CN113293239B - Universal RPA nucleic acid isothermal amplification primer and kit for bivalve herpesvirus OsHV-1 infection and application of primer and kit - Google Patents

Abstract

The invention belongs to the technical field of marine organisms, and particularly relates to a universal RPA nucleic acid isothermal amplification primer and a kit for bivalve herpesvirus OsHV-1 infection and application thereof. The primer is a complete set of amplification primers and consists of an upstream primer, a downstream primer and a probe primer; the upstream primer is shown as SEQ ID NO. 1; the downstream primer is shown as SEQ ID NO. 2; the probe primer is shown as SEQ ID NO. 3. Aiming at 7 OsHV-1 variant strains in four known bivalve shellfish hosts, the invention designs a universal RPA amplification detection primer, establishes a test strip RPA detection system and a test strip RPA detection method of OsHV-1, has important value for the on-site rapid screening and detection of OsHV-1, and has wide market application prospect.

Description

Universal RPA nucleic acid isothermal amplification primer and kit for bivalve herpesvirus OsHV-1 infection and application of primer and kit

Technical Field

The invention belongs to the technical field of marine organisms, and particularly relates to a universal RPA nucleic acid isothermal amplification primer and a kit for bivalve herpesvirus OsHV-1 infection and application thereof.

Background

The herpes viruses Ostreid Herpesvirus 1 and OsHV-1 which are infected with epidemic viruses in bivalves belong to the Herpesvirales (Herpesvirales), the mollusk herpesviridae (Malacoheresviridae) and OsHV-1 is widely prevalent in coastal shellfish culture or fishing production areas all over the world. At present, bivalve shellfish hosts which can be infected with OsHV-1 mainly comprise oysters, scallops, shellfish in Arca and the like, in recent years, shellfish cultured in Arca is seriously infected by the viruses in China, and the frequent infection of the viruses causes large-scale death of Arca granosa, Arca subcrenata and Arca inflata Reeve in coastal areas of China. The OsHV-1 infected in different species has a certain degree of variation, and the similarity among the gene groups is about 90 percent, so that a plurality of OsHV-1 variant strains are formed. The establishment of the universal type on-site detection method aiming at OsHV-1 can effectively monitor the epidemic situation of the viruses and avoid the large-scale death of the cultured bivalve shellfish caused by the infection of the viruses.

At present, the methods for detecting OsHV-1 mainly comprise an electron microscope method, conventional or fluorescent quantitative PCR and the like. Electron microscopes require expensive instrumentation; polymerase Chain Reaction (PCR) has been used as a gold-labeled method for diagnosing various diseases because it can detect trace amounts of pathogenic DNA. However, the conventional PCR requires special thermal cycling equipment, the product of the conventional PCR still requires electrophoresis detection, the fluorescence quantitative PCR has higher sensitivity, the reaction process is long, and an instrument with fluorescence detection and analysis is required. The existing OsHV-1 detection method cannot meet the requirement of epidemic disease field diagnosis due to the defects. The development of a technology suitable for the field diagnosis of OsHV-1 is of great significance for the effective control of OsHV-1 prevalence.

Recombinase-Polymerase-based nucleic acid Amplification (RPA) was developed by the british company twist dx Inc, which relies on Recombinase-mediated primer binding to target fragment sequences, leaving the nucleic acid Amplification reaction free from the thermal cycling steps of denaturation, annealing and extension that traditional PCR reactions must undergo, further triggering Polymerase to exponentially amplify the target fragments. The optimal reaction temperature is 37-42 ℃, the reaction speed is high, and the amplification product with a detectable level can be obtained within 10-20 minutes. Aiming at the detection of the RPA amplification product, the real-time fluorescence RPA can monitor the amplification reaction process in real time, but a constant temperature instrument which can excite and detect the fluorescent group is needed, such as a temperature-controllable enzyme labeling instrument or a fluorescence PCR instrument; in contrast, the test strip RPA has lower requirements on hardware conditions, and only needs to complete the temperature-controlled amplification reaction, and then read the test result through the lateral flow chromatography test strip. Therefore, the test strip RPA is more suitable for field detection. At present, the detection process of the bivalve herpesvirus OsHV-1 has dependence on instruments and equipment, and the rapid detection on site cannot be realized.

Disclosure of Invention

The invention mainly aims to provide a universal RPA isothermal amplification primer for the bivalve shellfish infection OsHV-1, which can realize the on-site rapid detection.

The invention also provides a kit containing the universal RPA isothermal amplification primer.

The invention also provides the application of the universal RPA isothermal amplification primer and the kit.

In order to achieve the purpose, the invention adopts the following technical means:

the invention provides a universal RPA nucleic acid isothermal amplification primer of bivalve herpesvirus OsHV-1, which is a complete amplification primer and consists of an upstream primer, a downstream primer and a probe primer;

the upstream primer is shown as SEQ ID NO. 1:

5’- ATTACCGACATGCCTGACAGATTAAAGGTAGATCA -3’；

the downstream primer is shown as SEQ ID NO. 2:

5’-biotin- CTCTTTGCAATTCCTCTTCGTCGGCCATGAGCTCT -3’；

the probe primer is shown as SEQ ID NO. 3:

5’-FAM-GCCATTACCAAAGAGCGAGATTCCGATTTTGT-THF-AAAAGAGTTGTTTCATC-SpC3-3’；

wherein biotin represents a biotin label, FAM represents a carboxyfluorescein label, THF represents a tetrahydrofuran linker formation defect, and SpC3 represents a Spacer C3 modification.

The invention also provides a kit containing the universal RPA nucleic acid isothermal amplification primer.

The invention also provides application of the universal RPA nucleic acid isothermal amplification primer for the bivalve herpesvirus OsHV-1 infection in rapid detection of the bivalve herpesvirus OsHV-1 infection.

Further, the method comprises the following steps:

(1) carrying out nucleic acid isothermal amplification reaction by using an RPA reagent;

(2) and analyzing the RPA amplification product by using a colloidal gold lateral flow immunochromatography test strip, and reading the test strip result.

The nucleic acid isothermal amplification reaction is calculated by 50 mu L, and specifically comprises the following steps: 29.5. mu.L of hydration buffer, 2.5. mu.L of 280 mM magnesium acetate, 2.1. mu.L of each of 10. mu.M forward primer and reverse primer, 0.6. mu.L of probe primer, 5. mu.L of template DNA, 8.2. mu.L of nuclease-free pure water, and incubation at 37 ℃ for 20 minutes.

Further, the specific process of the step (2) is as follows: and adding the 5 mu LRPA amplification product into 95 mu L of diluent for dilution, then dropwise adding the diluted RPA amplification product to the sample adding end of the colloidal gold lateral flow immunochromatographic test strip, and reading the test strip result.

Further, the diluent is 25 mM Tris, 150 mM NaCl and 0.05% Tween-20.

The inventor designs a complete set of isothermal amplification detection primers aiming at different OsHV-1 variants in different species. By carrying out comparison analysis on genome sequences of OsHV-1 variant strains KP412538.1, GQ153938.1, NC _005881.2, MG561751.2, KY242785.1, KY271630.1 and MF509813.1 in GenBank, conserved regions among different OsHV-1 variant strains are determined, and a set of primers are designed aiming at the zero mutation conserved region, so that OsHV-1 of different variant strains can be detected. The RPA complete set constant temperature amplification primer group designed by the invention can reduce the dependency of the detection process on the instrument and equipment, and is better applied to the field rapid detection.

The sensitivity and specificity of the test strip RPA detection method are tested, and the sensitivity test result shows that the sensitivity of the test strip RPA for detecting OsHV-1 is 10 copies/reaction, and the test strip RPA has a wider detection range of at least 10⁸-10¹Samples within the range can be detected. The specificity detection result shows that the test strip RPA detection method can well distinguish OsHV-1 positive samples and negative samples when the method is used for respectively detecting OsHV-1 in oyster larvae, chlamys farreri, scapharca subcrenata and arca inflata reeve, so that the test strip RPA detection method has good specificity and universality.

Compared with the prior art, the invention has the beneficial technical effects that:

1. the RPA complete set constant temperature amplification primer designed by the invention has strong specificity, high sensitivity and accurate detection result.

2. The invention designs universal primers aiming at 7 OsHV-1 variant strains in different bivalve shellfish, and the detected target site has high conservation and no mutant base.

3. The detection method combines the RPA constant temperature amplification technology with the colloidal gold immunochromatographic test strip, can realize the rapid detection of OsHV-1, and can detect and indicate about 10 copies of OsHV-1 positive samples at least. The detection method disclosed by the invention has the advantages of good specificity test result and good stability of a repeatability test, and provides a novel field detection method which is low in cost and does not need special equipment for effectively detecting OsHV-1.

4. The invention can be used as a rapid on-site screening and detecting method of OsHV-1 in the large-scale production process of bivalve shellfish, can also be applied to epidemiological investigation and research of OsHV-1 infection, and has important value and market application prospect.

Drawings

FIG. 1 shows the result of the test strip RPA sensitivity test;

wherein A is the detection result of the sensitivity of the primer combination of the Suite5, and B is the detection result of the sensitivity of the primer combination of the Suite 3.

FIG. 2 shows the test strip RPA test specificity and universality results;

wherein A is an OsHV-1 positive sample, and B is an OsHV-1 negative sample.

Detailed Description

The technical solution of the present invention is further explained and illustrated by the following specific examples.

Example 1: establishment of test strip RPA detection method for rapidly detecting OsHV-1 on site

1. Design of RPA upstream and downstream primers and Probe primer

The genome sequences of OsHV-1 variant strains KP412538.1, GQ153938.1, NC _005881.2, MG561751.2, KY242785.1, KY271630.1 and MF509813.1 are downloaded from NCBI GenBank and are compared and analyzed, the conserved regions among different OsHV-1 variant strains are determined, and a set of primers are designed aiming at the zero mutation conserved regions so as to detect OsHV-1 of different variant strains. Six sets of primers are designed and synthesized respectively in the invention, and are shown in the following table 1.

TABLE 1

2. Clinical sample DNA extraction

All clinical OsHV-1 positive samples used in the present invention were collected and deposited by the laboratory. Total DNA from mantle of bivalve shellfish was extracted using the TIANMP Marine antigens DNA Kit from TIANGEN as described in the specification and finally eluted with 100. mu.l of nuclease-free ultra-pure water. The extracted DNA was stored in a-20 ℃ refrigerator for subsequent use.

3. Test strip RPA test amplification condition optimization

The total DNA sample of the extracted and purified tissue is taken as a template for amplification, and the experimental system is as follows:

mu.L of hydrolysis buffer (hydration buffer, twist Dx nfo Kit, Cambridge, United Kingdom), 2.1. mu.L of forward primer (10. mu.M), 2.1. mu.L of reverse primer (10. mu.M), 0.6. mu.L of probe primer (10. mu.M), 5. mu.L of DNA template, 8.2. mu.L of ddH₂O and 2.5. mu.L of magnesium acetate (280 mM).

The reaction conditions were 37 ℃ and the reaction time was 20 min. After completion, the results were tested using a lateral flow test strip (TS101, GenDx). The system is used for evaluating the synthesized six sets of primer combinations respectively, and the evaluation result shows that the combination of one set of primer (Suite5) can generate the strongest amplification signal, so the set of primer combination is applied to the invention.

And (3) judging the test result of the test strip RPA test: the control line of a sample is positive on the test strip under specific conditions (37 ℃, 20min), and the sample with the positive detection line is a positive sample; the control line on the test strip is positive, and the sample with the negative detection line is a negative sample.

4. Sensitivity detection

Referring to the OsHV-1 taqman qPCR quantification method in the OIE (office International Des episologies) manual, the number of viral copies in positive samples was first quantitatively analyzed. Each of the quantified OsHV-1 DNA samples was diluted 10-fold in gradient (10)⁸-10¹) As a template for the detection sensitivity of the test strip RPA, a primer combination of Suite3 and a primer combination of Suite5 were used for the comparison of the test strip RPA amplification, and the reaction system and conditions were as described in the above 3. The results are shown in FIG. 1, and it can be seen from the sensitivity test results that the Suite5 primer combination is directed to 10²And 10¹OsHV-1 samples with orders of magnitude copies can still show positiveBands, other primer combinations like Suite3 can only indicate not less than 10³For OsHV-1 positive samples with orders of magnitude copies, the sensitivity of the Suite5 primer combination was higher than the other primer combinations.

5. Specific and general purpose assays

Nucleic acids of OsHV-1 positive oyster, scallop, scapharca subcrenata and scapharca broughtonii samples confirmed by an OIE manual and an industry standard oyster herpesvirus I (OsHV-1) type infection diagnosis procedure (SC/T7240-.

As shown in FIG. 2, the primer combination of Suite5 can specifically detect four bivalve OsHV-1 positive samples, and no amplified band exists at the detection line of the OsHV-1 negative samples.

Sequence listing

<110> research institute for aquatic products in yellow sea of China institute for aquatic science

<120> general RPA nucleic acid isothermal amplification primer and kit for herpes virus OsHV-1 infection of bivalves and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attaccgaca tgcctgacag attaaaggta gatca 35

<210> 2

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctctttgcaa ttcctcttcg tcggccatga gctct 35

<210> 3

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gccattacca aagagcgaga ttccgatttt gtaaaagagt tgtttcatc 49

Claims (2)

1. A universal RPA nucleic acid isothermal amplification primer and a probe for bivalve herpesvirus OsHV-1 are characterized in that the primer is a complete set of amplification primer and consists of an upstream primer, a downstream primer and a probe;

the sequence of the upstream primer is as follows:

5’- ATTACCGACATGCCTGACAGATTAAAGGTAGATCA -3’；

the sequence of the downstream primer is as follows:

5’-biotin- CTCTTTGCAATTCCTCTTCGTCGGCCATGAGCTCT -3’；

the sequence of the probe is:

5’-FAM-GCCATTACCAAAGAGCGAGATTCCGATTTTGT

-THF-AAAAGAGTTGTTTCATC-SpC3-3’；

wherein biotin represents a biotin label, FAM represents a carboxyfluorescein label, THF represents a tetrahydrofuran linker formation defect, and SpC3 represents a Spacer C3 modification.

2. A kit comprising the universal RPA nucleic acid isothermal amplification primers and probes of claim 1.

Images