the EcoRI-PstI fragment from pHUK-1 and the digested vector pUC19. In the same manner, Fusion B (261 base pairs) was mixed separately with the same three fragments. After ligation and transformation of Escherichia coli strain DH1 (Maniatis et al., 1982), the desired two different recombinant DNA plasmids could be isolated. These plasmids were named: pUC19 / t-PA :: u-PA-I and püC19 / t-PA :: u-PA-II.

The DNA of the plasmids püC19 / t-PA :: U-PA-I and 20 püC19 / t-PA :: u-PA-II was completely digested with the restriction endonuclease Hindlll and partly with the restriction endonuclease BamHI. to "cut" the BamHI site in the u-PA DNA section at position 1654. Thus, two HindIII-BamHI fragments could be isolated, which are related to the original "outlooping" with either primer I or primer II, the HindIII restriction site of which comes from the vector portion of pSV2 / t-PA and the BamHI restriction site of the polylinker portion of the vector püC19. In essence, the HindIII-BamHI fragments contain the fusions between t-PA cDNA, encoding the major part of the H chain of t-PA, and the B chain of u-PA (the difference between the two fragments being expressed in 13 amino acids more when using primer 35 ii compared to using with primer I). Finally, the two HindIII-BamHI were used separately to replace the full length t-PA cDNA portion on the plasmid pSV2 / t-PA. To this end, the DNA of plasmid pSV2 / t-PA was completely digested with the restriction endonucleases e? c ion -14-

HindlII and BglII and the fragment isolated containing the vector portion. Since the restriction endonucleases BamHI and BglII generate the same DNA ends, the above HindIII-BamHI fragments could then be ligated with the digested vector. After transformation of Escherichia coli DH1 bacteria, the desired two types of recombinant DNA plasmids were isolated and purified (Maniatis et al., 1982). The nucleotide sequence of the relevant sequences of these final plasmids, named pSV2 / t-PA: ju-PA-I and pSV2 / t-PA :: u-PA-II, was completely determined by "DNA sequencing" ( Sanger et al., 1977) and the relevant portion of the fusion between t-PA cDNA and u-PA (c) DNA, as well as the corresponding amino acid sequence, are shown in FIG. 1 is displayed. The mutant proteins to be discussed in the following sections were named t-PA :: u-PA-I and t-PA :: u-PA-II and are encoded by pSV2 / t-PA :: u-PA, respectively. -I DNA and pSV2 / t-PA :: u-PA-II DNA. Finally, it can be mentioned that as a result of the described constructions, the latter plasmids contain only one intron in the u-PA portion, which originally comes from the plasmid pHUK-1.

On April 28, 1987, a 13. coli 25 K12 strain DH1 [pSV2 / t-PA :: u-PA-II], number CBS 293.87, was deposited with the Central Bureau of Mold Cultures (CBS) in Baarn.

From the plasmid thus made accessible, the shorter plasmid pSV2 / t-PA: µu-PA-I can easily be constructed, e.g. via the outlooping technique.

Expression of the mutant proteins t-PA :: u-PA-I and t-PA :: u-PA-II

The mouse fibroblast cell line (mouse · Ltk-) was grown in so-called no. "Iscove's minimal medium" to which was added 35, penicillin, streptomycin and 10% (v / v) fetal calf serum. Transfection of these cells was performed as described (Lopata et al., 1984; Van Zonneveld et al., 1986b). After transfection, the cells were incubated in the above medium, but without δ7: 2, 1 -15 phthal calf serum. Conditioned media was harvested five days after transfection, and Tween-80 and sodium azide were added to a final concentration of 0.01% (v / v) and 0.02% (w / v), respectively. Thereafter, the conditioned media were dialyzed against a buffer consisting of 50 mM sodium phosphate (pH 7.4), 0.01% (v / v) Tween-80 and 0.02% (w / v) sodium for 16 hours at 4 degrees Celsius. azide. Formulations treated in the above manner were then stored at 4 degrees Celsius.

10

Determination of mutant protein concentration in conditioned media

Determination of the concentration of the secreted mutant proteins t-PA: uu-PA-I, t-PAs: u-PA-II, as well

of control transfection experiments with pSV2 / t-PA

DNA encoding recombinant t-PA (rt-PA) was performed using an immunoradiometric method (IRMA).

The IRMA is based on the presence of kringle 20 L (KI) of t-PA on all proteins to be tested and the

availability of two different monoclonal anti-t-PA

antibodies directed against AI (Van Zonneveld et al.,

1986c). These two antibody preparations are called CLB-t-PA

72 and CLB-t-PA 16 (Van Zonneveld et al., 1986c).

The monoclonal anti-t-PA antibody CLB-t-PA 72 was coupled to cyanogen bromide-activated Sepharose and incubated in 10.5 raM sodium phosphate (pH 7.4), 150 mM sodium chloride (PBS) added 1% (w / v) bovine serum albumin, 0.1% (v / v) Tween-20 and various dilutions of the conditioned media from the transfected tissue culture cells previously concentrated approximately 50-fold using Amicon centricon 30 filters. Then, an i-labeled IgG preparation (15,000 beats per minute) of monoclonal CLB-t-PA 16 was added to the above mixture to measure the binding of antigen to the immobilized monoclonal antibody.

The incubations were performed in a total volume of 0.5 ml for 18 hours at room temperature. During the incubations, the mixtures were rotated "head-over-head".

The Sepharose beads were washed five times with a buffer containing 0.9 M sodium chloride, 0.1% (v / v)

Tween-20 and 10 mM EDTA and the bound radioactivity was measured using a gamma radiation radioactivity counter. Dilutions of a standard Bowes melanoma t-PA preparation were used as reference material for the concentration determination. A characteristic concentration determination gave the following results: rt-PA 16 ng / ml; t-PA :: u-PA-I 0.6 ng / ml and t-PA :: u-PA-II 0.4 ng / ml being the concentrations in the unconcentrated conditioned media for transfected cells treated under similar conditions.

The lower expression level of the mutant plasminogen activator proteins, compared to rt-PA, may have to be attributed to the presence of an intron in the u-PA portion of the t-PA substitution mutants. If splicing of this intron is a limiting step, it could result in a lower expression level for the mutant proteins, compared to the expression of rt-PA.

25

Analysis of mutant proteins using gelatin plasma minoq and gel electrophoresis

An analysis of the mutant plasminogen activator proteins using gelatin plasminogen gel electrophoresis can lead to conclusions about two parameters of these proteins, i.e. a semi-quantitative insight into the plasminogen activator activity in the absence of fibrin and a relative molecular weight. The preparation of such gels (polyacrylamide, in which copolymerized gelatin and plasminogen), as well as the principle on which 870 U'1. .

This analysis system is based, has been described previously (Van Zonneveld et al., 1986b). The results of this analysis are shown in FIG. 2 is shown.

It can be concluded that both t-PA substitution mutants have plasminogen activator activity.

This observation is consistent with the determination of the nucleotide sequence of the mutant DNA1s where no stop codons could be detected in the translation "reading frame" and with the length of the relevant coding portion of the mutant DNAs. The relative molecular weight of t-PA :: u-PA-I and t-PA: uu-PA-II corresponds to the length of the respective coding part of pSV2 / t-PA: uu-PA-I and pSV2 / t -PA :: u-PA-II, which corresponds to 527 and 540 amino acids, respectively.

Kinetics of plasminogen activation by the mutant proteins t-PA :: u-PA-I and t-PA :: u-PA-II

The activation of Glu plasminogen to piasmin by t-PA :: u-PA-I and t-PA :: u-PA-II (and by the controls rt-PA and HMW u-PA) was performed at 37 degrees Celsius in a buffer consisting of 0.1 M TRIS-HCl (pH 7.4), 01% (v / v) Tween-80, 0.57 mM of the chromogenic substrate 25 s-2251 and, if indicated, 120 µg / ml fibrinogen fragments generated by digestion with cyanogen bromide (termed "stimulator") (Verheijen et al., 1982). The total reaction volume was 250 microliters and the reactions were performed in "96-well" microtiter plates.

A Titertek Multiscan spectrophotometer, equipped with a thermostat, was used to monitor the development of the optical density at 405 nm for 5 to 6 hours at 10 minute intervals. Initial reaction rates were obtained by graphically plotting the relationship between the increase in optical density at 405 nm per minute against the incubation time.

β 7 C 1 £ - - 1

S

-18-

Under these conditions, an increase in optical density at 405 nm per minute corresponds to 1 unit with an amount of 40 pmoles of piasmin in a volume of 250 microliters (concentration of piasmin 5 160 nM). In the absence of stimulator, the Glu-plasmino-no concentration was varied from 0.11 to 0.55 for 0.2-0.4 ng / ml t-PA :: u-PA-I, t-PA :: u-PA-II and HMW u-PA. / µM, while for 1.6-3.2 ng / ml rt-PA the Glu-plasminogen concentration was varied from 0.55 to 4.4 / µM. In the presence of stimulator (120 µg / ml), the Glu-plasminogen concentration was varied from 1.7 to 27.5 nM for 0.08-0.2 ng / ml of each of the mutant proteins, 0.32-0.64 ng / ml rt-PA and 0.1- 0.2 ng / ml HMW u-PA. For each Glu-plasminogen concentration, both in the presence and absence of stimulator, the experiments were run in duplicate and repeated four times. Using the results obtained, so-called no. Plotted "Lineweaver-Burk plots", using "weighted" linear regression analysis, after which the so-called Km and v (max) values could be determined.

20 The so-called k (cat) value could be calculated using the molecular weights of the different plasminogen activators, namely t-PA :: u-PA-I 72 kD, t-PA :: u-PA-II 74 kD, rt-PA 70 kD and HMW u-PA 54 kD. The results are shown in Table 1.

This kinetic analysis allows a number of inferences concerning the affinity of the different plasminogen activators for the substrate Glu-plasminogen (measure is the Km value) and the rate of conversion (measure is the k (cat) value) , in the absence and presence of the fibrin mimetic "stimulator".

In the absence of stimulator, the affinity of t-PA :: u-PA-I (Km = 0.61 / uM) and t-PA :: u-PA-II (Km = 0.88 / uM) for Glu plasminogen is of the same order of size as HMW u-PA (Km = 2.2 / uM). This result is due to the fact that the mutant proteins and HMW u-PA carry the same catalytic center located on the B chain P1. f? * <A 9 1 '* · ί V ü ïj? -19- from u-PA. The presence of different amino terminal chains on the mutant proteins among themselves, as well as compared to HMW u-PA, has little or no effect on the affinity for the substrate. The affinity of the 5 mutant proteins to the substrate is at least a factor of 57 to 82 greater than the affinity of rt-PA to the substrate. The conversion rates for the mutant plasminogen activators, rt-PA and HMW u-PA are of the same order of magnitude (0.25-0.65 sec - * -).

In the presence of fibrin, at least a stimulator that mimics the effect of fibrin, the affinity for the substrate Glu-plasminogen increases strongly for all plasminogen activators. For the mutant proteins t-PA :: u-PA-I and t-PA: uu-PA-II, the affinity increases by a factor of 122 to 220 (Km from 0.61-0.88 / uM to 0.005-0.004 / uM) , for rt-PA by a factor of at least 3125 (Km from ^> 50 / uM to 0.016 / uM) and for HMW u-PA by a factor of 30 (Km from 2.2 / uM to 0.073 / uM). From these values it can be concluded that the affinity for the substrate Glu-plasminogen in the presence of the stimulator increases by a factor of 4.1 to 7.3 due to the presence of the amino-terminal t-PA H chain, instead of the amino-terminal u-PA A chain. Also, in the presence of stimulator, the conversion rates of the different plasminogen activators are not essentially different k (cat) 0.26 - 0.45 sec-1 · The comparison of the enzymatic activity, represented by the quotient k (cat) / Km in presence and in absence of stimulator shows that it increases for rt-PA by a factor of at least 2100 (from less than 0.01 sec-1 / µM "1 to 21 sec" 1 / µM "1), for t-PA :: u -PA-I by a factor of 220 (from 0.41 sec "1 / uM-1 to 90 sec" 1 / uM "1), for t-PA :: u-PA-II by a factor of 288 (from 0.34 sec-1 / uM "1 to 98 sec" 1 / uM "1) 35 and for HMW u-PA by a factor of 12 (from 0.29 sec" 1 / uM "1 to 3.6 sec" 1 / uM "1). The more efficient plasminogen 6 / l; H'2 1 -20 activation by HMW u-PA in the presence of stimulator must be attributed to a conformational change of plasminogen by the stimulator (Lijnen et al., 1984). The same phenomenon will also occur in the 5 reactions. with the mutant plasminogen activators and rt-PA.

It can therefore be concluded from the comparison of the enzymatic activity [k (cat) / Kml value that in the presence of fibrin the mutant proteins are 4 to 5 times more effective in plasminogen activation than rt-PA and are approximately 25 more effective than HMW u. -PA.

Based on the findings that the kinetic parameters of t-PA :: u-PA-I and t-PA :: u-PA-II do not differ materially in the presence and absence of "stimulator", the following experiments with the mutant protein t-PA :: u-PA-II 15 are performed. As previously explained, t-PA :: u-PA-II contains 13 amino acid residues more than t-PA :: u-PA-I.

Complex formation of the mutant plasminogen activators with the endothelial plasminogen activator inhibitor (PAI-1) 20 and the inhibition of the mutant plasminogen activators by PAI-1

The endothelial plasminogen activator inhibitor (PAI-1) is considered to be the physiological inhibitor of the fibrinolytic process and thus an important in vivo regulator of the "net fibrinolytic activity" (review article: Sprengers and Kluft, 1987). PAI-1 is synthesized, inter alia, by cultured vascular endothelial cells. PAI-1 very quickly complexes both with u-PA and with t-PA (second-order reaction constant above 10 µM "1 sec" 1 (Sprengers and Kluft, 1987). The complex of the plasminogen activators with PAI-1 is resistant to sodium dodecyl sulfate (SDS), so complex formation can be analyzed using SDS polyacrylamide gel electrophoresis techniques, however, the activity of the plasminogen activators in complex with PAI-1 is only possible after treatment with Triton 87 01 1 -21- X-100 are demonstrated (Loskutoff et al., 1983), possibly due to intrinsic plasminogen activator activity of the complex or due to dissociation of plasminogen activator from the complex. PAI-1, which is cultured endothelial cells are synthesized and secreted, found as a mixture of inactive, latent and active inhibitor.The latent form can be activated by treatment with certain chemicals, such as SDS.

Recently, a number of groups have constructed PAI-1 cDNA that carries the complete genetic information for the human PAI-1 glycoprotein (Ny et al., 1986;

Pannekoek et al., 1986; Ginsburg et al., 1986; Andreasen et al., 1986). The amino acid sequence of PAI-1 could be deduced after the elucidation of the complete nucleotide sequence. The amino acid sequence of PAI-1 shows significant homology to proteins belonging to the "family" of serine protease inhibitors (so-called serpins). The mechanism of action of the serpins, in particular that of the prototype alpha-l-an-20 titrypsin with the serine protease elastase, has been extensively studied (Loebermann et al., 1984; Carrell and Boswell, 1986). It is plausible that the mode of action of PAI-1 with t-PA and u-PA is very similar to that of alpha-1-antitrypsin with elastase. On the basis of these considerations, it can be assumed that serpins, such as PAI-1, form a 1: 1 molar complex with the "target" protease.

The complex formation of PAI-1 with the mutant plasminogen activator t-PA: su-PA-II, as well as with the controls rt-PA and HMW u-PA was determined as follows. 0.2 ng of the plasminogen activators were incubated separately with an excess of PAI-1. A buffer consisting of 2% (w / v) sucrose, 5 µg / ml bromophenol blue and 2.5% (w / v) SDS was then added and the samples were analyzed using SDS polyacrylamide gel electrophoresis.

After electrophoresis, a fibrin agarose indicator 8 7 0 · Λ ** 1 -22 gel was prepared, which also contained plasminogen (Granelli-Piperno and Reich, 1978), and used as an "overlay" for the Triton X-100 treated SDS polyacrylamide gel. By diffusion of either "free" plasminogen activator or complexed with PAI-1, both the activity of plasminogen activators can be determined semi-quantitatively and the molecular weight of the plasminogen activator can also be determined. The results are shown in FIG.

3 is shown.

Two conclusions can be drawn from the results of this analysis. First, PAI-1 forms a complex with both t-PA :: u-PA-II and the control plasminogen activators t-PA and HMW u-PA. This conclusion can be deduced from the observation that the molecular weight of the plasminogen activator activity increases after preincubation with PAI-1. Second, it can be noted that the molecular weight of the complex, which forms PAI-1 with t-PA :: u-PA-II, rt-PA and HMW u-PA, corresponds to a 1:20 for all plasminogen activators. 1 molar complex. This conclusion is based on the observation that after pre-incubation with PAI-1, the plasminogen activator activity migrates at a molecular weight, which corresponds to the sum of the molecular weights of the plasminogen activators (approximately 70-74 kD) and 25 of PAI-1 (approximately 52 kD).

The effectiveness of inhibition of the mutant plasminogen activator, rt-PA and HMW u-PA by PAI-1 was then determined. To this end, the latent fraction of the PAI-1 preparation (total about 130 ng) was previously activated with SDS (final concentration 0.1% (w / v)). Different dilutions of the activated starting preparation were treated with an equal volume (55 / μl) 0.2 M TRIS-HCl (pH 7.4), 0.2% (v / v) Tween-80, 6% (v / v) Triton X-100 for 15 minutes at room temperature. Then, in a volume of 30 µl, one of the plasminogen activators was added, which corresponded to 0.024 87 0-1 02 1-23-ng t-PA :: u-PA-II, 0.024 ng rt-PA or 0.024 ng HMW u-PA.

The mixtures were incubated at room temperature for 30 minutes. The residual plasminogen activator activity of the different activators was finally determined as follows. 110 µl of a mixture containing 0.1 M TRIS-HCl (pH 7.4), 0.1% (v / v) Tween-80, human Glu plasminogen (final concentration 0.11 µM), chromogenic substrate S-2251 (final concentration 0.54 mM) was added ) and "stimulator" (120 µg / ml). The determination of the optical density at 405 nm, as a measure of the plasminogen activator activity, has already been explained in a previous section. The results are in Pig. 4 is shown.

The following conclusions can be drawn from the results. By comparing the amount of PAI-1 required to inhibit the plasminogen activator activity of the different plasminogen activators by 50%, it can be observed that approximately 5 times more PAI-1 is required for the mutant t-PA: : u-PA-II then for rt-PA or HMW u-PA. Therefore, the mutant plasminogen activator can be considered as a molecule more resistant to the physiological inhibitor PAI-1 than rt-PA and HMW u-PA. The dissociation constants of the different plasminogen activator-PAI-1 complexes could be determined by a Scatchard type analysis (Scatchard, 1949). In accordance with the above claim, it could be concluded that the complex of rt-PA and HMW u-PA dissociates with PAI-1 less readily than the complex of the mutant plasminogen activators with PAI-1. The calculated dissociation 30 constants are shown below:

Plasminogen activator Kd

t-PA :: u-PA-II 4.1 x 10 "12M

rt-PA 0.6 x 10 ”12M

HMW u-PA 0.24 x10 ”12M

8701021 -24-

Materials and Methods DNA analysis: 5

Isolation of plasmid DNA # the analysis of DNA digested with restriction endonucleases by agarose and polyacrylamide gel electrophoresis, "Southern" blotting, isolation of restriction fragments, labeling DNA with radioactivity, either by "nick translation", or with T4 polynucleotide kinase and the colony hybridization technique were performed as described (Maniatis et al., 1982). Determining the order of bases in the DNA (DNA sequencing) was performed by the dideoxy method (Sanger et al., 1977). The restriction endonucleases and other enzymes used were purchased from New England Biolabs (Beverley,

Mass., USA) and radiolabeled nucleotides from The Radiochemical Center (Amersham, England).

20

Transfection of tissue culture cells:

The procedure for obtaining "transient" expression using transfected mouse Lkt-25 cells was performed as previously described (Lopata et al., 1984; Van Zonneveld et al., 1986b).

Gelatin-plasminogen gel electrophoresis: The preparation of polyacrylamide gels, containing gelatin and plasminogen, and conducting the electrophoretic analysis of samples using these gels has been described previously (Van Zonneveld et al., 1986b).

35 Fibrin overlay technique:

The determination of plasminogen activator activity 870 1 02 1 -25- and the molecular weight associated with that activity was performed by the fibrin overlay technique, after SDS polyacrylamide gel electrophoresis of samples, as previously described (Granelli-Piperno and Reich, 1978).

5

Determination of plasminogen activator activity;

This assay uses the chromogenic substrate S-2251, which is specific for piasmin. Activation of Glu plasmirogen by rt-PA, Bowes melanoma t-PA and other t-PA derivatives is strongly accelerated by addition of fibrinogen cleavage products treated with cyanogen bromide. The latter component is called "stimulator" (Verheijen et al., 1982). If the plasminogen activator activity is determined after pre-incubation with PAI-1, the PAI-1 preparation uses either conditioned (serum-free) medium from cultured human vascular endothelial cells (concentration PAI-1; 2.4 µg / ml) or a purified preparation PAI-1 (100 µg / ml; Lambers et al., 1987).

Similar results were obtained with both preparations.

Remaining materials; 25 HMW u-PA (two chain) was a gift from Dr. G.

Cassani (Lepetit, Milan, Italy). Bowes melanoma t-PA (two chain) was purchased from Biopool (Umea, Sweden). Gluplasminogen, "stimulator" and the chromogenic substrate 30s-2251 was purchased from KabiVitrum (Stockholm, Sweden).

£:? C ·: Γ Γ 1 ί -26- TABLE 1 - stimulator + stimulator PREPARATION Km k (cat) k (cat) / Km Km k (oat) k (cat) / Km rt-PA> 50 0.49 <0.01 0.016 0.34> 21 t-PA :: u-PA-I 0.61 0.25 0.41 0.005 0.45 90 t-PA :: u-PA-II 0.88 0.30 0.34 0.004 0.39 98 HMW u-PA 2.2 0.65 0.29 0.073 0.26 3.6

The Km values are shown in ^ uM. The k (cat) values are shown in sec ”· * ·, so that the quotient k (cat) / Km has the dimension /UMage·*·.sec··*··.

Explanation of the Figures:

Fig. 1

The nucleotide sequence of the cDNA region encoding the fusion portion of t-PA :: u-PA-I (top) and t-PA: su-PA-II (bottom), respectively, is indicated.

Also, the corresponding amino acids of the t-PA parts and the u-PA parts are indicated. The numbering above the nucleotide sequences corresponds to that of the t-PA nucleotide sequence (955 etc.) and the u-PA nucleotide sequence (679 etc., 640 etc.). The numbering among the amino acid sequences corresponds to that of the t-PA amino acid sequence (256 etc.) and the u-PA amino acid sequence (147 etc., 134 etc.). The underlined nucleotide sequence indicates the synthetic primers used for the construction of both mutants.

Fig. 2.

Gelatin-plasminogen gel electrophoresis. The execution 87 0 1 -Ί 4 -27- of this analysis is shown in the text. The following were analyzed successively: 1. 1 ng Bowes melanoma t-PA (control); 2. 0.1 ng Bowes melanoma t-PA; 3.1ng rt-PA; 4.1 ng rt-PA; 5.1 ng t-PA :: u-PA-I; 6.1 ng t-PA :: u-PA-II; 5 7. 0.1 ng HMW u-PA. This analysis shows that the activity of the t-PA substitution mutants, in the absence of fibrin in this system, is comparable to HMW u-PA and higher than either (native) Bowes melanoma t-PA or rt-PA. To the left are reference molecular weights 70,000 and 54,000 of t-PA and HMW u-PA, respectively.

Pig. 3.

Pibrin overlay after SDS polyacrylamide gel electrophoresis.

This technique is described in the Materials and Methods, while the details are shown in the text. Subsequently, from left to right, the possible complex formation PAI-1 with one of the plasminogen activators, 20 t-PA :: u-PA-II without PAI-1 (MW ca. 70,000) was analyzed; t-PA :: u-PA-II with PAI-1 (MW greater than 70,000); rt-PA without PAI-1 (MW ca. 70,000); rt-PA with PAI-1 (MW greater than 70,000); HMW u-PA without PAI-1 (MW approx. 54,000); HMW u-PA with PAI-1 (MW greater than 70,000); conditioned medium from cultured human endothelial cells (ECCM), containing a complex of PAI-1 and t-PA; ECCM, to which is added conditioned medium from cultured, untransfected mouse Ltk cells.

FIG. 4.

The data on the assay for determining the inhibition of the activity of the various plasminogen activators by (increasing amounts of) PAI-1 has been described in detail in the text.

8 7 «Λ 1 7 r 1 VJ * V: · v '£ * $

Claims (10)

1. Human t-PA (u-PA) substitution mutant proteins, made up of a portion of human t-PA and a portion of human u-PA, the t-PA part being the H chain or a modified H chain and essentially 5 lacks the L chain, and the u-PA portion comprises the B chain and essentially lacks the A chain. The human t-PA (u-PA) substitution mutant proteins according to claim 1, wherein the t-PA portion consists essentially of the entire H chain. The human t-PA (u-PA) substitution mutant proteins according to claim 1, wherein the t-PA moiety essentially consists of a modified H chain containing one or more K2 domains and one or more of the other domains of the H chain is missing, and / or contains one or more F domains and one or more of the other H chain domains is missing. 4. Human t-PA (u-PA) substitution mutant proteins t-PA :: u-PA-I and t-PA: uu-PA-II. 5. Recombinant genetic information in the form of RNA, single-stranded DNA or double-stranded DNA encoding human t-PA (u-PA) substitution mutant proteins according to any one of claims 1-4. 6. Recombinant cloning and / or expression vector, such as, for example, a plasmid, comprising a suitable cloning and / or expression vector with recombinant genetic information according to claim 5 inserted therein. 7. Recombinant plasmids püC19 / t-PA :: u-PA-I; pUC19 / -t-PA :: u-PA-II; pSV2 / t-PA :: u-PA-i; and pSV2 / t-PA :: u-PA-II. 8. A method of preparing human t-PA (u-PA) substitution mutant proteins according to any one of claims 1-4, wherein suitable host cells are cultured using recombinant genetic information according to claim 5, in particular recombi 8. ci c '; The DNA of claim 6 or claim 7 has been transformed, e.g., transfected, and the human t-PA (u-PA) substitution mutant proteins produced by the host cells are recovered. Host cells, which are transformed, for example transfected, using recombinant genetic information according to claim 5, in particular recombinant DNA according to claim 6 or claim 7, and capable of multiplication and / or expression of the recombinant genetic information encoding human t-PA (u-PA) substitution mutant proteins according to any one of claims 1-4. Pharmaceutical preparations with an effect on blood clotting and / or on fibrinolysis, comprising a human t-PA (u-PA) substitution mutant protein according to any one of claims 1-4 and one or more pharmaceutically acceptable carriers, thinners and / or excipients. 8. o i;