NL2033157A

NL2033157A - Primer pair, probe and identification method of hirsutella sinensis

Info

Publication number: NL2033157A
Application number: NL2033157A
Authority: NL
Inventors: Ren Xiu; Wei Feng; Lu Tulin; Cui Shenghui; Kang Shuai; Zhang Ping; Ma Shuangcheng
Original assignee: Nat Inst Food & Drug Control
Priority date: 2021-09-29
Filing date: 2022-09-27
Publication date: 2023-04-04
Also published as: NL2033157B1; CN113832247A

Abstract

The present disclosure discloses a primer pair, a probe and an identification method of Hirsutella sinensis. The primer pair includes specific primers 5'—CACCACAGCAGTTGCCT—3' (SEQ ID NO:l) and 5'—TCATTTGCTTGCTTCTTGACTG—3'(SEQ ID NO:2), and the probe is 5'—CCTGTCGCAGTGGCATCTCT—3'(SEQ ID NO:3). The present disclosure designs the specific primers and the probe of H. sinensis, establishes a real—time fluorescent PCR identification method of each sample after optimization, and solves the identification problem of fermented Cordyceps sinensis medicinal materials from the molecular level.

Description

PRIMER PAIR, PROBE AND IDENTIFICATION METHOD OF HIRSUTELLA

SINENSIS

TECHNICAL FIELD

The present disclosure relates to the technical field of strain identification, in particular to a primer pair, a probe and an identification method of Hirsutella sinensis.

BACKGROUND

Cordyceps as a traditional precious Chinese medicinal materi- al has a history of thousands of years in China. It is mainly pro- duced in the Qinghai-Tibet Plateau and Hengduan Mountainous Re- gion. Cordyceps is adept in invigorating lungs and kidneys, stanching bleeding, transforming phlegm, suppressing cough, and stabilizing panting. Cordyceps, Ginseng Radix et Rhizoma, and Cer- vi Cornu Pantotrichum collectively known as the "Three Treasures of China".

Due to the increasing scarcity of natural Cordyceps sinensis resources and the difficulty in popularizing artificial cultiva- tion of C. sinensis in the market, the current research on fer- mented Cordyceps preparations mostly focuses on the chemical com- position and pharmacological effects of their products. There are few studies of spawns and their strain specificity of fermented

Cordyceps products. A raw material of these products is fermented mycelium powder. Fermented mycelium powder is obtained from the submerged fermentation of spawns extracted and isolated from

Cordyceps. Different spawns are fermented into different mycelium powders, and thus different fermented Cordyceps preparations are produced. Therefore, the extracted and isolated spawns are the source, and the purity thereof directly affects the quality of the fermented Cordyceps preparations. How to ensure the stability of the strain of the spawn in the production period without strain variation in the process of passage and fermentation culture of spawns is the fundamental to ensure product quality, which has not been reported in relevant literature inside and outside of China.

H. sinensis is the raw material of Corbrin Capsule or Bailing

Tablet - the source of the spawn of fermented C. sinensis mycelium powder. The fermented C. sinensis mycelium powder is the drug sub- stance of Corbrin Capsule/Bailing Tablet/Bailing Granules and is a dry powder of the mycelia obtained by liquid fermentation culture of H. sinensis, the agamobium of the fungus C. sinensis (Berk.})

Sacc. (Clavicipitaceae) isolated from fresh Cordyceps. Microscopic morphological identification is mostly used for spawn identifica- tion, which is mainly described from the conidial morphology, col- ony color, and presence or absence of septa and annulus. Although there have been reports in the literature on the use of molecular biological techniques in the identification of Cordyceps spawns, there are few practical applications in the spawn identification.

The reason is that, in one aspect, a molecular identification testing standard with strong specificity and easy operation has not been established, and in another aspect, enterprises are more inclined to micro-morphological identification from the perspec- tive of cost accounting.

Based on the above situation, a primer pair, a probe and an identification method of H. sinensis are proposed. This method can accurately and exclusively identify the fungal source of prepara- tions and drug substances, namely H. sinensis, at the molecular level, and ensure the specificity and stability of the spawn, drug substance, and preparations, namely, ensuring that the spawns do not mutate during the production and passage, thereby ensuring that the quality of the spawn, drug substance, and preparations is stable and controllable.

SUMMARY

The present disclosure provides a primer pair, a probe and an identification method of H. sinensis.

A primer pair of H. sinensis is provided, including specific primers 5'-CACCACAGCAGTTGCCT-3' (SEQ ID NO:1) and 5'-

TCATTTGCTTGCTTCTTGACTG-3' (SEQ ID NO:2).

A probe of H. sinensis is provided, where the probe is 5'-

CCTGTCGCAGTGGCATCTCT-3" (SEQ ID NO:3).

The present disclosure provides use of the above-described primer pair and the above-described probe in preparation of a kit for detecting H. sinensis.

The present disclosure provides a kit including the above- described primer pair and the above-described probe.

The present disclosure provides use of a kit in detecting H. sinensis.

An identification method of H. sinensis is provided. The identification method of H. sinensis has a total PCR system of 25

HL, and the reaction system includes 2.5 pL of 10xBuffer, 1.0 pL of dNTP (10 mmol/L), 0.2 uL each of primers (50 pmol/L), 0.2 uL of a probe, 0.15 pL of Tag DNA Polymerase (5 U/uL), 2 uL of a tem- plate, 18.75 pL of sterile ultrapure water.

Further, the PCR has the following program: initial denatura- tion at 95°C for 5 min and 40 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 60 s to obtain an amplification curve.

The present disclosure has the following beneficial effects:

The present disclosure designs the specific primers and the probe, establishes a real-time fluorescent PCR identification method of each sample including H. sinensis, fermented C. sinensis mycelium, and Corbrin Capsule/Bailing Tablet after optimization, and solves the fungal strain identification problem of fermented

C. sinensis medicinal materials from the molecular level.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a gel electrophoretogram of a specific primer am- plification sample of a drug substance of Corbrin Capsule, fer- mented C. sinensis mycelium powder;

FIG. 2 illustrates real-time fluorescent PCR amplification curves of H. sinensis, fermented C. sinensis mycelium powder, Cor- brin Capsule/Bailing Tablet, and Cordyceps in the present disclo- sure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

The principles and features of the present disclosure will be described below, and the example is only intended to explain the present disclosure, but not to limit the scope of the present dis-

closure.

The following steps are included in this example:

An internal transcribed spacer (ITS) sequence of a repre- sentative sample of fermented C. sinensis mycelium powder (Hir.sin.) (SEQ ID NO:4) was selected for online design of pri- mers and probe on the IDTDNA website, and the designed primers and probe were aligned with sample sequences; common primers and probes were removed, and the remaining primers and probes were synthesized, screened and optimized.

Screening and optimization of primers

The designed primers were screened and optimized one by one by PCR gel electrophoresis, and consequently, sequences of a pri- mer pair and a probe with better specificity were optimized and selected. [Identification]

Real-time fluorescent PCR assay

Template DNA extraction: A quantity of this substance (medic- inal material) was washed with 1 mL of 75% ethanol and 1 mL of sterile ultrapure water successively, the surface moisture thereof was sucked dry, and the substance was ground into a very fine pow- der (or the powder was directly used) in a mortar. About 20 mg of the powder was placed in a 2 mL sterile centrifuge tube, a quanti- ty of sterile glass beads were added, and the powder was ground on a high-speed ball mill at a frequency of 30 Hz for 1 min, and the grounding was repeated a total of 6 times; 1,500 pL of AP buffer and 4 pL of RNase solution were added and vortexed; DNA was ex- tracted according to the method of the Plant Genomic DNA Extrac- tion Kit, and 150 uL of eluate was obtained as the test solution to determine the concentration and purity thereof, followed by storage in a 4°C refrigerator for later use. In addition, refer- ence materia medica of fermented C. sinensis mycelium powder was prepared in the same manner as the reference materia medica tem- plate DNA solution, and the blank solution was extracted along with it.

RT PCR specific primers included: 5'-CACCACAGCAGTTGCCT-3' (SEQ

ID NO:1) and 5'"-TCATTTGCTTGCTTCTTGACTG-3"' (SEQ ID NO:2).

A probe of H. sinensis was 5'-CCTGTCGCAGTGGCATCTCT-3' (SEQ ID

NO:3).

PCR system: The reaction was carried out in a 200 pL centri- fuge tube, and the total reaction system was 25 ul.

The reaction system included 2.5 pL of 10xBuffer, 1.0 pL of 5 dNTP (10 mmol/L), 0.2 uL each of primers (50 pmol/L), 0.2 uL of the probe, 0.15 uL of Tag DNA Polymerase (5 U/uL), 2 uL of the template, 18.75 pL of sterile ultrapure water. The centrifuge tube was placed in a real-time fluorescence quantitative PCR amplifier.

The PCR parameters were as follow: initial denaturation at 95°C for 5 min and 40 cycles of denaturation at 95°C for 30 s, anneal- ing at 60°C for 30 s, and extension at 72°C for 60 s to obtain an amplification curve.

FIG. 1 is a gel electrophoretogram of a specific primer am- plification sample of a drug substance of Corbrin Capsule, fer- mented C. sinensis mycelium powder; FIG. 2 illustrates real-time fluorescent PCR amplification curves of H. sinensis, fermented C. sinensis mycelium powder, Corbrin Capsule/Bailing Tablet, and

Cordyceps in the present disclosure.

Result judgment

The positive sample peaked before Ct 20, showing a positive amplification curve; the reference materia medica also peaked be- fore Ct 20, and the blank solution did not peak.

The above description is only a preferred embodiment of the present disclosure, but the protection scope of the present dis- closure is not limited thereto. Any equivalent replacement or al- teration made within a technical scope of the present disclosure by a person skilled in the art according to the technical solu- tions of the present disclosure and inventive concepts thereof shall fall within the protection scope of the present disclosure.

Sequence Listing Information:

DTD Version: V1 3

File Name: HKJP20220700618.xml

Software Name: WIPO Sequence

Software Version: 2.1.2

Production Date: 2022-09-22

General Information:

Current application/Applicant file reference: HKJP20220700618

Earliest priority application / IP Office: CN

Earliest priority application/Application number: 202111151860.1

Earliest priority application / Filing date: 2021-09-29

Applicant name: National Institutes for Food and Drug Control

Applicant name / Language: en

Invention title: PRIMER PAIR, PROBE AND IDENTIFICATION METHOD

OF HIRSUTELLA SINENSIS ({ en )

Sequence Total Quantity: 4 sequences:

Sequence Number (ID): 1

Length: 17

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..17 > mol type, other DNA > note, primer 1 > organism, synthetic construct

Residues: caccacagca gttgcct 17

Sequence Number (ID): 2

Length: 22

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..22 > mol type, other DNA > note, primer 2 > organism, synthetic construct

Residues: tcatttgett gcttcttgac tg 22

Sequence Number (ID): 3

Length: 21

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..21 > mol type, other DNA > note, Probe of H. sinensis > organism, synthetic construct

Residues: cctgtcgcag tgggcatctc t 21

Sequence Number (ID): 4

Length: 491

Molecule Type: DNA

Features Location/Qualifiers: - source, 1..491 > mol type, other DNA > note, Hirsutella sinensis > organism, synthetic construct

Residues: tcgagtecace actcccaaac cccctgcgaa caccacagca gttgcctcgg cgggaccgcec 60 ccggegccec agggcccgga ccagggcgec cgccggagga cccccagacc ctcctgtege 120 agtggcatet ctcagtcaag aagcaagcaa atgaatcaaa actttcaaca acggatctet 180 tggttetgge atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt 240 cagtgaacca tcgaatcttt gaacgcacat tgcgccecgcc agcactctgg cgggcatgcc 300 tgtccgagcg tcatctcaac cctcgagccc cccgcctegc ggcggcgggg cccggccttg 360 ggggtcacgg cccegegceg ccccctaaac gcagtggcga ccccgccgcg gctcccctgec 420 gcagtagctc gctgagaacc tcgcaccggg agcgcggagg cggtcacgcc gtgaaaccac 480 cacaccctcc a 491

END .

i xml versicn=Nl, ON encoding=TUTFE-8" 7 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST265equenceListing V1 3.dtd"> 3 <3T268equencelisting dtdVerazion="V1 37 filoName="HRJIPIL0OZ20TO081IE ami” soïtwaceNems=*WIPO Sagueance? soitwareVersion="2.1.2% productions ie=vR0233-08-22">

A <ApplicentFileReferencs>HKJP20220700618-/4ApnlivantFileRsfsrence> > <FariiestPricritvAppiicaticonidentification> 6 <IPOfficetoderCN</IPOfficeloder 7 <ApplicetionNumerTezt>202111151860 .1</AppliceticnNumerText> 8 <FilingDate:2021-09-29/FilingDate> 3 </EarliestPriorityapplicationidentification»> 10 <AppiicentName languagelode="en">National Institutes for Food and Drug

Control</ApplicantName iA <InventlonTitle languagelode="en">PRIMER PAIR, PROBE AND IDENTIFICATION METHOD

OF HIRSUTELLA SINENSIS</InventionTitle»>

LE <BequencetotalQuantityr>4</SequenceTotalfuantity> 13 <SequernceData seguancaiDNumbhao="1%> id <INSDSeqg> is <INSDSeq length>17</INSDSeq length> 18 <INSDSeq moltype>DNA-/INSDSeg moltype>

Lj ZINSDSeq division>PAT</INSDSeq division» 15 <INSDSeq feabure-table>

Le <“INSDFesrure»> 20 <INSDFeature key>source</INSDFeature key> zl <INSDFeature location>l..17</INSDFeature locations ze <INSDFealurse guals> 22 <INSDOQualifier» 24 <IN3DQualifier namedmol type</INSDQualifisr name> 25 <INSDQualifier value>other DNA</IN3DGualifier value> 26 </INSDQuali fier» 27 <INSDQuaiifier id="g2">

ZS <INSDQualifier namernote</INSDQualifiesr name> a <INSDQualiflisr value>primer l</INSDQualifier values» 30 </INSDOualifier>

ZL <INSDOualifier id="gi"> 22 <IN3DQualifier namevorganism“/INSDQualifier name> 33 <INSDQualifier valuersynthetic construct</INSDQuallifier value» 34 </INSDQualifier> 35 </INSDFeature quals> 36 </IN3DFeature> u 37 “/INSDSeqg fesature-table> 28 <INSDSeg sequencercaccacagcagttgect-/INSDSeqg sequenced 29 </INSDSeq> 7 40 </SeguencaData> 44 <SequenceData zaquencalDNumben=n2n> 42 <INSDSeqr 43 <INSDSeq length»>22</INSDSeqg length» 44 <INSDSeq moltype>DNA</INSDSeg moltype> 45 <INSDSeq divislion»PAT</INSDSeqg division» da <INSDSeg Iearturertabie» a7 <INSDFeature> 48 <IN3DFeature key>source</IN3DFeature key> 49 <IN3DFeature location>»l..22</INSDFeaturs locations

S40 <INSDFsature qualsg>

Li <INSDuuelifier>

LE <INSDoualifier name>mol type“ /INSDQualifier name> 53 <INSDQualifisr value>other DNA</INSDQualifier valuer 54 </INSDOualifier> 55 CINSDOualifier id="gàr>

Ha <IN3DQualifier name>note</INSDQualifier name> 57 <INSDQualifier valuerprimer 2</TNSDQualifier value> <{INSDQualifier» 5G <INSDQualifier id="g3"> <INSDoualifier namerorganism</INsSDQualifier name> a1 <INSDQualifier valus>synthetic construct /INSDGualifier value 62 </INSDQualifier> u a3 </INSDFeature guals> 64 </INSDFealure> an </INSDSey feature-tabled oe <INSDSeqg sequance>teatttgettgettettgactg</INSDSey sequences

&7 </INSDEagr ad </SaquenceData> a3 “SequenceData seguencellNMumber="37> jp <INSDSeq>

JL <INSDSeg length>»21</INSDSeq length> 2 <IN3DSeq moltype>DNA</INSDSeq moltyper 73 <INSDSeq divisionsPAT</iINSDSeg division» 74 <INSDSeq feature-table> u

TI <INSDFeature» 78 <INSDFeaturs keyrsource</INSDFeaturs key 77 <INSDFeature locaction»l1..21</INSDFeature location» ie <INSDFeature guals> 79 <INSDOualifier> 5D <INSDQualifier name>mol type“/INSDQuali fier name>

SL <INSDQualifier valuerother DNA</INSDQualifier value»

GE «</INSDOQualifier»> 43 <INSDQualifler ia=’g5">

Sá <INSDQualifier name>note</INSDQualifisr name> <IN3DQualifier value>Probe of H. sinensis</INSDQualifier value> aa </INSDOQuali fier u 57 <INSDQualifier ìid='qgBj> 35 <INSDQualifier namerorganism</INSDQualiifier name> 34 <INSDQualifier valuersynthetic construct“/INSDQualifien value» </INSDOualifier> 31 </IN3DFeature gualsd 32 </INSDFeature> u 33 </INSDSeg features table» 84 <INSDSeg seguencs>cetgtegcagtgggcatetet</INSDSeg sequenca>

Gh </INSDSeg>

GE </Zequencebata> 7 <SequernceData seguancaTiDNunbhao="4%> 33 <INSDSeg> 33 <INSDSeq length>491</INSDSeq length> ijn <INSDSeq moltype>DNA-/INSDSeg moltype>

LOL ZINSDSeq division>PAT</INSDSeq division» 102 <INSDSeq feabure-table>

LOS <“INSDFesrure»>

Lid <INSDFeature key>source</INSDFeature key>

LOE <INSDFeature location>l..491</INSDFeature locations 108 <INSDFealurse guals> 107 <INSDOQualifier» 148 <IN3DQualifier namedmol type</INSDQualifisr name> i108 <INSDQualifier value>other DNA</IN3DGualifier value>

LAO </INSDQuali fier»

Lil <INSDQuaiifier id="g8*>

Liz <INSDOQualifier namernote</INSDQualifiesr name>

LLS <INSDQualifler value>Hirsutella sinensis</INSDQualifisr valus> iid </INSDOualifier>

Lin <INSDOualiifier id="qg"*> iia <IN3DQualifier name>organism</INSDQualifisr name> a <INSDQualifier valuersynthetic construct</INSDQualifier valued

TAB </INSDOualifier>

LLG </THSDFeaturs guals>

LEG </INSDFeatures 121 </IN3DSeqg feature-table> <IN3D3eq sequencertegagtcaccactcccaaaccccctgcgaacaccacagcagttgcctcggcgggac cgccccggcgccccagggccecggaccagggegcccgccggaggacccccagaccctcctgtecgcagtggcatct ctcagtcaagaagcaagcaaatgaatcaaaactttcaacaacggatctcttggttetggcatcgatgaagaacg cagcgaaatgcgataagtaatgtgaattgcagaattcagtgaaccatcgaatectttgaacgcacattgegcccg ccagcactctggcgggcatgcctgtccgagegtcatctcaaccctcgagccceccegcctcgcggcggecggggce cggccttgggggtcacggccccgegcegccccctaaacgcagtggcgacccegcegeggctcccctgegcagta gctegetgagaacctcgcaccgggagegcggaggcggtcacgecgtgaaaccaccacaccctcca/INSDS&eg sequencer 123 </TNSDSeg> 124 </SeguenceDala>

Lan </ST:6GS&eguenceListing>

Claims

CONCLUSIONS

A primer pair from Hirsutella sinensis comprising specific primers 5'-CACCACAGCAGTTGCCT-3'{SEQ ID NO:1) and 5'-TCATTTGCTTGCTTCTTGACTG-3' (SEQ ID NO:2).

2. Hirsutella sinensis probe, wherein the probe is CCTGTCGCAGTGGGCATCTCT-3° (SEQ ID NO:3).

Use of the primer pair and the probe according to any one of claims 1 to 2 for the preparation of a kit for detecting Hirsutella sinensis.

A kit comprising the primer pair and probe according to any one of claims 1 to 2.

Use of the kit according to claim 4 in detecting Hirsutella sinensis.

A method for identifying Hirsutella sinensis, wherein the method for identifying Hirsutella sinensis has a total PCR system of 25 µL, and the reaction system contains 2.5 µL of 10x buffer, 1.0 µL dNTP (10 mmol/ L), 0.2 µL of each of the primers (50 pmol/L), 0.2 µL of a probe, 0.15 µL of Tag DNA Polymerase (5 U/µL), 2 µL of a template, 18 .75 µl of sterile ultrapure water.

The method for identifying Hirsutella sinensis according to claim 6, wherein the PCR has the following program: initial denaturation at 95°C for 5 minutes and 40 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds to obtain an amplification curve.