CN106591456A - Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit - Google Patents
Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit Download PDFInfo
- Publication number
- CN106591456A CN106591456A CN201611198588.1A CN201611198588A CN106591456A CN 106591456 A CN106591456 A CN 106591456A CN 201611198588 A CN201611198588 A CN 201611198588A CN 106591456 A CN106591456 A CN 106591456A
- Authority
- CN
- China
- Prior art keywords
- probe
- echinococcus
- real
- mgb
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on an MGB (Minor Groove Binder) probe and a detection kit. The real-time quantitative PCR method comprises the following steps: designing primers, designing the MGB probe and selecting PCR amplification conditions; the detection kit contains an outer primer pair sequence of a PCR primer pair and an MGB type detection probe sequence. The method disclosed by the invention can be used for pertinently detecting samples containing the echinococcus multilocularis and/or the echinococcus granulosus by types and the accuracy is high; mitochondrion DNAs (Deoxyribonucleic Acid) of the echinococcus multilocularis and the echinococcus granulosus can be accurately detected by types; the sensitivity is high so that the echinococcus multilocularis and the echinococcus granulosus can be rapidly identified by types in a large batch; the operation is simple and convenient, and trace insect source mitochondrion DNAs in the samples can be amplified and the level of detecting by types is realized.
Description
Technical field
The present invention relates to technical field of biological, and in particular to a kind of real-time quantitative detected based on MGB probes typing
Round pcr genotyping detection method.
Background technology
Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) is a kind of in DNA amplification reaction, with glimmering
The method that photochemistry material surveys product total amount after each polymerase chain reaction (PCR) circulation.In real-time quantitative PCR reaction,
Hybridization probe is preferably to select with insertion dyestuff compared with SYBR Green.Fluorescence labeling probe can improve real-time quantitative
The efficiency of PCR results, sensitivity and specificity.And quantitative PCR can detect multiple target genes in a reaction simultaneously.
When PCR is expanded, the fluorescent probe of a specificity is added while pair of primers is added, and the probe is a linear oligonucleoside
Acid, two ends difference one fluorescent reporter group of labelling and a fluorescent quenching group, when probe is complete, it is glimmering that reporter group is launched
Optical signal is quenched group absorptions, and PCR instrument can't detect fluorescence signal；(the stage is extended), the 5'- of Taq enzyme when PCR is expanded
Probe enzyme action is degraded by 3' 5 prime excision enzyme activities, reporter fluorescence group is separated with quenching fluorescence group, so as to fluorescence monitoring system
Fluorescence signal can be received, i.e., is often expanded a DNA, is just had a fluorescence molecule to be formed, realize the accumulation of fluorescence signal
Complete Synchronization is formed with PCR primer, this is also quantitative basis place.Two Colour Fluorescence labelling technique very delicately can be distinguished
The very high gene difference of homology.Two Colour Fluorescence labelling technique is widely used at present distinguishes answering for labelling in allelic product
With by fluorescent labeling recognition allele product.
The quenching group of MGB probes adopts non-fluorescence quenching group (Non-Fluorescent Quencher), and itself is not
Fluorescence is produced, the intensity of background signal can be substantially reduced.MGB (Minor Groove are also associated with probe simultaneously
The Tm values of probe can be improved 10 DEG C or so, therefore in order to obtain same Tm values, MGB probes can by Binder) modification group
It is shorter to be designed to than general T aqMan probe, both reduced synthesis cost, also so that the success rate of probe and accuracy significantly
Increase.
Echinococcus (echinococcus) are recognized at least 9 kinds, are Echinococcus granulosus respectively
(E.granulosus), Echinococcus multilocularis (E.mulitilocularis), Fu Shi echinococcus (E.vogeli), save spine less
Ball cestode (E.oligarthra), Shiqu echinococcus (E.shiquicus), Canadian echinococcus (E.canadensis),
Ovshinsky echinococcus (E.ortleppi) and cat echinococcus (also known as lion echinococcus, E.felidis), wherein Echinococcus moltilocularis
It is widely current in the north and southwest with Echinococcus Granulosus Cysts.There is presently no and examined using probe Real-time quantitative PCR typing
The report of Echinococcus moltilocularis and Echinococcus Granulosus Cysts is surveyed, the diagnosis for Echinococcus moltilocularis with Echinococcus Granulosus Cysts at present mainly adopts mirror
Inspection method.But as echinococcuss individuality is small, it is unobvious to there are observation morphological differencess in conventional microscopy, and change method take time and effort and
Sensitivity is low, there is presently no the detection method of the molecular biology of correlation.Therefore, how quickly, accurate sensitive typing
Detect Echinococcus moltilocularis and Echinococcus Granulosus Cysts, it has also become problem demanding prompt solution.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of MGB probes real-time quantitative PCR typing detection Echinococcus moltilocularis
With the method and detection kit of Echinococcus Granulosus Cysts, visited by primer and typing detection of the design for echinococcuss mitochondrial DNA
Pin, detects Echinococcus moltilocularis and Echinococcus Granulosus Cysts using real-time quantitative PCR detection technique typing.
To solve above-mentioned technical problem, the present invention is adopted the following technical scheme that：It is a kind of that many rooms are detected based on MGB probes typing
Echinococcuss and the real time quantitative PCR method of Echinococcus Granulosus Cysts, it is characterised in that：PCR primer pair employed in the PCR method
Including outer primer to and MGB typing detection probes,
The sequence of the outer primer pair is as follows：
Forward primer EF：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：1)；
Downstream primer ER：5’–GTGGACCATCCTTTACTATGC–3’(SEQ ID NO：2)；
The sequence of the MGB typings detection probe is as follows：
AE probe：5’–FAM-CAGTGAGTGATTCTTGT-MGB–3’(SEQ ID NO：3)；
CE probe：5’–HEX-CAGTGAGCGATTCTTAT-MGB–3’(SEQ ID NO：4).
A kind of detection of the real time quantitative PCR method that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing
Test kit, the detection kit are contained within the outer primer of the PCR primer pair to sequence and the MGB typings detection probe
Sequence.
Further, the detection kit also includes dNTPs, Taq enzyme, Mg2+, one kind or many in PCR reaction buffers
Kind.
Further, the detection kit also includes standard positive template.
A kind of real time quantitative PCR method that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing, using institute
The outer primer of detection kit is stated to sequence and the MGB typings detection probe sequence pair Echinococcus moltilocularis and particulate spine ball
The larva of a tapeworm or the cercaria of a schistosome carries out typing PCR detections.
The detection method is comprised the following steps,
1) extract the STb gene in sample tissue；
2) with step 1) in STb gene as template, with EF and ER as primer pair, with AE-probe, CE-probe as probe,
Carry out real-time quantitative PCR amplified reaction；
3) quantitative fluorescent PCR analysis DNA product.
Preferably for EF and ER as primer pair, AE-probe, CE-probe are reacted for the real-time quantitative PCR of probe
System is calculated as with 20 μ L：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer EF, 0.40 μ L；10 μM of primer ER, 0.4 μ L；AE-
Probe, 0.3 μ L；CE-probe, 0.3 μ L；DNF buffer 2μL
DNA profiling, 2 μ L；ddH2O, 4.6 μ L；Overall reaction system is 20 μ L.
Preferably for the real-time quantitative PCR with EF and ER as PCR primer pair, with AE-probe, CE-probe as probe
The condition of reaction is：94 DEG C of enzyme activition 3min, 94 DEG C of degeneration 5s, 60 DEG C of annealing/extension/fluorescence datas collect 5s, and totally 40 are followed
Ring；FAM passage real-time detection AE probe, VIC passage real-time detection CE probe amplification curves.
The present invention compared with traditional detection with advantages below, first, accuracy is high, the present invention according to Echinococcus moltilocularis with
Echinococcus Granulosus Cysts mtdna sequence designs primer and designs MGB probes at the two difference, accurately typing can detect
Echinococcus moltilocularis and Echinococcus Granulosus Cysts mitochondrial DNA；
Second, easy to operate, the present invention will distinguish Echinococcus moltilocularis fluorescence different from the MGB probe labellings of Echinococcus Granulosus Cysts
Dyestuff (AE probe-FAM；CE probe-HEX), and while by above two probe add a reaction system, can be one
Complete the typing to Echinococcus Granulosus Cysts with Echinococcus moltilocularis to detect in individual reaction, can many room spine balls of high-volume fast typing identification
The larva of a tapeworm or the cercaria of a schistosome and Echinococcus Granulosus Cysts；
3rd, sensitivity is high, and the present invention extracts DNA from sample as template, with EF and ER as PCR primer, with AE
Probe and CE probe carry out real-time quantitative PCR efficient amplification for probe, as probe mark fluorescent group is examined compared with normal PCR
Survey limit to improve, the level of typing detection can be expanded and reached to micro worm sources mitochondrial DNA in sample.
Description of the drawings
The A-C of Fig. 1 is Echinococcus moltilocularis and Echinococcus Granulosus Cysts typing testing result figure；
Wherein Figure 1A is negative sample (not containing many rooms and Echinococcus Granulosus Cysts sample), and Figure 1B is containing Echinococcus moltilocularis sample
This real-time amplification, Fig. 1 C are the amplification of the real-time quantitative containing Echinococcus Granulosus Cysts sample；
Fig. 2 is Echinococcus moltilocularis probe sensitivity results figure, and NC represents negative sample, and AE represents test kit Echinococcus moltilocularis
Positive control, and be diluted to：108copy、107copy、106copy、105copy、104copy、103copy、102copy、
10copy、1copy；
Fig. 3 is Echinococcus Granulosus Cysts probe sensitivity results figure, and NC represents negative sample, and CE represents test kit Echinococcus Granulosus Cysts
Positive control, and be diluted to：108copy、107copy、106copy、105copy、104copy、103copy、102copy、
10copy、1copy。
Specific embodiment
Clear, complete description is carried out to technical scheme below in conjunction with accompanying drawing, it is clear that described enforcement
Example is a part of embodiment of the invention, rather than the embodiment of whole, is not meant to any limitation of the invention.Based on this
Embodiment in invention, the every other reality obtained under the premise of creative work is not made by those of ordinary skill in the art
Example is applied, the scope of protection of the invention is belonged to.
In the present embodiment, stability of the present invention based on Echinococcus moltilocularis mitochondrial DNA, design for Echinococcus moltilocularis with
The primer and probe of Echinococcus Granulosus Cysts mitochondrial DNA, filters out and can distinguish Echinococcus moltilocularis and Echinococcus Granulosus Cysts mitochondrial DNA
Specific primer and probe, reuse Real-time quantitative PCR and expanded, real-time quantitative fluorescence point is carried out to amplified production
Analysis so as to the level for accurately judging Echinococcus moltilocularis and Echinococcus Granulosus Cysts DNA can be reached.Primer, probe after optimized and
Amplification condition carries out real-time quantitative PCR experiment proof and can recognize Echinococcus moltilocularis and Echinococcus Granulosus Cysts DNA completely.
Material
1st, sample：Sample containing Echinococcus moltilocularis and the sample containing Echinococcus Granulosus Cysts；
2nd, DNA extraction：Extracted using QIAamp Circulating Nucleic Acid kit (50 times) test kits；
3rd, 2 × Taq PCR MasterMix (low ROX)；
4th, PCR instrument：ABI 7500.
First, the extraction of DNA
Add 20 μ L Protease K, plus the sample liquid of 200 μ L, plus the Buffer AL of 200 μ L, whirlpool in 1.5mL centrifuge tubes
Rotation 15s；
56 DEG C of incubation 10min, until cracking is complete, are quickly centrifuged；
Plus 200 μ L ethanol (100%), vortex 15s, it is quick to be centrifuged；
Transfer mixed liquor from 1min, renews pipe, discards to Spin column (2mL collecting pipes), 6000g or 8000rpm
Old collecting pipe；
Plus 500 μ L Buffer AW1, vortex 15s, 6000g or 8000rpm, from 1min, abandon old pipe and renew pipe；
Plus 500 μ L Buffer AW2, vortex 15s, at full speed (20,000g or 14,000rpm) renew pipe from 1min, full speed
(20,000g or 14,000rpm) blank pipe is centrifuged 3min；
New centrifuge tube, 100 μ L Buffer AE greenhouses incubate 5min, 6000g or 8000rpm, from 1min, repeat eluting 3
It is secondary.
2nd, the design of primer and probe
According to known array (gene order number：AB018440.2；KU925422.1 primer and probe are designed)：
Design primer EF and ER；
Forward primer EF：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：1)；
Downstream primer ER：5’–GTGGACCATCCTTTACTATGC–3’(SEQ ID NO：2)；
Design probe AE probe and CE probe
AE probe：5’–FAM-CAGTGAGTGATTCTTGT-MGB–3’(SEQ ID NO：3)；
CE probe：5’–HEX-CAGTGAGCGATTCTTAT-MGB–3’(SEQ ID NO：4).
Primer is synthesized by Shanghai Jiang Lin bio tech ltd with probe.
3rd, the real-time quantitative PCR amplification program of Echinococcus Granulosus Cysts and the detection of Echinococcus moltilocularis typing
With sample DNA as template, with EF, ER as primer, with AE probe, CE probe as probe, carry out in real time
Quantitative pcr amplification.Real-time quantitative PCR reaction system is：2 × Taq PCR MasterMix, 10 μ L；10 μM of primer EF, 0.40 μ
L；10 μM of primer ER, 0.4 μ L；AE-probe, 0.3 μ L；CE-probe, 0.3 μ L；DNF buffer 2μL；DNA profiling, 2 μ L；
ddH2O, 4.6 μ L；Overall reaction system is 20 μ L.The reaction bar of the real-time quantitative PCR with AE probe and CE probe as probe
Part is：94 DEG C of enzyme activition 3min, 94 DEG C of degeneration 5s, 60 DEG C of annealing/extension/fluorescence datas collect 5s, totally 40 circulations；FAM leads to
Road real-time detection AE probe, VIC passage real-time detection CE probe amplification curves.As a result as shown in Figure 1：It is many for not containing
The sample of room echinococcuss and Echinococcus Granulosus Cysts is not expanded, FAM passages and the equal no signal of VIC passages (Figure 1A), for many room spine
Ball larva of a tapeworm or the cercaria of a schistosome sample, FAM passages have stronger fluorescence signal and VIC passages do not have fluorescence signal (Figure 1B)；For Echinococcus Granulosus Cysts sample
This, VIC passages have obvious fluorescence signal and FAM passages do not have signal (Fig. 1 C).
4th, the sensitivity of MGB probe in detecting Echinococcus moltilocularis
By the Echinococcus moltilocularis positive quality control sample (carrier T comprising Echinococcus moltilocularis with Echinococcus Granulosus Cysts target DNA fragment
Plasmid) quantitatively diluted after (108copy、107copy、106copy、105copy、104copy、103copy、102copy、
10copy, 1copy) as template, with EF, ER as primer, with AE probe, CE probe as probe, carry out real-time quantitative PCR
Amplification.Real-time quantitative PCR reaction system is：2 × Taq PCR MasterMix, 10 μ L；10 μM of primer EF, 0.40 μ L；10 μM are drawn
Thing ER, 0.4 μ L；AE-probe, 0.3 μ L；CE-probe, 0.3 μ L；DNF buffer 2μL；DNA profiling, 2 μ L；ddH2O, 4.6
μL；Overall reaction system is 20 μ L.The reaction condition of the real-time quantitative PCR with AE probe and CE probe as probe is：94℃
Enzyme activition 3min, 94 DEG C of degeneration 5s, 60 DEG C of annealing/extension/fluorescence datas collect 5s, totally 40 circulations；FAM passage real-time detections
AE probe, VIC passage real-time detection CE probe amplification curves, and (result is shown in figure to observe real-time quantitative PCR testing result
2).The detection kit can be expanded to the genes of interest containing 1 copy Echinococcus moltilocularis DNA sample in sample.
5th, the sensitivity of MGB probe in detecting Echinococcus Granulosus Cysts
By the Echinococcus Granulosus Cysts positive quality control sample (carrier T comprising Echinococcus moltilocularis with Echinococcus Granulosus Cysts target DNA fragment
Plasmid) quantitatively diluted after (108copy、107copy、106copy、105copy、104copy、103copy、102copy、
10copy, 1copy) as template, with EF, ER as primer, with AE probe, CE probe as probe, carry out real-time quantitative PCR
Amplification.Real-time quantitative PCR reaction system is：2 × Taq PCR MasterMix, 10 μ L；10 μM of primer EF, 0.40 μ L；10 μM are drawn
Thing ER, 0.4 μ L；AE-probe, 0.3 μ L；CE-probe, 0.3 μ L；DNF buffer 2μL；DNA profiling, 2 μ L；ddH2O, 4.6
μL；Overall reaction system is 20 μ L.The reaction condition of the real-time quantitative PCR with AE probe and CE probe as probe is：94℃
Enzyme activition 3min, 94 DEG C of degeneration 5s, 60 DEG C of annealing/extension/fluorescence datas collect 5s, totally 40 circulations；FAM passage real-time detections
AE probe, VIC passage real-time detection CE probe amplification curves, and (result is shown in figure to observe real-time quantitative PCR testing result
3), the detection kit can be expanded to the genes of interest containing 1 copy Echinococcus Granulosus Cysts DNA sample in sample.
Below the present invention is described in detail, the above, only the preferred embodiments of the invention, when can not
Limit the scope of the present invention, i.e., it is all according to the made impartial change of the application scope with modify, all should still belong to covering scope of the present invention
It is interior.
<110>Qinghai University
<120>Real time quantitative PCR method and the detection examination of Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing
Agent box
<130> 1
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<400> 1
gacagggatt agatacccca tt 22
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<400> 2
gtggaccatc ctttactatg c 21
<210> 3
<211> 17
<212> DNA
<213>Artificial sequence
<400> 3
cagtgagtga ttcttgt 17
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence
<400> 4
cagtgagcga ttcttat 17
Claims (8)
1. a kind of real time quantitative PCR method that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing, its feature are existed
In：PCR primer employed in the PCR method to including outer primer to and MGB typing detection probes,
The sequence of the outer primer pair is as follows：
Forward primer EF：5’–GACAGGGATTAGATACCCCATT–3’(SEQ ID NO：1)；
Downstream primer ER：5’–GTGGACCATCCTTTACTATGC–3’(SEQ ID NO：2)；
The sequence of the MGB typings detection probe is as follows：
AE probe：5’–FAM-CAGTGAGTGATTCTTGT-MGB–3’(SEQ ID NO：3)；
CE probe：5’–HEX-CAGTGAGCGATTCTTAT-MGB–3’(SEQ ID NO：4).
2. it is a kind of to detect that Echinococcus moltilocularis and the real-time of Echinococcus Granulosus Cysts are determined based on MGB probes typing as claimed in claim 1
The detection kit of amount PCR method, it is characterised in that：The detection kit is contained within the outer primer of the PCR primer pair
To sequence and the MGB typings detection probe sequence.
3. the real-time quantitative that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing according to claim 2
The detection kit of PCR method, it is characterised in that：The detection kit also includes dNTPs, Taq enzyme, Mg2+, PCR reaction buffering
One or more in liquid.
4. the fixed in real time of Echinococcus moltilocularis and Echinococcus Granulosus Cysts is detected based on MGB probes typing according to Claims 2 or 3
The detection kit of amount PCR method, it is characterised in that：The detection kit also includes standard positive template.
5. the real-time quantitative that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing according to claim 2
PCR method, it is characterised in that：Using the outer primer of the detection kit to sequence and the MGB typings detection probe
Sequence pair Echinococcus moltilocularis and Echinococcus Granulosus Cysts carry out typing PCR detections.
6. the real-time quantitative that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing according to claim 5
PCR method, it is characterised in that：Comprise the following steps,
1) extract the STb gene in sample tissue；
2) with step 1) in STb gene as template, with EF and ER as primer pair, with AE-probe, CE-probe as probe, carry out
Real-time quantitative PCR amplified reaction；
3) quantitative fluorescent PCR analysis DNA product.
7. the real-time quantitative that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing according to claim 6
PCR method, it is characterised in that：For with EF and ER as primer pair, AE-probe, CE-probe are the real-time quantitative PCR of probe
Reaction system is calculated as with 20 μ L：
2 × Taq PCR MasterMix, 10 μ L；10 μM of primer EF, 0.40 μ L；10 μM of primer ER, 0.4 μ L；AE-probe, 0.3
μL；CE-probe, 0.3 μ L；DNF buffer 2μL
DNA profiling, 2 μ L；ddH2O, 4.6 μ L；Overall reaction system is 20 μ L.
8. the real-time quantitative that Echinococcus moltilocularis and Echinococcus Granulosus Cysts are detected based on MGB probes typing according to claim 6
PCR method, it is characterised in that：It is for EF and ER as PCR primer pair, fixed in real time with AE-probe, CE-probe as probe
Amount PCR reaction condition be：94 DEG C of enzyme activition 3min, 94 DEG C of degeneration 5s, 60 DEG C of annealing/extension/fluorescence datas collect 5s, and totally 40
Individual circulation；FAM passage real-time detection AE probe, VIC passage real-time detection CE probe amplification curves.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611198588.1A CN106591456A (en) | 2016-12-22 | 2016-12-22 | Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611198588.1A CN106591456A (en) | 2016-12-22 | 2016-12-22 | Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106591456A true CN106591456A (en) | 2017-04-26 |
Family
ID=58600526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611198588.1A Pending CN106591456A (en) | 2016-12-22 | 2016-12-22 | Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591456A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384872A (en) * | 2017-12-19 | 2018-08-10 | 上海百力格生物技术有限公司 | A kind of MGB primer and probe sequences for the detection of 1 critical sites hypotype of corn glutamate formiminotransferase |
| CN109762910A (en) * | 2019-01-10 | 2019-05-17 | 四川省疾病预防控制中心 | It is a kind of for detecting the primer and kit of amphitypy echinococcosis simultaneously |
| CN110283897A (en) * | 2019-04-17 | 2019-09-27 | 青海大学 | A kind of gene tester of individuation vitamin B12 supplement dosage |
| CN111518877A (en) * | 2020-05-12 | 2020-08-11 | 青海大学 | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples |
| CN111607656A (en) * | 2020-06-28 | 2020-09-01 | 哈密市动物疫病预防控制中心 | Triple PCR detection primer, method and kit for tapeworm and sporozoon in canine feces |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550455B (en) * | 2008-03-31 | 2011-08-24 | 广州达安临床检验中心有限公司 | Human parainfluenza virus distinguishing and quantitative detection regent kit |
| CN105018613A (en) * | 2015-07-17 | 2015-11-04 | 上海师范大学 | Method for detecting Echinococcus multilocularis from fox excrement |
-
2016
- 2016-12-22 CN CN201611198588.1A patent/CN106591456A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101550455B (en) * | 2008-03-31 | 2011-08-24 | 广州达安临床检验中心有限公司 | Human parainfluenza virus distinguishing and quantitative detection regent kit |
| CN105018613A (en) * | 2015-07-17 | 2015-11-04 | 上海师范大学 | Method for detecting Echinococcus multilocularis from fox excrement |
Non-Patent Citations (6)
| Title |
|---|
| ANKE DINKEL等: "A PCR system for detection of species and genotypes of the Echinococcus granulosus-complex, with reference to the epidemiological situation in eastern Africa", 《INTERNATIONAL JOURNAL FOR PARASITOLOGY》 * |
| ANKE DINKEL等: "Detection of Echinococcus multilocularis in the Definitive Host:Coprodiagnosis by PCR as an Alternative to Necropsy", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| HÜSEYIN CAN等: "Detection of Echinococcus granulosus and Echinococcus multilocularis in Cyst Samples Using a Novel Single Tube Multiplex Real-Time Polymerase Chain Reaction", 《MIKROBIYOL BUL.》 * |
| M. ROSTAMI NEJAD等: "Echinococcus granulosus strain differentiation in Iran based on sequence heterogeneity in the mitochondrial 12SrRNA gene", 《JOURNAL OF HELMINTHOLOGY》 * |
| RUNETTI E.等: "Expert consensus for the dia gnosis and treatment of cystic and alveolar echinococcosis in humans", 《 J. A CTA TROP》 * |
| 陈 璐等: "环介导等温扩增技术（LAMP ）检测棘球绦虫感染犬粪DNA 的研究Ⅱ", 《中国人兽共患病学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108384872A (en) * | 2017-12-19 | 2018-08-10 | 上海百力格生物技术有限公司 | A kind of MGB primer and probe sequences for the detection of 1 critical sites hypotype of corn glutamate formiminotransferase |
| CN109762910A (en) * | 2019-01-10 | 2019-05-17 | 四川省疾病预防控制中心 | It is a kind of for detecting the primer and kit of amphitypy echinococcosis simultaneously |
| CN110283897A (en) * | 2019-04-17 | 2019-09-27 | 青海大学 | A kind of gene tester of individuation vitamin B12 supplement dosage |
| CN111518877A (en) * | 2020-05-12 | 2020-08-11 | 青海大学 | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples |
| CN111607656A (en) * | 2020-06-28 | 2020-09-01 | 哈密市动物疫病预防控制中心 | Triple PCR detection primer, method and kit for tapeworm and sporozoon in canine feces |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106591456A (en) | Real-time quantitative PCR (Polymerase Chain Reaction) method for detecting echinococcus multilocularis and echinococcus granulosus by types based on MGB (Minor Groove Binder) probe and detection kit | |
| CN106011246B (en) | 5 kinds of root-knot nematode isothermal duplication detection primer sequences and its application based on microfluidic chip technology | |
| CA2793660A1 (en) | Methods, kits and compositions for detection of mrsa | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102010910A (en) | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method | |
| CN105755134B (en) | Endonuclease-mediated real-time multiple cross-displacement nucleic acid amplification technology and application | |
| CN108179212A (en) | For detecting the multiple fluorescence PCR kit of abdominal cavity bacterial infection and method | |
| CN111206106A (en) | RPA primer, kit and detection method for detecting sweet potato rot stem nematode | |
| Elbeaino et al. | Development of an FTP-LAMP assay based on TaqMan real-time PCR and LAMP for the specific detection of Xylella fastidiosa De Donno and mulberry strains in both plants and insect vectors | |
| CN117363767A (en) | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit | |
| Galetto et al. | Real-time PCR diagnosis and quantification of phytoplasmas | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN105624285A (en) | Mycoplasma pneumoniae fluorescent PCR detection reagent kit | |
| Gomes et al. | Direct detection of Theileria annulata in bovine blood samples using standard and isothermal DNA amplification approaches | |
| CN105219879B (en) | The application of Primer composition and its application, the kit and kit that are made from it for detecting citrus Tylenchulus Semipenetrans | |
| CN109022596A (en) | For detecting the Primer composition of Meloidogyne graminicola, the application of the kit and kit that are made from it | |
| CN107385048A (en) | A kind of Nucleic acid combinations, kit and method for detecting dendrobium candidum | |
| CN112301147A (en) | RPA primer probe combination, kit and detection method for detecting transgenic corn double antibody 12-6 | |
| CN112553350A (en) | Method for rapidly detecting multiple mycobacteria | |
| CN112359125A (en) | Method for rapidly detecting cryptococcus gatherensis | |
| CN107110864B (en) | Method for detecting the presence of highly virulent strains of clostridium difficile | |
| KR101759334B1 (en) | Primer Sets for Detecting Pseudomonas syringae pv. persicae, a Causal Agent of Bacterial Dieback in Stone Fruits and Methods for Detecting Pseudomonas syringae pv. persicae Using the Primer Sets | |
| CN114107539B (en) | LAMP primer composition for detecting pythium delicicola and application thereof | |
| KR101398286B1 (en) | Primer composition for loop-mediated isothermal amplification reaction for detecting Tobacco leaf curl virus, and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170803 Address after: Nanjing Road 810016 in Qinghai province Xining City District No. 251 Applicant after: Qinghai University Applicant after: Qinghai informed precision medical science and Technology Co Ltd Address before: Nanjing Road 810016 in Qinghai province Xining City District No. 251 Applicant before: Qinghai University |
|
| TA01 | Transfer of patent application right |