NL2032194B1 - RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application - Google Patents

RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application Download PDF

Info

Publication number
NL2032194B1
NL2032194B1 NL2032194A NL2032194A NL2032194B1 NL 2032194 B1 NL2032194 B1 NL 2032194B1 NL 2032194 A NL2032194 A NL 2032194A NL 2032194 A NL2032194 A NL 2032194A NL 2032194 B1 NL2032194 B1 NL 2032194B1
Authority
NL
Netherlands
Prior art keywords
rpa
rostochiensis
probe
primers
lfd
Prior art date
Application number
NL2032194A
Other languages
Dutch (nl)
Inventor
Peng Huan
Ge Jianjun
Peng Deliang
Wang Xu
Lei Rong
Original Assignee
Institute Of Plant Prot Ipp Chinese Academy Of Agricultural Sciences Caas
Chinese Acad Inspection & Quarantine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute Of Plant Prot Ipp Chinese Academy Of Agricultural Sciences Caas, Chinese Acad Inspection & Quarantine filed Critical Institute Of Plant Prot Ipp Chinese Academy Of Agricultural Sciences Caas
Application granted granted Critical
Publication of NL2032194B1 publication Critical patent/NL2032194B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Abstract

Disclosed is a RPA-LFD rapid detecting method of Globodera rostochiensis and its 5 application, belonging to the field of biotechnology. The application discloses primers and probe for RPA-LFD rapid detection of Globodera rostochiensis, where the primers including an upstream primer with sequence as shown in SEQ ID NO: 1 and a downstream primer with sequence as shown in SEQ ID NO: 2, and the probe has sequence as shown in SEQ ID NO: 3. The above primers and probe are used to construct RPA-LFD detection method, comprising 10 extracting DNA of Globodera rostochiensis, isothermically amplifying RPA system of Globodera rostochiensis and using LFD test strip to specifically and quickly detect Globodera rostochiensis. The detection method of the application has the advantages of strong specificity, high sensitivity, simple operation and high application value in rapid quarantine detection of Globodera rostochiensis.

Description

RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application
TECHNICAL FIELD The application relates to the field of biotechnology, and in particular to a RPA-LFD (Recombinase Polymerase Amplification with Lateral Flow Dipsticks) method for rapid detecting Globodera rostochiensis and its application.
BACKGROUND Potato cyst nematodes (PCNs) including G/obodera rostochiensis and Globodera pallida are serious soil-borne parasitic pests in potato, and the very important quarantine nematode pests of potato in many countries. It has been estimated that PCNs caused 9% loss of global potato production; when PCNs populations are high in the field, it can lead to the loss of potato yield as high as 80% - 90%, or even no harvest. PCNs are highly reproductive and can survive for a long time under adverse conditions, making it difficult to eradicate the population once it was established. At present, Globodera rostochiensis occurs in some areas of China, and it is a major quarantine pest of internal as well as external phytosanitary of China. PCNs possess very similar morphological characteristics and are difficult to distinguish. Traditional methods for identifying PCNs involve morphological and morphometric identification with the help of a certain number of characteristic spores or females, combined with the characteristics of second stage juveniles, making PCNs detection particularly sophisticated, while a sufficient number of specimens are also required. For the safety of China's agricultural production and preventing PCNs-infected potato from being introduced into China and spread as well, it is of major practical importance to carry out research on specific and rapid molecular detection techniques for PCNs.
Molecular diagnosis of PCNs began in 1980s. Based on the protein differences between Globodera pallida and Globodera rostochiensis, researchers designed and developed a number of specific probes, which can be used to detect and distinguish these two PCNs. Using serological techniques, Schots et al. screened and obtained monoclonal antibodies specific to two species of PCNs, making quantitative identification of the species possible. Since 1985, nucleic acid detection for taxonomic purposes has been developed, but it was then not sensitive and time-consuming in addition to requiring large amounts of nucleic acid. As PCR techniques are continuously optimized, reaction sensitivity and efficiency are also improved, and it is possible to use only a small amount of materials to achieve detection, PCR method is hence rather suitable for the study of nematode DNA. By designing PCR primers for amplifying two species of PCNs, products of PCR detection provide a good distinction between the two species of PCNs. Various molecular marker techniques developed from DNA molecular polymorphism based on PCR technology are involved in the application of PCNs detection and identification, such as RAPD, AFLP, RFLP, real-time fluorescent PCR and some thermostatically amplified techniques, loop-mediated isothermal amplification (LAMP) is also used in the detection of PCNs. Recombinase polymerase amplification (RPA) is first proposed by Olaf Piepenburg's team in the UK in 2006 and the technique has been used to detect a variety of pathogens, e.g., Subbotin (2018) used RPA technique to amplify the sequence of an IGS rRNA fragment of the Meloidogyne enterolobii and detected its amplified product by real-time fluorescence with a sensitivity of 1/10 of a second stage juveniles; Ju YL et al., (2019) established a rapid RPA detection method for Meloidogyne incognita, Meloidogyne javanica, Meloidogyne arenaria and Meloidogyne enterolobii; Chi YK et al., (2020) established a RPA-LFD detection method of Meloidogyne javanica, allowing visualization of positive samples within 20 minutes (min) at a constant temperature of 37 - 42°C; however, there is no report on RPA detecting Globodera rostochiensis.
SUMMARY The objective of the present application is to provide a RPA-LFD method for rapid detecting Globodera rostochiensis and its application so as to solve the problems existing in the prior art. The RPA-LFD method for rapid detecting G/obodera rostochiensis is established by designing RPA-specific primers and LFD-specific probe, enabling highly sensitive and specific detection of Globodera rostochiensis.
To achieve the above objective, the present application provides the following technical solutions: the application provides primers and a probe for RPA-LFD rapid detection of Globodera rostochiensis, where the primers has an upstream primer with sequence as shown in SEQ ID NO: 1 and a downstream primer with sequence as shown in SEQ ID NO: 2, and the probe has sequence as shown in SEQ ID NO: 3.
Preferably, the downstream primer has biotin added to its 5' end.
Preferably, the probe has Fam added to its 5' end, tetrahydrofuran added to the middle of the 5' end and its 3' end, and Spacer-C3 phosphoramidite added to the 3' end.
The application also provides a kit for RPA-LFD rapid detecting Globodera rostochiensis, which comprises the primers and the probe.
Preferably, the kit also includes a test strip, which is a nucleic acid detection test strip labelled with streptavidin and Fam antibody modified gold nanoparticles.
Preferably, the kit further includes DNA extraction reagent, and the DNA extraction reagent comprises lysate A and lysate B.
The application also provides a RPA-LFD rapid detecting method of Globodera rostochiensis, where a RPA reaction is carried out using the primers and probe described above, the final product of the RPA reaction is spotted onto LF test strip, the results are observed after standing, and whether it is Globodera rostochiensis is determined according to the observed results.
Preferably, the RPA reaction system comprises: 1} reaction mixture: 25 pl of rehydration solution, 2.1 pl of upstream primer and 2.1 pl of downstream primer, 0.6 pl of probe and 2.5 pl of magnesium acetate, all the above solutions are dissolved in enzyme dry powder, and sterilized distilled water is added to make up to 48 pl; 2) 2 ul DNA template.
Preferably, the RPA reaction conditions are as follows: after the reaction mixture and DNA template are evenly mixed, the mixture is incubated at 37 - 40°C for 30 min.
The application also provides an application of the primers and probe, or the kit, or the method as applied to any of (a) - (c) below: (a) detecting G/obodera rostochiensis in imported and exported plant products; (b) detecting G/obodera rostochiensis in soil; (c) identifying Globodera rostochiensis.
The application discloses the following technical effects: according to the application, an RPA forward primer, a biotin-modified reverse primer and a Fam-modified probe are designed, amplified products carrying biotin and Fam are generated under the action of polymerase and recombinase and can therefore be detected by a nucleic acid detection test strip labelled with gold nanoparticles modified by streptavidin and Fam antibody; the specific primer pair and probe designed above for detecting G/obodera rostochiensis has the following advantages: (1) strong detection specificity: the primers and probe used in RPA provide a double specificity guarantee by only amplifying the template DNA of the Globodera rostochiensis, providing more fidelity than other assays; (2) short detecting duration: it takes only 45 min from extracting nematode nucleic acid to the RPA-LFD detection, including one step extraction and one step detection, and no additional procedures are required at the beginning and end of the detection; (3) low requirements for detection conditions: the RPA detection can be carried out at 37 - 40°C without any warming apparatus such as a PCR instrument; and the detection can be completed with test strips requiring no gel electrophoresis and imaging system; (4) with rather less steps, simple operation and obvious results, the entire test process does not involve complex instruments and equipment and can be completed by general personnel; the results are easy to identify and can be observed by naked eyes without laborious electrophoresis and UV observation; (5) itis friendly to people and the environment as the testing process does not require application of toxic reagents such as EB, making it exceptionally safe to people and environment.
In summary, the present application has rather high specificity, sensitivity and portability compared to existing methods for detecting G/obodera rostochiensis, and can be used for field detection in actual production; it has significant practical value for the rapid molecular detection of imported and exported goods including soil samples and plants with G/obodera rostochiensis.
BRIEF DESCRIPTION OF THE FIGURES In order to more clearly explain the embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the figures that needed to be used in the embodiments. Obviously, the figures in the following description are only some embodiments of the present application. For those of ordinary skill in the art, other figures can be obtained according to these figures without any creative effort.
Fig. 1 shows a schematic diagram of RPA primers and probe design of Globodera rostochiensis; Fig. 2 shows results of RPA-specific detection of Globodera rostochiensis, where A: PCR specific primer amplified electrophoresis pattern of the G/obodera rostochiensis, B: RPA-LFD specific detection of G/obodera rostochiensis; Fig. 3 shows the RPA sensitivity test results of G/obodera rostochiensis, where A: PCR sensitivity detection of G/obodera rostochiensis, B: RPA-LFD sensitivity detection of Globodera rostochiensis; Fig. 4 shows results of RPA detection of Globodera rostochiensis in soil.
DESCRIPTION OF THE INVEN TION Now, various exemplary embodiments of the present application will be described in detail. This detailed description should not be taken as a limitation of the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.
It should be understood that the terms mentioned in the present application are only used to describe specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Every smaller range between any stated value or the intermediate value within the stated range and any other stated value or the intermediate value within the stated range is also included in the present application. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
Unless otherwise stated, all technical and scientific terms used herein have the same meanings commonly understood by those of ordinary skill in the field to which this application relates. Although the present application only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and/or materials related to the documents. In case of conflict with any incorporated documents, the contents of this specification shall prevail.
Without departing from the scope or spirit of the present application, it is obvious to those skilled in the art that many modifications and changes can be made to the specific embodiments 5 of the present specification. Other embodiments obtained from the description of the present application will be obvious to the skilled person. The specification and embodiments of this application are only exemplary.
As used in this paper, the terms "comprising", “including”, "having" and "containing" are all open terms, meaning including but not limited to.
The kits used in the following embodiments are commercially available, and the nematodes used are quarantine nematodes kept in the Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, for research purposes only.
Materials: samples of cyst nematode as shown in Table 1 below. Table 1 Sample code and population source of cyst nematode “sample code Group species Sampling location Host plant GG. rostochiensis Guizhou Province, China Potato GrF G. rostochiensis Guizhou Province, China Potato ora G. rostochiensis Hezhang County, Guizhou Province, Potato China Gry G. rostochiensis Zhaotong, Yunnan Province, China Potato ors G. rostochiensis Zhaojue County, Sichuan Province, Potato China GrN1 G. rostochiensis Norway Potato GrN2 G. rostochiensis Norway Potato GrN3 G. rostochiensis Norway Potato GrN5 G. rostochiensis Norway Potato Ga G. artemisiae Norway Potato Gp G. pallida Belgium Potato Gt G. tabacum Shanghai Sangon Biotech, China Plasmid Hs H. schacht Xinjiang Uygur Autonomous Region, Beet China Hg H. glycines Langfang, Hebei Province, China Soybean Main reagent: nucleic acid extraction kit is purchased from Ningbo Zhenhai Baichuan Biotechnology Co., Ltd. (article number: BC 002); TwistAmp nfo kit is purchased from TwistDx Company of the U.K. (article number: TANFOO2KIT); Milenia genline hybridetect test strip detection kit is purchased from Milenia Biotec Company of Germany (article number: MILENIAO1); DNA marker is purchased from TaKaRa Company; primers and probe are synthesized by Sangon Biotech, Shanghai. Embodiment 1 RPA detection method of PCNs
1. DNA extraction of cyst nematode absorbing lysate A of 10 ul to a EP tube of 200 ul, adding 2 pl lysate B for mixing, picking single cysts or single nematodes of Globodera rostochiensis, putting them into the mixed lysate, crushing the cysts, placing the EP tube at 95°C for 15 min, then performing instantaneous centrifugation, adding 20 ul sterilized water for dilution, and using supernatant as nematode DNA template for RPA detection directly or freeze at -20°C for later use.
2. RPA primer design using ITS sequencing results of the Globodera rostochiensis as a template, designing a pair of specific primers and a detecting probe (see Fig. 1), where the primers and probe are submitted to Sangon Biotech, Shanghai for synthesis; the primers sequence are as follows: (1) upstream primer GrF (SEQ ID NO: 1): 5-CTGTGTATTGGCTGGCACATTGACCAACA- 3, (2) downstream primer GrR (SEQ ID NO: 2): 5'-Biotin- TACGGCACGTACAACATGGAGTAGCAGCTAC-3" (3) probe GrP (SEQ ID NO: 3): 5'-Fam- TACGGCACGTACAACATGGAGTAGCAGCTAC(THF)CTGTGCTGGCGTCTGT-C3 spacer-3'. Preparation of RPA reaction system: adding 25 ul rehydration solution, 2.1 yl GrF and 2.1 pl GrR (10 pmol/l), 0.6 pl GrProbe (10 pmol/l) and 2.5 pl magnesium acetate (280 mM) into enzyme dry powder packed in the kit, fully mixing and dissolving, and adding sterilized ddH2O to make up to 48 ul to obtain a reaction mixture; adding 2 ul DNA to be tested and incubating at 37 - 40°C for 30 min.
3. The final product of the RPA reaction is spotted onto the end of the test strip and stood for observation. Embodiment 2 RPA specific detection of Globodera rostochiensis collecting 13 different populations (see Table 1) including G/obodera pallida, Globodera artemisiae, Heterodera schachtii and Heterodera glycine, extracting their DNA as templates; carrying out RPA detection together with the DNA template of Globodera rostochiensis to detect the specificity of RPA detection method of G/obodera rostochiensis; preparing reaction mixture according to the above Embodiment 1, evenly mixing, adding 2 Ml template DNA, and carrying out amplification reaction according to the reaction conditions of the Embodiment 1; after the reaction, spotting the final product of RPA reaction onto the end of the test strip, and letting it stand for observation. As shown in Fig. 2, the G/obodera rostochiensis can amplify a specific band (the gene sequence of the specific fragment is shown in SEQ ID NO: 4), which has no cross with bands amplified by other nematodes, indicating a specificity (see Fig. 2A).
Grd, GrN1, GrN2, GrN3, GrN5 and GrF are DNA of Globodera rostochiensis, and obvious bands can be observed in the test line; as for other samples and negative controls, only control line has obvious band, and no band in the test line (see Fig. 2B). The results show that the above RPA primers, probe and reaction systems have certain specificity in the detection of Globodera rostochiensis.
SEQ ID NO: 4 is as follows:
CTGTGTATGGGCTGGCACATTGACCAACAATGTACGGACAGCGCCCTGTGGGCACATGAG TGTTGGGGTGTAACCGATGTTGGTGGCCCTATGGGTGAGCCGACGATTGCTGCTGTCGTC GGGTCGCTGCGCCAACGGAGGAAGCACGCCCACAGGGCACCCTAACGGCTGTGCTGGC GTCTGTGCGTCGTTGAGCGSTTGTTGCGCCTTGCGCAGATATGCTAACATGGAGTGTAGC TGCTACTCCATGTTGTACGTGCCGTA.
Embodiment 3 RPA sensitivity detection of Globodera rostochiensis diluting DNA templates extracted from second stage juvenile of monocephalic G/obodera rostochiensis and monospora cysts respectively into 4 concentrations of 1x1071 - 1x10°3 by 10 times, taking 2 ul of DNA as templates, preparing reaction mixture according to Embodiment 1, mixing and dissolving uniformly, proceeding under the reaction conditions of Embodiment 1, spotting final product of RPA reaction onto the end of the test strip and letting it stand for observation.
Fig. 3 shows the results of PCR gel electrophoresis, where the concentration of 1/10 of the second stage juvenile shows a specific band, which is a positive amplification, while other concentrations show no specific bands by PCR gel electrophoresis, indicating that there is no effective amplification in systems of concentrations below 1/10 of nucleic acids of the second stage juvenile. RPA-LF detection results show that a faint test line appears in the concentration of 1/100 of second stage juvenile, indicating that the detection of nucleic acid below concentration of 1/100 of second stage juvenile is invalid; monospora cysts of concentration of 1/1000 are detected by PCR and RPA-LF, and specific bands and test lines appear, indicating that both detection methods are effective at this concentration.
Embodiment 4 Detection of Globodera rostochiensis in collected soil collecting three soil samples, respectively putting them into a bucket, stirring with water, letting them for standing for about 2 min, then pouring the suspension into plansifter of 35-mesh and 60-mesh, washing the filtrate of 60-mesh plansifter onto filter paper with clean water, and picking out the cysts with tweezers under a stereomicroscope; selecting three cysts from each soil sample according to the method of nucleic acid extraction from cysts in Embodiment 1 above, carrying out nucleic acid extraction of single cysts; preparing reaction mixture according to the above Embodiment 1, evenly mixing, adding 2 pl template DNA, carrying out amplification reaction according to the reaction conditions of
Embodiment 1, spotting the final product of RPA reaction onto the end of the test strip after the reaction, letting it stand for observation.
As shown in Fig. 4, all 9 cyst samples in 3 soils samples can be observed with obvious test lines, and the positive control samples of Globodera rostochiensis can be observed with control lines and test lines, while the negative control samples only have obvious bands at the control lines. The detection results indicate that all 3 soil samples contain Globodera rostochiensis.
The above-mentioned embodiments only describe the preferred mode of the application, but do not limit the scope of the application. On the premise of not departing from the design spirit of the application, all kinds of modifications and improvements made by ordinary technicians in the field to the technical scheme of the application shall fall within the scope of protection determined by the claims of the application.
Sequence Listing <110> Institute of Plant Protection (IPP), Chinese Academy of Agricultural Sciences (CAAS) <110> Chinese Academy of Inspection and Quarantine <120> RPA-LFD rapid detecting method of Globodera rostochiensis and its application <130> SHX-Globodera NL <150> CN202210145503.2 <151> 2022-02-17 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence(Artificial Sequence) <400> 1 ctgtgtattg gctggcacat tgaccaaca 29 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence(Artificial Sequence) <400> 2 tacggcacgt acaacatgga gtagcagcta c 31 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence(Artificial Sequence) <400> 3 Cggaggaagc acgcccacag ggcaccctaa cgctgtgctg gcgtctgt 48 <210> 4 <211> 264 <212> DNA <213> Artificial Sequence(Artificial Sequence) <400> 4 ctgtgtatgg gctggcacat tgaccaacaa tgtacggaca gcgccctgtg ggcacatgag 60 tgttggggtg taaccgatgt tggtggccct atgggtgagc cgacgattgc tgctgtcgtc 120 gegtcgctgc gccaacggag gaagcacgcc cacagggcac cctaacggct gtgctggcgt 180 ctgtgcgtcg ttgagcggtt gttgcgcctt gcgcagatat gctaacatgg agtgtagctg 240 ctactccatg ttgtacgtgc cgta 264

Claims (10)

CONCLUSIESCONCLUSIONS 1. Primers en probe voor snelle detectie van Globodera rostochiensis met behulp van RPA-LFD (Recombinase Polymerase Amplification — Lateral Flow Dipstick), waarbij de primers een stroomopwaartse primer omvatten met een sequentie als weergegeven in SEQ ID NO: 1, een stroomafwaartse primer met een sequentie als weergegeven in SEQ ID NO: 2, en de probe een sequentie heeft als weergegeven in SEQ ID NO: 3.1. Primers and probe for rapid detection of Globodera rostochiensis using RPA-LFD (Recombinase Polymerase Amplification — Lateral Flow Dipstick), the primers comprising an upstream primer having a sequence as shown in SEQ ID NO: 1, a downstream primer having a sequence as set forth in SEQ ID NO: 2, and the probe has a sequence as set forth in SEQ ID NO: 3. 2. De primers en de probe volgens conclusie 1, waarbij biotine is toegevoegd aan het 5'-uiteinde van de stroomafwaartse primer.The primers and the probe according to claim 1, wherein biotin is added to the 5' end of the downstream primer. 3. De primers en probe volgens conclusie 1, waarbij Fam is toegevoegd aan het 5'-uiteinde van de probe, tetrahydrofuraan is toegevoegd midden tussen het 5'-uiteinde en het 3'-uiteinde, en Spacer-C3-fosforamidiet is toegevoegd aan het 3'-uiteinde.The primers and probe of claim 1, wherein Fam is added to the 5' end of the probe, tetrahydrofuran is added midway between the 5' end and the 3' end, and Spacer-C3 phosphoramidite is added to the 3' end. 4. Een samengestelde set voor snelle detectie voor Globodera rostochiensis met RPA-LFD die de primers en de probe volgens willekeurig welke van de conclusies 1 — 3 omvat.A rapid detection kit for Globodera rostochiensis with RPA-LFD comprising the primers and the probe according to any one of claims 1 to 3. 5. De samengestelde set volgens conclusie 4, die voorts een teststrip omvat, waarbij de teststrip een teststrip voor nucleinezuuurdetectie is, die is gemarkeerd met streptavidine en met Fam- antilichaam gemodificeerde gouden nanodeeltjes.The assembled kit of claim 4, further comprising a test strip, wherein the test strip is a nucleic acid detection test strip labeled with streptavidin and Fam antibody-modified gold nanoparticles. 6. De samengestelde set volgens conclusie 4, die voorts een DNA-extractiereagens omvat, waarbij het DNA-extractiereagens lysaat A en lysaat B omvat.The assembled kit of claim 4, further comprising a DNA extraction reagent, wherein the DNA extraction reagent comprises lysate A and lysate B. 7. Een werkwijze voor het snel detecteren van G/obodera rostochiensis met behulp van RPA- LFD, waarbij de primers en de probe volgens conclusie 1 worden toegepast voor de RPA- reactie, het eindproduct van de RPA-reactie vleksgewijs op een LF-teststrook wordt aangebracht, en het resultaat wordt waargenomen nadat men het heeft laten staanstaan, en aan de hand van het waarnemingsresultaat wordt beoordeeld of het G/obodera rostochiensis is of niet.A method for the rapid detection of G/obodera rostochiensis using RPA-LFD, wherein the primers and the probe according to claim 1 are used for the RPA reaction, the final product of the RPA reaction spotwise on an LF test strip is applied, and the result is observed after standing, and the observation result is used to judge whether it is G/obodera rostochiensis or not. 8. De werkwijze volgens conclusie 1, waarbij de RPA een reactiesysteem heeft als volgt: 1) reactiemengsel: 25 pl rehydratieoplossing, 2,1 ul stroomopwaartse primer en 2,1 ul stroomafwaartse primer, 0,6 ul probe en 2,5 pl magnesiumacetaat, waarbij alle bovenstaande oplossingen worden opgelost in enzym droog poeder, waarbij gesteriliseerd gedestilleerd water wordt toegevoegd om tot 48 pl te komen; 2) 2 ul DNA-matrijs.The method of claim 1, wherein the RPA has a reaction system as follows: 1) reaction mixture: 25 µl rehydration solution, 2.1 µl upstream primer and 2.1 µl downstream primer, 0.6 µl probe and 2.5 µl magnesium acetate , dissolving all of the above solutions in enzyme dry powder, adding sterilized distilled water to make up to 48 µl; 2) 2 µl DNA template. 9. De werkwijze volgens conclusie 8, waarbij de RPA-reactiecondities als volgt zijn: nadat het reactiemengsel en het DNA-sjabloon gelijkmatig zijn gemengd, het incuberen van het mengsel gedurende 30 min. bij 37 - 40°C.The method of claim 8, wherein the RPA reaction conditions are as follows: after the reaction mixture and the DNA template are uniformly mixed, incubating the mixture for 30 minutes at 37-40°C. 10. Toepassing van primers en probe volgens conclusie 1, of de samengestelde set volgens conclusie 2, of de werkwijze volgens conclusie 7, voor topassing bij willekeurig welke van de volgende punten a) - C): (a) het opsporen van G/obodera rostochiensis in geïmporteerde en geëxporteerde plantaardige producten; (b) het opsporen van G/obodera rostochiensis in de bodem; en (c) het identificeren van G/obodera rostochiensis.Use of primers and probe according to claim 1, or the assembled set according to claim 2, or the method according to claim 7, for use in any of the following points a) - c): (a) detecting G/obodera rostochiensis in imported and exported plant products; (b) detecting G/obodera rostochiensis in the soil; and (c) identifying G/obodera rostochiensis.
NL2032194A 2022-02-17 2022-06-16 RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application NL2032194B1 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210145503.2A CN114438226B (en) 2022-02-17 2022-02-17 Rapid detection method and application of potato golden nematode RPA-LFD

Publications (1)

Publication Number Publication Date
NL2032194B1 true NL2032194B1 (en) 2022-12-30

Family

ID=81373839

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2032194A NL2032194B1 (en) 2022-02-17 2022-06-16 RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application

Country Status (2)

Country Link
CN (1) CN114438226B (en)
NL (1) NL2032194B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101545008A (en) * 2009-03-09 2009-09-30 中国检验检疫科学研究院 Primer and probe for detecting globodera rostochiensis
EP2966177A1 (en) * 2014-07-09 2016-01-13 Vetgenomics, S.L. Methods for detecting target DNA sequences
CN110951838A (en) * 2019-12-24 2020-04-03 中国农业科学院麻类研究所 Primer, probe, kit and application for detecting meloidogyne hapla based on RPA-LFD technology

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1939303A1 (en) * 2006-12-27 2008-07-02 Wageningen Universiteit Method for detecting cyst nematodes
CN102382819B (en) * 2010-02-25 2013-08-07 中国农业科学院植物保护研究所 Extraction method of DNA of radopholus similis in morbid plant tissues, and application thereof
CN104059909B (en) * 2014-07-11 2016-05-04 中国农业科学院植物保护研究所 Globodera rostochiensis SCAR mark and LAMP method for quick and application
CN111676296A (en) * 2020-06-17 2020-09-18 河北省农林科学院植物保护研究所 Test strip RPA primer for detecting potato rot stem nematode and detection kit thereof
CN113215269B (en) * 2021-04-27 2022-07-26 中国农业大学 Detection kit for visual detection of potato rot stem nematodes and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101545008A (en) * 2009-03-09 2009-09-30 中国检验检疫科学研究院 Primer and probe for detecting globodera rostochiensis
EP2966177A1 (en) * 2014-07-09 2016-01-13 Vetgenomics, S.L. Methods for detecting target DNA sequences
CN110951838A (en) * 2019-12-24 2020-04-03 中国农业科学院麻类研究所 Primer, probe, kit and application for detecting meloidogyne hapla based on RPA-LFD technology

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MEHRDAD MADANI ET AL: "gene, an additional target for discrimination between the potato cyst nematodes,and, and the related species", EUROPEAN JOURNAL OF PLANT PATHOLOGY, KLUWER ACADEMIC PUBLISHERS, DO, vol. 130, no. 3, 6 March 2011 (2011-03-06), pages 271 - 285, XP019913873, ISSN: 1573-8469, DOI: 10.1007/S10658-011-9752-Z *

Also Published As

Publication number Publication date
CN114438226A (en) 2022-05-06
CN114438226B (en) 2023-10-27

Similar Documents

Publication Publication Date Title
Veal et al. Fluorescence staining and flow cytometry for monitoring microbial cells
Congdon et al. In-field capable loop-mediated isothermal amplification detection of Turnip yellows virus in plants and its principal aphid vector Myzus persicae
Putnam Evaluation of selected methods of plant disease diagnosis
CN107142335A (en) Reagent, detection method and the application detected for H7 subtype avian influenza virus
Xu et al. Recombinase Polymerase Amplification–Lateral Flow Dipstick Assay for Rapid Detection of Fusarium circinatum Based on a Newly Identified Unique Target Gene
CN105177187B (en) Detect sample preparation methods and purposes that Curcurbitaceae seed carries cucumber green mottle mosaic virus
Van Vuurde et al. Immunofluorescence colony-staining (IFC)
NL2032194B1 (en) RPA-LFD Rapid Detecting Method of Globodera rostochiensis and its Application
CN112852995A (en) Primer probe composition, kit and detection method for detecting fusarium graminearum
CN103194544B (en) A kind of reagent of assistant identification nepovirus and application thereof
CN110295255B (en) RT-LAMP-LFD-based rapid detection method for detecting kiwi chlorotic and ringspot related viruses
NL2033977B1 (en) Recombinase Polymerase Amplification Primers and Probe, Kit for Rapid Detection of Heterodera filipjevi and Applications
Schnippenkoetter et al. Comparison of non-subjective relative fungal biomass measurements to quantify the Leptosphaeria maculans—Brassica napus interaction
Lunello et al. Ultra-sensitive detection of two garlic potyviruses using a real-time fluorescent (Taqman®) RT-PCR assay
CN116516058A (en) Method and kit for visually detecting phytophthora sojae
CN109943666A (en) A kind of the multiple PCR primer group and its application of the main virus of detection tomato
CN115838816A (en) Visualized nucleic acid detection kit for human five-trichomonas LFD-RPA
Ilbağı et al. Incidence of virus diseases in maize fields in the Trakya region of Turkey
CN113604577B (en) Primer, probe, kit and method for detecting cassava mealy bugs based on fluorescent quantitative PCR
CN107937490A (en) The method and kit of a kind of ELISA test strip phytopathogen of asymmetric pcr
Wang et al. A droplet digital PCR assay for detection and quantification of Verticillium nonalfalfae and V. albo-atrum
Katoch et al. Status of Bean yellow mosaic virus on Gladiolus
CN111321239B (en) LAMP primer group for detecting moniliforme and detection method
Qi et al. A rapid, equipment-free method for detecting avirulence genes of Pyricularia oryzae using a lateral flow strip-based RPA assay
CN113293239B (en) Universal RPA nucleic acid isothermal amplification primer and kit for bivalve herpesvirus OsHV-1 infection and application of primer and kit