NL2024510A - Multiplex real-time fluorescence pcr detection primer composition and detection method for identifying streptococcus suis and swine pasteurella multocida - Google Patents
Multiplex real-time fluorescence pcr detection primer composition and detection method for identifying streptococcus suis and swine pasteurella multocida Download PDFInfo
- Publication number
- NL2024510A NL2024510A NL2024510A NL2024510A NL2024510A NL 2024510 A NL2024510 A NL 2024510A NL 2024510 A NL2024510 A NL 2024510A NL 2024510 A NL2024510 A NL 2024510A NL 2024510 A NL2024510 A NL 2024510A
- Authority
- NL
- Netherlands
- Prior art keywords
- suis
- pasteurella multocida
- probe
- streptococcus suis
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the technical field of molecular biological bacterial strain detection, and particularly relates to a multiplex real-time fluorescence PCR detection primer 5 composition for identifying Streptococcus suis and Swine pasteurella multocida and a detection method. The present invention can realize precise quantification while providing qualitative detection for Streptococcus suis and Swine pasteurella multocida, and is high in amplification efficiency, high in sensitivity, high in precision rate, good in repeatability, and short in detection cycle. This method can complete detection in 1.5h and can realize real-time monitoring, has 10 very high feasibility and application prospect. It provides a scientific and reliable method for identifying pathogenic microorganism and reducing economic loss of breeding. 17
Description
TECHNICAL FIELD The present invention relates to the technical field of molecular biological bacterial strain detection, specifically relates to a multiplex real-time fluorescence PCR detection primer composition for identifying Streptococcus suis and swine pasteurella multocida, and also relates to a detection method using the detection primer composition.
BACKGROUD Swine Streptococcus suis (Suis) a kind of acute anthropozoonosis caused by multiple serum streptococcus groups, is severe in epidemic situation when breaking out. It is fast to propagate, and the body temperature of infected pigs rises to higher than 41°C suddenly. The typical symptoms of infected pigs are rarely seen, causing death in several hours. Streptococcus suis has 35 serum types, some serum types may cause morbidity of pigs, and may also cause morbidity of people. Swine Streptococcus suis is defined as the second class animal epidemic disease in China, not only causing great threat to the pig husbandry of the world, but also endangering the safety of public health. Because symptom lesion of this disease is relatively complicated, combination with clinical data according to pathological change generally may be only taken as primary diagnosis, and laboratory diagnosis is further needed to make a definite diagnosis. Clinical diagnosis is easily confused with swine fever, swine erysipelas and paratyphoid fever. Pathogen is detected from nasal drops, saliva, blood, muscle, viscera and swollen joints of infected pigs.
Swine pasteurella multocida (PM), a kind of important zoonotic pathogen capable of causing injection and morbidity of animals and humans, can trigger a high-mortality disease, swine plague, is popular all around the world, and generally occurs in large-scale pig farms of China. Outbreak of pasteurella multocida has serious harm to the health of humans and animals, and causes huge economic loss to the pig husbandry of the world. Currently, a conventional pathogen isolation method is generally adopted by veterinarians at home for diagnosis of the disease in clinical application, which is not only complicated and time-consuming, but also low in sensitivity.
Establishment of a method targeted to research and rapid detection of Streptococcus suis and swine pasteurella multocida is a key for successful prevention and treatment. Considering that Streptococcus suis and swine pasteurella multocida are both important common pathogens of porcine respiratory diseases, and are generally mixed infection, while conventional diagnosis technologies such as bacteria isolation and immunologic tests waste time and labor, is not suitable for rapid clinical diagnosis, and also is not suitable for large-scale epidemiological survey, along with rapid development of a molecular biological technology, many detection 1methods are established targeted to the nucleic acid of pathogenic microorganism, including PCR detection technology, nucleic acid probe hybridization technology, loop-mediated isothermal amplification (LAMP) and the like. PCR technology is one of important research means for molecular biology, and the method is time-saving, simple and convenient, economical and practical, and greatly increases the detection efficiency of clinical samples. On the basis of simplex PCR, many new PCR technologies are established, such as multiplex PCR technology, real-time fluorescence quantitative PCR technology, multiplex fluorescence quantitative PCR technology and reverse transcription PCR technology.
For example, CN 108315401 A discloses a triplex PCR primer, a method and a kit for detecting Streptococcus suis type, Swine pasteurella multocida and Haemophilus parasuis. While real-time fluorescence quantitative PCR is generally regarded as a qualitative leap of the PCR diagnosis technology. A duplex fluorescence PCR detection method established by taking Streptococcus suis and swine pasteurella multocida as research objects is still absent in the prior art. Because the size of common PCR amplified segments is generally 150-1000bp, fluorescence PCR not only requires that primer G+C content is 40%-60%, but also requires that the size of an amplified segment is 100-300bp on the best, then, these is a higher requirement for fluorescence PCR. Therefore, not all genes of common multiplex PCR may be detected by using multiplex fluorescence PCR, which brigs a new problem for development of the multiplex fluorescence PCR detection technology.
SUMMARY In order to solve the foregoing problem that a duplex fluorescence PCR detection method established by taking Streptococcus suis and swine pasteurella multocida as research objects is absent in the prior art, the present invention provides a fluorescence PCR detection primer composition used for identifying Streptococcus suis and swine pasteurella multocida.
The present invention also provides a fluorescence PCR detection method for identifying Streptococcus suis and swine pasteurella multocida. The method has high specificity and selectivity, and is high in amplification efficiency, high in sensitivity, high in accuracy, good in reproducibility, and short in detection cycle, is capable of detecting DNA amplified reaction in real time, and thus has very high feasibility and application prospect.
gdh gene is a recently discovered factor related to virulence of Streptococcus suis, belongs to the glutamate dehydrogenase protein family, is exposed on cell walls of thalli, and has an important meaning for pathogenicity of bacteria. Nucleotide sequences of gdh genes among different serum types of Streptococcus suis are highly conservative, homology is about 96%-100%, the proteantigen may be taken as an important symbolic antigen for detecting Streptococcus suis, can accurately detect infection of Streptococcus suis, and thus has an important meaning for the epidemiology study of the disease.
pIpE gene exists in PM of all serum types, and is specific conservative gene of the 2bacterium, the sequence similarity of plpE genes of PM of different serum types is more than 92%, as a result, plpE gene is suitable for PM pathogen detection.
In order to achieve the foregoing purpose, the present invention adopts the following technical scheme: A multiplex fluorescence PCR detection primer composition for identifying Streptococcus suis and swine pasteurella multocida includes Streptococcus suis specific upstream and downstream primers and a specific probe, swine pasteurella multocida specific upstream and downstream primers and a specific probe, and bacteria-universal upstream and downstream primers and a probe, with nucleotide sequences as follows respectively: a Streptococcus suis specific upstream primer _ Suis-gdh QF: 5- CCTCCGCCAGTTTGATGC -3', the nucleotide sequence is as shown in SEQ ID NO. 1; a Streptococcus suis specific downstream primer Suis-gdh QR: 5- GAAGGATTTACCGTTTGCTGC -3’, the nucleotide sequence is as shown in SEQ ID NO.2; a Streptococcus suis specific probe Suis-gdh QP: 5'- X4- TCATTGATCCGCCCAGAAGCA -Y;-3, the nucleotide sequence is as shown in SEQ ID NO.3; a Swine pasteurella multocida specific upstream primer PM QF: 5- TAGTTGCATGTAGCGGTGGT -3’, the nucleotide sequence is as shown in SEQ ID NO.4; a Swine pasteurella multocida specific downstream primer PM QR: 5- AGGGGCTTGAAAGGAGGA -3', the nucleotide sequence is as shown in SEQ ID NO.5; a Swine pasteurella multocida specific probe PM QP: 5-Xz- CGCTGGAAATCGTGCTGACC —Y2-3’, the nucleotide sequence is as shown in SEQ ID NO.6; a bacteria-universal upstream primer 16SF: 5- CGTATTACCGCGGCTGCTGG 3’, the nucleotide sequence is as shown in SEQ ID NO.7; a bacteria-universal downstream primer 16SR: 5’- GATTAGATACCCTGGTAGTCC -3, the nucleotide sequence is as shown in SEQ ID NO.8; and a bacteria-universal probe 16SP: 5'-X3- CCGCCTTCGCCACCGGTGTTCTT —Y3-3’, the nucleotide sequence is as shown in SEQ ID NO.S. For the multiplex fluorescence PCR detection primer composition, optimally, X41, Xz, Xs at &' ends of a Streptococcus suis specific probe, a swine pasteurella multocida specific probe and a bacteria-universal probe are respectively fluorescence modification different from the other two in FAM, JOE, CY5, ROX, CY3, and Yj, Yo, Y3 at the 3’ end are respectively quenching groups different from the other two in Dabcyl, BHQ1, BHQ2, TAMRA. For the multiplex fluorescence PCR detection primer composition, optimally, a Streptococcus suis specific probe Suis-gdh QP is: 5- TAMRA - 3
TCATTGATCCGCCCAGAAGCA -BHQ2-3’, the nucleotide sequence is as shown in SEQ ID NO.3; a Swine pasteurella multocida specific probe PM QP is: 5'-JOE- CGCTGGAAATCGTGCTGACC -BHQ2-3’, the nucleotide sequence is as shown in SEQ ID NO.86;and a bacteria-universal probe 16SP is: 5'-CY5- AAGTACGCTCCATTGGTGACCTCA -BHQ2-3, the nucleotide sequence is as shown in SEQ ID NO.10. A multiplex fluorescence PCR detection kit for identifying Streptococcus suis and Swine pasteurella multocida optimally contains the multiplex fluorescence PCR detection primer composition described in any one of claims 1-3. The multiplex fluorescence PCR detection kit contains 20uL of PCR amplification system: 10uL of 2xTagMan Master Mix, final concentration of Suis-gdh QF, Suis-gdh QR, PM QF, PM QR, 16SF and 16SR being respectively 0.25uM, final concentration of Suis-gdh QP, PM QP and 16SP being respectively 0.125uM, 2pL of 20ng/uL of DNA template, and the rest of double distilled water supplementing to 20pL.
A multiplex fluorescence PCR detection method includes the following steps: 1) extract template DNA of a to-be-tested sample, and perform PCR amplification by using reagents of the multiplex fluorescence PCR detection primer composition described in claim 1 or the multiplex fluorescence PCR detection kit described in claim 2; and 2) if a Suis-gdh QP and 16SP fluorescence modified probe has an amplification curve, and that Ct<35 is met, a to-be-detected sample is Streptococcus suis; if a PM QP and 16SP fluorescence modified probe has an amplification curve, and that Ct<35 is met, a to-be-detected sample is Swine pasteurella multocida; and if neither of Suis-gdh QP or PM QP fluorescence modified probes has an amplification curve, but 16SP has an amplification curve, and that Cts35 is met, a to-be-detected sample is neither of the two bacteria.
In the multiplex fluorescence PCR detection method, optimally, an amplification process: 95°C, 2min; 95°C, 10s; 58°C, 35s, with 40 circulations.
According to the multiplex fluorescence PCR detection method, detection is performed on a fluorescence quantitative PCR instrument with 5 channels or more.
Further, the present invention provides genome precise quantification based detection method used for Streptococcus suis and Swine pasteurella multocida, specifically including: preparation of Streptococcus suis genome-standard sample: initial concentration being 30ng/uL, Streptococcus suis genome size being 2.007Mb, Copy number being equal to (6.02x1023 yx (30ng/uIx 10° )/(2.007x 10° x660) equaling to 1.36x107 copies/uL; 3preparation of Swine pasteurella multocida-standard sample: initial concentration being 30ng/uL, Swine pasteursila muliocida genome size being 2.3Mb, Copy number being equal to (6.02x 1023 )x(30ng/ulIx 10° )/(2.3x 10° x660) equaling to 1.19x 107 copies/uL; and dilute genome DNA of Streptococcus suis and Swine pasteurella multocida respectively from 1.36x107 copies/uL and 1.19% 107 copies/uL by 5 gradients stepwise according to 10x, that is copy number of orders of magnitude of 10°, 105, 10%, 103, 102. By taking the standard samples of 5 gradients as templates, perform real-time fluorescence quantitative PCR detection, to generate a standard curve, and meanwhile, perform precise quantification on a to-be-detected sample.
Beneficial effects of the present invention: According to the present invention, Streptococcus suis and Swine pasteurella multocida respectively take gdh and plpe as exclusive target genes, which have high specificity and specificity. According to the present invention, due to the design of a bacterial-universal primer and a universal probe, false negative caused by PCR inhibited factors may be effectively avoided, and three-color multiplex real-time fluorescence PCR is adopted to identify two bacteria at the same time. The present invention can realize precise quantification while providing qualitative detection for Streptococcus suis and Swine pasteurella multocida, and is high in amplification efficiency, high in sensitivity, high in precision rate, good in reproducibility, and short in detection cycle, can complete detection in 1.5h, can realize real-time monitoring, has very high feasibility and application prospect, and thus provides a scientific and reliable method for identifying pathogenic microorganism and reducing economic loss of breeding.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an amplification curve diagram of Streptococcus suis under different fluorescence modified probes; it is seen from the diagram that: when a Suis-gdh QP and 16SP fluorescence modified probe has an amplification curve, and that Cts35 is met, a to-be-detected sample is Streptococcus suis; FIG. 2 is an amplification curve diagram of Swine pasteurella multocida under different fluorescence modified probes; it is seen from the diagram that: when a PM QP and 16SP fluorescence modified probe has an amplification curve, and that Ct<35 is met, a to-be-detected sample is swine pasteurella multocida FIG. 3 is an amplification curve diagram of bacteria except the two bacteria under different fluorescence modified probes; it is seen from the diagram that: when only a 16SP fluorescence modified probe has an amplification curve, and that Ct<35 is met, a to-be-detected sample is neither of the two bacteria; FIG. 4 is a sensitivity amplification curve diagram when a Streptococcus suis template is respectively 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng; it is seen from the diagram that: the 5lowest detect limit is 0.01ng; FIG. 5 is a sensitivity amplification curve diagram when a Swine pasteurella multocida template is respectively 10ng, 1ng, 0.1ng, 0.01ng, 0.001ng, 0.0001ng; it is seen from the diagram that: the lowest detect limit is 0.01ng; FIG. 6 is a standard curve diagram of Swine pasteurella multocida; and FIG. 7 is a standard curve diagram of Streptococcus suis.
DESCRIPTION OF THE EMBODIMENTS Further descriptions will be made to the present invention in combination with accompanying drawings and embodiments, it should be noted that the following descriptions are only used for explaining the present invention, instead of limiting the content thereof.
Experimental materials, reagents and instruments used in the present invention are as follows: Experimental materials: Streptococcus suis, Swine pasteurella multocida, Haemophilus parasuis, Swine actinobacillus pleuropneumonia, Escherichia coli, Bacillus pyogenes, staphylococcus aureus, Bacillus subtilis, Avibacterium paragallinarum, Bacillus coagulans, Lactobacillus reuteri, Lactobacillus plantarum, Gallibacterium and Enterococcus faecium.
Reagents: bacteria DNA extraction kit purchased from Bao Bioengineering (Dalian) Co., Ltd.
Primer and probes are synthesized by Sangon Bioengineering (Shanghai) Co., LTD. Brand of 2xTagMan Master Mix is DBI Bioscience. DNA sequencing is completed by the Sequencing center of Biotechnlology Research Center, Shandong Academy of Agricultural Sciences.
Instruments: an ABI 7500 fluorescence quantitative PCR instrument which is a product of ABI company, a Takara PCR instrument which is a product of Bao Bioengineering (Dalian) Co., Ltd. A 5424D type high-speed centrifuge is a product of Eppendorf company.
Embodiment 1
1. Extract DNA of a Streptococcus suis sample, a swine pasteurella multocida sample and other bacteria samples: extracting by adopting a bacteria DNA extraction kit, referring to a kit specification for specific operation steps. Measuring purity and concentration of extracted genome DNA by an ultraviolet spectrophotometer. When OD260/0D280 values are all about 1.8-1.9 and concentration is more than 10ng/uL by measurement, DNA purity is relatively high, and concentration is moderate, meeting a PCR amplification requirement.
2. Selection of target gene and design of primers: Streptococcus suis (Suis) and Swine pasteurella multocida (PM) respectively take Gdh gene, plpE gene and OmlA gene as nucleotide sequences of specific target genes primers, and nucleotide sequences of designed primers and probes are as shown in table 1. Table 1 Nucleotide sequences of primers and probes 6
© PrimerName ~~ Primerand probe sequence (5-3) Fra gment length (bp) Streptococcus suis specific upstream primer CCTCCGCCAGTTTGATGC (SEQ ID Suis-gdh QF NO.1) 13 Streptococcus suis specific downstream GAAGGATTTACCGTTTGCTGC (SEQ © primer Suis-gdh QR ID NO.2) TAMRA - Streptococcus suis specific probe Suis-gdh TCATTGATCCGCCCAGAAGCA -BHQ2 oP (SEQ ID NO.3) Swine pasteurella multocida specific TAGTTGCATGTAGCGGTGGT (SEQ upstream primer PM QF ID NO.4) 18 Swine pasteurella multocida specific AGGGGCTTGAAAGGAGGA (SEQID 4 downstream primer PM QR NO.5) Swine pasteurella multocida specific probe JOE- CGCTGGAAATCGTGCTGACC PM QP -BHQ2 (SEQ ID NO.6) CGTATTACCGCGGCTGCTGG (SEQ Bacteria-universal upstream primer 16SF ID NO.7) 22 GATTAGATACCCTGGTAGTCC (SEQ © Bacteria-universal downstream primer 16SR ID NO.8) Bacteria-universal probe 16SP CY5-
CCGCCTTCGCCACCGGTGTTCTT -BHQ2 (SEQ ID NO.9)
3. Preparation of standard samples: Preparation of Streptococcus suis genome-standard sample: initial concentration being 30ng/uL, Streptococcus suis genome size being 2.007Mb, Copy number being equal to (6.02x1023 yx (30ng/uIx10°)/(2.007x 10° x660) equaling to 1.36x 107 copies/uL; preparation of Swine pasteurella multocida-standard sample: initial concentration being 30ng/pL, Swine pasteurella multocida genome size being 2.3Mb, Copy number being equal to (6.02%x10% )x(30ng/ulx 10° )/(2.3x 108x660) equaling to 1.19x107 copies/pL; dilute genome DNA of Streptococcus suis and Swine pasteurella multocida respectively from 1.36x107 copies/uL and 1.19x107 copies/pL by 5 gradients stepwise according to 10x, thatis copy number of orders of magnitude of 10%, 105, 10% 103, 102. By taking the standard samples with 5 gradients as templates, perform real-time fluorescence quantitative PCR detection, to generate a standard curve, and meanwhile, perform precise quantification on a to-be-detected sample.
4. Fluorescence detection 20pL of real-time fluorescence PCR amplification system is preferably used, a reaction system being as shown in table 2.
Table 2 PCR reaction amplification system © Resgemt Concentration Use amount (ul) Taghdan Master Mix 2% 10 Primer group Sh] 1 Probe composition ZN B DNA template ZOnguL 2 double distilled water 5 Feral volume 0
5. PCR amplification conditions: 95°C, 2min; 95°C, 10s; 58°C, 35s, collecting fluorescence signals here, with 40 circulations.
8. Result analysis: set Streptococcus suis positive control, Swine pasteurella multocida positive control, negative control and blank control for each time of experiment, open analysis software after experiment is ended, analyze an experiment result, give ARn (fluorescence added value in nth circulation) and amplification curve Ct value, and determine whether a to-be-detected sample is the Swine pasteurella multocida or the Streptococcus suis according to a probe fluorescence signal and an amplification curve Ct value. Results are as shown in FIG. 1, when a Suis-gdh QP and 165P probe has an amplification curve, and that Ct<35 is met, a to-be-detected sample is Streptococcus suis; FIG. 2, when a PM QP and 16SP probe has an amplification curve, and that Cts35 is met, a to-be-detected sample is Swine pasteurella multocida; FIG. 3, when it is shown that only a 16SP probe has an amplification curve, and that Ct=35 is met, a to-be-detected sample is neither of the two bacteria.
FIG. 6 is a standard curve diagram of Swine pasteurella multocida; the copy number of to-be-detected sample Swine pasteurella multocida is computed by an equation y=-3.547X+21.167(R2: 0.997, Eff%: 91.38); and FIG. 7 is a standard curve diagram of Streptococcus suis, the copy number of to-be-detected sample Streptococcus suis is computed by an equation y=-3.971X+25.296(R2:0.990, Eff%:
90.30).
Embodiment 2 Specificity verification Perform real-time fluorescence PCR detection by respectively taking total genome DNA of Swine Streptococcus suis, Swine pasteurella multocida, Haemophilus parasuis, Swine actinobacillus pleuropneumonia, Escherichia coli, Bacillus pyogenes, Staphylococcus aureus, 8bacillus subtilis, Avibacterium paragallinarum, Bacillus coagulans, Lactobacillus reuteri, Lactobacillus plantarum, Gallibacterium and Enterococcus faecium as templates by utilizing primers and probes designed according to the present invention, and verify specificity of the primers and probes thereof.
Results are as shown in table 3 and FIG. 3, and the results show that probes and primers designed by the research have strong specificity.
Table 3 Specificity verification experiment Fluorescemre quantitative PCR detection for Cf value Streptocoeens Swine pasteurells multocida ‚ OT en Universal probe Srecies zis probe spectfte probe (ESP Result Speci Suis-gdh QP FM OP re determination rr a ie (CYS) {TAMRA) GOE) Stepiociccus suis DNO 35 N FEAL 135 Steptocarrus Suis Swine pastewrella multocida N 14.93.0014 P48210.33 Swine pasteursily multocida Haemophilus parasuis N N 15.4110.36 Other species Swine actmobacillus pleurormeunonin N N {4941005 Other species Escherichia coli WN N 8331026 Other species Bacillus pyogenes N N FEB Other species Staphylococcus aureus N N FEU0.15 Other species Bacillus subtilis N N E5.6810.21 Other species Avibactertun paragallinarum MN N 15464009 Ciier species Bacillus congulans N N 15.19.4403 Other species Lactobacillus reuten N WN 15251034 Other species Lactobacillus plantarum ™ KN IS. 1046013 Ciber species Gallibseterians N N 21. 174047 Other species Enterococcus Becium N HN 15.3040.86 Other species Embodiment 3 Sensitivity experiment Respectively quantify genome DNA of Streptococcus suis and Swine pasteurella multocida to 5ng/uL, perform gradient dilution according to 10x, wherein 2.0uL is taken for each gradient as template quantity, (that is, 10ng, 1ng, O.1ng, 0.01ng, 0.001ng, 0.0001ng, 0.0001ng) perform real-time fluorescence quantitative PCR detection, and evaluate a detection limit of the present invention.
FIG. 4-5 show that the sensitivity of Streptococcus suis and Swine pasteurella multocida is both 0.01ng, and a result shows that a quantitative detection limit of the present method is 0.01ng, indicating that a method provided by the present invention has very high sensitivity, which is higher than the sensitivity of common PCR.
Embodiment 4 Clinical suspicious sample detection A multiplex real-time fluorescence PCR detection method simultaneously targeted to Streptococcus suis and Swine pasteurella multocida and established according to the present invention is used for detecting 22 clinical suspicious samples, and sample types include pathological material and serum of different regions such as Shouguang and Yantai.
Sources and serial numbers of 22 clinical suspicious samples are as shown in table 4. Meanwhile, a virus isolation method and sequencing are used for detecting.
The fluorescence quantitative detection result is as shown in table 4, a result shows that a method established according to the 9present invention is completely consistent to sequencing result verification after virus isolation, and the method is accurate and reliable. Table 4 - - Result Strepiocoe cus Swine pasteurella Universal probe determination Sample name suis probe multocida probe Copy number Suis—gdh WW QP | task {TAMRA) (JOE) | (05)
20. 3140. 38 5 18.8160. 31 | LEO XD . z Soon De ‚ | Swine pasteurelle multocida New 2 (blood) N N | 25. 1340. 35 Negative Small (blood) N N | 25.3210. G8 Negative Big (blood) x N | 24, 780. 18
21.4540. 27 N | 25.5110.36 | 5.96 xd Shou I (blood) 5 N | 24.6040. 25 Negative Shou 2 (blood) \ N | 25, 5820, 04 Negative Yan 3 (blood) Ax N | 25, 2440, ¥0 CC Negative Yan 4-1 (blood) Ny x | 05. 7540, 37 Negative material) | Ls Swing pastevraila Qing $pethologionl materials 5 17482012 TA 38008 ARKH maiteeiëz EE meteih |X | w | mesoos | egwe | [Shou Npsthologieatmatenialy | 0 [ON | ziee || ewe | sossen | [ON | Bess || ewe | sossemepain | | ox | zes || ews | Er | 5 | 5 | mean || ee | | tmiwtiogoet | x | x | me [| 0 | wes | The foregoing embodiments are only preferred implementation modes of the present invention, however, the implementation modes of the present invention are not limited by embodiments, any other alterations, modifications, combinations, substitutions and simplifications made without departing from the spirit essence and principle of the present invention should be regarded as equivalent substitute modes, and are all included in the protection scope of the present invention. 10
SEQUENCE LISTING <110> Institute of animal husbandry and veterinary medicine, Shandong Academy of Agricultural Sciences <120> MULTIPLEX REAL-TIME FLUORESCENCE pcr DETECTION PRIMER
AND DETECTION METHOD <130> GWP201911321 <150> 201811551878.9 <151> 2018-12-19 <160> 10 <170> Patentln version 3.5 <210> 1 <211> 18 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific upstream primer Suis-gdh QF <400> 1 cctccgccag tttgatgc 18 <210> 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific downstream primer Suis-gdh QR i
<400> 2 gaaggattta ccgtttgctg c 21 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific probe Suis-gdh QP <400> 3 tcattgatcc gcccagaagc a 21
<210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific upstream primer PM QF <400> 4 tagttgcatg tagcggtggt 20 <210> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific downstream primer PM QR <400> 5 aggggcttga aaggagga 18 12
<210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific probe PM QP
<400> 6 cgctggaaat cgtgctgacc 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> a bacteria-universal upstream primer 16SF <400> 7 cgtattaccg cggctgctgg 20
<210> 8 <211> 21 <212> DNA <213> artificial sequence <220> <223> a bacteria-universal downstream primer 16SR <400> 8 gattagatac cctggtagtc c 21 13
<210> 9 <211> 23 <212> DNA <213> artificial sequence
<220> <223> a bacteria-universal probe 16SP <400> 9 ccgecttege caccggtgtt ctt 23 <210> 10 <211> 24 <212> DNA <213> artificial sequence <220> <223> a bacteria-universal probe 16SP is
<400> 10 aagtacgctc cattggtgac ctca 24
14
2024510SEQ
SEQUENCE LISTING <110> Institute of animal husbandry and veterinary medicine, Shandong Academy of Agricultural Sciences <120> MULTIPLEX REAL-TIME FLUORESCENCE pcr DETECTION PRIMER COMPOSITION
AND DETECTION METHOD <130> GWP201911321 <156> 201811551878.9 <151> 2018-12-19 <160> 10 <170> PatentIn version 3.5 <21e> 1 <211> 18 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific upstream primer Suis-gdh QF <400> 1 cctccgccag tttgatgc 18 <2105 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific downstream primer Suis-gdh QR <400> 2 gaaggattta ccgtttgctg c 21 <2105 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> a Streptococcus suis specific probe Suis-gdh QP <400> 3 tcattgatcc gcccagaagc a 21 Pagina 1
2024510SEQ <2105 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific upstream primer PM QF <400> 4 tagttgcatg tagcggtggt 20 <216> 5 <211> 18 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific downstream primer PM QR <400> 5 aggggcttga aaggagga 18 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> a Swine pasteurella multocida specific probe PM QP <400> 6 cgctggaaat cgtgctgacc 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> a bacteria-universal upstream primer 16SF <400> 7 cgtattaccg cggctgctgg 20 <2105 8 <211> 21 <212> DNA Pagina 2
2024510SEQ
<213> artificial sequence
<220>
<223> a bacteria-universal downstream primer 16SR
<400> 8gattagatac cctggtagtc c 21
<2105 9
<211> 23
<212> DNA
<213> artificial sequence
<220>
<223> a bacteria-universal probe 16SP
<400> 9ccgccttcgc caccggtgtt ctt 23
<210> 10
<211> 24
<212> DNA
<213> artificial sequence
<220>
<223> a bacteria-universal probe 16SP is
<400> 10aagtacgctc cattggtgac ctca 24 Pagina 3
Claims (8)
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811551878.9A CN109666750B (en) | 2018-12-19 | 2018-12-19 | Multiplex real-time fluorescence PCR detection primer probe set and detection method for identifying streptococcus suis and pasteurella multocida |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| NL2024510A true NL2024510A (en) | 2020-07-07 |
| NL2024510B1 NL2024510B1 (en) | 2021-02-09 |
Family
ID=66144001
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| NL2024510A NL2024510B1 (en) | 2018-12-19 | 2019-12-19 | Multiplex real-time fluorescence pcr detection primer composition and detection method for identifying streptococcus suis and swine pasteurella multocida |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109666750B (en) |
| NL (1) | NL2024510B1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113403411B (en) * | 2021-08-11 | 2023-03-31 | 江西中科基因检测技术有限公司 | Triple fluorescence PCR detection kit for porcine respiratory disease and detection method thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6699670B2 (en) * | 2001-03-01 | 2004-03-02 | The Johns Hopkins University | Quantitative assay for the simultaneous detection and speciation of bacterial infections |
| CN101812518A (en) * | 2010-03-08 | 2010-08-25 | 上海交通大学 | Multiple PCR detection kit for virulence factors of streptococcus suis and detection method thereof |
| CN105779625B (en) * | 2016-04-21 | 2019-08-23 | 韶关学院 | It is a kind of to detect that Streptococcus suis is universal and streptococcus suis 2-type double fluorescent quantitative PCR primer, kit and method simultaneously |
| CN108315401B (en) * | 2018-04-26 | 2021-08-27 | 华南农业大学 | Triple PCR primer, method and kit for detecting streptococcus suis type 2, swine pasteurella multocida and haemophilus parasuis |
-
2018
- 2018-12-19 CN CN201811551878.9A patent/CN109666750B/en active Active
-
2019
- 2019-12-19 NL NL2024510A patent/NL2024510B1/en active
Also Published As
| Publication number | Publication date |
|---|---|
| NL2024510B1 (en) | 2021-02-09 |
| CN109666750A (en) | 2019-04-23 |
| CN109666750B (en) | 2022-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN110777220B (en) | Primer group, probe, RPA test strip kit and identification method | |
| CN111187804A (en) | Rapid detection kit and detection method for mycoplasma pneumoniae nucleic acid based on CRISPR/Cas12a | |
| CN112322764B (en) | Detection kit and detection method for brucella | |
| Mentasti et al. | Design and validation of a qPCR assay for accurate detection and initial serogrouping of Legionella pneumophila in clinical specimens by the ESCMID Study Group for Legionella Infections (ESGLI) | |
| Shahid et al. | High-resolution melting-curve analysis of obg gene to differentiate the temperature-sensitive Mycoplasma synoviae vaccine strain MS-H from non-temperature-sensitive strains | |
| KR102267326B1 (en) | Method and kit for detecting coronavirus | |
| CN111286559A (en) | Primer, probe and kit for detecting African swine fever virus | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| KR102675157B1 (en) | Method and Kit for Diagnosing Bovine tuberculosis using PNA | |
| NL2024510B1 (en) | Multiplex real-time fluorescence pcr detection primer composition and detection method for identifying streptococcus suis and swine pasteurella multocida | |
| Audia et al. | DNA microarray analysis of the heat shock transcriptome of the obligate intracytoplasmic pathogen Rickettsia prowazekii | |
| WO2006001972A2 (en) | Compositions and methods for the diagnosis of group b streptococcus infection | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| KR102557450B1 (en) | Composition for detecting Salmonella spp. based on CRISPR-Cas, and Salmonella spp. detection method using the same | |
| JP4806749B2 (en) | Bordetella pertussis gene detection method using LAMP method and primer set used in this method | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| KR101336862B1 (en) | Method of providing information for diagnosis of tuberculosis using quantitative realtime PCR and diagnostic kit comprising thereof | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN106929573B (en) | Against Legionella pneumophila type O12wzmAndwecAgene specific nucleotide sequence and application thereof | |
| Chen et al. | C-terminal part of glutamate-ammonia-ligase adenyltransferase gene identified by RAPD-HRM with 3H primer for E. Coli Screening | |
| KR102502129B1 (en) | Method and Kit for Identifying the serotype of Actinobacillus pleuropneumoniae causing pneumonia in Pigs using PNA probe | |
| Bashashati et al. | Development of two novel SYBR green-based quantitative PCR assays for detection andquantification of Mycoplasma gallisepticum and Mycoplasma synoviae |