NL2035090A - Maize Dual Regulatory Module for Regulating the Balance between Plant Growth and Disease Resistance - Google Patents

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to 5 an application of a maize dual regulatory module for regulating the balance between plant growth and disease resistance. The maize dual regulatory module comprises a promoter of a ZmTBF1a gene and its uORF sequence, namely, pZmTBF1a:uORFZmTBF13v the nucleotide sequence of which is shown in SEQ ID No.1; it also includes the promoter of ZmTBF1b gene and its uORF sequence, namely, pZmTBF1b:uORFZmTBF1b, whose nucleotide sequence is shown in SEQ ID 10 No.2. On this basis, the invention clones two regulatory elements of promoters pZmTBF1 and uORFZmTBF1 upstream of the two genes to form a pathogen-inducible gene regulatory module suitable for maize; two plant expression vectors based on pCAMB|A3301 are constructed to regulate the induced expression of resistance genes in maize, which has application value in cultivating new transgenic maize varieties with high resistance and stable yield.

Description

Maize Dual Regulatory Module for Regulating the Balance between Plant Growth and

Disease Resistance

TECHNICAL FIELD

The invention belongs to the technical field of agricultural biotechnology, and particularly relates to the application of a maize dual regulatory module for regulating the balance between plant growth and disease resistance, and more particularly relates to the application of two

TBF 1 genes’ promoters and their uORF elements in regulating the balance between plant growth and disease resistance.

BACKGROUND

As one of the main food and feed crops in China, corn plays an important role in agricultural production. In recent years, with the climate change and variety replacement, the occurrence of maize diseases has been increasing, which seriously threatens China's food security.

Therefore, the improvement of disease resistance of varieties has become an important goal of maize breeding at present. In the 21st century, the molecular mechanism of plant disease resistance has made a breakthrough, and the basic framework of plant immune system has been established, which has laid a good theoretical foundation for molecular improvement of maize disease resistance. However, production practice and experimental research have found that there is a close antagonistic relationship between plant growth and disease resistance, and introducing resistance genes is an effective means to improve maize disease resistance.

However, over-expression of resistance genes often leads to unexpected growth defects. For instance, while improving crop resistance, the resistance gene often results in inhibition of plant growth and thus affecting crop yield. Therefore, the balance between growth and disease resistance has become a bottleneck restricting the application of disease resistance genes in maize breeding.

In the process of long-term evolution and adaptation, plants have formed complex regulatory networks and molecular mechanisms to balance the growth and disease resistance.

Among them, Arabidopsis thaliana TBF 1 gene, as a key switch molecule, plays an important role in growth-to-defence transition.

As a key switch molecule of growth-to-defence transition, the expression of TBF 1 is precisely regulated by the upstream Open Reading Frame (YORF) at the translation level. The results show that the upstream region of the initial codon of TBF 7 gene contained two uORF™! rich in codons of phenylalanine. When it grows normally, a proper amount of phenylalanine can meet the normal metabolic requirements. At this time, the unphosphorylated translation initiation factor elF2a will bind to uORF™F inhibiting the translation initiation of TBF 1. However, when pathogenic bacteria invaded, the demand for phenylalanine in plants increased, which led to the accumulation of a large number of unloaded phenylalanine transport ribosomes (tRNAP") and the subsequent phosphorylation modification of elF2a promoted its binding to the translation initiation site of TBF 1, which activated the expression of TBF 1 and promoted the transformation of plants into disease-resistant mode. Therefore, the presence of UORF7?7 can strictly inhibit the expression of TBF 17 in normal growth Arabidopsis, but it can be quickly started when pathogenic bacteria invade, thus playing a switching role in its growth-to-defence transition (Pajerowska-Mukhtar, KM., Wang, W., Tada, Y., et al. (2012) The HSF-like transcription factor

TBF 1 is a major molecular switch for plant growth-to-defence transition. Curr Biol 22,103-112).

Based on the molecular mechanism of regulation of TBF 7 gene expression at transcriptional and translational level, Professor Xinnian Dong and Professor Shiping Wang's team have successfully overcome the growth defects caused by the expression of resistance genes in Arabidopsis thaliana and rice (Xu, G., Yuan, M., Al, C., et al. (2017) uORF-mediated translation allows engineered plant disease resistance without fitness costs. Nature 545,491- 494). However, the conservation of this mechanism in other crops, especially the role of maize in resisting its unique diseases, is still unclear.

To sum up, the problem existing in the prior art is that maize resistance genes can exert the disease-resistant function and affect the yield at the same time. Although it has been proved in

Arabidopsis thaliana and rice that the regulatory module of TBF 1 gene can balance the growth and disease resistance of plants, the function of TBF 7 gene in maize is not clear, and there is no report on regulating the growth and disease resistance balance of maize by using the dual regulatory module of maize TBF 1 promoter and uORF.

SUMMARY

In order to solve the above technical problems, the invention provides an application of a maize dual regulatory module for regulating plant growth and disease resistance balance.

The purpose of the present invention is to provide an application of a maize dual regulatory module for regulating the balance between plant growth and disease resistance. The maize dual regulatory module includes a promoter of ZmTBF 1a gene and its uORF sequence, namely, pZmTBF 1a:uORF2"78F2 (regulating ZmTBF 1a gene expression), and its nucleotide sequence is shown in SEQ ID No.1, in which positions 1-1565 are promoters and penultimate positions 190- 315 are uORF of ZmTBF 1a gene. The maize dual regulatory module also comprises a promoter ofthe ZmTBF1b gene and its ORF sequence, namely, pZmTBF 1b:uORF*"™8F (regulating the expression of the ZmTBF 1b gene), and the nucleotide sequence thereof is shown in SEQ ID

No.2, where positions 1-1576 are promoters, and penultimate positions 155-280 from the bottom are YORF of the ZmTBF 1b gene. The TBF 1 gene comprises ZmTBF1a and ZmTBF 1b, where the nucleotide sequence of ZmTBF1a is shown in SEQ ID No.3, where positions 1-234 and penultimate positions 1-663 are exons, and the nucleotide sequence of ZmTBF1b is shown in SEQ ID No.4, where positions 1-228 and penultimate positions 1-669 are exons.

Preferably, the application of the maize dual regulatory module for regulating the balance between plant growth and disease resistance is that the maize dual regulatory module inhibits the expression of corresponding genes under normal growth conditions and significantly induces the expression of corresponding genes under disease conditions, so as to ensure that their respective regulated genes are only expressed under disease conditions, thus balancing the growth and disease resistance of plants, and enabling plants to have both disease resistance and proper growth characteristics.

Preferably, the application of the maize dual regulatory module in regulating and controlling the balance between plant growth and disease resistance balance is provided, and the plant is corn.

Preferably, the application of the maize dual regulatory module for regulating the balance between plant growth and disease resistance, where the maize dual regulatory module (TBF 1 gene promoter and YORF) is used for regulating corn characters, so that the corn is resistant to disease and stable; the disease resistance refers to resistance to diseases and insect pests.

Preferably, the application of the maize dual regulatory module for regulating plant growth and disease resistance balance, where the disease and pest resistance is caused by Puccinia polysora, Curvularia lunata, Fusarium graminearum, Fusarium moniliforme, Demodex tumefaciens, Colletotrichum graminicola, Iranian mosaic virus, Spodoptera exigua, armyworm or aphid.

Preferably, the application of the maize dual regulatory module for regulating plant growth and disease resistance balance comprises amplifying uORF?"7?" element and corresponding

ZmTBF1 promoter sequence from maize DNA, and cloning them into plant expression vector pCAMBIA3301 by seamless cloning.

Preferably, the application of the above-mentioned maize dual regulatory module for regulating plant growth and disease resistance balance, and the primers for amplifying

UORF?"8F1 element and the corresponding ZmTBF 1 promoter sequence are shown in Table 5.

Preferably, the application of maize dual regulatory module for regulating plant growth and disease resistance balance, using EcoRI and Ncol restriction endonucleases to linearize the vector pPCAMBIA3301, and using seamless cloning technology to ligate the amplified maize dual regulatory module sequence to the plant expression vector; the maize dual regulatory module comprises pZmTBF 1a:uORF*™8F1a and pZmTBF 1b:uQRF#" 18h.

Preferably, the application of maize dual regulatory module for regulating the balance between plant growth and disease resistance, uses Ncol and Pml to double-digest the constructed vector, and replaces GUS sequence in the vector with the sequence of disease resistance gene (the expression of disease resistance gene is regulated by the maize dual regulatory module) between the digestion sites, thus preparing the plant expression vector containing maize dual regulatory module and disease resistance gene.

Compared with the prior art, the invention has the following beneficial effects: 1. the present invention identified two homologous genes (ZmTBF 1a and ZmTBF 1b) of

TBF1 in maize, and found that there are conservative UORF2"7?F elements in their upstream,

which can regulate the initiation of gene translation; the further research results showed that

ZmTBF 1s are induced by many corn pathogens and pests, which proved that their promoter had the characteristics of pathogen induction; moreover, the overexpression of these gene can activate hypersensitivity and promote the expression of immune response-related gene

ZmBiP2, the results showed that ZmTBF 1s are involved in the disease resistance response of maize and had the potential to regulate plant growth and disease resistance transformation; on this basis, the promoter and uORF regulatory elements upstream of ZmTBF1a and ZmTBF 1b genes are cloned to form a pathogen-induced gene regulatory module suitable for maize; two plant expression vectors based on pCAMBIA3301 are constructed to regulate the specific induced expression of resistance genes in maize, so as to cultivate new transgenic maize varieties with high resistance and stable yield; 2. the two pathogen-induced regulation modules designed by the invention can balance the influence of disease-resistant genes on growth and disease resistance in maize application, and then cultivate new transgenic maize varieties with high yield and strong disease resistance. In the future, gene editing technology can also be used to introduce the regulation module designed by the invention into the upstream of maize resistance genes, so as to realize a new maize variety with high vield and disease resistance without transgenic markers.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the blast results of the protein sequence of Arabidopsis thaliana TBF 1 in maize genome.

FIG. 2 is an evolutionary analysis of protein sequences of HSF family genes in Arabidopsis thaliana and the candidate TBF 7 homologous genes in maize; the phylogenetic tree is constructed by maximum likelihood method.

FIG. 3 is a comparison of TBF1 protein, promoter and 5'-UTR sequence between Arabidopsis thaliana and maize.

A: amino acid sequence comparison of TBF 1 protein between Arabidopsis thaliana and maize;

B: comparing the promoter sequence of TBF 1 gene between Arabidopsis thaliana and maize;

C: 5'-UTR sequence alignment of TBF 1 gene in Arabidopsis thaliana and maize.

FIG. 4 shows the sequence and evolutionary analysis of “ORF TBF1,

A: DNA sequences of UORF from Arabidopsis thaliana and maize TBF1 gene;

B: amino acid of uORF from Arabidopsis thaliana and maize TBF1 gene;

C: alignment of homologous sequences of different species of uORF25F7,

D: evolutionary analysis of homologous sequences of different species UORF27?7, At,

Arabidopsis thaliana, Pv, Phaseolus vulgaris, Gm, Glycine max, Gr, Gossypium raimondii, Nb, Nicotiana benthamiana, Ca, Cicer arietinum, Pd, Phoenix dactylifera,

Ma, Musa acuminata subsp. malaccessis, Os, O.sativa, ZM, Zea Mays L., maize.

FIG. 5 shows the inhibitory effect of uORF?778F7 on the translation level of downstream genes,

A: vector diagram of LUC reporter gene driven by pZmTBF 1:uQRF*"TEF1, 5 B: influence of WORF?"78F2 on the protein level of downstream genes;

C: effect of UORF?"7EF2 on the transcriptional level of downstream genes;

D: effect of UORF2"78F1 on protein levels of downstream genes;

E: effect of UORF2"78F® on the transcriptional level of downstream genes; wherein in Figs. 5B-E, |, Il, lll, and IV correspond to the carriers in Fig. 5A, respectively.

FIG. 6 is an expression analysis of the ZmTBF1 gene of the present invention,

A: tissue expression characteristics of the ZmTBF 1a gene;

B: tissue expression characteristics of the ZmTBF 1b gene;

C: treatments for up-regulated expression of the ZmTBF 1a gene;

D: treatments for up-regulated expression of the ZmTBF 1b gene;

E: mutants for up-regulated expression of the ZmTBF 1a gene;

F: mutants for up-regulated expression of the ZmTBF1b gene; wherein in Fig. 6, F.graminearum = Fusarium graminearum, F.verticillioides =

Fusarium moniliforme; MIMV = Iranian mosaic virus; C.gramicola = Colletotrichum graminicola; E.turcium = Exserohilum turcicum, SA = salicylic acid; S.exigua =

Spodoptera exigua; M.separata = Mythimna separata, T.urticae = Tetranychus urticae.

FIG. 7 shows the rapid induction of ZmTBF 1 by maize diseases,

A: ZmTBF1a and ZmTBF 1b genes are induced by the pathogen of southern corn rust;

B: ZmTBF1a and ZmTBF 1b genes are induced by the pathogen of Maize Curvularia leaf spot;

C: expression pattern of ZmPR 1 gene in maize after inoculation with Curvularia lunata;

D: expression pattern of ZmTBF 1a gene in maize after inoculation with Curvularia funata;

E: expression pattern of ZmTBF 1b gene in maize after inoculation with Curvulana lunata; wherein P. polysora = Puccinia polysora; C.lunata = Curvularia lunata;

FIG. 8 shows the regulatory effect of Zm7BF1 on immune response,

A: induction of hypersensitivity response by overexpression of ZmTBF1a and ZmTBF1b genes;

B: schematic diagram of vectors for ZmTBF 1 overexpression and ZmBiP2 promoter- driven LUC reporter gene;

C: ZmTBF1-induced upregulated expression of ZmBiP2 promoter-driven LUC reporter gene, wherein |, II, lll and IV in Fig. 8C correspond to the carriers in Fig. 8B, respectively, with "+" indicating a total of two carriers transformed.

FIG. 9 is a structural diagram of a plant expression vector containing ZmTBF 1a gene's promoter and UORF?7"7?F" element (A) and ZmTBF 1b gene's promoter and uQRF#" TBF element (B).

FIG. 10 is the working mode diagram of two pathogen-induced plant expression vectors designed based on ZmTBF1 gene.

DESCRIPTION OF THE INVENTION

In order to make those skilled in the art better understand that the technical scheme of the invention can be implemented, the invention will be further explained with specific examples and figures.

In the description of the present invention, unless otherwise specified, the reagents and vectors used are all commercially available, and the methods used (such as vector construction method, PCR amplification method, etc.) all adopt conventional techniques in this field. . Identification and sequence analysis of TBF 1 homologous gene in maize

Arabidopsis thaliana TBF 1/HSF4 gene belongs to HSF heat shock protein family. However, functional studies show that AtTBF1 does not participate in the heat shock reaction of plants. At first, the invention uses the BLAST tool of Gramene (https:.//www.gramene.org/) website to search the protein sequence of AtTBF1, and finds that there are many sequences similar to

AtTBF1 protein in corn, but the consistency is relatively low (Fig. 1). Therefore, the present invention further constructs a phylogenetic tree of these genes and Arabidopsis thaliana HSF family genes (Fig. 2). The results show that there are two candidate genes (Zm00001eb314890 and Zm00001eb100770) closely related to the evolution of Arabidopsis thaliana TBF 1 gene, and they are probably homologous genes with similar functions, so they are named ZmTBF 1a and ZmTBF 1b respectively (Fig. 2).

Through further protein sequence comparison, it is found that the amino acid sequence consistency of ZmTBF1a and ZmTBF 1b proteins is very high, reaching 83.61%, but there is a big difference with the sequence of Arabidopsis thaliana TBF 1 protein, and the consistency is only 38.87% and 37.42%, respectively (Fig. 3A). Promoter, as an important regulatory region of gene expression, is very important for gene function. The promoters of A{TBF1, ZmTBF1a and

ZmTBF 1b genes are quite different, and the consistency is about 35% (Fig. 3B). However, there is a very consistent segment in the 5'-UTR region of ZmTBF 1a and ZmTBF 1b genes (Fig. 3C).

Il. UORF#"TBF1 element in maize can regulate the translation initiation of downstream genes

Through sequence analysis, it is found that ZmTBF 1a and ZmTBF1b contained an open reading frame similar to the sequence of uORF24"8% in the highly consistent sequence of 5'-

UTR region (Figs. 4A and 4B). Studies in Arabidopsis thaliana show that the function of TBF 1 depends on two phenylalanine-rich open reading frames (yORF17?F’ and uORF25F") upstream of its gene, but the function of uORF element in 5'-UTR region of maize Zm7BF1 gene is not clear. The retrieval results in different species show that tORF2™ is a widely existing conservative open reading frame (Fig. 4C). At present, it is not clear whether the functional diversity of YORF27?F7 is caused by sequence variation in the evolution process. Evolutionary analysis shows that the relationship between this element in maize and rice is close (Fig. 4D).

Previous studies have shown that an important function of ORF is to regulate the translation level of downstream genes. Therefore, the present invention amplified two uORF"TPF! elements and the corresponding ZmTBF1 promoter sequence from the DNA of maize B73 inbred line, and cloned them into the vector of dual luciferase reporter system by using the seamless cloning method (completed by the Clonexpress Ultra One Step Cloning Kit of Novozen Biotechnology Company) (Fig. 5A). At the same time, the function of uORF?"™5F1 is destroyed by introducing a mutant base (ATG mutated to CTG) into the primer (uORF27781 Fig. 5A). The primers constructed by the above vectors are shown in Table 1. These vectors are transiently transformed into maize protoplasts by PEG-mediated method, and the luciferase activity is determined. The results show that there is no significant difference in the expression level of downstream FLUC after the two VORF?7"72F mutations, but the expression level of relative enzyme activity, that is, protein level, has increased significantly (Fig. 5B-E). These results prove that these two UORF?"7PF7 in maize can inhibit the translation of downstream genes. The primers for gene expression detection are shown in Table 2.

Table 1 Vector construction primers for functional verification of UORF277BF7

Primer name Primer sequence 5-3’

Forward: tcctgcagcccgggggatccCATCGCCATCCATTTAAACATT (SEQ ID No.5)

ZmTBF1a-0800-uORF

Reverse: gtttttggegtcttccatggCCCTCGCCGCCGGCTATGTATA (SEQ ID No.6)

Forward: tcctgcagcccgggggatccGCTCGCTCGATCGTCCGCCCTT (SEQ ID No.7)

ZmTBF1a-0800-uorf

Reverse: gtttttggcgtcttccatggCTCTCGCTCGGCGCCGACGATT (SEQ ID No.8)

Forward: cgcctctactcccagGTAAGCGCCTGCGCCTGCGCCG (SEQ ID No.9)

ZmTBF1b-0800-uORF

Reverse: ggcgcaggcgcttacCTGGGAGTAGAGGCGGGCGGGT (SEQ ID No.10)

Forward: cgcctctactcccagGTAAGCGCCTGCGCCTGCGCCG (SEQ ID No.11)

ZmTBF1b-0800-uorf

Reverse: ggcgcaggcgcttacC TGGGAGTAGAGGCGGGCGGGT (SEQ ID No.12)

Table 2 Vector construction primers for functional verification of UORF2778F1

Primer name Primer sequence 5-3’

Forward: CGAGGTGGACATCACTTACG (SEQ ID No.13)

FLUC-qPCR

Reverse: CGAAATGCCCATACTGTTG (SEQ ID No.14)

Forward: CCTCGTGAAATCCCGTTA (SEQ ID No.15)

RLUC-qPCR

Reverse: GGAAACTTCTTGGCACCTTC (SEQ ID No.16)

lll. ZmTBF1 gene is induced by many maize pathogens

As a switch factor of growth and disease resistance transformation, the transcription and translation levels of Arabidopsis thaliana TBF 1 gene are strictly regulated. With the help of

PPRD (http://ipf.sustech.edu.cn/pub/plantrna/), the expression levels of ZmTBF 1a and

ZmTBF1b genes in public databases are analysed in this study. The results show that the expression of ZmTBF1 genes are maintained at a relatively low level in the roots, leaves and stamens of maize (Figs. 6A and 6B). However, when treated with maize pathogens (such as

Fusarium graminearum and Fusarium moniliforme causing ear rot and stem rot, Exserohilum turcicum causing leaf blight, Colletotrichum graminicola causing anthracnose, etc.), the expression of the two genes are increased significantly (Figs. 6C and 6D). Similar to the results in Arabidopsis thaliana, the expressions of ZmTBF 1s are also induced obviously under SA treatment (Figs. 6C and 6D). In addition, Iranian mosaic virus and some common corn pests, such as Spodoptera exigua, armyworm and aphid, can also induce the gene expression of

ZmTBF1, suggesting that Zm7BF1s are widely involved in the response of corn pests and diseases, and at the same time indicating that the promoter of this gene has the characteristics of pathogen-induced expression (Figs. 6C and 6D).

Rp1-D21 mutant is a lesion-like mutant caused by R gene recombination, showing broad- spectrum rust resistance. In the transcriptome data of public database, the expression of two

ZmTBF1 genes in Rp1-D21 mutants are increased significantly (Figs. 6E and 6F). Our research group collected several lesion-like mutants {/es) in the early stage, and sequenced the transcriptome of the materials with improved disease resistance. The results show that the expression of ZmTBF1 genes in these /es mutants are also increased significantly (Fig. SE).

The above results suggest that the promoters of ZmTBF1 genes are regulated by pathogen invasion, which leads to the increase of gene expression.

In order to further analyse the relationship between the gene and corn diseases, the present invention uses qRT-PCR method to detect the expression of ZmTBF 1 gene after inoculation of Puccinia polysora, the pathogen of southern corn rust, and Curvularia lunata, the pathogen of Curvularia leaf spot. The primers used are shown in Table 3. The results show that the inoculation of the two pathogens significantly induce the expression of ZmTBF 1a and

ZmTBF1b (Figs. 7A and 7B). In addition, the present invention has monitored the expression changes of ZmTBF1 gene and disease course related gene ZmPR1 for one week after corn is inoculated with Curvularia lunata. The results show that the expression of ZmPR1 gene is up- regulated 4 days after inoculation, and reaches the peak on the 6th day, while the expression of

ZmTBF1a and ZmTBF 1b genes reaches the peak on the 4th day, and then quickly recovers to the level before inoculation (Fig. 7C-E). Therefore, ZmTBF 1 genes are very sensitive to diseases.

Table 3 Quantitative primers of ZmTBF1 and ZmPR1 genes ~ Primername 0 Primersequence 5-3 zmTsriagecR | oard: TICGTGGTGTGGAAGCCC (SEQ ID No.17)

Reverse: ACATCTGCAGCGCCGTTG (SEQ ID No.18)

ZMTBE1b-gPCR Forward: CGCTCCTTCGTGGTGTGG (SEQ ID No.19)

Reverse: TSCGGCGTCGTTGACTTG (SEQ ID No.20)

ZmPR1-GPCR Forward: CGCGAGAGCCCCTACTAGAC (SEQ ID No.21

Reverse: AAATCGCCTGCATGGTTTTA (SEQ ID No.22)

IV. ZmTBF1 activates hypersensitivity and promotes the expression of immune response related gene ZmBiP2

When plant immune system is activated, it often causes hypersensitivity, leading to cell death to fight against the invasion of pathogenic bacteria. In order to verify the function of maize

ZmTBF 1s, the present invention constructs the constitutively over-expressing vector of this genome (Fig. 8B), and transiently transforms it into tobacco by Agrobacterium-mediated method. The results show that the overexpression of ZmTBF 1a and ZmTBF 1b led to obvious hypersensitivity phenotype (Fig. 8A), which indicate that ZmTBF 1 gene can activate the immune response. Previous studies have shown that Arabidopsis thaliana TBF 1 protein can bind to TL1 element of BiP2 gene promoter and participate in the immune response process of plants.

Sequence analysis showed that the promoter region of maize BiP2 homologous gene also contained a typical TL1 element. Therefore, the reporter system vector of ZmBiP2 promoter driven LUC is constructed and co-transformed into maize protoplasts with the overexpression vector of ZmTBF1 (Figs. 8B and 8C). See Table 4 for primers for vector construction. Because the overexpression of ZmTBF 1 will cause a strong hypersensitivity reaction, the enzyme activity of the reporter gene LUC is determined 8 hours after transformation. The results show that both

ZmTBF1a and ZmTBF 1b promote the expression of LUC gene driven by ZmBiP2 promoter (Fig. 80).

Table 4 Primers for ZmTBF1 overexpression and ZmBiP2 promoter report vector construction “Primer name ~~ Primersequence 5-3 mTBE1a.0E | OTWard: gelegggtaccoggggatccATGGGAGAAGCGGCCGCGGCCG (SEQ ID No.23)

Reverse: gtgtcgactctagaggatccATTCTCGCCGCCGCACCGGCCC (SEQ ID No.24) 2TBEb. OE Forward: gctegggtaccegggoatccATGGTGGAGGAAGGCGCCACCG (SEQ ID No.25)

Reverse: gtgtcgactctagaggatccATTCCCGCCGCCGCACCGCCCC (SEQ ID No.26)

ZmBiP2-0800- Forward: tcctgcagcccgggggatccCATGTACGTGCCAAACCCTCCTG (SEQ ID No.27)

LUC Reverse: gtttttggcgtcttccatggGGCCGACACCAGCACCACTTGA (SEQ ID No.28)

V. Cloning of ZmTBF1 gene promoter and VORF and construction of plant expression vector

The above experimental results show that the regulatory module composed of two ZmTBF1 gene promoters and vORF?"7?F! element can sensitively respond to plant diseases of maize (such as southern corn rust and Curvularia leaf spot), showing high application potential in balancing maize growth and disease resistance. Therefore, the regulatory module consisting of two ZmTBF1 initiators and uORF ZmTBF 1 sequences is cloned into the plant expression vector pCAMBIA3301 (Figs. 9-10). The primers for vector construction are shown in Table 5. In the subsequent application, Ncol and Pmll are used for double restriction enzyme digestion, and

GUS sequence in the vector is replaced by the sequence of disease-resistant gene between restriction enzyme digestion sites, so as to construct a plant expression vector containing pathogen induction module. The working mode of the pathogen-induced regulatory module is shown in Fig. 10.

Table 5 Primers for ZmTBF 1 overexpression and ZmBiP2 promoter report vector construction

Primername ~~ Primersequence 5-3

BFraasg | OMWard: algaccaigattacgaaticCATCGCCATCCATTTAAACATT (SEQ ID No.29)

Reverse: taccctcagatctaccatggCCCTCGCCGCCGGCTATGTATA (SEQ ID No.30)

TBE 1b. 3301 Forward: atgaccatgattacgaattcGCTCGCTCGATCGTCCGCCCTT (SEQ ID No.31)

Reverse: taccctcagatctaccatggCTCTCGCTCGGCGCCGACGATT (SEQ ID No.32)

It should be noted that when numerical ranges are involved in the present invention, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. Since the steps and methods adopted are the same as those of the embodiment, the preferred embodiment is described in order to avoid redundancy. Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these examples once they know the basic creative concepts. Therefore, the appended claims are intended to be interpreted as including the preferred embodiment and all changes and modifications that fall within the scope of the present invention.

Obviously, those skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention are within the scope of the claims and their technical equivalents, it is intended that the present invention also include these modifications and variations.

i Alum. overslon=T1.0" encoding=TUTF-Qn Tx 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST265equenceListing V1 3.dtd"> 3 <ST26Sequencelisting drdvVersion="NWL 37 fijlshName="Maize Module NL aml? sofiwaceName= “WIPO Sequence!" softwareVerszion="32,3.0" prochctionDate="2023~08-149>

A <ApplicentFileReferencs>Henan Agricultural University/ApplicantFileRefíerence> > <FariiestPricritvAppiicaticonidentification> 6 <IPOfficetoderCN</IPOfficeloder 7 <ApplicetionNumerTezt>202210674892.8/ArplicariornNumberText> 8 <FilingDate>»>2022-06-15</FilingDatex 3 </EarliestPriorityapplicationidentification»> <AppiicentName languagelode="en">Henan Agricultural University</ApplicantName>

Ld <ApplicantNamelatin>Henan Agricultural University</ApplicantNameLatin> 12 <InventorName languageCode="an®>60U Mingyue</InvantorName> 13 <IpventionTitle languagyeloede="san">Maize Dual Regulatory Module for Regulating the

Balance between Plant Growth and Disease Resistance</InventionTitlel 14 <JequanceTotalQuantity>32</SaquenceTataluantity> in “<SequenceData segusnceliNumec=NI"> ia <INSDSeq>

Lj <INSDSeq length>2000-</INSDSeg length> is ZINSDSegq molitypes>DNAC/INSDSeq moltyper> 1% <IN3DSeq divisior>PAT</INSDIeqg division» ay <INSDSeq feature-table>

AL <IN3DFesture> dd “INSDFeature keyvsource“/INSDFeature key> 23 <INSDFeature location>l..2000</INSDFeature location» 24 <INSDFeature quels» <INSDOualifier> 2a <IN3DQualifier name>mol type</INSDQualifisr name> 2 <INSDQualifiler valuerother DNA</INGDGualifier value» 28 </INSDQualifier> 2% <INSDQualifier id="gè*> 3G CINSDQualifisr namerorganism</INsSDQualifier name>

ZL <INSDQualifier value>synthetic construct «/INSDQualifier value» 32 </INSDQualifier> 33 </IN3DFeature guals> 34 </INSDFeatura> </INSDSeu feature-table>

SE <INSDSeq sequence catcgccatccatttaaacattgacataaaaaatgaagagctaaaattaaacgacttaatgttttaggatggag ggagtatatgtcgttggagagttctagaaacgccattctagacctetttgtactacagttatgtaaaaccataa cattcaaacagagtctgagctatttttgactgatgacgagccctaagtctatacataaacctccaatatatata gacgggttgagggttcaaagaccattactactaagtaatttgagttaagagaaagttaattgcgcactagtagt taaagacagctagatgaaattagacatcaagtcecgcctagtataaatacagtagtacaatccgecgtegtcagtg tgacggcatggtcgacgcgccggceggggetgegtgtgegtgtcaagcteggccecggccgatgatttcacttte ccggegcegtttegtgtgccgatcgacgaaaaagtccaagctttaatgatcgtggtagccagccatcttgtteg cacctacctcgaatctgtttttgttttggcacggagaagaaatgaaatcaacggctgatgaaagtaactactag aagttagtgataagttacgataattcaaagtagctagtacgtcagcttattattecgatctgactgcaagcatca tegatatcgacggcttgcacacacggtagctagtttcetttttttttcacttttegttttcaaagtccaagagt tttaaatttgecgecagegaagtttggetggegeggetgttgegegtacgtgtagggaaagggaagggatcagte atcagtgagagcactcacgcgcaggecgggegeggettetteggggteegeggaagegagatgtggacaaategg gggtgtgcegcaccgcagtggagtgcgacgagecgctccgagcacaagtccgegctecgegegegcattttccacg cgcctttgggtggtttactttctctcceggecgacggcgaggcaggcgccegccagegtcacaggtggtgacgag gcattcecggtgccgaggaggatccaaaggacagtcggttegtcctggegcggtcgagacgggcegggccctcect ccctectgtgcgtgggagccagccagccagccaggagcggcgggccccgecttgggecgagcgacgaattttcggg cgctttgacteggcteggctcacggctecctggatattggacgacaaagcggtggaagcttcttatttggaccgg ccgcgggccggctgcaaggaagagcggctgaaaggggtgggcgagctgactgectgagcatacgtaccegcgcga agaagcagacggaggtcatcacgctacccgegegtggccagtaccagacagactcctacctacactcagaaagc aagaagcccaacgccgaaagcaaccaccgegctggtetctegectgtgcegcecctegatcgcgcgtgaagagaa gccectcacttcegtcetccetcectgtectgtccagctaccceggccccgaccccgataaagccegccctttaaa tcggcggatcgaggcgatgagcgcetctecgcgacgccagggcggagagctagcecggccgggagcccacacgcag ctggaagcaccagaccgatcgtgccggccgagcggcggcgcaggcgcaggegcttacatgggagtagaggcggg cgggtgcgggcggagggecggtcgtcacegggttctacgtctggggctgggagttcectcacegccctcettetect tcteggcegecgtegecgccgcagactcctactagcaagctaccaaccttetttetttcattcccttaggtagc tcagccgtacacacaacaacacacaagtcatcagttactagctagttagtagcctatacaacacatacatacat acaaaggtgagtgaggttcgcgtgcaagcagagccaatcgtgccgatcgagctatatacatagccggcggcgag gg: /INSDSeq sequence» 37 </TNSDSeg> 38 </SeguenceDala> 38 <SequenceData seguencalDNumber="2n>» <INSDSeq>

41 <INSDSeq length>2000</INSDSeag length» 4% <INSDSeq moltype>DNA</INSDSea moliype> 42 <INSDSeq divislon»PAT</INSDSey division ad <IN3D3eq feature-table> 45 <INSDFeatura> 48 <IN3DFeature key>source</IN3DFeature key» 47 <INSDFeature location>1..2000</INSDFeature location» 43 <INSDFeature quals> 4% <IN3DQualifiers 54 <INSDQualifier name>mol type</INSDQualifier name> 51 <INSDQualifier value>other DNA</INSDQualifier valued 52 </INSDQualifier> 33 <INSDOQualifier id='gát> 54 <IN3DQualifier namerorganism“/INSDQuali fier name> 55 <INSDQualifier valuelsynthetic construct </INSDQualifier valued 58 </INSDOualiLfier»> 57 </INSDFeaturs guals> 58 </INSDFeature> 53 </INBDSeq feature-table> ai <INSDSegq sequenca> getegctegatcgtcegcccttatttagctagcggatgcagatgccagatgggtatgtttggttaaggtggttt ctegtctcattttgtgagttaacgactcattaatagatacttgattggtttgtatggtctatctataggataat gacttactgataaagaggagaggaataaacctaccagctttactgtggtagagactagcaccgtgcagtgaaaa aaaatataaggcaaacatcgaaattacgcttaactccattccactgtacattattacagttaagctatctgtgt ccgtgtagatgttggtcgggatgcacgegtgttcatggccctgtttgttteggcttctggcagecttctggccac caaaagctgctgeggactgccaaacattcagcttttcagccagcttctataaaattcattggggaaaaaccatc caaaatcaacataaacacataatcggttgagtcgttgtaatagtaggaatcecgtcattttctagatcctaagcc ctatgaacaattttatcttcctccagaaataatcataatgatactcagattctcgccacaaccagattectccte acagccagattttcagaaaagctggtcagaaaaaagctgaaccaaacaggccccatgtcaagcgagcctgaccg ctttagggctactttgggaacctgagatacaccttatgattaaatggtattgggatagaaataatgtaatttte tttctaatcetctttcaattttgaagtggatttaagtttccaaactagccttaagtgatcctcatggtggecggta gccaaacatcttgttcgcacctacctegaaccttttttttttggtttcacggagaagaaactaacaatggctgg tgaaattataggtatacacactatgatggctagctaagagtgcgatggatcaaagcagcacagcgtcagcegtca ccggcctactagattggactgcaagcatcatcgaccgtcgaccgacggegegtgegcectctetegttettegta gtcegagaatttcgecgtacgtgtagtagggacggacttegegtttgcccacccaccaccaacccatccaactte tgggttggggcgacgacgtccgtggaagcaagatgtggcgccgcagtgggagtgcaaacgagcgcgcaagccac cggtggtgggtctttgggttttctggaacgegcggactgcggccacggtacggtgecgcgcggacccaaaggaca ttcaactcgtcetecgaccgcgggaggegctegegegggccectettctgegtgeegtgcaccecgtcccaccgcga ggctaccaggccaggagcggcgggccccgctegegegcgacgatttttgactecggttcacggtgggaggggtac agggtegegcccactgccagctgtggaagecttctattcggaccggagcggctgaaagggcgagcatacgtacta acgtacgtataccgaagaaacacacaagactgacccgcgcgaagaaatagtcgcagctcacgctgccagacgaa agcaaccgcctegctggtctatcgcegcaaagccattccatcctttaaatcgcccgaggcgacggggcgagcga ctcatctccetccccagacaagcggcgacacgccagggcggagagcacacaccgaagcgggccgeggcggegge gcaggcgcaggcgcttacatgggagtagaggcgggcgggtgcgggcggagggcggtecgtgaccgggttctacgt ctggggctgggagttcctcaccgcccteectgetetteteggcegcegcegccgcegcagactcttactagctag ctagccacctettettcetcetccttgtaggtagtagtaggctacacaacaaccacatatatacatactaggta ctagcaggcgagcgagattcgtgcaataatcaaggcagccagttattaatagttaatcgtcggcgccgagcgag ag<“/INSDSeq sequences

GL </INSDS=eo> az </Seguencedata> aa <SequenceData sequence lDNumben="3%> ad <INSDSeq> <INSDSeag length»2928</INSDSeq length» ee <INSDSeq moltype>DNA</INSDSeg moltype» 67 <INSDSeq division>PAT</INSDSeg division»

Go <INSDSeq feature-table> ah <INSDFeature> <INSDFeature key>sourcec/INSDFeature key»

Fl <IN3DFeature location>l..292B</INSDFeature locaticn> ia <INSDFeature guals> 73 <INSDOualifien>

JA <INSDQualifier name>mol type“/INSDQualifier name>

Wes <INSDQualifier valuerother DNA</INSDQualifier value» 78 </INSDOualiLfier»> 7 <INSDQuelifler in="g5">

Te <INSDQualifier name>organism</iNSDQualifier name>

Fa <INS5DQualifier value>synthetic construct </IN3DQualifier value»

SD </INSDQuali fier» 5 </INSDFeature quals> 52 </IN3DFeature>

3% </INSDSeg feature-table>

G4 <INSDSeq sequences atgggagaagcggccgcggccgtggeggegtegaagaggggecggegggeeggegecgttectgaccaagacgea ccagatggtggaggagcggggcacggacgaggtgatctcgtgggcggagcagggcecgctcecttegtggtgtgga agccegtggagctggcgegegacctcctceegectccacttcaagcactgcaacttetcctcecttegtccgccag ctcaacacctacgtgagtacactacgcegcegctceggccatcatctcttectactacgatcgatgcaatatate acctgtecgtegtegtttagtgattgcaaaacacatacacttggtttcecgtattaaattaatcagctagctagct agatgategttctctgctctatgatctgttagttctgaagcatgttgttgttttegtectgtgctcgataaatta agctatgttatgtggtcgacgagcgagccttccaggcagctaccgtaccgtcttccaaggagtatatgegtgtg agcgtgtcacggttecgtaggaaggagtgecgtcagtcatgacacatctctaccaccctttaattcctttcccacg caaagcatgcttgtegtttcagagctagctgaagaggaatgacctgcgataacacttgaagattagggtgccgg tgcgggtctgaaattacacctgtgggtacgatcgtgatttagatagacgacttcacggatgtgattacaggagt ttttttttttectctacctgatctaaggccctgtttgggaacacagttttttcaaactgcagtttttcaaatact aaagtatactttagtcatgacattactacagtttacaatgcttcagttttcgaatacaacagtattcaatacat caaggtgtttgggaaaaactttggttgagaccaatcagccagagcgggaccaagctggcactctctttacagag aaaaactttggctgagaccaaagtttccaaaactgcaaaacaagtgcagtatttgcaatactacagtttagtat acagagatttcagatgagtttccaaacacctcaaagtatataataccacagtattgctcaatactacagtattg cttcaatactgcagaaaaactttgttcccaaacaccccctaaactgccatctectaactactatatatgtataga gcaaggtgcacggggaaattgaataagcaaagcaaatcaggtcggttgacacgccacggtattgtagtggcgac agaagcatggtattctatggaacagttaaggccctgtttgggaacaaagtttttgaaaaccacagtttttgaaa tactatactatactttagttatgacaataccgtagtttataataccgcagttttgaaaactgaggtccagagct aagtttagaatgccttaaaacaactatagtatttgcaatacttcagttttgaaaacagagattttacctagctt gccaaacaccattatgtatataatactgcagtatttgagaatactgcagtattcttccaaaactgcagaaaaac tttgttcccaaacaccccctaagaagctteggatggacgagcttttcagggctagctcttcetgegtggcctaca agaaggttaatttagctaggaattggatgctattagctgagcaagcaatataatcatccaaggcatccagcaag tatactaatcettttgttgcctettccatctattagctgggatacgaaatcgctcaagaaattgacttggaagtt aggatgatgatttaggccctgtttgtagtttctccaacagctagcttcataatttgtttttgttttttggctgg atagtattttccaaaatagcttcatggtatttggtaaagcttettetttttttetetctctcaagccaaaggaa agtgatgcagggatacgaatagctgaaacacgagtagcttattctagcgcagtcaaagattcacactgacttgg gttegttctcactgaaccttaatctattaatcagagggagagagagctagecttctctaaatcaatgtgtgaaca gctataaggcgttatctgaccatgtgagcgacgtatggtggtcaaagtagacaggcctgacgtgttcatttcgg cgtttgtttagggactggctgaataggacactgtgtcgaatgcagctcttgttetttttgcecgcattggatact tacgtcgacggcgaccatggcgcatgcgcatccatatccatgcagggtttccgaaaggtggtgccggaccggtg ggagttcgcgaacgacaacttccgtecgaggcgagcagggtctcctgtceggcatccgccgccgcaagtcaacgg cgctgcagatgtccaagtccggatccggcggcagcggecggecgtgaacgccacgttecccccegcctetgccccct ccgcectcecgegteggccaccacgtceggegtccacgagcgcagctegtegteggegtegtegccaccgcggge gccegacctggccagcgagaacgagcagctcaagaaggacaaccacacgctgtcecgccgagetggegcaggege gccggcactgecgaggagctcctgggettectetegegettcetecgacgtceggcagctcgacctecggetgete atgcaggaggacgtgcgagcgggggcaagcgacgacggcgcacagcgcecgecgegcacgcagtggccagccagct ggagcgcggcggcggcgaggaggggaagagcgtgaagctgttcggegtactcttaaaggacgccgcgaggaaga ggggccggtgcgaggaagcggcggccagcgagcggcccatcaagatgatcagggtcggcgagcegtgggtegge gteccgtegtegggccegggccggtgeggeggcgagaattaa/INSISeqy sequence </INSDSecp £4 </SeguenceData> 8% <SeguenceData semuenceIDNumber="gn> 85 <INSDSeq» 59 <INSDSeq lengch>3253</INSDSeg length»

EE <INSDSeq molitype>DNA</IN3DSeq moltype>

SL <INSDSeq division>PAT</INSDSeq divisicn>

DE <INSDSeq [eatureriabie> 32 <INSDFeaturer»

S94 <IN3DFeature key>source</IiN3DFeature key» 85 <IN3DFeature lowation»l..3253</INSDFeature location 36 <INSDFeature guals>

Sj <INSDOualifier>

G3 <INSDOQualifier name>mol type</INSDQualifier name>

Gh <INSDQualifler valverother DNA</INSDQualifier value» 100 </INSDOualifier> 101 <INSDOQualifier id="q8"> 142 <IN3DQualifier namerorganism</INSDQualifiesr name> 103 <INSDQualifier value>synthetic construct </INgDQualifier value» 104 </INSDQualifier> 10S </INSDFeaturs quals> 108 </IN3DFaature> 107 “/INSDSeqg fesature-table> 108 <IN3SD3eq sequence» atggtggaggaaggcgccaccgcggcggcgtcgaggagcgggcecggecgcegttcectgagcaagacgcaccagat ggtggaggagcggggcacggacgaggtgatctegtgggcggagcaaggccgetccttegtggtgtggaagcccg tggagctggegegcgacctcctccegctccacttcaagcactgcaacttctcctcectttgtcegccagctcaac acctacgtgagtactactacgtacactcctccatctatacatcatctgttetetgttcagttgatgactagact agatagctgcctcataaaacaaaggtctgetttggttecgatctgtgtgtgtgtettttgtttatgtccaacgaa actgatgggagaagaaagcctttcgaceggegtegtegtcagagagttgecgaacgtgegtgtgtggteggega gtctagaaaccttccacaaccttccgagagcgagcgaggagacgtacacgtaacgtaaggccgccggtcgaaac gtagaaactgagcaaggcggcggccagggettettecctttcettteecttgtgtegtttgtgcaacgacctggect atceggtttecegtttecceggtgtgtgtagtgtacccctacgcacgtagcacaacacctgtactacgccacctgte acctgtgtgacctttgcttcgagatgtacaacatggtacagcagacagtcaatcagagtacgcgtttaattagt agtataggaagtggtggettcattegtecctegtecgcgatacacctagcagcaacacgtacgcgcgcaaaaaggt gcetgcgactgcgaggtgggagctgtteccgtggaataagcaaagcaaagcaaagcaaattaggcgcgcgcctgac acgccacagcgttctagtgegectgeggtegattatcaatggaacagttaggaatectcaaggaagettegegeg cgtggatgagcctttetgggetettectatgegtgtggtetactactagaagetaatttagetaggaactgetgg acgtgtgtgtatatgctagcagctagctgaacaagcaatattatcatcgtccaatgcaaggcacccagcgaata tatatactgaccttttgttgcecttttagttgggctcagaaatcgggtcaataaataaattgattttgaagttag aatgaatgaatgggagatttattgtagccaaacaaccgaacatgcgcgcaagcgattgagtcttgtacggagac gcatgatgtgagtatgtgacgacgacttgcccactcccacagtcaaagcttcacacgcacagctggtttetttt tgttctcacceggtccatcatcattcaactattccatctatatagttagatggggagctagcttccgtgaataat gtctaaaaagaaaaagcgaaggcgacgcgcggtatctgacactgcgagcaacatgttctattcaaagtagtata ggtaacactgttagcaaaaaataattttaggagataggccaaaatatgtgttttagtttatagattctgcagtt cagagtttatataattctgaccttaaatgttcgtatagtaaaaaaactgtagtgectcgatccatgctgcatgca tgtttgetgtttacaattaataacttctttatttgaaatcgtttacagcctttaatattttttttaaaaaaaat tgtataggagatttgttttgttcaaaacgtacagagacacgcatcctatttcaaactttttaaaactttgtagt tacttttettttgtttcagttcatttattacccaagatatttagagteggtttggtttaggtcgtagctgtgaa aaaaaccattgtaagccgtgagttgtgaaaaaaaagatgttatgggctgtgagctgtttaaaattttaaaccat ttggtaggtagaacctactaaaagtcgttcaaagttctttcatatatatttttatggttgcatctgcaagctgc taaaaacaggtaaaaaacactttcaattttgcactcagagaaagtttgcttttagaaagaaaaaaaaaactggt ttcetegattcaggcctttaatatggcttttagcttttagggagcaaaaggcaaaaccaaaagtcaagctaaaca catacttattatctacaaaaaagtaacatactatatattgtagagaggtgecgaatectttgttaacctattactg tgtctggctecggaagatctaactaacctagacattgtgatggagccacggaggtggcgttgtgegtgtectcca ttaataaaacggtcaacaatgatttatttgctagtgcacgcctcacatgtaccgtataatatatcagggacgta tcaaatgtttactcatataagtacagatttgcacacgattttattcegtctctgaaattgtcgtcttagacaaa acaagaattggttaggggcctgcecgcctgecttaatgggacagtgatgaatgctgcacatttgatcacttttgce getgtttttttttagcatggatctgcattccacatttccacttacgtcgatggcgacaatccatgcagggttte cggaaggtggtgccggaccggtgggagttegcgaacgagaatttccggcgaggcgagcaaggcctcctgtccgg catcegtegccgcaagtcaacgacgccgcagccatccaagtacggcggcggcagcgtcgtgaacaccgegttce ctecgecgttgcccetteegcctccegegteggtcaccacgtectggcggtggecggtgcecggtggcgctggcaac gagcgcagctcctegteggcatcegtegcegccacggacagacgacctgaccagcgagaacgagcagctcaagaa ggacaaccgcacgctgtccaccgagctggcgcaggcgcegtcggcactgecgaggagctcctgggettcctetege gettcctegacgteccggcagctegaccttgggetgctcatgcaggaagacgtgcgagcgggtgccggtgacgac gcecgecgccgegcecgcgcaatggtcagccagctagagcgcggcggcgaggaggggaagagcgtgaagctgttcgg cgtactcctcacggatgccgcaaggaagagggcccggtgcgaggaggcggcggccagcgagcggcccattaaga tgatcagaatcggcgagccgtggatcggegtecegtecgtcgggcccggggcggtgcggcggcgggaattaa </INSDSeg sequencer 100 </INZDEeq> 116 </SaquenceData>

Lil “SequenceData seguencellNumber="587> iië <INSDSeqg> 113 <INSDSeg length>»42</INSDSeq length>

Lie <IN3DSeq moltype>DNA</INSDSeq moltyper

Lis <INSDSeq division>PAT</INSDSeg division»

LAE <INSDSeq feature-table>

LL? <IN3DFeature> iis <INSDFeaturs keyrsource</INSDFeaturs key 113 <INSDFeature locaction»l..42</INSDFeature location» 1E0 <INSDFeature guals> ini <INSDQqualifier> 122 <IN3DQualifier name>mol type“/INSDQuali fier name> 123 <INSDQualifier valuerother DNA</INSDQualifier value» 124 </INSDOualifier>

Lan <INSDQualifler ia="gij>

LES “INSDoualifier name>organism</INSDQualifier name> a <IN3SDQualifier value>synthetic construct </INBDQualifier value> ies </INSDOQuali fier 12% </INSDFsature guals> 130 </INSDFeature> 131 </ITNSDSey feature-tabhle> sd <INSDSeq sequsncerteetgeageccgggggatcccategecatccatttaaacatt “/INSDSeg samquence> 132 </INSDSeg> 124 </SeguenceData> 125 <SeguenceData semuenceIDNumber="6n> 138 <INSDSeq» 137 <INSDSeq length>42</INSD3eq lengths

RYE <INSDSeq molitype>DNA</IN3DSeq moltype>

13% <INSDSeq division>PAT</INSDSeq division» 140 <INSDSeq feature-iable> 141 <INSDFeaturer» 142 <IN3DFeature key>source</IiN3DFeature key» 143 <IN3DFeature lowation>l..42</INSDFeaturs location» 144 <INSDFeature guals> 145 <INSDOualifier> 146 <INSDOQualifier name>mol type</INSDQualifier name> 147 <INSDQualifisr valuerother DNA</INSDQualifier value» 148 </INSDOualifier> 143 <INSDOualifier id="qLär> 154 <IN3DQualifier namerorganism</INSDQualifiesr name> i151 <INSDQualifier value>synthetic construct </INgDQualifier value» 152 </INSDQualifier> 15% </INSDFeature quals> 1nd </IN3DFeature> u 135 “/INSDSeqg fesature-table> isa <IN3D3eq sequence»gtttttggegtettccatggccetcegcecgcecggctatgtata </INSDSeg zeguence> 157 </INSDSeq> 155 </SeguenceDaia> 150 <Sequencebata zedquencelDNumser=Win>

LEU <INS3DSeq> iel <“INSDSeqg length>42</INSDSeq Length> 16d <INSDSeq moltype>DNA</INSDSea moliype> az <INSDSeq divislon»PAT</INSDSey division iad <INSDSeq feature-table> 18h <INSDFeature>

Le6 <IN3DFeature key>source</IN3DFeature key»

Lo? <INSDFeature location»l1..42</INSDFeature location»

Len <INSDFeature quals> u

LEG <IN3DQualifiers

L7G <INSDQualifier name>mol type</INSDQualifier name>

LL <INSDOualifier valuesother DNA</INS3SDO0uelifier value» 172 </INSDOualifiers u 173 <INSDOualifier Ld=Ygldn> 14 <IN3DQualifier namerorganism“/INSDQuali fier name>

Lin <INSDQualifier valuersynthetic construct </INsDQualifier value» 178 </INSDOualiLfier»> 177 </INSDFeaturs duals? 178 </TNSDFeaturer 173 </INBDSeq feature-table>

LED <INSDSeg sequencertecetgcagcccgggggatcegctegetegategtecgccctt </INSDSeg seguencer

LR </INSDSeq»

LSL </Zequencebata> ies <SequernceData sequenceliNuec="S"> ls <INSDSeg> 185 <INSDSeq length>42</INSDSeq length> 188 <INSDSeq moltype>DNA-/INSDSeg moltype> ig ZINSDSeq division>PAT</INSDSeq division» i188 <INSDSeq feabure-table>

TRG <INSDFeature>

Lal <INSDFeature key>source</INSDFeature key> iel <INSDFeature location>l..42</INSDFeature locations 19d <INSDFealurse guals> inl <INSDOQualifier» 154 <IN3DQualifier namedmol type</INSDQualifisr name> 1585 <INSDQualifier value>other DNA</IN3DGualifier value> 198 </INSDQuali fier»

La <INSDQuaiifier id="gië’x>

Ls <INSDQualifier namerorganism</INSDQualifier name>

AGS <INSDOualifier value>synthetic construct </INSDQuali fier value>

ZON </INSDOualifier> 201 </IN3DFeature guala> 202 </THSDFeatura> u 2073 </INSDSeg featurs-tablied 204 <INSDSeg sedquencezgtttttggegtettccatggetctegctecggegccgacgatt </INSDSeg sequence> ws </INSDSear>

ZOE </SaguenceData> 207 “SequenceData seguencelóNumbec=NB%> 208 <INSDSeg> 20% <INSDSeg length>»37</INSDSeq lengths» 216 <IN3DSeq moltype>DNA</INSDSeq moltyper 214 <INSDSeq division>PAT</INSDSeg division

Zi <INSDSeq feature-table> “iS <INSDFeature>

Fd <INSDFeaturs keyrsource</INSDFeaturs key» 215 <INSDFeature locaction»l1..37</INSDFeature location» zin <INSDFeature guels> 217 <INSDQualifiar> 248 <IN3DQualifier name>mol type“/INSDQuali fier name>

Zhe <INSDQualifier valuerother DNA</INSDQualifier value»

ZE «</INSDOQualifier»>

Al <INSDQualifler ia="gig>

HEE <INSDQualifier name>organism</INSDQualifier name> 222 <INSDQualifier value>synthetic construct </INBDQualifier value> 224 </THNSDOQualifiar> 225 </INSDFesature duals» 224 </INSDFeature> 227 </INSDSeg feacture-taebhle>

Ed “INSDSeq sequsncevegectetactcccaggtaagegeectgegeetgegeeg“/INSDSeqg sequencer

Zen </INSDSeg>

ZEN </Seguencedata> 221 <SequenceData seguencelDihumber="107> 222 <INSDSeq> 233 <INSDSeq Leng:th>37</IN5DSeq length 2734 <INSDSeq moltype>DNA</INSDSeg moltyper 235 <INSDSeg division>PAT</INShIeqg division» as <INSDSeq feature-table> 257 <INZDFeature> 238 <INSDFeature key>sourcec/INSDFeature key» 223 <INSDFearure location>l..37</INSDFeature location» 240 <INSDFeature guals> 244 <INSDOualifien> 242 <INSDQualifier name>mol type</INSDQualiifier name> 243 <INSDQualifier valuerother DNA</INSDQualifier value» aad </INSDOualiLfier»> 245 <INSDQualiifler id="g29'>

Zan <INSDQualifier name>organism</iNSDQualifier name> 247 <INS5DQualifier value>synthetic construct </IN3DQualifier value» 248 </INSDQuali fier» 24% </INSDFearure quals> 250 </INSDFeature>

ZR </INSDSeg feature-table> zel “INSDSeq sequsncerggegcaggegettacctgggagtagaggecgggegggt/INSDSeq sequsrnce> 253 </TNSDSeg> 254 </SeguenceData> 255 <SeguenceData soquencelDNunmbery="11"> 256 <INSDSeg> 25% <INSDSeq length>37</INSD3eq lengths 203 <INSDSeq molitype>DNA</IN3DSeq moltype> we <INSDSeq division>PAT</INSDSeq divisicn>

Ze <INSDSeq [eatureriabie> 251 <INSDFeaturer» 262 <IN3DFeature key>source</IiN3DFeature key» 263 <IN3DFeature lowation>l..37</INSDFeaturs location» 264 <INSDFeature guals> 28% <INSDOualifier>

SEE <INSDOQualifier name>mol type</INSDQualifier name> wi <INSDQualifisr valuerother DNA</INSDQualifier value»

FESR </INSDOualifier> 263 <INSDQualifier id="q22"> zin <IN3DQualifier namevorganism“/INSDQualifier name> 271 <INSDQualifier value>synthetic construct </INgDQualifier value»

Zz </INSDQualifier>

SEE </INSDFeature quals> wid </IN3DFeature>

Zin “/INSDSeqg fesature-table> 27a <IN3D3eq sseguencercgectctacteccaggtaagegectgegeectgegeeg</INSD3eq sequence 277 </INSDSegqs 7 278 </SeguencaData> 273 <SequenceData zaquencalDNumber="3i2%> 280 <INSDSeq> 281 <INSDSeq length>37</INSD5eq length» abd <INSDSeq moltype>DNA</INSDSeg moltype>

ZE3 <INSDSeq divislion»PAT</INSDSeqg division»

Zod <INSDSeq feature-table> 288 <INSDPsaturer 288 <IN3DFeature key>source</IN3DFeature key> 287 <IN3DFeature location>1..37</INSDFeature location 288 <INSDFsature qualsg>

Zie <INSDQualifier> el <INSDoualifier name>mol type“ /INSDQualifier name> dai <INSDQualifisr value>other DNA</INSDQualifier valuer 232 </INSDQualifier> 282 <INSDOualifier id="q24'> 234 <IN3DQualifier name>organism</INSDQualifisr name> 285 <INSDQualifiler valuersynthetic construct </INSDDualifier valued ze «</INSDOQualifier»> wad </THSDFeaturs guals> 238 </INSDFeatures 233 </IN3DSeqg feature-table> 200 <INSDSeq sequence>ggegcaggegettacctgggagtagaggegggegggt/iNSDieq sequence 301 </INSDSeq> 302 </SeguenceDaia> 305 <SeguenceDbata zecgvuencelDNumser="ijNs» 304 <INS3DSeq> sos <“INSDSeqg length>20</INSDSeq Length> 308 <INSDSeq moltype>DNA</INSDSea moliype> 307 <INSDSeq division»PAT</INSD3ea division” 208 <IN3D3eq feature-table> 308 <INSDFeatura> 310 <IN3DFeature key>source</IN3DFeature key»

FAL <INSDFeature location»l1..20</INSDFeature location>

SL <INSDFeature quals> u

SLS <IN3DQualifiers 314 <INSDQualifier name>mol type</INSDQualifier name> 315 <INSDOualifier wvalue>other DNA</INSDCualifier value» èië </INSDQualifier> u 247 <INSDOualifier ld='g2s"> 348 <IN3DQualifier namerorganism“/INSDQuali fier name>

ERE <INSDOualifier valuersynthetic construct </INsDQualifier value»

SED </INSDOualiLfier»>

IZ </INSDFeaturs guals> ize </INSDFearure:»> 223 </INBDSeq feature-table> 224 ZINSDSeq seguencsregaggtggacatcacttacg“/INSDSey sequenae> 325 </INSDSeg> 326 </SegusnceData»> 327 <Sequencebata seguengsiiNuombar="ig49s

SEE <INSDieg>

SZ “INSDSeq length>19</IN3DSeq Length> 230 <INSDSeq moltype>DNA</INSDSeq moltype> 221 <IN3DSeq division»PAT</INSD3eq division» 332 <INSDSeq fearure-tabier 333 <INSDFeabture> 334 <INSDFeature key>source</INIDFeature key> 355 <INSDFeature location>l..19</INSDFeature location> 336 <INSDFeature qguals> u 337 <INSDQualifier»> 338 <INSDQualifier name>mol type</iNSDQualifier name> 233 <INSDuuelifier value>other DNA</INSDOualifier valuex 340 </INSDQualifisr> u 341 <INSDQualifier id='"g28"x> 34D <INSDQualifier namerorganism</INSDQualiifier name>

BAS <INSDQualifier valuersynthetic construct

</INSDQualifisn values» 344 </INSDOualifier> 345 </IN3DFeature gualsd 245 </INSDFeature> u 247 </INSDSeg features table» 345 <IN3DSeqy segvencs>cgaaatgcccatactgttg:/INSDSeq sequences 340 </INSDSeg> 350 </Zequencebata>

SDi <SequenceData seqvencelIDNumec=M5'>

ILE <INSDSeqg> 252 <INSDSeq length>18</INSDSeq length> 25d <INSDSeq moltype>DNA-/INSDSeg moltype> 255 ZINSDSeq division>PAT</INSDSeq division» 358 <INSDSeq feabure-table> 357 <“INSDFesrure»> 356 <INSDFeature key>source</INSDFeature keys

SDE <INSDFeature location>l..18</IN3DFeature locations

IGG <INSDFealurse guals>

Ssi <INSDOQualifier» 262 <IN3DQualifier name>mol type“/INSDQualifier name> 2683 <INSDUvaelifier valuerother DNA</INSDGualifier value> 354 </INSDOuali fier» u 355 <INSDQuaiifier id="g3x>

KI <INSDQualifier namerorganism</INSDQualifier name> 387 <INSDQualifisr value>synthetic construct </INSDQuali fier value» 368 </INSDOualifier> 285 </IN3DFeature guala> arn </THSDFeatura> u 37 </INSDSegy featurs-table>

ZEE <INSDSeq sequencercetegtgaaatccegtta/INSDSeg sequence»

SUS </INSDSeg> 374 </SequenceData>

REN <SequenceData segusnceliNumec=MNLö®> 374 <INSDSeq>

RA <IN3DSeq length»20</INSDSeq length»

Iie ZINSDSegq molitypes>DNAC/INSDSeq moltyper> 379 <INSDSeag divisior>PAT</INSDIeqg division» 380 <INSDSeq feature-table> 3&1 <INSDFeature>

SG <INSDFeaturs keyrsource</INSDFeaturs key> 355 <INSDFeature location>l..20</IN3DFeature location» sed <INSDhFeature quels» 285 <INSDQualifier> 288 <IN3DQualifier name>mol type</INSDQualifisr name> 287 <INSDQualifler valuerother DNA</INSTGualifier value» 385 <{INSDQualifier»

IEG <INSDQualifier ia=stgldvs

SG <INSDoualifier namerorganism</INsSDQualifier name>

ESC <INSDQualifier value>synthetic construct </INSDQualifier value 252 </THSDOualifier> 2383 </INSDFeature guals> 194 </INSDFeaturs> 385 </INSDSeu feature-table> 3GE <INSDSeq sequance>ggaaacttettggecacctte</INSDSeq sequences 347 </IN3SDSaq> 308 </SaquenceData> 393 <Sequencelata sequenceliNumber="17"> 4010 <INSDSeg>

ZOL <INSDSeg length>18</INSDSeq length> 402 <IN3DSeq moltype>DNA</INSDSeq moltyper 4073 <INSDSeq division>PAT</INSDSeg division 404 <INSDSeq feature-table> 405 <INSDFeature> 408 <INSDFeaturs keyrsource</INSDFeaturs key» 4047 <INSDFeature locaction»1..18</INSDFeature location» 408 <INSDFeature guels> 400 <INSDQualifiar> 410 <IN3DQualifier name>mol type“/INSDQuali fier name> 440 <INSDQualifier valuerother DNA</INSDQualifier value» 412 </INSDOualifier>

413 <INSDQualifler ia="gs4> 414 <INSDQualifier name>organism</INSDQualifier name> 415 <IN3SDQualifier value>synthetic construct </IN3DQualifier value> aia </INSDQuali fier» u 417 </INSDFesature duals» 415 </INSDFeature> 41% </INSDSeg feature-tabhle> 420 <INSDSeq segquance>ttegtggtgtggaagece«</IN3DSeay sequenaa> del </INSDSeg> azz </Seguencedata> 422 <SequenceData semiencelDNumber="igN> 424 <INSDSeq> 42% <IN3DSeqy Leng:th>18</IN5DSeq length 226 <INSDSeq moltype>DNA</INSDSeg moltype»

A27 <INSDSeq division>PAT</INSDSeg division»

A45 <INSDSeq feature-table> 470 <INZDFeature> 4540 <INSDFeature key>sourcec/INSDFeature key» 421 <INSDFearure location>l..18</INSDFeature location» 422 <INSDFeature guals> 433 <INSDOualifier> 4734 <INSDQualifier name>mol type</INSDQualiifier name> 435 <INSDQualifier valuerother DNA</INSDQualifier value» 456 </INSDOualifiers 437 <INSDQualiifler id="g38r> 458 <INSDQualifier name>organism</iNSDQualifier name> 453 <INS5DQualifier value>synthetic construct </IN3DQualifier value» 440 </INSDQuali fier»

A471 </INSDFeature quals> 44% </IN3DFeature> 445 </INSDSeg feature-table> 444 <INSDSeq sequenceracatetgecagegeegttg</INSDSay zeguencex> £45 </INEDSey> 444 </SeguenceData> 447 <SeguenceData soquencelDNunmbey="18"> 4485 <INSDSedg> 440 <INSDSeq length>18</IN3SD3eq lengths

A450 <INSDSeq molitype>DNA</IN3DSeq moltype> 451 <INSDSeq division>PAT</INSDSeq division» 45% <INSDSeq feature-iable> 452 <INSDFeaturer» 454 <IN3DFeature key>source</IiN3DFeature key» 455 <IN3DFeature lowation>l..18</INSDFeaturs location» 458 <INSDFeature guals> 457 <INSDOualifier> 453 <INSDOQualifier name>mol type</INSDQualifier name> 45% <INSDQualifisr valuerother DNA</INSDQualifier value» 460 </INSDOualifier> 461 <INSDOualifier id="q38%> 4982 <IN3DQualifier namerorganism</INSDQualifiesr name> 4a3 <INSDQualifier value>synthetic construct </INgDQualifier value» 484 </INSDQualifier> 455 </INSDFeature quals> 48E </IN&DFeaturer 467 “/INSDSeqg fesature-table> 468 <IN3D3eq seguencercgeteccttegtggtgtgg</INSDSey sequence 449 </INSDSeq> 7 470 </SeguencaData> 470 <SequenceData zagquencalDNumber=n20">

AE <INSDSeqr

AUS <INSDSeq length>18</INSD5eq length» 474 <INSDSeq moltype>DNA</INSDSeg moltype> 475 <INSDSeq divislion»PAT</INSDSeqg division» 478 <INSDSeg feature~tablex 4771 <INSDPsaturer aia <IN3DFeature key>source</IN3DFeature key> 47% <IN3DFeature location>»l..18</INSDFeaturs locations 480 <INSDFsature qualsg> 4371 <INSDuuelifier>

AE <INSDoualifier name>mol type“ /INSDQualifier name> 453 <INSDQualifisr value>other DNA</INSDQualifier valuer 484 </INSDOualifier> 485 <INSDOualifier id="gqga0"> 48a <IN3DQualifier name>organism</INSDQualifisr name> 387 <INSDQualifiler valuersynthetic construct </INSDDualifier valued

AEB </INSDOualifier> 4% </THSDFeaturs guals> 440 </INSDFeature> 433 </IN3DSeqg feature-table> 432 <IN3DSeq sequence>tgeggegtegttgacttg“/INSDSeg sequenced 433 </TNSDSeg> 393 </SeguenceDala> 48% <Sequencebata zedgvuencelDNumser="2iNs» 408 <INSDSeq> 447 <INSDSeq length>20</INSDSeq lengths 408 <INSDSeq moltype>DNA</INSDSea moliype> 4973 <INSDSeq divislon»PAT</INSDSey division 500 <INSDSeq feature-table>

DOL <INSDFeature>

DOE <IN3DFeature key>source</IN3DFeature key» 5073 <INSDFeature location»l1..20</INSDFeature location>

S04 <INSDFeature quals> u

S05 <IN3DQualifiers

S08 <INSDQualifier name>mol type</INSDQualifier name>

S07 <INSDOualifier wvalue>other DNA</INSDCualifier value» 508 </INSDQualifier> u 50% <INSDOualifier Ld=Ygd2n> 510 <IN3DQualifier namerorganism“/INSDQuali fier name>

SEA <INSDOualifier valuersynthetic construct </INsDQualifier value»

SLE </INSDOualiLfier»>

S13 </INSDFeaturs guals>

Sid </TNSDFeaturer 518 </INBDSeq feature-table>

RES ZINSDSeq sequencsregegagagcccctactagac-/INSDSey sequenaes 517 </INSDSeg>

SLB </SegusnceData»>

SLO <SequenceData zegvencelnNumer="24">

Det <INSDieg>

DEL <INSDSeq length>20</IN3DSeq length» se <INSDSeq moltype>DNA</INSDSeq moltype> 522 <IN3DSeq division»PAT</INSD3eq division» bid <INSDSeq fearure-tabier

B25 <INSDFeabture>

REA <INSDFeature key>source</INIDFeature key>

Era <INSDFeature location>l..20</INSDFeature location>

DEG <INSDFeature qguals> u

LER <INSDQualifier»>

S330 <INSDQualifier name>mol type</iNSDQualifier name>

Sal <INSDuuelifier value>other DNA</INSDOualifier valuex 532 </INSDQualifier> u 533 <INSDQualifier Ld=Vgdadn> 234 <INSDQualifier namerorganism</INSDQualiifier name>

SRE <INSDQualifier valuersynthetic construct </INSDguali fier values» 5368 </INSDOualifier> 537 </IN3DFeature gualsd 228 </INSDFeature> u 539 </INSDSeg features table» 540 <INSDSeg seguencs>aaategectgcatggtttta-/INSISeq sequenced

SAL </INSDSeg>

DAL </Zequencebata>

TAZ <SegquenceData seguoancelDNungbhao="237%>

Sá <INSDSeg> 545 <INSDSeq length>42</INSDSeq length>

Sdn <INSDSeq moltype>DNA-/INSDSeg moltype>

Ha ZINSDSeq division>PAT</INSDSeq division» 545 <INSDSeq feabure-table> sao <“INSDFesrure»>

DRO <INSDFeature key>source</INSDFeature key>

IIL <INSDFeature location>l..42</INSDFeature locations

DIE <INSDFealurse guals> 353 <INSDOQualifier» 554 <IN3DQualifier namedmol type</INSDQualifisr name> 555 <INSDUvaelifier valuerother DNA</INSDGualifier value> 556 </INSDQualifier» u 557 <INSDguelifier id="ga8">

SRE <INSDOQualifier namerorganism</INSDQualifier name>

SEG <INSDQualifisr value>synthetic construct </INSDQuali fier value»

Ban </INSDOualifier> 581 </IN3DFeature guala> bez </THSDFeatura> u 563 </INSDSeg featurs-tablied

So <INSDSeg sedquencerzgetegggtacccggggatccatgggagaagcggccgcggceg </INSDSeg sequence>

Des </INSDSear>

LEE </SaquenceData> 5657 “SequenceData seguencellNunber="247>

B68 <INSDSeg> bas <INSDSeg length>»42</INSDSeq length> bij <IN3DSeq moltype>DNA</INSDSeq moltyper

SEL <INSDSeq division>PAT</INSDSeg division»

Did <INSDSeq feature-table>

RI <INSDFeature>

Sid <INSDFeaturs keyrsource</INSDFeaturs key 575 <INSDFeature locaction»l..42</INSDFeature location»

Sin <INSDFeature guels> 57 <INSDOQualifier> 578 <IN3DQualifier name>mol type“/INSDQuali fier name>

Sis <INSDQualifier valuerother DNA</INSDQualifier value»

S&D «</INSDOQualifier»>

Sel <INSDQualifler ia="gs8>

L587 <INSDQualifier name>organism</INSDQualifier name>

S83 <IN3SDQualifier value>synthetic construct </INBDQualifier value> 584 </INSDOQuali fier

HES </INSDFesature duals» 586 </INSDFeature> 557 </INSDSeg feature-tabhle>

LEG <INSDSeq sequencergtgtecgactctagaggatccattctcgccgcecgcaccggcce “/INSDSeg saquences

SED </INSDSeg> 530 </SeguenceData> 531 <SeguenceData soquencelDNunmbey="28">

DSZ <INSDSedg> 583 <INSDSeq length>42</INSD3eq lengths 284 <INSDSeq molitype>DNA</IN3DSeq moltype>

Den <INSDSeq division>PAT</INSDSeq divisicn>

S48 <INSDSeq feature-iable> 537 <INSDPFSsarure:» 538 <IN3DFeature keyrsource</INSDFeature key> 539 <IN3DFeature lovation>l..42</INSDFeature Locations»

SD <INSDFeature guals>

SO <INSDOualifier>

SoL <INSDQualifier name>mol type</INSDQualifier name>

G03 <INSDQualifler valverother DNA</INSDQualifier value»

Eid </INSDOualifier>

S05 <INSDOualifier id="qB0%> aia <IN3DQualifier namerorganism</INSDQualifiesr name> aid <INSDQualifier value>synthetic construct </INgDQualifier value»

S05 </INSDQualifier> 505 </INSDFeature quals> £10 </IN3DFeature> u

GLi “/INSDSeqg fesature-table> sle <iNSD5ed sequence»getegggtacccggggatccatggtggaggaaggcgccaccg </INSDSeg zeguence> £13 </TNSDSeq> old </SeguenceDaia> ais <Sequencelata zaguencesIDNurber="28Y>

GLE <INS3DSeq>

CLT <INSDSeq length>42</INSDSeq lengths

GLa <INSDSeq moltype>DNA</INSDSea moliype>

S13 <INSDSeq division»PAT</INSD3ea division”

AEN <INSDSeq feature-table>

Aal <INSDFeature> 222 <IN3DFeature key>source</IN3DFeature key»

S273 <INSDFeature location»l1..42</INSDFeature location>

Gzá <INSDFeature quals> u

Cal <IN3DQualifiers

S98 <INSDQualifier name>mol type</INSDQualifier name> s27 <INSDOualifier wvalue>other DNA</INSDCualifier value» 428 </INSDQualifier> u 529 <INSDQualifier ld="g82"> 430 <INSDQualifier namerorganism“/INSDQuali fier name>

S3l <INSDQualifier valuersynthetic construct </INsDQualifier value»

SS </INSDOualiLfier»> 633 </INSDFeaturs guals> 534 </INSDFeature»

A25 </INBDSeq feature-table> 434 <INSDSeg sequencergtgtegactctagaggatccattcccgccgcecgcaccgccce </INSDSeg seguencer 837 «/INSDSeg> 635 </Zequencebata>

C3 <SegquenceData seguoancelDNungbhao="27F%>

Gail <INSDSeqg>

Gal <INSDSeq length>42</INSDSeq length>

L442 <INSDSeq moltype>DNA-/INSDSeg moltype> ada ZINSDSeq division>PAT</INSDSeq division» sad <INSDSeq feabure-table> oa <INSDfeasture>

GAL <INSDFeature key>source</INSDFeature key>

Cad <INSDFeature location>l..42</INSDFeature locations

GAS <INSDFealurse guals>

S473 <INSDOQualifier»

ARG <IN3DQualifier namedmol type</INSDQualifisr name> ahi <INSDUvaelifier valuerother DNA</INSDGualifier value> 852 </INSDOuali fier» u 555 <INSDQuaiifier id="gBd4x>

E04 <INSDOQualifier namerorganism</INSDQualifier name>

NN <INSDQualifisr value>synthetic construct </INSDQuali fier value»

Sha </INSDOualifier> 457 </IN3DFeature guals> aha </THSDFeatura> u 85% </INSDSeg featurs-tablied

Sol <INSDSeg sedquencerteetgcagcccgggggatccatgtacgtgccaaaccctcctg </INSDSeg sequence>

Sel </INSDSear>

GEZ </SaguenceData>

S62 <Sequencelata seguencellNunber="287> aad <iNSDSieg> anh <INSDSeg length>»42</INSDSeq length> 506 <IN3DSeq moltype>DNA</INSDSeq moltyper ae <INSDSeq division>PAT</INSDSeg division

LOB <INSDSeq feature-table>

CES <INSDFeature>

CG <INSDFeaturs keyrsource</INSDFeaturs key» 87 <INSDFeature locaction»l..42</INSDFeature location»

A72 <INSDFeature guels> 373 <INSDOQualifier> did <INSDQualifier name>mol type“/INSDQuali fier name>

Sis <INSDQualifier valuerother DNA</INSDQualifier value»

GPE </INSDOualifier> add <INSDQualifler ia="g58%>

Ss “INSDoualifier name>organism</INSDQualifier name> 573 <INSDQualifier value>synthetic construct </INSDOQualifier values an </INSDOQuali fier u

SS </INSDFesature duals»

SBL </INSDFeature>

GES </INSDSeg feature-tabhle>

Coa <INSDSeq sequence>gtttttggegtettecatggggecgacaccagecaccacttga “/INSDSeg saquences 585 </TNSDSeg> 488 </SeguenceData>

SET <SeguenceData sequencelDNumber="28"> aus <INSDSedg> osn <INSDSeq length>42</INSD3eq lengths

GR <INSDSeq molitype>DNA</IN3DSeq moltype>

Cul <INSDSeq division>PAT</INSDSeq division»

Go <INSDSeq [eatureriabie> 592 <INSDFeaturer»

Lhd <IN3DFeature key>source</IiN3DFeature key» 435 <IN3DFeature lovation>l..42</INSDFeature Locations» 436 <INSDFeature guals>

AGF <INSDOualifier>

E43 <INSDOQualifier name>mol type</INSDQualifier name>

Son <INSDQualifler valverother DNA</INSDQualifier value»

FOG </INSDOualifier>

Tal <INSDOualifier id="qB8%>

FOZ <IN3DQualifier namerorganism</INSDQualifiesr name>

Ta <INSDQualifier value>synthetic construct </INgDQualifier value»

TOA <{INSDQualifier»

TOL </INSDFeature quals> 708 </IN3DFeature> u 707 “/INSDSeqg fesature-table>

GOs <IN3D3eq segquenceratgaccatgattacgaattccatcgccatccatttaaacatt </INSDSeg zeguenced

ERR </TNSDSeg>

TAD </Seguencehata

TAL <Sequencelata soguenceibDNunber="30">

Fin <INSDSeq>

LS <“INSDSeqg length>42</INSDSeq Length>

TA <INSDSeq moltype>DNA</INSDSea moliype>

Tis <INSDSeq divislon»PAT</INSDSey division

Tin <INSDSeq feature-table>

TE <INSDFeature>

TAR <IN3DFeature key>source</IN3DFeature key»

TAG <INSDFeature location»l1..42</INSDFeature location>

VEO <INSDFeature quals> u

EL <IN3DQualifiers

TED <INSDQualifier name>mol type</INSDQualifier name>

TEE <INSDOualifier wvalue>other DNA</INSDCualifier value»

Tod </INSDQualifier> u jah <INSDOualifier id='gs0"> jad <INSDQualifier namerorganism“/INSDQuali fier name>

Tay <INSDOualifier valuersynthetic construct </INSDOQualifier values

TEE </INSDOualiLfier»>

ZS </INSDFeaturs duals?

TIN </TNSDFeaturer

Fad </INBDSeq feature-table>

GRR <INS3D3eq seduencertaccctcagatctaccatggccctegccgceggctatgtata </INSDSeg zeguence>

TY «/INSDSeg> 734 </SequenceData> ss <Sequancelata segueancellMNunbar="31> 738 <INSDSeg>

FEY <INSDSeq length>42</INSDSeq length> 358 <INSDSeq moltype>DNA-/INSDSeg moltype>

EEE ZINSDSeq division>PAT</INSDSeq division»

TAD <INSDSeq feabure-table>

Fa <INSDhreature> dan <INSDFeature key>source</INSDFeature key>

JAS <INSDFeature location>l..42</INSDFeature locations

Fad <INSDFealurse guals>

Tan <INSDOQualifier»

Fda <IN3DQualifier namedmol type</INSDQualifisr name>

Ta <IN3DQualifier valuevother DNA</INSDGualifier value»

TAR </TNSDOQuali fier

TAD <INSDQuaiifier id='qgsi"x>

TRG <INSDOQualifier namerorganism</INSDQualifier name>

TIL <INSDQualifisr value>synthetic construct </INSDQualifier values 752 </INSDOualifier> 752 </INSDFeature gvals>

TRA </INSDFeaturer

THEY </INSDSeg featurs-tablied

ThE <INSDSeq seguencezatgaccatgattacgaattegctcgctegategtcegcectt </INSDSeg sequences

TET </INSDEagr

Ja </SaguenceData> 753 “SequenceData sequenceliNunber="32%>

TAD <INSDSeg>

Tal <INSDSeg length>»42</INSDSeq length>

Tan <IN3DSeq moltype>DNA</INSDSeq moltyper 763 <INSDSeq division>PAT</INSDSeg division»

Ted <INSDSeq feature-table>

TEE <INSDFeature>

TES <INSDFeaturs keyrsource</INSDFeaturs key

TE <INSDFeature locaction»l..42</INSDFeature location» 748 <INSDFeature guels>

TAS <INSDQualifiar>

TO <IN3DQualifier name>mol type“/INSDQuali fier name>

TEL <INSDQualifier valuerother DNA</INSDQualifier value»

FEE </INSDOualifier>

TA <INSDQualifler ia="gs4>

FFA <INSDQualifier name>organism</INSDQualifier name>

FIR <IN3SDQualifier value>synthetic construct </IN3DQualifier value

TIA </THNSDOQualifiar> u

Tij </INSDFesature duals»

TER </INSDFeature>

TG </INSDSeg feature—-table>

Tal <INSDSeq sequence>taccctcagatctaccatggetetegeteggegecgacgatt “/INSDSeg saquences

JEL </INSDSeo> 782 </SeguenceData>

Tea </&T26SeguencelListing>

Claims (4)

CONCLUSIONS 1. Application of a maize dual regulatory module to regulate the balance between plant growth and disease resistance, where: — the maize dual regulatory module contains a promoter of the ZmTBF1a gene and its UORF sequence, namely pZmTBF 1a: uUORFZmTBF 1a, of which the nucleotide sequence is shown in SEQ ID No.1; — the maize dual regulatory module also includes a promoter of the ZmTBF1b gene and a UORF sequence, namely pZmTBF1b: YORF?"73F1°, shown in SEQ ID No.2; — the use of connecting ZmTBF 1a downstream of pZmTBF 1a : UORFZ"78F12 and of ZmTBF1b downstream of pZmTBF1b: uORF?"78F%%; wherein the nucleotide sequence of ZmTBF1a is shown in SEQ ID No.3 and the nucleotide sequence of ZmTBF1b is shown in SEQ ID No.4; — the plant maize — disease resistance refers to resistance to diseases caused by strains of Puccinia polysora and Curvularia lunata. Use of maize dual regulatory module for regulating the balance between plant growth and disease resistance according to claim 1, wherein the VORF ZmTBF1 element and the corresponding ZmTBF1 promoter sequence are amplified from maize DNA and subsequently cloned into plant expression vector pCAMBIA3301 by seamless cloning. Use of maize dual regulatory module for regulating the balance between plant growth and disease resistance according to claim 2, wherein the primers for amplifying the uORF ?'BF element and the corresponding ZmTBF1 promoter sequence are as follows: ZmTBF1a-3301: forward: 5'-atgaccatgattacgaattcCATCGCCATCCATTTAAACATT-3' (SEQ ID NO:29) reverse: 5'-taccctcagatctaccatggCCCTCGCCGGCTATGTATA-3' (SEQ ID NO:30) ZmTBF1b-3301: forward:5'-atgaccatgattacgaattcGCTCGCTCGATCGTCCGCCCTT-3' (SEQ ID NO:31) reverse:5'-taccctcagatctaccatggCTCTCGCTCGGCGCCGACGATT-3' (SEQ ID NO:32). Application of maize double regulatory module for regulating the balance between plant growth and disease resistance according to claim 2, wherein the vector pCAMBIA3301 is linearized using EcoRl and Ncol restriction endonucleases, and the expanded maize double regulatory module connected by seamless cloning technology is with the plant expression vector.