NL2032124B1

NL2032124B1 - FRAGARIA ANANASSA TRANSCRIPTION FACTOR FaBBX21, PROTEIN ENCODED THEREBY, AND USE THEREOF

Info

Publication number: NL2032124B1
Application number: NL2032124A
Authority: NL
Inventors: Wang Xiaorong; Luo Ya; Zhang Yunting; Yue Maolan; Zhang Yong; Jiang Leiyu; Chen Qing; Lin Yuanxiu; Wang Yan; Li Mengyao; Ye Yuntian; Tang Haoru; Liu Zejing; Liu Yongqiang
Original assignee: Univ Sichuan Agricultural
Priority date: 2022-06-10
Filing date: 2022-06-10
Publication date: 2023-12-18

Abstract

The present disclosure belongs to the technical ﬁeld of bioengineering, and in particular relates to a F ragaria ananassa transcription factor FaBBX21, a protein encoded thereby, 5 and use thereof. The transcription factor FaBBX21 of the present disclosure is derived from Fragaria ananassa and is a B-box transcription factor. In the present disclosure, an overeXpression vector is constructed based on the transcription factor FaBBX21 and then transformed into Fragaria ananassa, which can be stably eXpressed and helps to promote the accumulation of anthocyanin in F ragaria ananassa.

Description

FRAGARIA ANANASSA TRANSCRIPTION FACTOR FaBBX21, PROTEIN

ENCODED THEREBY, AND USE THEREOF

TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of bioengineering, and in particular relates to a Fragaria ananassa transcription factor FaBBX21, a protein encoded thereby, and use thereof.

BACKGROUND ART

[02] Anthocyanins are derived from plant flavonoid metabolic pathways and are widely distributed in plant organs such as leaves, flowers, and fruits, making plants colorful and thus attracting insects, birds, and beasts to help plant pollination and seed spread. In addition, anthocyanins are important secondary metabolites that are involved in the resistance of plants to various environmental stresses to adapt to environmental changes. Anthocyanins also have very high nutrition and health values, which can protect the human body from free radicals and play a positive role in anti-inflammation, anti-oxidation, and the like. Therefore, it is of great significance to deeply study a regulatory mechanism of plant anthocyanin metabolism.

[03] Fragaria ananassa has high nutrition values and is widely cultivated worldwide. It has always been one of the important goals of Fragaria ananassa researchers to increase an anthocyanin content in strawberries. Most studies on Fragaria ananassa mainly focus on structural genes and some regulatory factors in anthocyanin synthesis pathways. For example, a key gene MYBI10 for Fragaria ananassa anthocyanin synthesis is expressed under light induction, which further activates the expression of structural genes DFR and UFGT in anthocyanin synthesis pathways.

Upstream of MYB10, FvHY5, a key factor in light signaling, binds to an MYBI10 promoter and positively regulates the expression of MYB10; and FvHY5 also interacts with the protein FvbHLH9 to jointly promote the synthesis of Fragaria ananassa anthocyanins. Fragaria ananassa B-box transcription factors are important regulatory factors for the growth and development of Fragaria ananassa. There are increasingly- thorough functional researches on B-box transcription factor proteins, but most of the functional researches focus on plant photomorphogenesis, flowering control, and response to environmental stresses, and the role of B-box transcription factors in the regulation of anthocyanin synthesis has not been reported.

SUMMARY

[04] The present disclosure is intended to provide a Fragaria ananassa transcription factor FaBBX21, a protein encoded thereby, and use thereof, such as to increase an anthocyanin content in I'ragaria ananassa and improve a quality of strawberries.

[05] The present disclosure provides a protein for regulating plant anthocyanin metabolism, with an amino acid sequence shown in SEQ ID NO: 1.

[06] The present disclosure also provides a nucleic acid encoding the protein described above.

[07] Preferably, a nucleotide sequence of the nucleic acid may include a nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence that has 80% or more homology with the nucleotide sequence shown in SEQ ID NO: 2 and encodes the protein.

[08] The present disclosure also provides a recombinant vector, a gene expression cassette, a transgenic cell line, or a recombinant bacterial strain carrying the nucleic acid described above.

[09] The present disclosure also provides use of the protein described above, the nucleic acid described above, or the recombinant vector, the gene expression cassette, the transgenic cell line, or the recombinant bacterial strain described above in any one of the following A1 to A6:

[010] Al. regulation of plant anthocyanin metabolism;

[011] A2. preparation of a product capable of regulating plant anthocyanin metabolism;

[012] A3. expression of a structural gene for promoting anthocyanin synthesis;

[013] A4. expression of a structural gene for promoting anthocyanin transport;

[014] AS. preparation of a product with the expression of the structural gene for promoting anthocyanin synthesis; and

[015] AG. preparation of a product with the expression of the structural gene for promoting anthocyanin transport.

[016] Preferably, the structural gene for promoting anthocyanin synthesis may include

PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT, and the structural gene for promoting anthocyanin transport may include RAP.

[017] The present disclosure also provides a method for increasing an anthocyanin content in Fragaria ananassa, including the following step: allowing the expression of the nucleic acid described above in a genome of Fragaria ananassa.

[018] Preferably, a method for the expression may include: introducing a recombinant vector carrying the nucleic acid described above into Fragaria ananassa.

[019] The transcription factor FaBBX21 of the present disclosure is derived from

Fragaria ananassa and is a B-box transcription factor. In the present disclosure, an overexpression vector is constructed through polymerase chain reaction (PCR) amplification and homologous recombination and then transformed into Fragaria ananassa for stable expression; and it is found that the overexpression of the transcription factor in Fragaria ananassa can promote the expression of genes PAL,

C4H, 4CL, CHS, CHL F3H, ANS, and UFGT in anthocyanin synthesis and the expression of gene RAP in anthocyanin transport, and the transcription factor has the ability to promote the anthocyanin accumulation in Fragaria ananassa.

BRIEF DESCRIPTION OF THE DRAWINGS

[020] To explain the technical solutions in examples of the present disclosure or in the prior art more clearly, the accompanying drawings required in the examples will be briefly described below.

[021] FIG. 1 is an electropherogram of a PCR amplification product of the Fragaria ananassa gene FaBBX21 in Example 1;

[022] FIG. 2-1 to FIG. 2-4 show schematic maps of the vector and identification results of double enzyme digestion in Example 2;

[023] FIG. 3 shows phenotypes of strawberries in a FaBBX21 transient overexpression group and a control group of Example 3;

[024] FIG. 4 shows the comparison of Fragaria ananassa gene expression level and anthocyanin content between the FaBBX21 transient overexpression group and the control group in Example 3;

[025] FIG. 5 shows the comparison of expression levels of Fragaria ananassa genes

PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT between the FaBBX21 transient overexpression group and the control group in Example 4;

[026] FIG. 6 shows a process of acquiring a FaBBX21-overexpressing transgenic material and the colors of calli and root tissues in Example 5;

[027] FIG. 7 shows the B-glucuronidase (GUS) staining results of the FaBBX21- overexpressing transgenic materials obtained in Example 5;

[028] FIG. 8 shows the results of light cultivation and dark cultivation of FaBBX21- overexpressing Fragaria ananassa calli in Example 6; and

[029] FIG. 9 shows the expression levels of gene FaBBX21 in FaBBX21- overexpressing Fragaria ananassa calli under light cultivation and dark cultivation conditions in Example 6.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[030] The present disclosure provides a protein for regulating plant anthocyanin metabolism, with an amino acid sequence shown in SEQ ID NO: 1.

[031] The protein shown in SEQ ID NO: 1 of the present disclosure is a Fragaria ananassa transcription factor FaBBX21 derived from the Fragaria ananassa variety "Benihoppe". The protein is composed of 308 amino acids, and has a molecular weight of 33.94 kD, a theoretical isoelectric point of 6.59, a molecular formula of

Ci478H2307N4130471S17, an instability index of 50.85, and an overall average hydrophilicity index of - 0.436. The protein is an unstable hydrophilic protein and includes two conserved B-box domains at the N-terminus.

[032] The Fragaria ananassa transcription factor FaBBX21 of the present disclosure is a Fragaria ananassa B-box transcription factor, which can activate the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT and promote the anthocyanin accumulation.

[033] The transcription factor FaBBX21 of the present disclosure can be modified, and a resulting protein that can activate the expression of genes PAL, C4H, 4CL, CHS,

CHI, F3H, ANS, and UFGT and promote the anthocyanin accumulation also falls within the protection scope of the present disclosure. The modification of the present disclosure may preferably refer to the substitution, deletion, and/or addition of one or more amino acid residues for the amino acid sequence shown in SEQ ID NO: 1.

[034] In the present disclosure, a protein that has 80% or more homology with the amino acid sequence shown in SEQ ID NO: 1 or the modified amino acid sequence and can activate the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT and promote the anthocyanin accumulation also falls within the protection scope of the present disclosure.

[035] The present disclosure also provides a nucleic acid encoding the protein described above. A nucleotide sequence of the nucleic acid of the present disclosure may include a nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence that has 80% or more homology with the nucleotide sequence shown in SEQ ID NO: 2 and 5 encodes the protein.

[036] The nucleic acid shown in SEQ ID NO: 2 of the present disclosure has a full length of 927 bp, and encodes the protein shown in SEQ ID NO: 1 in the sequence listing. In the sequence shown in SEQ ID NO: 2 in the sequence listing of the present disclosure, a fragment from position 1 to position 927 at the 5'-terminus is an open reading frame (ORF) of 927 bp. A protein encoded by the nucleic acid can activate the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT and promote the anthocyanin accumulation.

[037] In the present disclosure, a nucleic acid that has 80% or more homology with the nucleic acid shown in SEQ ID NO: 2 and can encode the protein capable of activating the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT and promote the anthocyanin accumulation also falls within the protection scope of the present disclosure.

[038] A recombinant vector, a gene expression cassette, a transgenic cell line, or a recombinant bacterial strain carrying the nucleic acid also falls within the protection scope of the present disclosure.

[039] In the present disclosure, the recombinant vector may include a base vector and the nucleic acid. The base vector of the present disclosure may be preferably pCAMBIA1301, pCAMBIA2301, pBI121, or pGreen 1I-62-SK, and more preferably pCAMBIA1301. In the present disclosure, the nucleic acid may preferably be inserted into the base vector at a multiple cloning site (MCS) to obtain the recombinant vector.

For example, when pCAMBIA 1301 is adopted as a base vector, the nucleic acid may be inserted between restriction sites Xbal and Sall of pCAMBIA 1301. The gene expression cassette of the present disclosure may include a promoter, the nucleic acid, a marker gene, and a terminator; the promoter may be preferably a CaMV35S promoter, a Ubi promoter, or an MAS promoter, and more preferably a CaMV35S promoter; the marker gene may be preferably 3 x Flag, 3 x HA, GFP, or Myc, and more preferably 3 x Flag; and the terminator may preferably be a Nos terminator, an MAS terminator, or a CaMV poly(A) terminator, and more preferably a Nos terminator. The recombinant bacterial strain of the present disclosure may preferably include GV3101, EHA105, or LBA4404, and may more preferably include GV3101.

[040] The recombinant vector, gene expression cassette, transgenic cell line, or recombinant bacterial strain carrying the nucleic acid of the present disclosure can be used to activate the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and

UFGT and promote the anthocyanin accumulation.

[041] The present disclosure also provides use of the protein described above, the nucleic acid described above, or the recombinant vector, the gene expression cassette, the transgenic cell line, or the recombinant bacterial strain described above in any one of the following Al to A6:

[042] Al. regulation of plant anthocyanin metabolism;

[043] A2. preparation of a product capable of regulating plant anthocyanin metabolism;

[044] A3. expression of a structural gene for promoting anthocyanin synthesis;

[045] A4. expression of a structural gene for promoting anthocyanin transport;

[046] AS. preparation of a product with the expression of the structural gene for promoting anthocyanin synthesis; and

[047] AG. preparation of a product with the expression of the structural gene for promoting anthocyanin transport.

[048] The structural gene involved in an anthocyanin synthesis and/or transport pathway of the present disclosure may include PAL, C4H, 4CL, CHS, CHI, F3H, ANS,

UFGT, or RAP. The nucleic acid, recombinant vector, gene expression cassette, transgenic cell line, or recombinant bacterial strain of the present disclosure can express a protein FaBBX21 in Fragaria ananassa, and the protein FaBBX21 acts as a transcription factor to directly or indirectly activate or inhibit the expression of related genes to regulate the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, UFGT, or RAP and promote the anthocyanin synthesis.

[049] The present disclosure also provides a method for increasing an anthocyanin content in a plant, including the following step: allowing the expression of the nucleic acid described above in a genome of the plant.

[050] In the present disclosure, a recombinant vector carrying the nucleic acid may be preferably introduced into the plant, such that the nucleic acid is expressed in the genome of the plant. A construction method of the recombinant vector of the present disclosure may preferably include the following steps:

[051] amplifying the gene FaBBX21 with an amplification primer pair, and inserting the gene into a vector pCAMBIA 1301 at an MCS to obtain the recombinant vector.

[052] In the present disclosure, the amplification primer pair may include an upstream primer FaBBX21-OXF with a sequence shown in SEQ ID NO: 3 and a downstream primer FaBBX21-OXR with a sequence shown in SEQ ID NO: 4. In the present disclosure, the upstream primer FaBBX21-OXF may include an Xbal restriction site, and the downstream primer FaBBX21-OXR may include a Sall restriction site; and the target gene FaBBX21 can be inserted into a modified vector pCAMBIA1301-35S- 3FLAG-NOS through homologous recombination.

[053] In the present disclosure, before the gene FaBBX21 is inserted into the vector pCAMBIA 1301 at the MCS, the vector pPCAMBIA1301 may preferably be modified. A method for the modification of the present disclosure may include: adding an expression cassette CaMV35S-MCS-3FLAG-Nos with a CaMV35S promoter and a Nos terminator to the restriction site EcoRI/HindIll of pCAMBIA1301 to obtain the vector pCAMBIA 1301-35S-3FLAG-NOS shown in B of FIG. 2. In the present disclosure, the gene FaBBX21 may be inserted between the restriction sites Xbal and Sall of the expression cassette, and may be expressed in the plant. In the present disclosure, the vector PCAMBIA 1301-35S-3FLAG-NOS obtained by adding the expression cassette witha CaMV35S promoter and a Nos terminator to the vector pCAMBIA 1301 can make the gene FaBBX21 expressed abundantly in the plant.

[054] In the present disclosure, preferably, the specific amplification primer pair may be designed with a genome of a Fragaria ananassa variety "Camarosa", and then with cDNA of a Fragaria ananassa variety "Benihoppe" as a template, the gene FaBBX21 may be amplified with the specific amplification primer pair. The specific primer pair of the present disclosure may include an upstream primer FaBBX21-F with a sequence shown in SEQ ID NO: 5 and a downstream primer FaBBX21-R with a sequence shown in SEQ ID NO: 6.

[055] The base sequences of the primers of the present disclosure are as follows from

S5'to3"

[056] FaBBX21-OXF:

TCACGCGTGACTAGTTCTAGAAATGGTCTAAACCTCTTGGAGCC;

[057] FaBBX21-OXR:

AAGCTTATCGATACCGTCGACATGAAGATCCAGTGTGACGTGTGC;

[058] FaBBX21-F: ATGAAGATCCAGTGTGACGTGTG; and

[059] FaBBX21-R: AGAACCGGGTTGTTGGAAA.

[060] In the present disclosure, after the recombinant vector is obtained, the freeze- thaw method may preferably be used to transform the recombinant vector into

Agrobacterium tumefaciens (A. tumefaciens) competent cells GV3101, and then a positive A. tumefaciens strain may be selected and subjected to expansion cultivation to obtain a recombinant vector-containing bacterial solution. The present disclosure does not have stringent requirements on the freeze-thaw method, the transformation method, and the expansion cultivation method, and conventional methods can be adopted. In the present disclosure, the expansion cultivation may preferably be stopped when an OD value of the positive A. tumefaciens strain is 0.5 to 0.8.

[061] In the present disclosure, after the recombinant vector-containing bacterial solution is obtained, the recombinant vector-containing bacterial solution may be introduced into a plant to realize the introduction of the recombinant vector. Preferably, a method for the introduction of the present disclosure may be injection, and more preferably, the recombinant vector-containing bacterial solution may be injected into fruits of the plant. The plant of the present disclosure may include Fragaria ananassa.

[062] In the present disclosure, the plant introduced with the recombinant vector may preferably be cultivated under light to promote the expression and accumulation of anthocyanins. An intensity of the light of the present disclosure may preferably be 6,000

Lux.

[063] The transcription factor FaBBX21 of the present disclosure is derived from

Fragaria ananassa and 1s a B-box transcription factor. In the present disclosure, an overexpression vector is constructed through homologous recombination and then transformed into Fragaria ananassa for stable expression; and it is found that the overexpression of the transcription factor in Fragaria ananassa can promote the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT in anthocyanin synthesis and the expression of gene RAP in anthocyanin transport, and the transcription factor has the ability to promote the anthocyanin accumulation in Fragaria ananassa.

[064] In order to further illustrate the present disclosure, the technical solutions provided by the present disclosure are described in detail below in connection with accompanying drawings and examples, but these examples should not be understood as limiting the claimed scope of the present disclosure.

[065] Example 1 Cloning of a Fragaria ananassa gene FaBBX21

[066] A specific primer pair FABBX21-F/R was designed based on a genome of the

Fragaria ananassa variety "Camarosa", and then with cDNA of the Fragaria ananassa variety "Benihoppe" as a template, a high-fidelity PrimeSTAR Max DNA polymerase of

TaKaRa was used to conduct PCR amplification. A PCR procedure was as follows: pre- denaturation at 98°C for 3 min, denaturation for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 30 s, with 35 cycles; final extension at 72°C for 5 min; and storage at 4°C. An amplification system of 50 pL in total was as follows: 2 uL of cDNA template, 2 uL of upstream primer, 2 uL of downstream primer, 25 pL of high-fidelity enzyme

MIX, and the balance of sterile water.

[067] An amplification product was subjected to 1% agarose electrophoresis, then purification was conducted through gel extraction, and a target band was recovered, cloned into a pEASY-Blunt cloning vector of TransGen Biotech, and transformed into

Escherichia coli (E. coli) Trans T1; the E. coli was coated on an LB solid medium with 50 mg/L kanamycin, and cultivated overnight at 37°C; and then single colonies were picked and subjected to colony PCR. A colony PCR procedure was as follows: pre- denaturation at 94°C for 3 min, denaturation for 10 s, annealing at 55°C for 10 s, and extension at 72°C for 30 s, with 35 cycles; final extension at 72°C for 5 min; and storage at 4°C. An amplification system of 50 pL in total was as follows: 2 uL of bacterial solution template, 2 uL of primer M13-F, 2 uL of primer M13-R, 25 uL of PCR enzyme

MIX, and the balance of sterile water. The recombinant bacteria confirmed as positive clones by electrophoresis (denoted as pEASY-Blunt-FaBBX21) were sent to a biological company for sequencing. The electrophoresis results of PCR amplification of FaBBX21 were shown in FIG. 1. Sequencing results showed that the amplified target gene had a full length of 927 bp and a specific nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing. The target gene could encode a protein shown in SEQ ID NO: 1 in the sequence listing; and the protein shown in SEQ ID NO: 1 was composed of 308 amino acids. The gene was named FaBBX21.

[068] Example 2 Construction of a Fragaria ananassa FaBBX21 gene expression vector

[069] With a positive cloning plasmid (pEASY-Blunt-FaBBX21) sequenced in

Example 1 as a template, an amplification primer pair (FaBBX21-OXF:

S'TCACGCGTGACTAGTTCTAGAAATGGTETAAACCTCTTGGAGCC-3'; and

FaBBX21-OXR: 5'AAGCTTATCGATACCGTCGACATGAAGATCCAGTGTGACGTGTGC-3') and a high-fidelity PrimeSTAR Max DNA polymerase of TaKaRa were used to conduct PCR amplification. A PCR procedure was as follows: pre-denaturation at 98°C for 3 min, denaturation for 10 s, annealing at 60°C for 15 s, and extension at 72°C for 30 s, with 35 cycles; final extension at 72°C for 5 min; and storage at 4°C. An amplification system of 50 pL in total was as follows: 2 pL. of cDNA template, 2 pL of upstream primer, 2 pL. of downstream primer, 25 pL of high-fidelity enzyme MIX, and the balance of sterile water.

[070] An amplification product was subjected to 1% agarose electrophoresis, then purification was conducted through gel extraction, and a target band was recovered and inserted into a modified plasmid pCAMBIA1301-35S-3FLAG-NOS (which was obtained by adding an expression cassette with a CaMV35S promoter and a Nos terminator to an MCS of a vector pCAMBIA 1301, as shown in FIG. 2-1) to obtain a recombinant vector pPCAMBIA1301-35S-FaBBX21-3FLAG-NOS (as shown in FIG. 2- 2 and FIG. 2-3). A ligation system of 20 uL in total was as follows: 5 pL of linearized vector fragment, 2 uL of inserted fragment, 2 uL of recombinase, 4 uL of 5xBuffer, and the balance of sterile water; and the ligation was conducted at 37°C for 30 min.

[071] The recombinant vector was verified by double-enzyme digestion. An enzyme digestion system of 50 pL in total was as follows: 5 pL of plasmid, 1 pL of endonuclease

Sall, 1 pL of endonuclease EcoRI, 5 uL of 10xBuffer, and the balance of sterile water; and the double-enzyme digestion was conducted at 37°C for 2 h. The double-enzyme digestion verification results were shown in FIG. 2-4. It can be seen from FIG. 2-4 that, after the double-enzyme digestion of the recombinant vector, a total of 3 target bands respectively of 12,688 bp, 861 bp, and 449 bp were obtained, indicating that the target fragment was successfully recombined into the vector.

[072] Example 3 Transient expression of the gene FaBBX21 in strawberries

[073] With reference to the instructions of GV3101 transformation (Shanghai Weidi

Biotechnology Co., Ltd., CAT#: AC1001), the recombinant vector pCAMBIA1301- 35S-FaBBX21-3FLAG-NOS of Example 2 was transformed into A. tumefaciens

GV3101; then the A. fumefaciens was coated on a YEP solid medium, and cultivated at 28°C for 3 d; positive A. tumefaciens strains were selected and subjected to expansion cultivation at 28°C under shaking; when OD was 1.0, bacterial cells were enriched and then washed and resuspended with an MS liquid (including 10 mmol L*! MES, 10 mmol: Lt MgCl, and 20 g-L™! sucrose), then acetosyringone (250 pmol-L™) was added, and activation was allowed in a shaker (with a rotational speed of 50 r:min"!) at 28°C for 3 h; an OD value of a bacterial solution was adjusted to 0.8, and then the bacterial solution was injected into strawberries of "Benihoppe" (the fruit flesh was red under natural conditions) and "Xiaobai" (the fruit flesh was white under natural conditions) (specifically, the bacterial solution was drawn with a 1 mL syringe and then injected along a strawberry button, and the injection was stopped when there were water spots on a surface of a strawberry), the injected strawberries were incubated in a 25°C incubator in the dark for 24 h and then incubated at room temperature for 7 d under light; and a phenotype was observed, and an expression level of the gene FaBBX21 and a content of anthocyanin were determined. Strawberries of "Benihoppe" and "Xiaobai" transformed with an empty vector pPCAMBIA1301-35S-MCS-3FLAG were adopted as blank controls.

[074] The expression level of the gene FaBBX21 was determined as follows: Total

RNA was extracted from strawberries by the cetyltrimethylammonium bromide (CTAB) method. The RT EasyTM II cDNA first-strand synthesis kit from Chengdu Foregene

Biotechnology Co., Ltd. was adopted as a reverse transcription kit, and the SYBR Green

Iwas adopted as PCR Mix. The Fragaria ananassa FaACTIN gene (accession number:

AB116565.1) was adopted as an internal reference correction gene. A fluorescence quantitative PCR instrument was CFX96 from Bio-Rad, and a reaction system of 10 uL in total was as follows: 5 uL of SYBR Green I Mix, 1 uL of each of upstream and downstream primers for fluorescence quantification, 1 uL of cDNA template of a strawberry sample to be tested, and the balance of water. A PCR procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with 40 cycles in total. A relative expression level was calculated by the 2"*4“T method.

[075] An anthocyanin content was determined by the pH differential method.

Specifically: acetone, methanol, water, and glacial acetic acid were mixed in a ratio of 60 ml : 60 ml : 30 ml : 15 ml to prepare an anthocyanin extracting solution; about 0.5 g (fresh weight) of an appropriate material was taken and ground with liquid nitrogen, then 5 ml of the anthocyanin extracting solution was added, and leaching was allowed overnight at 4°C in the dark; and a resulting extract solution was centrifuged at a maximum speed for 10 min, and a resulting supernatant was collected for measurement.

A same sample was diluted 10-fold with pH 4.5 NaAc buffer and pH 1.0 KCI buffer, and the absorbance was determined at 496 nm and 700 nm, where the zero adjustment was conducted with double distilled water. The anthocyanin content was mainly represented by pelargonidin-3-glucoside, and a calculation formula was as follows: anthocyanin content (mg-g™) = (Ao-Ar) x V x n x M/(e * m), where Ao represents A496 1m-A700 nm at a pH of 1.0; A: represents A496 nm-A700 nm at a pH of 4.5; V represents a volume of the extracting solution (ml); n represents a dilution factor; M represents a molar mass of pelargonidin-3-glucoside and is 433.2; & represents a light absorption coefficient of 15,600; and m represents a mass of a sample (g).

[076] The phenotype observation results were shown in FIG. 3, and the detection results of FaBBX21 gene expression and anthocyanin content were shown in FIG. 4. It can be seen from FIG. 3 and FIG. 4 that a relative expression level of the FaBBX21 gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 52 times that in the control group; and a relative expression level of the FaBBX21 gene in FaBBX21 gene- overexpressing "Xiaobai" strawberries was 251 times that in the control group. The overexpression of the FaBBX21 gene in the present disclosure increased the anthocyanin content in "Benihoppe" and "Xiaobai" strawberries, where an anthocyanin content in "Benihoppe" strawberries was 655.25 ug gt, which was 1.7 times higher than that in the control group; and an anthocyanin content in "Xiaobai" strawberries was 203.64 ug-g™!, which was 3.7 times higher than that in the control group.

[077] Example 4 Influence of the overexpression of the FaBBX21 gene on the expression of the genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT and the anthocyanin transport gene RAP

[078] A specific implementation process was the same as in Example 3, except that only the transient expression study was conducted in "Benihoppe" strawberries, and "Benihoppe" strawberries transformed with an empty vector pCAMBIA1301-35S-

MCS-3FLAG was adopted as a blank control.

[079] A method for determining an expression level of the PAL gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the PAL gene were SEQ ID NO: 7 (PAL-F):

TTGAAGCTCATGTCTTCCAC, and SEQ ID NO: 8 (PAL-R):

CAAGTTCTCCTCCAAATG; and the 2°\ACT method was used to calculate a relative expression level.

[080] A method for determining an expression level of the C4H gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the C4H gene were SEQ ID NO: 9 (C4H-F): TGCCCTTGGCTTCATGACT, and SEQ ID NO: 10 (C4H-R): GCTTGACACTACGGAGAAAGGT; and the 27¢T method was used to calculate a relative expression level. A method for determining an expression level of the 4CL gene was as follows: a specific implementation process was the same as in Example 3, except that quantification primers for the 4CL gene were SEQ

ID NO: 11 (4CL-F): GTAGCCAAATCATGAAAGG, and SEQ ID NO: 12 (4CL-R):

GTCGATGTACCCTATATCACC: and the 2-**“T method was used to calculate a relative expression level.

[081] A method for determining an expression level of the CHS gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the CHS gene were SEQ ID NO: 13 (CHS-F):

GCTGTCAAGGCCATTAAGGA, and SEQ ID NO: 14 (CHS-R):

GAGCAAACAACGAGAACACG; and the 2°**T method was used to calculate a relative expression level.

[082] A method for determining an expression level of the CHI gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the CHI gene were SEQ ID NO: 15 (CHI-F):

AGGGGGATGGAGATACAGGG, and SEQ ID NO: 16 (CHIR):

CCGTCTTGCCCTTCCACTTA; and the 2°*ACT method was used to calculate a relative expression level.

[083] A method for determining an expression level of the F3H gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the F3H gene were SEQ ID NO: 17 (F3H-F):

ATCACCGTTCAACCTGTGGAAG, and SEQ ID NO: 18 (F3H-R):

TCTGGAATGTGGCTATGGACAAC; and the 2°**¢T method was used to calculate a relative expression level.

[084] A method for determining an expression level of the ANS gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the ANS gene were SEQ ID NO: 19 (ANS-F):

GAAGTGCGTACCCAACTCCATCGT, and SEQ ID NO: 20 (ANS-R):

ACCTTCTCCTTGTTGACGAGCCC; and the 2°**“T method was used to calculate a relative expression level.

[085] A method for determining an expression level of the UFGT gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the UFGT gene were SEQ ID NO: 21 (UFGT-F):

CTACTACCATGGGTTGGTCC, and SEQ ID NO: 22 (UFGT-R):

GTATTGTCCCAAAATGGCCC; and the 2°ACT method was used to calculate a relative expression level.

[086] A method for determining an expression level of the RAP gene was as follows: a specific implementation process was the same as in Example 3, where quantification primers for the RAP gene were SEQ ID NO: 23 (RAP-F):

CAAGTTCCAGCAATCGAAGA, and SEQ ID NO: 24 (RAP-R):

TGGGAAGGATCACAAGTTGA: and the 2°**“T method was used to calculate a relative expression level.

[087] The gene expression levels of PAL, C4H, 4CL, CHS, CHI, F3H, ANS, UFGT, and RAP were shown in FIG. 5, and it can be seen from FIG. 5 that a relative expression level of the PAL gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 1.4 times higher than that in the control group; a relative expression level of the C4H gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 3.7 times higher than that in the control group; a relative expression level of the 4CL gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 2.5 times higher than that in the control group; a relative expression level of the CHS gene in FaBBX21 gene- overexpressing "Benihoppe" strawberries was 3.2 times higher than that in the control group; a relative expression level of the CHI gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 2.6 times higher than that in the control group; a relative expression level of the F3H gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 1.5 times higher than that in the control group; a relative expression level of the ANS gene in FaBBX21 gene-overexpressing "Benihoppe" strawberries was 2.1 times higher than that in the control group; a relative expression level of the UFGT gene in FaBBX21 gene-overexpressing "Benthoppe" strawberries was 2.9 times higher than that in the control group; and a relative expression level of the RAP gene in

FaBBX21 gene-overexpressing "Benihoppe" strawberries was 3.2 times higher than that in the control group. The overexpression of the gene FaBBX21 of the present disclosure can increase the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT in "Benihoppe" strawberries, thereby promoting the anthocyanin accumulation in strawberries.

[088] Example 5 Genetic transformation of the Fragaria ananassa gene FaBBX21

[089] Robust “Benihoppe" Fragaria ananassa leaves growing on a 1/2 MS medium were selected and punched with a leaf disc diameter of about 4 mm, and resulting leaf discs were cultivated in a pre-medium (an MS solid medium including 2 mg L*t TDZ, 0.5mg L1 IBA, and 20 g-L*? sucrose, pH 5.8) in the dark for 3 d. Positive A. tumefaciens carrying the FaBBX21 overexpression plasmid in Example 3 was subjected to expansion cultivation until OD was 0.5, then bacterial cells were enriched and washed twice with an equal volume of an MS liquid, acetosyringone (100 pumol-L) was added, and activation was allowed at 28°C for 3 h in a shaker (with a rotational speed of 50 r min” 1). The leaf discs obtained after the pre-cultivation were subjected to infection in an activated bacterial solution for 15 min, during which the activated bacterial solution was gently shaken. After the infection was completed, the bacterial solution on a surface of the leaf discs was removed, and then the leaf discs were cultivated in a co-cultivation medium (an MS solid medium including 2 mg Lt TDZ, 0.5 mg-L! IBA, 100 pmol-L™!

AS, and 20 g Lt sucrose, pH 5.5) for 3 d in the dark; after the co-cultivation was completed, the leaf discs were transferred to a bacteriostatic medium (an MS solid medium including 2 mg L-t TDZ, 0.5 mg-L IBA, 500 mg-L! Carbenicillin, and 20 g L° t sucrose, pH 5.8) and cultivated for 7 d in the dark, and then transferred to a selection medium (an MS solid medium including 2 mg Li TDZ, 0.5 mg :L* IBA, 500 mg L*

Carbenicillin, 10 mg-L™! Hygromycin B, and 20 g Lt sucrose, pH 5.8) and cultivated under light until a large number of resistant calli and transgenic plants were obtained, where during the selection cultivation, the selection medium was changed every 20 d; and the transgenic Fragaria ananassa plants were cultivated in a 1/2 MS medium for rooting and seedling boosting. The colors of calli and root tissues were observed, and results were shown in FIG. 6, where A is for the calli in the pre-cultivation stage; B is for the obtained Fragaria ananassa resistant calli, and specifically, the upper panel is for the FaBBX21-overexpressing calli and the lower panel is for the wild-type (WT) control calli; C is for the WT Fragaria ananassa root tissues; D is for the FaBBX21- overexpressing Fragaria ananassa root tissues; and E shows the comparison of

FaBBX21-overexpressing Fragaria ananassa plants with the WT plant, where #1 to #3 (denoted as 35Spro::FaBBX21-3FLAG) are the results of genetic transformation with the positive A. tumefaciens carrying the FaBBX21 overexpression plasmid in Example 3.

[090] It can be seen from FIG. 6 that, the resistant calli regenerated from Fragaria ananassa turned red, and the red calli were further differentiated into Fragaria ananassa plants; and the FaBBX21-overexpressing Fragaria ananassa root tissue was red, but the

WT Fragaria ananassa plant was white.

[091] According to the instructions of the GUS staining kit (Coolaber, CAT#: 37165), with the cultivated resistant calli and transgenic plant root tissues as experimental groups and the callus and root tissue of WT Fragaria ananassa as control groups, fresh materials to be stained were completely immersed in a GUS staining solution and subjected to static staining at 37°C for 12 h in the dark, then the staining solution was removed, 70% ethanol was added to allow decoloration 2 to 3 times until a background color faded, and the materials were observed and photographed. Staining results were shown in FIG. 7. It can be seen from FIG. 7 that the resistant callus regenerated from the FaBBX21-overexpressing Fragaria ananassa in the present disclosure was a positive callus.

[092] Example 6 Light treatment of transgenic Fragaria ananassa calli

[093] The FaBBX21 gene-overexpressing Fragaria ananassa calli with prominent and consistent growth conditions in Example 4 were selected, and a callus transformed with an empty vector was adopted as a control. The above calli were subcultivated in a

Fragaria ananassa callus medium (an MS solid medium including 4 mg Li TDZ, 0.5 mg Lt IBA, 10 mg L™! Hygromycin B, and 20 g-L™! sucrose, pH 5.8), with each callus inoculated into 8 flasks; after the calli were cultivated at 23°C in the dark for two weeks, half of the materials were taken out and subjected to light treatment for 7 d at a light intensity of about 6,000 lux; and a phenotype was observed, and an expression level of the FaBBX21 gene was determined according to the method described in Example 3.

The phenotype and expression level determination results were shown in FIG. 8 and

FIG. 9. It can be seen from FIG. 8 and FIG. 9 that the FaBBX21-overexpressing

Fragaria ananassa calli can promote the anthocyanin accumulation, and the anthocyanin accumulation ability under light conditions is significantly improved.

[094] The transcription factor FaBBX21 provided in the present disclosure can promote the expression of genes PAL, C4H, 4CL, CHS, CHI, F3H, ANS, and UFGT in anthocyanin synthesis and the expression of gene RAP in anthocyanin transport, and has the ability to promote the anthocyanin accumulation in Fragaria ananassa.

[095] Although the present disclosure has been described in detail through the above examples, the examples are only a part rather than all of the examples of the present disclosure. All other examples obtained by a person based on these examples without creative efforts shall fall within a protection scope of the present disclosure.

SEQUENCE LISTING

<110> Sichuan Agricultural University <120> FRAGARIA ANANASSA TRANSCRIPTION FACTOR FaBBX21, PROTEIN

ENCODED THEREBY, AND USE THEREOF <130> HKJP202110766 <160> 24 <170> Patentln version 3.5 <210> 1 <211> 308 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of the protein encoded by FaBBX21 <400> 1

Met Lys Ile Gln Cys Asp Val Cys Asn Lys Asp Glu Ala Ser Val Phe 1 5 10 15

Cys Thr Ala Asp Glu Ala Ala Leu Cys Asp Gly Cys Asp His Arg Val 20 25 30

His His Ala Asn Lys Leu Ala Ser Lys His Gln Arg Phe Ser Leu Ile

His Pro Ser Ser Ser Lys Leu Ser Pro Leu Cys Asp Ile Cys Gln Glu 50 55 60

Arg Arg Ala Phe Leu Phe Cys Gln Gln Asp Arg Ala Ile Leu Cys Arg 65 70 75 80

Glu Cys Asp Val Pro Ile His Ser Thr Asn Gln His Thr Gln Lys His 85 90 95

Asn Arg Phe Leu Phe Thr Gly Val Lys Leu Ser Ala Thr Ser Thr Val 100 105 110

Tyr Thr Ser Thr Glu Ser Ala Ala Val Thr Asp Pro Lys Pro Gln Pro 115 120 125

Leu Ile Asn Lys Gln Gln Pro Val Pro Val Ser Ser Ser Ile Ser Asn 130 135 140

Pro Phe Ser Val Pro Lys Ile Ser Thr Thr Thr Thr Thr Thr Thr Val 145 150 155 160

Pro Lys Thr Ser Thr Ser Thr Lys Ser Gly Ala Ser Leu Ile Pro Asn 165 170 175

Asp Gly Val Gly Ser Met Ser Ser Ile Ser Glu Tyr Leu Thr Glu Thr 180 185 190

Leu Pro Gly Trp His Val Glu Asp Leu Leu Asp lle Ser Ser Asn His 195 200 205

Pro Phe Gly Phe Cys Lys Ala Asp Asn Glu Ala Leu Pro Phe Phe Asp 210 215 220

Asp Asp Ile Gln Ser Asn Leu Ser Ser Phe Ser Ser Glu Asn Leu Gly 225 230 235 240

Ile Trp Val Pro Lys Ala Arg Asn Pro Ser Leu Gln His Ser Gln Met 245 250 255

Gly Phe Lys Glu Ala Thr Lys Glu Ala Ala Thr Asn Met Asn Met Thr 260 265 270

Lys Ala Asn Tyr Asn Ser Asn Tyr Ile Ser Met Trp Asn Val Asp Asp 275 280 285

Ser Phe Thr Val Pro Gln Ile Ser Pro Pro Ser Val Gly Ser Lys Arg 290 295 300

Phe Arg Pro Phe 305 <210> 2 <211> 927 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of FaBBX21 <400> 2 atgaagatcc agtgtgacgt gtgcaacaag gacgaagcgt cggtgttctg caccgccgac 60 gaggctgctc tctgegacgg ctgcgaccac cgtgtccacc atgccaataa getegcctcc 120 aaacatcaac gcttetcect catccacccc tcctettcca aactctcccc tctctgcgat 180 atctgccagg agagacgagc titcttgttc tgtcagcagg acagagcaat cttatgtaga 240 gagtgtgacg ttccgattca ctctacaaac caacacacac agaagcataa tcgctttett 300 ttcacagggg tcaagctcte tgctacctct acagtttaca catctactga gtetgetgeg 360 gttactgatc ccaagcctca gcetttgatc aacaagcagc agcctgttcc agtttectca 420 tctatttcaa atccettttc agttcccaag atttcaacta ctactactac tactacagtt 480 cccaagacct caactagtac taaaagtggt gcaagtttga taccaaatga tggggttgga 540 tcaatgagta gcatatcaga gtatttgact gagacgcttc cgggttggea cgttgaggac 600 cttcttgata tttcctctaa ccatcccttt ggtttctgta aggctgacaa tgaagettta 660 ccctttttcg atgatgatat ccaaagcaat ctcagctctt tctcgtcaga gaacctgggg 720 atttgggtcc ctaaagcacg aaatccttct cttcaacatt cacaaatggg gttcaaagag 780 gctacaaagg aggctgctac aaatatgaac atgaccaaag ccaactataa cagcaattac 840 atatcaatgt ggaacgtcga cgatagcttc acagttcctc agattagtcc tccatctgtt 900 ggctccaaga ggtttagacc attttga 927 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Primer FaBBX21-OXF <400> 3 tcacgcgtga ctagttctag aaatggtcta aacctcttgg agcc 44

<210> 4 <211> 45 <212> DNA <213> Artificial Sequence

<220> <223> Primer FaBBX21-OXR

<400> 4 aagcttatcg ataccgtcga catgaagatc cagtgtgacg tgtgc 45 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer FaBBX21-F <400> 5 atgaagatcc agtgtgacgt gtg 23

<210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer FaBBX21-R <400> 6 agaaccgggt tgttggaaa 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Primer PAL-F <400> 7 ttgaagctca tgtcttccac 20 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer PAL-R

<400> 8 caagttctcc tccaaatg 18 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer C4H-F <400> 9 tgcccttggc ttcatgact 19

<210> 10 <211> 22

<212> DNA <213> Artificial Sequence <220> <223> Primer C4H-R <400> 10 gcttgacact acggagaaag gt 22

<210> 11 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Primer 4CL-F <400> 11 gtagccaaat catgaaagg 19 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer 4CL-R

<400> 12 gtcgatgtac cctatatcac Cc 21

<210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer CHS-F <400> 13 gctgtcaagg ccattaagga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer CHS-R <400> 14 gagcaaacaa cgagaacacg 20

<210> 15 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Primer CHI-F

<400> 15 agggggatgg agatacaggg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer CHI-R <400> 16 ccgtcttgcc cttccactta 20

<210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer F3H-F <400> 17 atcaccgttc aacctgtgga ag 22 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Primer F3H-R <400> 18 tctggaatgt ggctatggac aac 23 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer ANS-F

<400> 19 gaagtgcgta cccaactcca tcgt 24 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer ANS-R <400> 20 accttetcct tgttgacgag cee 23

<210> 21 <211> 20

<212> DNA <213> Artificial Sequence <220> <223> Primer UFGT-F <400> 21 ctactaccat gggttggtcc 20

<210> 22 <211> 20 <212> DNA <213> Artificial Sequence

<220> <223> Primer UFGT-R <400> 22 gtattgtcee aaaatggccc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer RAP-F

<400> 23 caagttccag caatcgaaga 20

<210> 24

<211> 20

<212> DNA <213> Artificial Sequence

<220>

<223> Primer RAP-R <400> 24 tgggaaggat cacaagttga 20

Claims

Conclusions L Protein for regulating plant anthocyanin metabolism, having an amino acid sequence shown in SEQ ID NO: 1.

2. Nucleic acid encoding the protein according to claim 1.

The nucleic acid of claim 2, wherein a nucleotide sequence of the nucleic acid comprises a nucleotide sequence shown in SEQ ID NO: 2, or a nucleotide sequence that has 80% or more homology to the nucleotide sequence shown in SEQ ID NO: 2, and codes for the protein.

A recombinant vector, a gene expression cassette, a transgenic cell line or a recombinant bacterial strain carrying the nucleic acid according to claim 2 or 3.

Use of the protein according to claim 1, the nucleic acid according to claim 2 or 3, or the recombinant vector, the gene expression cassette, the transgenic cell line or the recombinant bacterial strain according to claim 4 in any of the following A1-A6:

Already. regulation of plant anthocyanin metabolism;

A2. preparation of a product capable of regulating plant anthocyanin metabolism;

A3. expression of a structural gene for promoting anthocyanin synthesis;

A4. expression of a structural gene for promoting anthocyanin transport;

A5. preparation of a product expressing the structural gene for promoting anthocyanin synthesis; and

A6. preparation of a product with the expression of the structural gene for promoting anthocyanin transport.

Use according to claim 5, wherein the structural gene for promoting anthocyanin synthesis comprises PAL, C4H, 4CL, CHS, CHI, F3H, ANS and UFGT; and includes the structural gene for promoting anthocyanin transport RAP.

A method for increasing an anthocyanin content in Fragaria ananassa, the method comprising the following step: allowing the expression of the nucleic acid according to claim 2 or 3 in a genome of Fragaria ananassd.

A method according to claim 7, wherein a method of expression comprises: introducing into Fragaria ananassa a recombinant vector carrying the nucleic acid according to claim 2 or 3.