NL2023233B1 - Nucleic Acid and Kit for Simultaneously detecting Pathogens Causing Damping Off, Spot Disease and Powdery Mildew on Begonia - Google Patents

Abstract

The present invention relates to a group of nucleic acids, a kit and a detection method for simultaneously detecting three pathogens causing damping off, spot disease and powdery mildew on Begonia. The nucleic acids used for multipleX PCR to simultaneously detect three pathogens include upstream and downstream primers of three pathogens causing damping off, spot disease and powdery mildew on Begonia. The nucleic acids used for multipleX PCR to simultaneously detect three pathogens further include probes corresponding to each pathogen. The present invention further establishes a relatively efficient and sensitive detection method for simultaneously detecting the three pathogens causing damping off, spot disease and powdery mildew on Begonia. The method can effectively improve the sensitivity of detection, avoid the occurrence of false negative results, and provides a technical means for effectively preventing the occurrence of damping off, spot disease and powdery mildew on Begonia.

Description

Nucleic Acid and Kit for Simultaneously Detecting Pathogens Causing Damping Off, Spot Disease and Powdery Mildew on Begonia Technical Field

The present invention belongs to a biological detection technology, and particularly relates to a nucleic acid and a kit for simultaneously detecting pathogens causing damping off, spot disease and powdery mildew on Begonia.

Background

In recent years, the incidence of damping off, spot disease and powdery mildew on Begonia are rising, and the combined infection of the three diseases is increasing, which causes huge losses to farmers who plant Begonia in China every year. At present, there are no effective fungicides and disease-resistant varieties of damping off, spot disease and powdery mildew on Begonia. Once the Begonia is found to be infected with these three diseases, it is necessary to remove the affected trees in time to prevent the spread of the diseases. In addition, the management of nonepidemic areas should be strengthened to prevent the invasion of these three diseases. Therefore, it is particularly important to establish early rapid detection methods for damping off, spot disease and powdery mildew on Begonia.

Regarding the detection methods of three pathogens causing damping off, spot disease and powdery mildew on Begonia, there are currently no methods for detecting the three pathogens quickly and simultaneously.

Summary (1) Technical problems to be solved

In order to solve the above technical problems, the present invention provides a nucleic acid for multiplex PCR to simultaneously detect pathogens causing damping off, spot disease and powdery mildew on Begonia. Nucleic acids and a kit for detecting pathogens causing damping off, spot disease and powdery mildew on Begonia by multiple real-time fluorescent quantitative PCR are also provided.

(2) Technical solutions

In order to achieve the above objectives, the main technical solutions adopted by the present invention are as follows.

A group of nucleic acids for multiplex PCR to simultaneously detect three pathogens includes upstream and downstream primers for detecting three pathogens that cause damping off, spot disease and powdery mildew on Begonia, respectively; wherein, an upstream primer sequence of the pathogen of the damping off is as shown in SEQ ID No: 1, and a downstream primer sequence of the damping off is as shown in SEQ ID No: 2;

an upstream primer sequence of the pathogen of the spot disease is as shown in SEQ ID No: 4, and a downstream primer sequence of the spot disease is as shown in SEQ ID No: 5; and an upstream primer sequence of the pathogen of the powdery mildew is as shown in SEQ ID No: 7, and a downstream primer sequence of the powdery mildew is as shown in SEQ ID No: 8.

A group of nucleic acids for fluorescent quantitative PCR to simultaneously detect three pathogens include the above-described upstream and downstream primers for detecting three pathogens that cause damping off, spot disease and powdery mildew on Begonia, respectively, and probes corresponding to the three pathogens; wherein, a sequence of the probe corresponding to the pathogen of the damping off is as shown in SEQ ID No. 3;

a sequence of the probe corresponding to the pathogen of the spot disease is as shown in SEQ ID No. 6; and a sequence of the probe corresponding to the pathogen of the powdery mildew is as shown in SEQ ID No. 9.

The nucleic acids as described above, preferably, the group of nucleic acids further includes sequences of positive amplification products for detecting the three pathogens causing the damping off, spot disease and powdery mildew on Begonia; wherein, a sequence of a positive amplification product for detecting the pathogen of the damping off contains the sequence shown between the 28^lh and 155'¹¹ bp in SEQ ID No: 10;

a sequence of a positive amplification product for detecting the pathogen of the spot disease contains the sequence shown between the 14^th and 121^th bp in SEQ ID No: 11; and a sequence of a positive amplification product for detecting the pathogen of the powdery mildew contains the sequence shown between the 3^th and 82^th bp in SEQ ID No: 12.

A kit for fluorescent quantitative PCR to simultaneously detect three pathogens includes: the upstream and downstream primers for detecting three pathogens causing damping off, spot disease and powdery mildew on Begonia, and the corresponding probes, described in the technical solution 2. The 5’ and 3’ ends of each probe were correspondingly labeled with

TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3, respectively.

The kit as described above preferably further includes sequences of positive amplification products for detecting the three pathogens causing the damping off, spot disease and powdery mildew on Begonia; wherein, a sequence of a positive amplification product for detecting the pathogen of the damping off contains the sequence shown between the 28^lh and 155'¹¹ bp in SEQ ID No: 10;

a sequence of a positive amplification product for detecting the pathogen of the spot disease contains the sequence shown between the 14^th and 121^th bp in SEQ ID No: 11; and a sequence of a positive amplification product for detecting the pathogen of the powdery mildew contains the sequence shown between the 3^th and 82^th bp in SEQ ID No: 12.

The kit as described above preferably further includes Premix EX TaqTM2.

(3) Advantages

The advantages of the present invention are as follows.

The present invention provides a group of nucleic acids for common PCR detection of three pathogens causing damping off, spot disease and powdery? mildew on Begonia. The group of nucleic acids can be used for the detection of a single pathogen, as well as for the multiplex amplification of simultaneous detection of these three pathogens. When the group of nucleic acids is used to detect these three pathogens simultaneously, it has been verified that there is no crossreaction between these three pathogens, and the detection has high sensitivity and specificity.

The present invention further provides nucleic acids and a kit for fluorescent quantitative PCR to simultaneously detect three pathogens causing damping off, spot disease and powdery mildew on Begonia, and at the same time establishes a relatively efficient, sensitive and highly specific detection method which can simultaneously detect the three pathogens. The method can effectively improve the sensitivity of detection, avoid the occurrence of false negative results, and provides a technical means for effectively preventing the occurrence of damping off, spot disease and powdery mildew on Begonia. The provided detection kit is convenient to use, easy to operate, highly automated, and can effectively replace traditional pathogen isolation and culture to obtain detection results. Moreover, the reagents used in the kit are few and the cost is low, which greatly simplifies the operation process, reduces the process of repeated operations, thus reducing the pollution in the operation process, avoiding excessive labor caused by repeated operations, saving time, saving costs, and achieving rapid screening. The provided kit has good detection effect, strong specificity and high sensitivity. The present invention provides nucleic acids, a kit and a detection method thereof, so as to solve the technical problem that the existing technique fails to simultaneously detect pathogens causing damping off, spot disease and powdery mildew on Begonia.

The detection method provided adopts a completely closed tube operation, and the operation is simple, convenient and quick; the quantitative result is obtained by directly detecting the changes of the fluorescent signal in the PCR process; no post-processing or electrophoresis detection is required after the common PCR; the problems of easy contamination and false positives of conventional PCR technology are overcame; and the non-specific amplification problems can be effectively avoided. In addition, the detection method is suitable for screening and detection of large quantities of samples.

Brief Description of the Drawings

Fig. 1 shows electrophoresis results of PCR for simultaneously detecting three pathogens.

Fig. 2 is a diagram showing a sensitivity test result of a detection of a pathogen of damping off by using a fluorescent quantitative PCR for simultaneously detecting three pathogens, according to the present invention.

Fig. 3 is a diagram showing a sensitivity test result of a detection of a pathogen of spot disease by using a fluorescent quantitative PCR for simultaneously detecting three pathogens, according to the present invention.

Fig. 4 is a diagram showing a sensitivity test result of a detection of a pathogen of powdery mildew by using a fluorescent quantitative PCR for simultaneously detecting three pathogens, according to the present invention.

Detailed Description of the Embodiments

For a better explanation and a complete understanding of the present invention, the present invention will be described in detail hereinafter by embodiments with reference to the drawings. The embodiments of the present invention are not limited thereto, and the complementary sequences of the nucleotide sequences provided by the present invention may also realize the present invention. Unless otherwise specified, the reagents used in the present invention are conventional reagents. Therefore, all equivalent substitutions made in the prior art according to the present disclosure fall within the protection scope of the present invention.

Embodiment 1 Design of primers and probes

The fluorescence quantitative PCR detection is achieved through a specific fluorescent probe based on common PCR detection. The probe is an oligonucleotide labeled with a fluorescent reporter and a quencher of fluorescence at each end. When the probe is intact, the fluorescent signal emitted by the reporter is absorbed by the quencher. During PCR amplification, the 5’ to 3’ exonuclease activity of the Taq polymerase degrades the probe, separating the fluorescent reporter from the quencher of fluorescence, so that the fluorescence monitoring system can receive the fluorescent signal. That is, each time a DNA strand is amplified, a fluorescent molecule is formed, which realizes that the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. Therefore, the premise of fluorescence quantitative PCR detection is to carry out PCR amplification reaction, avoid crossreaction between the primers and products during the amplification reaction as much as possible, and further ensure that there should be no cross-reaction between the specific probe and each amplification product and primer. Since the present invention is carried out by a multiple fluorescence quantification, the selection of the probe labels is also critical. Not only should the probes designed by the software be screened, but also the probe signals of the three genes cannot interfere with each other.

Firstly, the specific target genes of pathogens causing damping off, spot disease and powdery mildew on Begonia were screened separately. According to the detection purpose, multiple gene sequences of each pathogen were downloaded from GenBank, and comparative analysis was performed to select conservative regions. Then, amplification primers and hybrid probes suitable for fluorescence quantitative PCR reaction system were designed in the conservative regions

Since the present invention is carried out by a multiple fluorescence quantification, firstly, the selection of the probe labels is relatively critical; and secondly, the probes designed by the software should be screened, and the probe signals of the three genes cannot interfere with each other. Therefore, it is necessary to consider that the three pairs of primers and three probes cannot interfere with each other when designing the probes.

A plurality of primer sequences and hybrid probe sequences specific for the three pathogens causing damping off, spot disease and powdery mildew on Begonia were designed, respectively. Subsequently, the sequence homology and adaptability of the probe and primer combinations to be selected were analyzed and evaluated, and were verified by a large number of detection tests.

Finally, the primer and probe combinations specific to these three pathogens and suitable for multiple fluorescence quantitative reaction system were selected.

It should be noted that the design principle of primers for common PCR is not applicable to the design of primers for fluorescent quantitative PCR. The design of the primers for fluorescent PCR is more demanding than that of primers for common PCR, but the primers for fluorescent quantitative PCR are certainly useful for common PCR amplification reactions.

For the amplification primers designed for each pathogen, first, the amplification detection of a single pathogen should be carried out; and then the multiple amplification of pathogens were carried out after confirming that no non-specific amplification occurs during the amplification detection of a single pathogen. When designing primers, it is necessary to avoid cross-reaction as much as possible, considering that amplification conditions should be as consistent as possible, and finally eliminating cross-reaction through hybridization reaction. According to the above design, bioinformatics analysis, the inventor’s experience design and screening results through a large number of experimental test, the following sequences were determined:

amplification primer pairs and probes specific to the pathogen of damping off: the specific amplification primer pair shown in SEQ ID No: 1 and SEQ ID No: 2, and the hybrid probe sequence shown in SEQ ID No: 3 are as follows:

SEQ ID No: 1:5’- TCGGTCTCTTGCTTTGGTATTGG -3’;

SEQ ID No: 2: 5’- CGGTGTCCTCAGCGATAGATAAC -3’;

SEQ ID No: 3: 5’- ACGCCGAGTGGAACCAAGCATAACA-3’;

amplification primer pairs and probes specific to the pathogen of spot disease: the specific amplification primer pair shown in SEQ ID No: 4 and SEQ ID No: 5, and the hybrid probe sequence shown in SEQ ID No: 6 are as follows:

SEQ ID No: 4: 5’- GTCGTAACAAGGTCTCCGTAGG -3’;

SEQ ID No: 5: 5’-ACAAGGGTGAATAATTCAGCAAGG -3’;

SEQ ID No: 6: 5’- CCCGAGAGGTTCCAGCCCGCC -3’; and amplification primer pairs and probes specific to the pathogen of powdery mildew: the specific amplification primer pair shown in SEQ ID No: 4 and SEQ ID No: 5, and the hybrid probe sequence shown in SEQ ID No: 6 are as follows:

SEQ ID No: 7: 5’-ATCGAGTCTTTGAACGCATCTTG -3’;

SEQ ID No: 8: 5’-GGATGTGGGTTGTTGTTGATACTG -3’;

SEQ ID No: 9: 5’-TGGTATTCCATTGAGCACGCCTGTT -3’.

In the present invention, the design of the probes is particularly critical, and the probes can be selected between the fragments amplified by the primers. Firstly, the probe itself cannot form a primer dimer, otherwise it will lead to false negative test results. Secondly, when used for multiplex detection of pathogens, there should be no cross-reactivity between the fragments and the primers, otherwise false positive or false negative results will be caused. When designing the probe, the maximum wavelength of fluorescence emission of the reporter of each pathogen probe should be in a different spectral range, so as to ensure that the detection channel of the fluorescence quantitative PCR instrument can distinguish the probe of each pathogen. Therefore, in the design, in addition to using the primer select software for evaluation to ensure that the primers are theoretically suitable for multiple reactions, the concentrations of primers and probes should be appropriately adjusted according to the amplification curve of the reaction until an optimal amplification curve is obtained.

The three fluorescent dyes of TEXRED, FAM and CY5 selected by the present invention, whose wavelengths are in different spectral ranges, cannot interfere with each other, and have obvious distinguishing effect and signal intensity.

After being verified with a large number of experiments, the above primers and probes can be used to detect a single pathogen corresponding to each primer pair and probe. The 5’ and 3’ ends of the probes can be labeled with TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3, respectively. However, when simultaneously detecting three pathogens, each probe label should be used to label the three combinations, that is, the TEXRED-BHQ1, FAM-TAMRA and CY5BHQ3 are used to label the probe of the pathogen of damping off, the probe of the pathogen of spot disease, the probe of the pathogen of powdery mildew, respectively. The fluorophores labeled at the 5’ end and the 3’ end of each probe are not coincident, but can be combined at will, and the detection results are not affected. Of course, when detecting a single pathogen, other fluorophore such as VIC, NED and Texred may also be selected as luminophore for the probe, and BHQ, MGB and BHQ2 etc. may be selected as quencher of fluorescence.

Embodiment 2 Detection of three pathogens causing damping off, spot disease and powdery mildew on Begonia by common PCR

A conservative sequence of the pathogen of the damping off in GenBank with the sequence number GU270601 were screened according to Embodiment 1, and the nucleotide sequence of the conservative sequence is shown in SEQ ID No: 10. Primers and probes were designed in this conservative sequence. Finally, the size of the fragment amplified by the designed primers of the pathogen of the damping off was determined to be 128 bp, and the amplification sequence was the sequence between the 28^th and 155^th bp as shown in SEQ ID No: 10.

SEQIDNo: 10:

TTCAAAGCAAACCTTTTGTTAATTCAATCGGTCTCTTGCTTTGGTATTGGAGGT CTTTGCAGCTTCACACCTGCTCCTCTTTGTTTATTAGCTGGATCTCAGTGTTATGCTT GGTTCCACTCGGCGTGATAAGTTATCTATCGCTGAGGACACCGTAAAAAAGTGGCC AAG.

A conservative sequence of the pathogen of the spot disease in GenBank with the sequence number KF731832 were screened, and the nucleotide sequence of the conservati ve sequence is shown in SEQ ID No: 11. Primers and probes were designed in this conservative sequence. The size of the fragment amplified by the primers was 108 bp, and the amplification sequence was the sequence between the 14^th and 121^th bp as shown in SEQ ID No: 11.

SEQIDNo: 11:

TGGAAGTAAAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATC ATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTA TTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCAC.

A conservative sequence of the pathogen of the powdery mildew in GenBank with the sequence number JF909350 were screened, and the conservative sequence is shown in SEQ ID No: 12. Primers and probes were designed in this conservative sequence. The size of the fragment amplified by the primers was 80 bp, and the amplification sequence was the sequence between the 3^th and 82^th bp as shown in SEQ ID No: 12.

SEQ ID No: 12:

TCATCGAGTCTTTGAACGCATCTTGCGCTCAATGGTATTCCATTGAGCACGCCTG TTTCAGTATCAACAACAACCCACATCCACAATTTTGCTGTGAATGGAATTGAGAATTT TCGGATTTATTTTTAAGCTGAGTTCTTTAAAAT.

The primers, the probes and the amplified fragments of Embodiment 1 were synthesized; and primers and positive plasmid DNAs respectively carrying the sequences of SEQ ID No: 10, SEQ ID No: 11, and SEQ ID No: 12 were obtained.

Common PCR amplification was performed using the primers and the positive plasmid DNAs; Premix EX TaqTM x 2 developed by Bao Bioengineering (Dalian) Co., Ltd. were used. In the 25 pL reaction system: each upstream and downstream primers (10 μΜ) was 0.5 pL; Premix EX TaqTMx2 was 12.5 pL; each positive plasmid DNA template was 1 pL, and the rest was nuclease-free water for supplement.

The reaction conditions of PCR amplification are preferably as follows.

Reaction conditions: pre-denaturation at 95 °C for 4 min; amplification at 94 °C for 25 sec, 60 °C for 40 sec, 72 °C for 45 min, with 45 cycles; followed by a final extension step at 72 °C, 7 min; and finally incubation at 4 °C.

The amplification products were subjected to electrophoresis, and the results are shown in Fig. 1. In the Fig. 1, B is a blank control, 1 is the amplification result of the pathogen of damping off, 2 is the amplification result of the pathogen of spot disease, 3 is the amplification result of the pathogen of powdery mildew, and M is a DNA Marker. The results showed that the designed primers can effectively amplify the positive bands corresponding to the pathogens causing damping off, spot disease and powdery mildew on Begonia.

Embodiment 3 Fluorescent quantitative PCR kit for detecting three pathogens

A fluorescent quantitative PCR kit for detecting three pathogens causing damping off, spot disease and powdery mildew on Begonia includes the following components:

Premix EX TaqTM><2;

the upstream primer sequence as shown in SEQ ID No: 1, the downstream primer sequence as shown in SEQ ID No: 2, and the probe sequence as shown in SEQ ID No: 3, for detecting the pathogen of the Rhizoctonia root; wherein, the 5’ end of the probe having the sequence of SEQ ID No: 3 was labeled with TEXRED, the 3’ end of the probe was labeled with BHQ1;

the upstream primer sequence as shown in SEQ ID No: 4, the downstream primer sequence as shown in SEQ ID No: 5, and the probe sequence as shown in SEQ ID No: 6, for detecting the pathogen of the spot disease; wherein, the 5’ end of the probe having the sequence of SEQ ID No: 6 was labeled with FAM, the 3’ end of the probe was labeled with TAMRA; and the upstream primer sequence as shown in SEQ ID No: 7, the downstream primer sequence as shown in SEQ ID No: 8, and the probe sequence as shown in SEQ ID No: 9, for detecting the pathogen of the powdery mildew; wherein, the 5’ end of the probe having the sequence of SEQ ID No: 9 was labeled with CY5, the 3’ end of the probe was labeled with BHQ3.

Further, in order to avoid failure or contamination of the reagents used, a positive control and a negative control reagent were provided, and the negative control is nuclease-free water.

The positive control includes plasmid DNAs carrying amplification products, and the nucleotide sequences of the amplification products are shown in SEQ ID No: 10, SEQ ID No: 11, and SEQ ID No: 12, respectively.

The design of the negative control can effectively verify whether the reagents used are contaminated and avoid the occurrence of false positives. The design of the positive control can effectively verify the effectiveness of the reagents used and avoid the occurrence of false negatives.

Moreover, the Premix EX TaqTM^x2, nuclease-free water are purchased from Bao Bioengineering (Dalian) Co., Ltd.; primers, probes and plasmids are synthesized by Invitrogen Corporation Shanghai Representative Office.

Embodiment 4 Method for simultaneously detecting three pathogens using fluorescent quantitative PCR

The method for simultaneously detecting three pathogens causing damping off, spot disease and powdery mildew on Begonia by fluorescent quantitative PCR includes the following steps:

(1) Extraction of pathogen DNA

The reagents used include: liquid nitrogen, CTAB extraction buffer: 2% CTAB (cetyltrimethylammonium bromide), 1% β-mercaptoethanol, 1.4 mol/L NaCl, 20 mmol/L EDTA, 100 mmol/L Tris-HCl (pH 8.0), 3M NaAC, 50 mM Tris-HCl (pH 8.0), 20 mM EDTA, chloroform: isoamyl alcohol (24:1), isopropanol, 70% ethanol, and TE buffer.

The method for extracting DNA is carried out as follows. The plant material was cut into pieces of about 1 cm and placed in a pre-cooled porcelain mortar; the liquid nitrogen was added for quick cooling, and the plant material was ground into fine powder (the finer the better). The fine powder and 2.5 mL of extraction buffer were added into a 5 mL centrifuge tube. The centrifuge tube was incubated at 60 °C for 1 h, and then was centrifuged at 15000 rpm for 10 min; the supernatant in the centrifuge tube was transferred to another new centrifuge tube; chloroform: isoamyl alcohol (24:1) in a volume equal to that of the supernatant was added to obtain a solution; the solution was mixed well and subjected to extraction until the solution turns into water emulsion melts; the centrifuge tube was centrifuged at 15000 rpm for 10 min; and the supernatant was transferred to another new centrifuge tube. The pre-cooled isopropanol in a volume equal to 2/3 volume of supernatant was added into the centrifuge tube; the centrifuge tube was incubated at -20 °C for 40 min; the DNA was mixed slowly and precipitated in a flocculating form. Then, the centrifuge tube was centrifuged at 15000 rpm for 10 min, and the supernatant was discarded; the DNA precipitate was washed twice with 70% ethanol; and 400 pL of TE buffer was added to dissolve the DNA.

(2) Fluorescent quantitative PCR amplification

The reaction system was prepared by using the kit prepared in Embodiment 3. In the 25 pL reaction system: the final concentrations of the upstream and downstream primers of the pathogens of the damping off and the spot disease were 0.24 pmol/L, respectively, and the final concentrations of the probes of the pathogens of the damping off and the spot disease were 0.4 pmol/L, respectively; the final concentration of the upstream and downstream primers of the pathogen of powdery mildew was 0.40 pmol/L, and the final concentration of the probe of the pathogen of powdery mildew was 0.64 pmol/L; 12.5 pL of Premix EX TaqTM*2 was added; and the additive amount of DNA extracted from each sample was 1 pL.

When the positive control was prepared, in the 25 pL reaction system, the sample DNA was replaced with a plasmid containing a positive amplification sequence of each pathogen; and when the negative control was prepared, in the 25 pL reaction system, the sample DNA was replaced with nuclease-free water.

Amplification conditions: the following amplification conditions are preferred:

pre-denaturation at 95 °C for 5 min; amplification at 95 °C for 15 sec, 60 °C for 40 sec, 72 °C for 40 s, with 45 cycles; followed by a final extension step at 72 °C, 7 min; and finally incubation at 4 °C.

(3) Collection of fluorescent signals. The fluorescence detection mode of TEXRED, FAM, Cy5 were selected, respectively; the baseline was adjusted for fluorescence signals of 3-15 cycles; and the threshold line was set just above the highest point of the normal negative controls.

(4) Determination of the results. If the fluorescence growth curve of the sample to be tested exceeds the threshold line and exhibits a good logarithmic growth, it is determined as positive. If there is no typical amplification curve, it is determined as negative. In this embodiment, the threshold is 35. When the Ct value is lower than or equal to 35, there is a clear amplification curve, which is a positive result; and when the Ct value is larger than 40, there is no obvious amplification curve, which is a negative result.

Embodiment 5 Detection of sensitivity of the kit of the present invention

The plasmid DNAs of the pathogens causing damping off, spot disease and powdery mildew on Begonia synthesized in Embodiment 2, which were determined to have concentrations of 0.145 ng/pL, 0.28 ng/pL, 0.21 ng/pL, respectively, were diluted in a 10-fold ratio. After dilution, the concentrations of the pathogen DNA of damping off were 1.45* IO'² ng/pL, 1.45* 10'³ ng/pL, 1.45><10⁴ ng/pL, 1.45x10'° ng/pL, 1.45X10⁶ ng/pL, respectively; the concentrations of the pathogen DNA of spot disease were 2.8* 10'² ng/pL, 2.8xl0'³ ng/pL, 2.8xl0⁴ ng/pL, 2.8* 10'⁵ ng/pL, 2.8 1 O'⁶ ng/pL, respectively; and the concentrations of the pathogen DNA of powdery mildew were 2.1 χIO’² ng/pL, 2.1x10'·’ ng/pL, 2.1χ IO’⁴ ng/pL, 2. lx 10’³ ng/pL, 2.1χ IO⁶ ng/pL, respectively. The kit prepared in Embodiment 3 was used to detect three pathogens, which cause damping off, spot disease and powdery mildew on Begonia, on the above-mentioned different concentrations of DNA templates, respectively.

(1) NTC (negative control): nuclease-free water.

The reaction system was a 25 pL reaction system. In the 25 pL reaction system, Premix EX TaqTMx2 was 12.5 pL; each of the upstream and downstream primers (20 pM) of the pathogens of the damping off and the spot disease was 0.3 pL; each of the upstream and downstream primers (20 pM) of the pathogen of powdery mildew was 0.5 pL; each of the probes (20 pM) of the damping off and the spot disease was 0.5 pL; the probe (20 pM) of powdery mildew was 0.8 pL; and the amount of each sample DNA was 1 pL. The sample DNA was detected by using the above diluted positive template. The preferred reaction conditions are: pre-denaturation at 95 °C for 5min; amplification at 95°C for 15 s, 60 °C for 40 s, 72 °C for 40 s, with 45 cycles; followed by a final extension step at 72 °C, 7 min; and finally incubation at 4 °C. The real-time fluorescent quantitative PCR detection was performed on an ABI7500 PCR machine.

(2) Three parallel samples for each gradient.

Determination of the results: when the Ct value is lower than or equal to 35, there is a clear amplification curve, which is a positive result; and when the Ct value is larger than 40, there is no obvious amplification curve, which is a negative result.

In the diagrams showing fluorescence values of the test results, the sensitivity test results of the pathogen of damping off were shown in Fig. 2, and the concentrations of the DNA templates of the pathogen of damping off from left to right of the curve shown in Fig. 2 were 1.45x1 O'² ng/pL and 1.45xl0'³ ng/pL, 1.45xl0'⁴ ng/pL, 1.45x10’’ ng/pL, 1.45xl0'⁶ ng/pL, respectively. As can be concluded from the results, the method established by the present invention can detect the pathogen DNA of damping off with a concentration as low as 1.45x1 O'⁶ ng/pL. The sensitivity test results of the pathogen of spot disease were shown in Fig. 3, and the concentrations of the DNA templates of the pathogen of spot disease from left to right of the curve shown in Fig. 3 were 2.8xl0‘² ng/pL and 2.8* 10‘³ ng/pL, 2.8xl0’⁴ ng/pL, 2.8xl0'³ ng/pL, 2.8 IO⁶ ng/pL, respectively. As can be concluded from the results, the method established by the present invention can detect the pathogen DNA of spot disease with a concentration as low as 2.8χ IO⁶ ng/pL. The sensitivity test results of the pathogen of powdery mildew were shown in Fig. 4, and the concentrations of the DNA templates of the pathogen of powdery mildew from left to right of the curve shown in Fig. 4 were 2. lx IO’² ng/pL and 2.1 xl0‘³ ng/pL, 2.1 * IO’⁴ ng/pL, 2.lx 10'³ ng/pL, 2.1 x IO'⁶ ng/pL, respectively. As can be concluded from the results, the method established by the present invention can detect the pathogen DNA of powdery mildew with a concentration as low as 2.1 x IO⁴’ ng/pL. According to the results, the sensitivities of the method of the present invention for detecting pathogens of damping off, spot disease and powdery mildew are 1.45x10' ⁶ ng/pL, 2.8X10⁶ ng/pL and 2.1 10^-6 ng/pL, respectively.

Embodiment 6 Specificity of the kit of the present invention

The kit of the present invention was used to detect Rhizoctonia solani (cfcc 7848), Aspergillus flavus (cfcc 84919), Fusarium oxysporum (cfcc 89008), Alternaria alternata (cfcc 84543), Colletotrichum gloeosporioides (cfcc 82273), Bacillus subtilis (cfcc 14476), Aspergillus flavus (CICC 2090), Bacillus cereus (cfcc 2692), Trichoderma viride (CICC 2535), Candida albicans (cfcc 3529), Ampelomyces (cfcc 83251).

The above-mentioned strains are commercially available. After the above strains are activated and cultured, the bacterial solution is taken to extract DNA. The extracted DNA was detected by the method described in Embodiment 4. The test results showed that the Rhizoctonia solani and the Ampelomyces in the above strains had amplification curves; and the other strains had no amplification curve, and the test results were negative. That is, Rhizoctonia solani corresponds to the pathogen of damping off, and the Ampelomyces corresponds to the pathogen of powdery mildew, and the test results were positive. The results showed that the primers and probes designed by the present invention have specificity, no non-specific amplification and have strong specificity.

Embodiment 7 Detection of samples using the kit of the present invention

Begonia leaf samples with symptoms of damping off, spot disease and powdery mildew and healthy Begonia leaf samples were collected from the Qingdao, Shandong province. There were 21 samples with symptom of damping off, 15 samples with symptom of spot disease, and 35 samples with symptom of powdery mildew.

The above samples were subjected to DNA extraction by the method of extracting DNA described in Embodiment 4, and the extracted DNA is detected by the kit of the present invention, and the fluorescence quantitative method described in Embodiment 4 is used for detection. The results showed that for the samples with symptoms of damping off, spot disease and powdery mildew, the Ct values were all lower than or equal to 35, there were clear amplification curves, which were positive results; and the DNA test results of healthy Begonia samples have no amplification curve, which were negative results. The results indicated that the detection method of the present invention has a good applicability to the detection of the samples. The detection is carried out on the AB175 00 fluorescence quantitative PCR instrument, and the detection accuracy 5 is up to 100%.

The foregoing descriptions are merely preferred embodiments of the present invention, which are not intended to limit the present invention in any other forms. Any person skilled in the art may change or modify the technical contents disclosed above to obtain the equivalent embodiments. However, any simple modifications, equivalent changes or derivations made 10 according to the above embodiments without departing from the technical solutions and contents of the present invention still fall within the protection scope of the technical solutions of the present invention.

Claims (6)

Conclusions A group of nucleic acids for multiplex PCR to simultaneously detect three pathogens, comprising: upstream primers and downstream primers for detecting the three pathogens, which cause knock-over, leaf spot, and powdery mildew on Begonia, respectively, wherein: an upstream primer sequence of the pathogen causing knock-over disease is as shown in SEQ ID NO: 1, and a downstream primer sequence of the knock-down disease is as shown in SEQ ID NO: 2; an upstream primer sequence of the pathogen causing leaf spot is as shown in SEQ ID NO: 4, and a downstream primer sequence of the leaf spot is as shown in SEQ ID NO: 5; and an upstream primer sequence of the powdery mildew pathogen is as shown in SEQ ID NO: 7, and a downstream primer sequence of the powdery mildew is as shown in SEQ ID NO: 8. A group of nucleic acids for a fluorescent quantitative PCR to simultaneously detect three pathogens, comprising: upstream primers and downstream primers for detecting the three pathogens, which cause knock-over, leaf spot, and powdery mildew on Begonia, and probes corresponding to the three pathogens, where: a probe sequence corresponding to the pathogen of the knock-over disease is as shown in SEQ ID NO: 3; a probe sequence corresponding to the pathogen of the leaf spot is as shown in SEQ ID NO: 6; and a probe sequence corresponding to the powdery mildew pathogen is as shown in SEQ ID NO: 9. The group of nucleic acids according to claim 1 or claim 2, wherein the group of nucleic acids further comprises: sequences of positive amplification products for detecting the three pathogens causing knock-over, leaf spot and powdery mildew on Begonia; wherein, a sequence of a positive amplification product for the detection of the pathogen of the anti-tip disease comprises the sequence is shown between the 28 ^c and 155 ^e basepair in SEQ ID NO: 10; a sequence of a positive amplification product for detecting the pathogen of the leaf spot comprises the sequence shown between the 14 ^th and 12 ^th base pair in SEQ ID NO: 11; and a sequence of a positive amplification product to the sequence for the detection of the pathogen of powdery mildew which comprises 3 is shown between the ^e and 82 ^e basepair in SEQ ID NO: 12. 4. Set of fluorescent quantitative PCT components to simultaneously detect three patgogens, the set comprising: The upstream primers and downstream primers for detecting three pathogens causing the knock-over, leaf spot, and powdery mildew on Begonia, and the corresponding probes according to claim 2, wherein the 3 'and 3' ends of each probe is labeled accordingly with TEXRED-BHQ1, FAM-TAMRA and CY5-BHQ3, respectively. A set of components according to claim 4, further comprising: sequences of positive amplification products for detecting the three pathogens causing knock-on, leaf spot and powdery mildew on Begonia; wherein, a sequence of a positive amplification product for detecting the pathogen of the knock-over disease comprises the sequence shown between the 28 ^th and 155 ^th base pair in SEQ ID NO: 10; a sequence of a positive amplification product for detecting the pathogen of the leaf spot comprises the sequence shown between the 14 ^th and 12 ^th base pair in SEQ ID NO: 11; and a sequence of a positive amplification product to the sequence for the detection of the pathogen of powdery mildew which comprises 3 is shown between the ^e and 82 ^e basepair in SEQ ID NO: 12. The set of components of claim 4, further comprising: Premix EX Taq ™> <2.