NL2021185B1

NL2021185B1 - Combination Therapy and Use Thereof for Treating Cancer

Info

Publication number: NL2021185B1
Application number: NL2021185A
Authority: NL
Inventors: Bernards Rene; Wang Cun
Original assignee: Stichting Het Nederlands Kanker Inst Antoni Van Leeuwenhoek Ziekenhuis
Priority date: 2018-06-26
Filing date: 2018-06-26
Publication date: 2020-01-06
Also published as: WO2020005063A1

Abstract

The present invention relates to the field of cellular senescence and cancer therapy, more particularly to combination therapies and use thereof for the treatment of various cancers (e.g. liver cancer). Provided are combination therapy compositions comprising a CDC? inhibitor compound and a mTOR inhibitor compound, and kit thereof, for use in the treatment of divers cancers (e.g. liver cancer, lung cancer, non-small lung cancer, colon cancer, and others), as well as for use in methods of treatment of a cancer subject (e.g. liver cancer subject) as taught herein. Also provided are methods for selecting a cancer subject suitable for treatment with the combination therapy composition of the invention.

Description

DESCRIPTION

FIELD OF THE INVENTION

The present invention relates to the field of cellular senescence and cancer therapy, more particularly to combination therapies and use thereof for the treatment of cancer. Provided are combinations comprising a CDC7 inhibitor and a mTOR inhibitor, and compositions and kits comprising such inhibitor of CDC7 and/or such inhibitor of mTOR, for use in the treatment of cancers including, but not limited to liver cancer, lung cancer, non-small lung cancer, colon cancer. Also provided are methods of treatment of a cancer subject using the combination therapy as taught herein.

BACKGROUND

Cancer is a leading cause of death worldwide, accounting for more than 8.8 million deaths in 2015. Generally, when cancer develops, normal cells become progressively abnormal over time as they acquire mutations, which allow them to escape immune surveillance, survive, grow uncontrollably, and spread through the body (Lazebnik, Y., (2010), Nature Reviews Cancer, Vol. 10, pages 232-233; Bekele and Brindley (2012), Clinical Lipidology, Vol.7, pages 313-328).

Despite recent advances in understanding mechanisms involved in cancer encouraging pre-clinical studies of once promising approaches in the end regularly fail to provide substantial benefits in cancers patients. Drug therapies for various types of cancers are often palliative in nature and rarely offer a long-term cure. There is a constant need for new treatment options either in the form of monotherapy or in the form of combination treatment, combining different new or known drugs, for use as first line therapy, and/or as second line therapy in treatment of cancer (e.g. to treat treatment-resistant tumors).

Identifying pharmaceutically acceptable drugs that can be used in combination therapy. This is due to the fact that proliferative diseases are multifactorial in nature.

Just considering any combination of therapeutic agents having different mode of action does normally not lead to combinations with advantageous effects. Most notable example is the publication of Tol et al (N Engl J Med 2009;360:563-72) showing that the addition of cetuximab to capecitabine, oxaliplatin, and bevacizumab in colon cancer resulted in significantly shorter progression-free survival and inferior quality of life. Cetuximab is approved for use in colon cancer and is beneficial, but adding it to another effective regimen (capecitabine, oxaliplatin and bevacizumab) did not improve therapy.

There is also a need for finding alternative ways of using drugs that, despite promising pre-clinical evidence, provided no benefit or only provided limited benefit to patients as monotherapy, for example due to toxicity or lack of activity.

Over the last decade, there has been interest in the field of therapy-induced senescence (also known as pro-senescence therapy) for use as new or alternative cancer therapeutics and/or for use in method of treatment for cancer (Nair et al (2017), Biomedical Research Journal, Vol. 4(1), pages 28-48; Ewald et al (2010), J, Natl Cancer Inst., Vol. 102(20), pages 1536-1546; Lee and Lee (2014), BMB reports, Vol. 47(2), pages 51-59).

Therapy-induced senescence is a type of cancer therapy involving the use of compounds or drugs capable of inducing senescence in cancer cells. Senescence is a physiological process of (essentially) “stable cell-cycle arrest”, which leads to the loss of proliferative (cell division) capacity of mitotic cells (cells having the ability to divide), even in the presence of mitogenic signals. Senescence plays a role in natural aging. Although senescent cells have lost their ability to proliferate, they remain viable and metabolically active (e.g. capable of secretary activity such as secreting cytokines, growth factors and proteases, and others), a phenotype referred to as senescence-associated secretory phenotype.

It was quickly realized that having a way of (artificially) inducing senescence in cancer cells may help to contain or prevent or slow cancer growth. However, it turned out that the exploitation of the senescence concept as a way to treat cancer was not as easy or as straight forward as was initially thought.

For example, it was found (rather disappointingly) that the effect of therapy-induced senescence in cancer cells was prominent in the early stages of treatment but did not endure or was not enough to prevent or stop tumor growth (Wu et al (2012), Exp. Oncol., Vol.34(3), pages 298-305; Nair et al (2017), Biomedical Research Journal, Vol. 4(1), pages 28-48).

It has also been reported that although therapy-induced senescence may have shortterm benefits, the response by the tumor may also causes reprogramming of gene expression and activates invasion-related genes that accelerate tumor progression (Yang et al (2017), Cell Death Discovery (2017) 3, 17049;

doi:10.1038/cddiscovery.2017.49). It was suggested that blocking the initiation of senescence, or inhibiting reversal from senescence, may reduce the chance of tumor progression.

In addition it was found that cancer cells have the ability to overcome therapyinduced senescence resulting in the cancer cells (also known as senescence escapers) being able to resume proliferation (Sabine and Anderson (2011), Genome Integrity, Vol.2(1), page 7; Nair et al (2017), Biomedical Research Journal, Vol. 4(1), pages 28-48; Munoz-Espin et al (2014), Nat Rev Mol Cell Biol, Vol. 15(7), pages 48296).

It was further found that senescent cancer cells, e.g. senescence escaper cancer cells, can exert harmful effects by secreting paracrine-active factors capable of influencing growth and migration of cells in the tumor environment (e.g. promote growth of epithelial cells) and other factors promoting inflammation (Munoz-Espin et al (2014), Nat Rev Mol Cell Biol, Vol.15(7), pages 482-96; Nair et al (2017), Biomedical Research Journal, Vol. 4(1), pages 28-48; Lee and Lee (2014), BMB reports, Vol. 47(2), pages 51-59).

Overall, despite the great potential of therapy-induced senescence for treating or improving long-term outcomes such as increasing progression-free survival and response rate of cancer patients approaching encompassing therapy-induced senescence are currently not optimal and are associated with undesired or disadvantageous effects, including those mentioned above.

Therefore, there remains a need for new therapeutic strategies based on the concept of therapy-induced senescence, for the treatment of various cancer types and which are devoid of at least some of the limitations above.

SUMMARY

The present inventors have uncovered a new cancer therapy relying on the concept of therapy-induced senescence and which is devoid of at least some of the limitations current associated with such therapies. Specifically, the present inventors have found a new combination therapy comprising (the use of) a CDC7 inhibitor and a mTOR inhibitor. Also provided are new cancer treatment methods, including methods to identify a cancer subject suitable for treatment with the combination therapy of the invention. The advantageous of the present invention will be discussed throughout the present disclosure and are summarized below:

Combination therapy

It was surprisingly found that, when administered in combination, e.g. in a way that both compounds exert concomitant therapeutic effects in the same cells, this particular combination of compounds (i.e. a CDC7 inhibitor and a mTOR inhibitor) effectively caused growth inhibition of cancer, including, but not limited to, liver cancer, lung cancer, non-small lung cancer, and colon cancer, both in vitro and in vivo, as shown herein. This effect was not seen when other senescence inducing drugs, not a CDC7 inhibitor, were used. Without being bound to any theory, it is believed that the cancer growth inhibition effect is the consequence of induction of senescence by specifically inhibiting CDC7 in the cancer cell using a CDC7 inhibitor, as exemplified by XL413, Tak-931, and LY3177833 and the killing of these specific cells (e.g. via apoptosis) in response to exposure to a mTOR inhibitor, as exemplified by AZD8055 or AZD2014. In other words, the inventors believe that the specific combination of an inhibitor of CDC7 and an inhibitor of mTOR provide for the observed beneficial effect, both in vitro and in vivo. It is thought that the inhibition of CDC7 and inhibition of mTOR causes a specific physiological response the cancer cells leading to inhibition of growth and cancer cell death.

The observed effect is not limited to those combinations of CDC7 inhibitors and mTOR inhibitors tested in the Examples herein. The data supports the surprising conclusion that it is the inhibition of CDC7 and the inhibition of mTOR in cancer cells that provides for the observed beneficial effects.

Combinations of inhibitors of CDC7 inhibitor such as XL413, TAK-931 and LY3177833 and inhibitors of mTOR, such as AZD8055 and AZD2014, were indeed found to be effective, i.e. effectively caused growth inhibition of cancer (as shown herein, e.g. in vitro). In particularly the inventors tested combinations wherein:

- the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD8055;

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD8055;

- the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD8055;

- the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD2014;

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD2014; and

- the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD2014.

The combination therapy of the present invention, e.g. such as described above, offers several advantages over existing cancer therapies First, the present inventors have shown for the first time that cancer cells artificially induced to undergo senescence by inhibition of CDC7, i.e. by exposure to a CDC7 inhibitor such as XL413, or TAK931 or LY3177833 can be selectively eradicated (killed via apoptosis, and then eliminated from the body) by inhibiting mTOR is said cells, e.g. by exposure to a mTOR inhibitor such as AZD8055 or AZD2014, and, surprisingly, with minimal effects on healthy cells or tissue. In other words, the combination selectively acts on or targets cancer cells, more in particular the mTOR inhibitor selectively acts on or target cancer cells treated with a CDC7 inhibitor.

Therefore, in one aspect the invention provides for a new way of using an mTOR inhibitor in the treatment of cancer by treating cancer cells treated with a CDC7 inhibitor.

Thereof, in one aspect the invention provides for a new way of using a CDC7 inhibitor in the treatment of cancer by treating cancer cells treated with a mTOR inhibitor.

Another advantage of the combination therapy is that it allows to rid the body of senescent cancer cells artificially induced to be senescent by exposure to a CDC7 inhibitor before the senescent cancer cells can exit the senescent fate (e.g. by activating senescence reversal mechanisms) and/or before the senescent cells can exert harmful effects having negative influences on surrounding (healthy) cells and tissues (e.g. secretion of paracrine signals and /or pro-inflammatory molecules, etc.).

Globally, the combination therapy of the invention not only effectively stops or slows cancer cell growth or tumor growth but also specifically removes the targeted cancer cells. This can result in enduring, long-term beneficial effects in cancer subjects (such as mammals, e.g. human beings) receiving or being administered with the combination as taught herein, such as decrease in tumor size and/or increased survival (increased progression-free survival), as well as increased overall (positive) response rate in cancer subjects.

In a beneficial embodiment the present combination was found to be particularly effective for treating cancer subjects wherein the cancer is characterized by a mutated p53 gene, i.e. wherein the patient carries mutations in the p53 gene relative to wild-type p53, for example loss-of-function mutations or other defects leading to the occurrence of non-functional p53 gene or protein of altered function.

Therefore, the present combination therapy represents a new effective treatment strategy which is devoid of at least some of the disadvantages of existing cancer therapies as discussed above.

Method of treatment

The present inventors have devised new treatment methods relying on the use of the combination of the invention.

In one embodiment it was found that the combination therapy of the invention is particularly beneficial or effective in the treatment of cancer (e.g. liver cancers) having a mutated p53 gene, e.g. causing a loss-of-function of the p53 protein thus providing a “personalized” treatment or medicine to a particular cancer patient group, wherein the cancer patients are characterized by having (e.g. in their genome) a p53 mutation (e.g. p53 mutant genotype or phenotype) or other genetic or metabolic alterations leading to the occurrence of non-functional p53 gene product (p53 proteins). Based on this the present inventor have also devised a method for identifying a cancer subject (particularly) suitable for treatment with the combination therapy of the invention, which relies on detecting the presence or absence of a p53 mutation, as taught herein.

DETAILED DESCRIPTION

Definitions

A portion of this disclosure contains material that is subject to copyright protection (such as, but not limited to, diagrams, device photographs, or any other aspects of this submission for which copyright protection is or may be available in any jurisdiction). The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or patent disclosure, as it appears in the Patent Office patent file or records, but otherwise reserves all copyright rights whatsoever.

Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. For purposes of the present invention, the following terms are defined below.

As used herein, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise. For example, a method for administrating a drug includes the administrating of a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

As used herein, the term “and/or” indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

The term to comprise and its conjugations as used herein is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It also encompasses the more limiting “to consist of”.”

The terms “cancer” and “tumor” (used interchangeably), as used herein, refer to or describe the physiological condition in humans that is typically characterized by unregulated cell growth. The terms “cancer” and “tumor” also refer to cells that have undergone a malignant transformation that makes them pathological to the host organism. Cancer cells can be distinguished from non-cancerous cells by techniques known to the skilled person.

The term subject or “patient” (used interchangeably) as used herein refers to a human subject male or female, adult, child or infant, suffering from a cancer, regardless of the stage or state of the cancer.

The terms treat, treating, treatment, “therapy” and the like as used herein refer to reducing or ameliorating a disorder (herein cancer) and/or symptoms associated therewith. It is appreciated that treating a disorder or condition (e.g. cancer such as lung cancer) does not require that the disorder, condition or symptoms associated therewith be completely eliminated. It is further understood that the terms treat, treating, treatment, “therapy” and as used herein may be a first or first line of treatment (i.e. patient is naive to any cancer treatment) or a second or third line treatment and so on (i.e. the first treatment or second treatment and so on was not effective or has failed).

The term inhibitor” of a (defined) protein”, for example CDC7 inhibitor or a mTOR inhibitor, as used herein refers to a compound capable of down-regulating, decreasing, suppressing gene expression and/or protein production or otherwise regulating the amount and/or activity (e.g. enzymatic activity) of the (defined) gene or protein (i.e. CDC7 or mTOR, as taught herein). In an embodiment, the compound inhibits the activity (e.g. enzymatic activity) of CDC7 or mTOR. Such compounds, in particular such pharmaceutically acceptable compound are well-known to the skilled person and are generally referred to in the prior art as CDC7 inhibitor or mTOR inhibitor. For example, marketing authorizations and drug approvals identify approved drugs not only by structure but also by its mode of action, in this case by identifying a compound as a CDC7 inhibitor and/or as mTOR inhibitor, reflecting the understanding by the skilled person that the treatment is based on the inhibition of, in the current case, CDC7 and/or mTOR. Another example are scientific publications that refer to (candidate) drugs by means of it mechanism of action, for example (candidate) drugs are studied by its virtue of being a modulator of enzyme activity, for example by being a CDC7 inhibitor or a mTOR inhibitor. Consequently, a skilled person very well understands what, in the context of the current invention is an inhibitor of CDC7. Consequently, a skilled person very well understands what, in the context of the current invention is an inhibitor of mTOR.

The term “cell division cycle 7-related protein kinase (abbreviated CDC7)” as used herein refers to an enzyme involved in regulation of the cell cycle at the point of chromosomal DNA replication. In human, CDC7 is encoded by the CDC7 gene (ensemble ref: ENSG00000097046). CDC7 (protein) is predominantly localized in the nucleus and serves as a cell division cycle protein with kinase activity. Specifically, CDC7 (protein) is a serine-threonine kinase that plays a key role in the initiation of DNA replication and regulation of the S phase cell cycle check point. CDC7 activity requires the binding of either one of two regulatory subunits, Dbf4 and Drf1/Dbf4B. Periodic accumulation of CDC7, Dbf4 and Drf1/Dbf4B during S-phase is thought to be the major mechanism that regulates CDC7 activity during the cell cycle. CDC7 and related pathways have been intensively studied and reviewed, for instance in Masaaki Sawa and Hisao Masai (2008), Drug design, Development and Therapy, Vol. 2, pages 255-264).

The term “CDC7 inhibitor” as used herein is well-understood by the skilled person and refers to compounds or drugs (e.g. small molecules) capable of, in particular in vivo, for example when provided to a patient, (specifically) down-regulating, decreasing, suppressing or blocking the expression of the CDC7 gene and/or downregulating, decreasing, suppressing or blocking the production of its product (CDC7 protein), or otherwise (specifically) regulating (e.g. by decreasing or blocking or suppressing) the amount and/or activity (e.g. enzymatic activity) of CDC7 kinase. As mentioned, is a preferred embodiment the CDC7 inhibitor inhibits the activity of the CDC7 kinase. In the context of the present invention, a CDC7 inhibitor compound is a compound capable of (specifically) inhibiting CDC7 by at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more compared to control. In an embodiment the CDC7 inhibitor is a compound capable of (specifically) inhibiting CDC7 comparable to XL413 (e.g. 0.1 - 10 fold potency). The skilled person is wellacquainted with methods for measuring CDC7 inhibition. CDC7 activity inhibition can be measured, for example, as described in EP2970221.

One of the first series of CDC7 inhibitors (e.g. CDC7 kinase ATP-competitive smallmolecule inhibitors belonging to the 2-heteroaryl-pyrrolopyridones chemical class) to be considered for clinical use were identified at Nerviano Medical Sciences Sri by high-throughput screening (e.g. see Vanotti et al (2008), J Med Chem, Vol. 51, pages 487-501; Montagnoli et al (2010) American Association of Cancer Research, Vol. 16(18), pages 4503-4508). Other CDC7 inhibitors include NMS-1116354 (Montagnoli et al (2010) American Association of Cancer Research, Vol. 16(18), pages 4503-4508), XL-413 (also known as BMS-863233 from Bristol Myers Squibb (BMS), e.g. see Koltun et al (2012), Bioorg Med Chem Lett., Vol. 22(11), pages 3727-31; Montagnoli et al (2010) American Association of Cancer Research, Vol. 16(18), pages 4503-4508), and SRA141 (Sierra Oncology, e.g. Montagnoli et al (2010) American Association of Cancer Research, Vol. 16(18), pages 4503-4508).

Other CDC7 inhibitors include TAK-931 (Takeda oncology), LY3177833 as well as compounds described in W02005/100351, W02014143601A1, and in Masaaki Sawa and Hisao Masai (2008), Drug design, Development and Therapy, Vol. 2, pages 255264).

The term “mammalian target of rapamycin (abbreviated mTOR)”, as used herein, refers to a kinase, which is a member of the phosphatidylinositol 3-kinase-related kinase family of protein kinases. In human, mTOR is encoded by the MTOR gene (Ensembl ref: ENSG00000198793). mTOR is also known as “the mechanistic target of rapamycin and FK506-binding protein 12-rapamycin-associated protein 1 (FRAP1)”. mTOR links with other proteins and serves as a core component of two distinct protein complexes, mTOR complex 1 and mTOR complex 2, which regulate different cellular processes. In particular, as a core component of both complexes, mTOR functions as a serine/threonine protein kinase that regulates cell growth, cell proliferation, cell motility, cell survival, protein synthesis, autophagy, and transcription. As a core component of mTORC2, mTOR also functions as a tyrosine protein kinase that promotes the activation of insulin receptors and insulin-like growth factor 1 receptors. mTORC2 has also been implicated in the control and maintenance of the actin cytoskeleton. Interest in mTOR as a potential cancer therapy target (e.g. as monotherapy) came from studies on rapamycin. Rapamycin is one of the first mTOR inhibitors, which was developed as an antifungal drug against Candida albicans, Aspergillus fumigatus and Cryptococcus neoformans. It was later discovered that rapamycin also had anti-cancer activity against several human cancer types (e.g. see Faivre et al (2006), Nature Reviews Drug Discovery, Vol. 5 (8). pages 671-88). This prompted the development of several mTOR inhibitors (e.g. rapamycn derivatives or analogues (rapalogs) such as temsirolimus (CCI-779, Wyeth), everolimus (RAD001, Novartis), and ridaforolimus (AP-235730, Ariad Pharmaceuticals) (see e.g. Brachman et al (2009), Current Opinion in Cell Biology, Vol.21 (2), pages 194-8). Rapamycin and its analogues only inhibit mTOR1. Other non-limiting examples of mTOR inhibitor compounds are listed below. However, it was found that in general, the development of mTOR inhibitors for the treatment of cancer (e.g. as monotherapy) was not successful due to unfavorable pharmacokinetic properties or other adverse effects (Guertin and Sabatini (2007),

Cancer Cell, Vol.12, pages 9-22; Oronsky et al (2017) Neoplasia, Vol 19(10), pages 842-847)).

The term “mTOR inhibitor” as used herein is well-understood by the skilled person and refers to compounds or drugs (e.g. small molecules) capable of, in particular in vivo, for example when provided to a patients, (specifically) down-regulating, decreasing, suppressing or blocking the expression of the mTOR gene and/or downregulating, decreasing, suppressing or blocking the production of its product (mTOR protein) or otherwise (specifically) regulating (e.g. by decreasing or blocking or suppressing) the amount and/or activity (e.g. enzymatic activity) of mTOR kinase As mentioned, is a preferred embodiment the CDC7 inhibitor inhibits the activity of the CDC7 kinase. In the context of the present invention, a mTOR inhibitor compound is a compound capable of (specifically) inhibiting mTOR by at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more as compared to control. In an embodiment the mTOR inhibitor is a compound capable of (specifically) inhibiting mTOR comparable to AZD8055 (e.g. with a 0.1 - 10 fold potency).The skilled person is well-acquainted with methods for measuring mTOR inhibition, for example using methods as described in US9102670.

Non-limiting examples of mTOR inhibitors include AZD8055 (e.g. see Chresta et al, (2010) Cancer Res., Vol. 70(1), pages 288-98), and AZD2014 (AstraZeneca ,e.g. see (2015), Guichard et al (2015) Mol Cancer Ther., Vol. 14(11), pages 2508-18), TAK931 and LY3177833. Other examples include PP242 and PP30, WAY-600, WYE-687 and WYE354, and KU0063794, OSI-027, a triazine derivative, INK128, a pyrimidine derivative similar to PP242 and PP30, Torin 1, BEZ235, XL765, TAK931, XL413 and LY3177833 (see for an overview Mol Cell Pharmacol. 2015; 7(2): 1520.). Within the context of the current invention, the mTOR inhibitors preferably inhibit mTOR2 (see for selectivity of mTOR inhibitors Cancer Res. 2010 Jan 1 ;70(1):288-98.). Within the context of the current invention, the mTOR inhibitors preferably inhibit both the mTOR complexes, i.e. inhibit both mTOR 1 and mTOR2. It is noted that, for example, rapamycin, which only inhibits mTOR1 was way less active in our assays as compared to the mTOR inhibitors that are also inhibitors of mTOR2.

The term “tumor protein 53 (abbreviated as p53)” as used herein is well-known to the skilled person and refers to a nucleophosphoprotein that binds DNA and regulates normal cell growth and proliferation and prevents unrestrained division of cells whose DNA has been damaged (e.g. via ultraviolet or ionizing radiation). The absence of functional p53, usually resulting from a genetic mutation, increases the risk of developing various cancers. P53 is encoded by the TP53 gene (humans, ensemble ref: ENSG0000014151). Therefore, the term TP53 or “p53 gene” as used herein refers to the gene encoding p53 protein. The term “p53” is also known as cellular tumor antigen p53, phosphoprotein p53, tumor suppressor p53, antigen NYCO-13, or transformation-related protein 53 (TRP53) or any isoform of a protein encoded by homologous genes in various organisms In the context of the present invention, the term p53 as used herein refers to both p53 protein and the TP53 gene.

The term “mutated p53 gene” or “p53 mutation” as used herein refers to genetic mutation(s) in the tumor protein 53 (TP53) gene. In the context of the present invention, it is understood that “mutated p53 gene” or “p53 mutation” refers to any p53 protein or gene other than wild- type p53 protein or gene. It was found that the TP53 gene is one of the most commonly mutated gene in human cancer (Muller and Vousden (2014), Cancer cell, Vol. 25, pages 304-317). Mutations in the TP53 gene typically lead to a loss of wild-type p53 activity (i.e. so-called “loss-of-function” mutation leading to non-functional p53 gene or protein compared to wild type p53 gene or protein) or alterations in wild-type p53 activity (e.g. leading to less functional p53 gene or p53 protein compared to wild type p53 gene or protein) (Muller and Vousden (2014) Cancer cell, Vol. 25, pages 304-317). Several (different) type of p53 mutations have been documented. For instance, an extensive lists of p53 mutations is available on the IARC TP53 Database (see http://p53.iarc.fr/). The IARC database compiles various types of data and information on human TP53 gene variations (e.g. mutation) related to cancer. Data are compiled from the peer-reviewed literature and from generalist databases. A further source of non-limiting examples of p53 mutations is disclosed in Muller and Vousden (2014), Cancer Cell, Vol. 25, pages 304-317. Other examples of TP53 mutations are described in, e.g., Soussi T. (2007)

Cancer Cell 12(4):303-12; Cheung K. J. (2009) Br J Haematol. 146(3):257-69; Pfeifer G. P. et al. (2009) Hum Genet. 125(5-6):493-506; Petitjean A. et al. (2007) Oncogene 26(15):2157-65; Olivier et al., (2010) Cold Spring Harb Perspect Biol 2, a001008.

Alterations of a wild-type p53 gene according to the present invention encompass all forms of mutations such as insertions, inversions, deletions, and/or point mutations and includes somatic and germ line mutations and that cause a loss-of-function. Somatic mutations are those which occur only in certain tissues, e.g., in the tumor tissue, and are not inherited in the germ line. Germ line mutations can be found in any of a body's tissues. As previously described 70% of TP53 mutations are missense mutations affecting residues within the p53 DNA-binding domain (DBD).

The term “administered” or “administering” or “providing” as taught herein refers to the act of providing or administering a subject with the combination of the invention

i.e., a CDC7 inhibitor compound and a mTOR inhibitor compound, which can be administered to said subject simultaneously, separately or sequentially (as explained herein), using any of the various methods of delivery systems well known to those skilled in the art. The administering can be performed, for example, orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, introccularly, via local delivery, subcutaneously, intraadisposally, intraarticularly, intrathecally, into a cerebral ventricle, intraventricularly, intratumorally, into cerebral parenchyma or intraparenchymally or microinjection or others. Depending on the type of compounds used, the skilled person knows how to select a suitable delivery system, /nip

The term “senescence”, as used herein, refers to a phenomenon by which normal cells stop or cease to divide. Senescence was originally identified through the limited ability of primary fibroblasts in culture to undergo cell division (Hayflick et al (1965), Exp. Cell Res, Vol.37, pages 614-636). After the replicative potential of primary cells is exhausted, they enter into a stable state of growth arrest termed senescence, which is characterized by absence of proliferation markers, expression of growth inhibitory tumor suppressor genes, senescence associated β-galactosidase (SA-βgal) and nuclear heterochromatin foci, referred to as senescence-associated heterochromatin foci (SAHFs) (Munoz-Espin et al (2014), Nat Rev Mol Cell Biol., Vol. 15(7), pages 482-96). Senescence is generally considered to be a fail-safe mechanism against oncogenic transformation, as expression of an oncogenic RAS gene in primary cells leads to a post-replicative state referred to as oncogeneinduced senescence (Serrano et al (1997), Cell, Vol.88 (5), pages 593-602). This fail-safe mechanism also operates in humans to prevent cancer, as melanocytic nevi (moles) often carry an activated BRAF(V600E) oncogene, but stain for many of the known senescence markers, indicative of a stable and lasting state of oncogeneinduced senescence in these cells (Michaloglou et al (2005), Nature, Vol.436(7051), pages 720-724). Senescent cells also secrete a variety of inflammatory cytokines and chemokines, collectively referred to as the “Senescence-Associated Secretory Phenotype (SASP) (Kuilman et al (2008), Cell, Vol.133(6), pages 1019-1031; Coppe et al (2008), PLoS Biol, Vol. 6(12), pages 2853-2868). These cytokines are thought to assist in the clearance of senescent cells through attraction of inflammatory phagocytic cells, such as macrophages and B and T cells.

The term “senescent cells” or “senescent cancer or tumor cells” as used herein refers to cells (e.g. cancer cells), which are in a state of growth arrest. A cell capable of dividing may become senescent (in a naturally-occurring way, i.e. not induced by a drug compound) when, for example, it encounters oncogenic stress or undergo DNA damage (e.g. see Rodier F (2011) J Cell Biol. 2011, DOI: 10.1083/jcb.201009094, from which the description of senescence is incorporated herein by reference). In the present invention, the term senescent tumor cells or “senescent cancer cells” encompasses cancer cells which have adopted the cellular senescence phenotype, for example as evidenced by growth arrest and/or by the presence of a marker or combination of markers that are characteristic of senescence. Such markers include but are not necessarily limited to the pl6INK4a tumor- suppressor protein, and modified, e.g. increased, expression relative to a reference, such as a non-senescent cell, in the levels of DNA-damage response (DDR) markers, as well as the cell cycle inhibitors pl6INK4A, pl5INK4B, p21CIP1, and p53. DEC1, DCR2 (Collado M, et al (2005), Nature, Vol. 436, page 642), and others (Collado M, Serrano M. (2010), Nat Rev Cancer, Vol. 10, pages 51-57). In one embodiment, senescent cells are SA-beta-Gal (senescence-associated beta galactosidase) positive.

The term “combination therapy” or in combination with as used herein is intended to refer to all forms of administration that provide a first drug (e.g. a CDC7 inhibitor compound as taught herein) together with a further (second, e.g. a mTOR inhibitor compound as taught herein). The separate drugs may be administered simultaneously, separately or sequentially, and in any order. Drugs administered in combination have biological activity in the subject to which the drugs are delivered, and more particular the combination has biological activity in the same cancer cell. In the case where the drugs are administered or provided separately or sequentially (one after the other, in any order), it is preferable that the drugs are administered or provided within a certain time limit such that the pharmacological effect of the first drug is still noticeable in the patient, more in particular in the cancer cells in the patient. In a preferred embodiment, the treatment is simultaneously, i.e. wherein the CDC7 inhibitor and the mTOR inhibitor are provided to the patient at the same day, or within a period of no more than 48, 24, 12, 8, 6 or 4 hours. In some embodiments, the therapy may be an alternating therapy. For example, treatment is started or initiated with a CDC7 inhibitor, followed by treatment with a mTOR inhibitor. After the period of treatment with the mTOR inhibitor, treatment may be continued by, for example, treatment with only the CDC7 inhibitor (or, in some embodiments, by both mTOR and CDC7 inhibitor). The steps may be repeated as long as it is to the benefit of the patient. In such treatment schedules, a period of treatment (including the initial period) with the CDC7 inhibitor may be, for example, 1, 2, 3, 4, 5, 6, 7 8 ,19, 10 .......13, 14, 15, ......20, 21, 22, .....27, 28, 29...days, for example one week, two weeks or three weeks. Preferably a treatment with the CDC7 inhibitor is for at least 5 days, for example 5 - 22 days. In such treatment schedules, a period of treatment with the mTOR inhibitor may be, for example, 1, 2, 3, 4, 5, 6, 7 8 ,19, 10.......13, 14,

15, ......20, 21, 22, .....27, 28, 29...days, for example one week, two weeks or three weeks. Preferably a period of treatment with the mTOR inhibitor is between 2-12 days. Preferably a period of treatment with the mTOR inhibitor is shorter (in days) than a treatment period with the CDC7 inhibitor. Preferably, during the period the

CDC7 inhibitor is provided to the patient, no mTOR inhibitor is provided to the patient during that period (or there is an overlap of a short period, for example for one or two days). Preferably during the period the mTOR inhibitor is provided to the patient no CDC7 inhibitor is provided to the patient during that period (or there is an overlap of a short period, for example for one or two days).

Suitable examples of treatment regimens according of the current invention include: providing the inhibitor of CDC7 and the inhibitor of mTOR at the same day; providing the CDC7 inhibitor for a period of one week, followed by treatment with the mTOR inhibitor for a period of one week; providing the CDC7 inhibitor for a period of one week, followed by treatment with the mTOR inhibitor for a period of 3 - 5 days; providing the CDC7 inhibitor for a period of two weeks, followed by treatment with the mTOR inhibitor for a period of two weeks; providing the CDC7 inhibitor for a period of two weeks, followed by treatment with the mTOR inhibitor for a period of 510 days and so on.

The term “compositions”, “products” or “formulation” or “combinations” as used herein refer to compositions, products, formulation or combinations that are suitable for administration via various routes of administration. The compositions, formulations, products, and composition according to the disclosure invention normally comprise the drugs (alone or in combination) and one or more suitable pharmaceutically acceptable excipients or carriers.

The term combined preparation or “therapeutic combination” “therapeutic pharmaceutical combination” or “combination therapy” as used herein also relates to a kit of parts in the sense that the combination partners (a) and (b) can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners (a) and (b), i.e. simultaneously or at different time points.

The term “effective amount” as used herein refers to an amount of an agent/pharmaceutical compound required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active agent(s) used to practice the present invention for therapeutic treatment of a cancer varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an effective amount”. Thus, in connection with the administration of a drug or combination of drugs, which, in the context of the current disclosure, is effective against a disease or condition indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in at least one disease sign or symptom, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.

The term “mammal”, as used herein, refers to any member of the class Mammalia, including, without limitation, humans and non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and new-born subjects, as well as fetuses, whether male or female, are intended to be included within the scope of this term. Preferably the mammal is human.

The term pharmaceutically acceptable, as used herein, is employed herein to refer to those combinations as described herein, other drugs or therapeutics, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in human beings and animals, without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The term pharmaceutically-acceptable carrier, as used herein, means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material. Each carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.

The term “simultaneously” or “simultaneous administration”, as used herein, refers to administration of more than one drug at the same time, but not necessarily via the same route of administration or in the form of one combined formulation. For example, one drug may be provided orally whereas the other drug may be provided intravenously during a patient’s visit to a hospital.

The term “separately” or “separate administration” as used herein, refers to administration of the drugs in separate form and/or at separate moments in time, but again, not necessarily via the same route of administration.

The term “sequentially” or “sequential administration”, as used herein, indicates that the administration of a first drug if followed, immediately or in time, by the administration of the second drug. Within the context of the current invention, the simultaneous, separate or sequential administration of the combination of agents as disclosed herein (for example the combination of a CDC7 inhibitor and a mTOR inhibitor, as disclosed herein) causes the agents/compounds to be therapeutically active in the patient receiving the treatment, more in particular causes the agents/compounds to be (jointly) therapeutically active in the cancer cells of the patient suffering from the cancer. In other words, and as used herein, the term jointly therapeutically active or joint therapeutic effect means that the therapeutic agents of the combination may be given separately (in a chronologically staggered manner, especially a sequence-specific manner) in such time intervals such that in the patient to be treated, the combination still show a (preferably synergistic) interaction (joint therapeutic effect). Without being bound by theory, for the current invention it is believed that the CDC7 inhibitors, for example, by inducing senescence, makes the cancer cells very sensitive to mTOR inhibition. As will be understood by the skilled person, in principal, in such case the mTOR inhibitor can be provided to the patient as long as cancer cells are still in the state induced by the treatment with the CDC7 inhibitor. In any case, there is at least one beneficial effect, e.g., a mutual enhancing of the effect of the combination partners (a) and (b) as used herein, in particular a synergism, e.g. a more than additive effect, additional advantageous effects, less side effects, a combined therapeutic effect in a non effective dosage of one or both of the combination partners; very preferably there is a synergism of the combination partners (a) and (b).

Combination therapy and use thereof

In a first aspect, the present invention relates to a CDC7 inhibitor and a mTOR inhibitor for use in the treatment of cancer in a subject.

In an embodiment, the treatment of cancer in a subject suffering from cancer (e.g. a liver cancer subject) comprises the step of treating a patient by inhibiting CDC7 activity in the cancer of the patient by providing a CDC7 inhibitor to the patient. The CDC7 inhibitor may induced senescence in the cancer cells. Non limiting examples of such inhibitors of CDC7 include TAK931, XL413 and LY3177833 or others mentioned herein. The inhibition of CDC7 in the cancer cells is combined with the inhibition of mTOR using an mTOR inhibitor such as, but not limited to AZD8055 or AZD2014 or others as mentioned herein. The present inventors have surprisingly found that, by using a CDC7 inhibitor and a mTOR inhibitor in combination (combination therapy) for the treatment of cancer, it leads to an efficient treatment outcome (e.g. great decrease in tumor and/or greater survival rate) relative to a cancer treatment based on monotherapy with a compound capable of inducing senescence in cancer cells (e.g. CDC7 inhibitor compound such as XL413) or relative to treatment with a mTOR inhibitor alone. It was found (without being bound to any theories) that this effect was associated or due to the selective action of mTOR inhibitor compounds on cancer cells that are treated with a CDC7 inhibitor. Specifically, the present inventors discovered that mTOR inhibitors can selectively target or act (to kill or inhibit viability) on cancer cells, which were treated with a CDC7 inhibitor (and thereby were induced to undergo senescence (e.g. as indicated by the presence of the marker beta-galactosidase)) This represents a new and surprising treatment strategy not envisaged before the filing date of the present invention.

In a preferred embodiment, the cancer (or cancer cell) is a cancer (or cancer cell) having a mutated p53 gene or protein. In other words, the cancer (the cancer subject or cancer cell) has a p53 or a TP53 mutation in his genome leading a loss of wild type p53 activity (i.e. so-called “loss-of-function” mutation leading to non-functional p53 gene or protein compared to wild type p53 gene or protein) or alterations in wildtype p53 activity (e.g. leading to less functional p53 gene or p53 protein compared to wild type p53 gene or protein) (Muller and Vousden (2014) Cancer cell, Vol. 25, pages 304-317).

The p53 mutation or TP53 mutation is any mutation that leads to loss-of-function of the p53 gene or p53 protein, i.e. the gene cannot produce a p53 protein or cannot produce a functional p53 protein (has lost biological activity compared to wild type p53 protein) or the p53 protein is altered in such a way that it cannot exert its biological function compared to wild type p53 protein. The skilled person is well acquainted with the various type of p53 or TP53 mutation and can determine whether a mutation in the TP53 gene or p53 protein is a loss-of-function mutation (also known as inactivating mutation).

The mutational status of TP53 gene (or p53 protein) in a subject or a cell, e.g. detection of mutant TP53 genes or p53 protein (relative to wild-type TP53 gene or protein) in said subject or cell (e.g. human being such as a cancer patient or a cancer cell), can be detected in tumor samples or, in some types of cancer, in biological samples such as urine, stool, sputum or serum using standard molecular as well as laboratory techniques (e.g. PCR techniques, immunohistochemistry (IHC) techniques on tumor sections stained with a p53 antibody, etc.) to identify mutations and polymorphisms in a gene of interest (e.g. p53). The skilled person is wellacquainted with methods for assessing the mutational status of p53 gene or p53 protein (by reference to a wild-type p53 gene or p53 protein) in a sample.

In an embodiment, the CDC7 inhibitor compound may be provided or administered to the subject simultaneously, separately or sequentially with the mTOR inhibitor.

It is understood that the CDC7 inhibitor compound and the mTOR inhibitor compound as taught herein, can be administered to the subject simultaneously, separately or sequentially (as explained herein) using any of the various methods of delivery systems well known to those skilled in the art.. Depending on the type of compounds used, the skilled person knows how to select a suitable delivery system.

In a preferred embodiment, the treatment is initiated by the provision or administration of the CDC7 inhibitor to the subject.

Said otherwise, the treatment is started by providing a CDC7 inhibitor to the subject before a mTOR inhibitor is provided or administrated to the subject. In such embodiment, the treatment of the patient is initiated/started by providing a CDC7 inhibitor, followed by, for example within several days or weeks as described herein, administration of the mTOR inhibitor (alone or in combination with a CDC7 inhibitor).It is believed that initiating treatment with the CDC7 inhibitor, followed by treatment with the mTOR inhibitor further improves the treatment as this may lead to a situation where a maximal (as much as possible) cancer cells have become sensitive to the mTOR inhibitor (e.g. are in a state of induced senescence) It was found that treating or exposing cancer cells exposed to a CDC7 inhibitor to a mTOR inhibitor causes the mTOR inhibitor compound to selectively act or targets or inhibits viability or survival of the cancer cells, with no of few effects on healthy cells or tissues. Therefore, and next to initiating the treatment by providing a CDC7 inhibitor it is also advantageous, during the course of the treatment, to administer or provide the CDC7 inhibitor prior to providing the mTOR inhibitor to maximize the killing effect, i.e. kill the maximal amount of cancer cells (as much as possible cancer cells) per treatment event.

In an embodiment, the sequence of events is as follows: that the treatment of cancer (e.g. liver cancer) is initiated or started by first providing or administering the cancer subject (e.g. liver cancer subject) with the CDC7 inhibitor compound (e.g. XL413 or TAK931 or LY3177833). In a subsequent step, the cancer subject, which has been treated with the CDC7 inhibitor compound (e.g. XL413 or TAK931 or LY3177833) is then treated with a mTOR inhibitor compound (e.g. AZD8055 or AZD2014).

In the case where the drugs are administered or provided separately or sequentially (one after the other, in any order), it is preferable that the drugs are administered or provided within a certain time limit such that the pharmacological effect of the first drug is still noticeable in the patient, more in particular in the cancer cells in the patient. In a preferred embodiment, the treatment is simultaneously, i.e. wherein the CDC7 inhibitor and the mTOR inhibitor are provided to the patient at the same day, or within a period of no more than 48, 24, 12, 8, 6 or 4 hours. In some embodiments, the therapy may be an alternating therapy. For example, treatment is started or initiated with a CDC7 inhibitor, followed by treatment with a mTOR inhibitor. After the period of treatment with the mTOR inhibitor, treatment may be continued by, for example, only treatment with the CDC7 inhibitor (or, in some embodiments, by both mTOR and CDC7 inhibitor). The steps may be repeated as long as it is to the benefit of the patient. In such treatment schedules, a period of treatment with the CDC7 inhibitor may be, for example, 1, 2, 3, 4, 5, 6, 7 8 ,19, 10 .......13, 14, 15, ......20, 21,

22, .....27, 28, 29...days, for example one week, two weeks or three weeks.

Preferably a treatment with the CDC7 inhibitor is for at least 5 days, for example 5 22 days. In such treatment schedules, a period of treatment with the mTOR inhibitor may be, for example, 1, 2, 3, 4, 5, 6, 7 8 ,19, 10 .......13, 14, 15, ......20, 21, 22,

.....27, 28, 29... days, for example one week, two weeks or three weeks. Preferably a period of treatment with the mTOR inhibitor is between 2-12 days. Preferably a period of treatment with the mTOR inhibitor is shorter (in days) than a treatment period with the CDC7 inhibitor. Preferably, during the period the CDC7 inhibitor is provided to the patient, no mTOR inhibitor is provided to the patient during that period (or there is an overlap of a short period, for example for one or two days). Preferably during the period the mTOR inhibitor is provided to the patient no CDC7 inhibitor is provided to the patient during that period (or there is an overlap of a short period, for example for one or two days).

In some embodiments the treatment also comprises short periods (for example 1, 2, 3, 4, or 5 days) wherein the patient is not treated with a CDC7 inhibitor and not treated with a mTOR inhibitor.

In an embodiment, the cancer may be any cancer, particularly a cancer characterized by the presence of a p53 mutation as taught herein.

In an embodiment, the cancer, preferably a cancer characterized by the presence of a p53 mutation as taught herein, is selected from the group of liver cancer, lung cancer such as non-small lung cancer, colon cancer, preferably liver cancer.

In an embodiment, the subject is a human subject (a human cancer subject).

In an embodiment, any CDC7 inhibitor compound may be used. In a further embodiment, the CDC7 inhibitor may be selected from the group consisting of TAK931, XL413, LY3177833, NMS-1116354, and SRA141.

The compound TAK-931 or TAK931 (Takeda oncology; see also EP 2403857), is an orally bioavailable inhibitor of CDC7. Upon administration, TAK-931 binds to and inhibits CDC7 (Iwai et al (2016) European Journal of Cancer, Vol 69(1) page S34). TAK931 can be represented by the following chemical structure:

The compound XL413 (also known as BMS-863233, from Bristol Myers Squibb (BMS), e.g. see Koltun et al (2012), Bioorg Med Chem Lett., Vol. 22(11), pages 3727-31; Montagnoli et al (2010) American Association of Cancer Research, Vol.

16(18), pages 4503-4508)is an orally bioavailable inhibitor of CDC7. Upon administration, XL413 binds to and inhibits CDC7. XL413 can be represented by the following chemical structure (see also EP2097419):

The compound LY-3177833 is an orally bioavailable inhibitor of CDC7. Upon administration, LY3177833 binds to and inhibits CDC7 (see also EP2970221). LY3177833 can be represented by the following chemical structure:

'NH

The compound AZD8055 (e.g. see Chresta et al, (2010) Cancer Res., Vol. 70(1), pages 288-98) is an orally bioavailable inhibitor of mTOR. In vitro, AZD-8055 decreases viability of brain tumor cells; in vivo, it inhibits tumor growth. AZD-8055 had been in phase I trials by AstraZeneca for the treatment of malignant gliomas and solid tumors. However, this research has been discontinued. Upon administration, AZD8055 binds to and inhibits mTOR. AZD8055 can be represented by the following chemical structure:

The compound AZD2014 (also known as Vistusertib, from AstraZeneca ,e.g. see (2015), Guichard et al (2015) Mol Cancer Then, Vol. 14(11), pages 2508-18) is an orally bioavailable inhibitor of mTOR. Upon administration, AZD2014 binds to and inhibits mTOR. AZD2014 can be represented by the following chemical structure:

In an embodiment, any mTOR inhibitor compound may be used, for examples those described herein. Preferably the mTOR inhibitor inhibits both MTOR 1 and mTOR 2. Preferably the mTOR inhibitor inhibits mTOR2. The skilled person is well aware what, in the context of the current invention, related to the treatment of patients, is an inhibitor of mTOR (or, in case of the CDC7 inhibitor, what is an inhibitor of CDC7). In a further embodiment, the mTOR inhibitor may be selected from the group consisting of AZD8055, AZD2014. Other non-limiting examples include XL388, GDC0349, GSK105965, MLN0128, PI-103, NVP-BEZ235, WJD008, XL765, SF-1126, Torinl, PP242, PP30, Ku-0063794, WYE-354, WYE-687, WAY-600, INK128, and OSI-027.

In an embodiment, the combination of a CDC7 inhibitor and a mTOR inhibitor may be:

- the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD8055 or;

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD8055 or;

- the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD8055 or;

- the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD2014 or

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD2014 or;

- the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD2014.

It was found that these specific combinations of a CDC7 inhibitor and a mTOR inhibitor were particularly effective, i.e. effectively caused growth inhibition of cancer such as e.g. liver cancer (as shown herein, e.g. in vitro). Therefore, in certain embodiments, it may be particularly advantageous to use one of these specific combinations of a CDC7 inhibitor and a mTOR inhibitor for use in the treatment of cancer, e.g. liver cancer, in particular p53 mutated cancers

CDC7 inhibitor and use thereof

In a further aspect, the present invention relates to a CDC7 inhibitor for use in the treatment of cancer in a subject, wherein the treatment further comprises the use of a mTOR inhibitor.

In a further aspect, the present invention relates to a composition comprising CDC7 inhibitor for use in the treatment of cancer in a subject, wherein the treatment further comprises the use of a mTOR inhibitor.

The advantages and options and ways of performing the embodiments, which are described above for the combination therapy, apply herein for the embodiments relating to the CDC7 inhibitor and use thereof, and are not reiterated in details for sake of conciseness. Particularly:

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably XL413, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD8055, or

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably TAK-931, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD8055, or

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably LY3177833, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD8055, or

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably XL413, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD2014, or

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably TAK-931, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD2014, or

- The CDC7 inhibitor compound may be selected as taught herein, and is preferably LY3177833, and the mTOR inhibitor compound may be selected as taught herein, and is preferably AZD2014.

The cancer may be any cancer, preferably liver cancer, and preferably the cancer (the cancer subject or cancer cell) has a p53 or a TP53 mutation in his genome leading a loss of wild-type p53 activity or alterations in wild-type p53 activity (e.g. leading to less functional p53 gene or p53 protein compared to wild type p53 gene or protein)..

- The CDC7 inhibitor compound may be provided or administered to the subject simultaneously, separately or sequentially with the mTOR inhibitor as taught herein (by any suitable route of administration as described above), preferably the CDC7 inhibitor compound is provided at initiation of the treatment or administered before the mTOR inhibitor compound as taught herein.

mTOR inhibitor and use thereof

In a further aspect, the present invention relates to a mTOR inhibitor for use in the treatment of cancer in a subject, wherein the treatment further comprises the use of a CDC7 inhibitor.

In a further aspect, the present invention relates to a composition comprising a mTOR inhibitor for use in the treatment of cancer in a subject, wherein the treatment further comprises the use of a CDC7 inhibitor.

The advantages and options and ways of performing the embodiments, which are described above for the combination therapy, apply herein for the embodiments relating to the mTOR inhibitor and use thereof, and are not reiterated in details for sake of conciseness. Particularly:

The cancer may be any cancer, preferably liver cancer, and preferably the cancer (the cancer subject or cancer cell) has a p53 or a TP53 mutation in his genome leading a loss of wild-type p53 activity or alterations in wild-type p53 activity (e.g. leading to less functional p53 gene or p53 protein compared to wild type p53 gene or protein).

The mTOR inhibitor compound may be provided or administered to the subject simultaneously, separately or sequentially with the CDC7 inhibitor as taught herein (by any suitable route of administration as described above), preferably the CDC7 inhibitor compound is provided or administered at initiation of the treatment or before the mTOR inhibitor compound as taught herein.

Combination composition

In a further aspect, the present invention relates to a combination comprising a CDC7 inhibitor, such as XL413, TAK-931, or LY3177833, and others and a mTOR inhibitor, such as AZD8055, AZD2014, and others. For instance, the combination comprising a CDC7 inhibitor and a mTOR inhibitor may be a composition, e.g. a pharmaceutical composition comprising both compounds (compounds are mixed together) or the combination comprising a CDC7 inhibitor and a mTOR inhibitor may be a composition wherein the CDC7 inhibitor and a mTOR inhibitor are provided separately (in different tube or bottle or container) but are mixed before administration to a subject or a provided separately, e.g. one after the other, or sequentially to a subject in a manner that allows both compounds to exert their biological activity or in such a way that both compounds are therapeutically active together (e.g. at some point in time, they overlap in action), in the same cells (e.g. cancer cells).

In an embodiment, the combination as taught herein may be used as a medicament in the treatment of cancer in a subject, more preferably for use in the treatment of cancer in a subject, wherein the cancer (cancer subject or cancer cell) has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein, as taught herein.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to the combination composition, and are not reiterated in details for sake of conciseness.

Kits

In a further aspect, the present invention relates to a kit comprising

a) a CDC7 inhibitor in a first unit dosage form;

b) a mTOR inhibitor in a second unit dosage form;

c) container means for containing said first unit dosage form and second unit dosage forms, and optionally, instructions for use.

In an embodiment, the kit as taught herein, the kit may be for use as a medicament, preferably for use as a medicament in the treatment of cancer in a subject, more preferably for use in the treatment of cancer in a subject, wherein the cancer or cancer cell has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein, as taught herein.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to the kit, and are not reiterated in details for sake of conciseness.

Combination treatment and compositions.

In a further aspect, the present invention relates to a combination treatment comprising the simultaneous, separate or sequential administration of an effective amount of a CDC7 inhibitor such as XL413, TAK-931, LY3177833, and others and a mTOR inhibitor such as AZD8055, AZD2014, and others to a subject for use in the treatment of cancer.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to combination treatment, and are not reiterated in details for sake of conciseness.

Methods of treatment

In a further aspect, the present invention relates to a method of the treatment of cancer in a subject, wherein the method comprises the simultaneous, separate or sequential administration of an effective amount of a CDC7 inhibitor and an effective amount of a mTOR inhibitor to the subject.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to the method of treatment, and are not reiterated in details for sake of conciseness

Method for selecting a cancer subject suitable for treatment

In a further aspect, the present invention relates to a method for selecting a subject having cancer suitable for simultaneous, separate, or sequential treatment with a CDC7 inhibitor and a mTOR inhibitor, wherein the method comprises the steps of:

a) Providing a sample comprising cancer cell material from said subject; and

b) Detecting in the sample of step a) whether the cancer has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

The cancer cell material may be obtained, for example, from a cancer cell biopsy of from a liquid biopsy from blood or other fluid of a cancer patient. If the sample of step a) has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein, it indicates that the cancer subject is suitable for simultaneous, separate, or sequential treatment with a CDC7 inhibitor and a mTOR inhibitor. If the sample of step a) does not have a mutated p53 gene or does not express a mutant p53 protein or an mRNA encoding a mutant p53 protein, it indicates that the cancer subject is less or not suitable for simultaneous, separate, or sequential treatment with a CDC7 inhibitor and a mTOR inhibitor.

In step a), the sample comprising cancer cells may be any type samples, such as a tumor tissue sample or tumor biopsy sample, i.e. piece(s) or slice(s) of tissue that has/have been removed from a tumor, including following a surgical tumor resection. Alternatively, the sample may be a blood sample comprising cancer cells or urine sample comprising cancer cells. The tumor tissue sample or blood or urine sample can be subjected to a variety of well-known post-collection preparative and storage techniques (e.g., fixation, storage of fixed tissue, freezing, homogenization, etc.) prior performing detection of p53 mutation using standard techniques such as immunostaining or prior performing PCR techniques, or in situ hybridization or other laboratory techniques allowing detection of a p53 mutation in said sample.

In step b), it is understood that detecting a p53 mutation performed relative to the p53 wildtype gene or protein. The skilled person is well-acquainted with methods for detecting a p53 mutation in a cancer (cancer subject or cancer cell), as taught herein above, and can establish or determine whether a cancer subject is suitable for the combination therapy as taught herein, according to step b) above.

When performing step b), if the sample of step a) has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein, it indicates that the cancer subject is suitable for simultaneous, separate, or sequential treatment with a CDC7 inhibitor such as XL413, TAK-931, LY3177833, and others and a mTOR inhibitor such as AZD8055, AZD2014, and others. In that case, said subject may be treated according to the methods as taught herein, e.g. may be administered with the combination as taught herein.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to the method for selecting a cancer subject suitable for the combination therapy as taught herein, and are not reiterated in details for sake of conciseness.

In vitro or in vivo method for treating cancer cells

In a further aspect, the present invention relates to an in vitro or in vivo method for treating cancer cells, the method comprising treating the cancer cells with a CDC7 inhibitor such as XL413, TAK-931, LY3177833, and others and a mTOR inhibitor such as AZD8055, AZD2014, and others.

The advantages and options and ways of performing the embodiments, which are described above, apply herein for the embodiments relating to the in vitro or in vivo method for treating cancer cells, and are not reiterated in details for sake of conciseness. In addition, with the provided in vitro and in vivo methods the skilled person can study specific combinations of CDC7 inhibitors and mTOR inhibitors, for example, in specific cancers in order to establish efficacy of such combination.

Preferably the in vivo method is not performed in a human subject. The in vivo method may be performed in any other animal, for example, mammals and rodents including rats and mice. In certain embodiments of the in vivo method human cells, e.g. human cancer cells may be used and that have been introduced in a non-human animal (e.g. Patient derived xenografts (model of cancer where the tissue or cells from a patient's tumor are implanted into an (immune-deficient or humanized) mouse.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Inhibition of CDC7 as a potential senescence-induction strategy in liver cancer: (A) Schematic outline of the stress lethality screen. Hep3B and Huh7 cells were infected with a lentiviral kinome gRNA library and cultured for 14 days (T14) in replicates. gRNA barcodes in TO and T14 samples were subsequently recovered by PCR and analyzed by next generation sequencing. (B) Pooled gRNA screen identified stress lethal hits in Hep3B and Huh7 cells. Each dot in the plot represents a gRNA from the screen experiment. The y axis shows the fold change in abundance (ratio of gRNA frequency in T14 sample to that in TO sample). The x axis represents the frequency (the average counts of sequencing reads in TO sample). (C) Venn diagram of dropout genes (top 50 most strongly deleted genes in each cell line) identified by CRISPR screen in Hep3B and Huh7 cells. Hits with red font are targetable with commercial compounds. Blue font represents that the hits are not targetable with commercial compounds now. (D) Schematic outline of the secondary compound screen.in liver cancer cells (Hep3B and Huh7) and normal cells (BJ and RPE-1) were plated in 96-well plates. For the screen, all compounds were tested at 5 different concentrations for 4 days, and senescence was detected by staining of βgalactosidase activity. (E) Heatmap showing effects of compounds (5 μΜ) on cell senescence in different cell lines in the secondary screen.

Figure 2. Upregulation of CDC7 correlates with poor prognosis of liver cancer patients: (A) Western blot analysis of CDC7, p-MCM2, and MCM2 levels in a panel of normal cell lines and liver cancer cell lines. HSP90 served as a control. (B) Upregulation of CDC7 was found in the cohort of GSE14520 (n=213) and TCGA database (n=50). (C) Representative images of immunohistochemical staining of CDC7 in liver cancer tissues and the paired noncancerous tissues. (D) Kaplan-Meier curves depicting overall survival outcomes of liver cancer patients from the TCGA cohort (n=361). The 33.3% of patients with the highest tumor levels of CDC7 exhibited the worst survival outcomes. (E) Patients with high CDC7 expression have poorer overall survival compared with patients with low CDC7 expression (n=80).

Figure 3. CDC7 inhibition in p53 mutant liver cancer cells (A) The level of CDC7 knockdown in liver cancer cell lines was measured by western blot. (B) Liver cancer cells (Hep3B, Huh7, SK-Hep1, and Huh6) were stably infected with pLKO empty vector or with two independent shRNAs targeting CDC7 (shCDC7 #1, shCDC7 #2). Viability was assessed by colony formation assay. Cells were fixed, stained, and photographed after 10 days of culture. (C) CDC7 knockdown induces senescence in Hep3B and Huh7 cells. Senescence was detected by staining of βgalactosidase activity according to the user manual. (D) p53 mutant or null liver cancer cells (Hep3B, Huh7, SNU182, SNU398, SNU449, PLC/PRF/5, MHCC97H, and HCCLM3), p53 wild-type liver cancer cell lines (SK-Hep1 and Huh6), and normal cell lines (BJ, TIG-3, RPE-1, and MCF-10A) were seeded at low confluence and treated with increasing concentrations of XL413 twice per week. Viability was assessed by a colony formation assay. Cells were fixed, stained, and photographed after 14 days of culture. (E) XL413 treatment induces senescence in p53 mutant or null liver cancer cells. Liver cancer cells and normal cell lines were cultured in the presence of 10 μΜ XL413 for 4 days. Senescence was detected by staining of β galactosidase activity. (F) Gene set enrichment analysis (GSEA) indicated that the gene set related to senescence-associated genes was enriched in XL413-treated liver cancer cells (Hep3B and Huh7), but not in normal cell lines (BJ and TIG-3).

Figure 4. LY3177833 and TAK931 in p53 mutant liver cancer cells: (A-B) p53 mutant or null liver cancer cells (Hep3B, Huh7, SNU398, MHCC97H, and HCCLM3) and p53 wild-type liver cancer cell lines (SK-Hep1 and Huh6) were seeded at low confluence and treated with indicated concentrations of LY3177833 or TAK931 twice per week. Viability was assessed by a colony formation assay. Cells were fixed, stained, and photographed after 14 days of culture. (C-D) Liver cancer cells were seeded and culture in presence of indicated concentrations of LY3177833 or TAK931, the growth curves were measured by IncuCyte® cell proliferation assay. (EF) Liver cancer cells were cultured in presence of indicated concentrations of LY3177833 or TAK931 for 4 days. Senescence was detected by staining of βgalactosidase activity.

Figure 5: mTOR inhibition: (A) the untreated cells were seeded at low confluence, while XL413-treated cells were seeded at high confluence. Then the cells were cultured with different concentration of AZD8055. Cells were fixed, stained, and photographed after 5 days. (B) Control cells and XL413-treated cells were cultured with increasing concentrations of AZD8055 for 96 hr. Apoptotic cells were determined by IncuCyte® caspase-3/7 apoptosis assay according to the user manual. (C) Biochemical responses of Huh7 and Hep3B cells treated with XL413, AZD8055 or their sequential treatment were documented by western blot analysis. Cells were harvested at 48 hr after AZD8055 treatment. (D) The untreated cells were seeded at low confluence, while XL413-treated cells were seeded at high confluence. Then the cells were cultured with different concentration of AZD2014. Cells were fixed, stained, and photographed after 5 days. (E) Control cells and XL413-treated cells were cultured with increasing concentrations of AZD2014 for 96 hr. Apoptotic cells were determined by IncuCyte® caspase-3/7 apoptosis assay. (F) Combination of XL413 and AZD8055 can synergize to suppress tumor growth in Huh7 xenograft models. (G) Combination of XL413 and AZD8055 can synergize to suppress tumor growth in MHCC97H (Hepatocellular carcinoma) xenograft models.

Figure 6: Sequential treatment on liver cancer cells using different combination of two CDC7 inhibitor (LY3177833 or TAK931) and two mTOR inhibitor (AZD8055 or AZD2014): (A-B) Control cells and LY3177833-treated or TAK931treated cells were cultured with increasing concentrations of AZD8055 for 96 hr. Apoptotic cells were determined by IncuCyte® caspase-3/7 apoptosis assay according to the user manual. (C-D) Control cells and LY3177833-treated or TAK931-treated cells were cultured with increasing concentrations of AZD2014 for 96 hr. Apoptotic cells were determined by IncuCyte® caspase-3/7 apoptosis assay according to the user manual.

EXAMPLES

Example 1: Materials

Cell lines

The human liver cancer cell lines (Hep3B, HepG2, PLC/PRF/5, SNU182, SNU398, SNU449, SK-Hep1, and Huh6) were purchased from the American Type Culture Collection (ATCC, VA, USA). The human liver cell line Huh7 cells was purchased from Riken Cell Bank (Tsukuba, Japan). The human hepatocellular carcinoma cell lines MHCC97H and HCCLM3 were provided by the Liver Cancer Institute of Zhongshan Hospital (Shanghai, China). hTERT immortalized BJ (fibroblasts) and RPE-1 (retinal pigment epithelial cells) cell lines were provided by Xiaohang Qiao (Amsterdam, The Netherlands). MCF-10A (non-tumorigenic epithelial cell line) and TIG-3 (human lung fibroblast cell line) were gifts from Reuven Agami (Amsterdam, The Netherlands). Live cancer cells, BJ, and TIG-3 were cultured in DMEM with 10% FBS, glutamine and penicillin/streptomycin (Gibco®) at 37 °C / 5% CO2. RPE-1 cells were cultured in DMEM: F12 medium with 10% FBS, glutamine and penicillin/streptomycin (Gibco®) at 37 °C I 5% CO2.

Compound and antibodies

AZD8055 (S1555), AZD2014 (S2783), XL413 (S7547), BMS265246 (S2014), ON01910 (S1362), BLU9931 (S7819), PD0166285 (S8148), LDC000067 (S7461), PF03814735 (S2725), D 4476 (S7642), and VE-821 (S8007) were purchased from Selleck Chemicals. THZ531 (A8736) was purchased from ApexBio. TAK-931 (CT

TAK931) was purchased from CHEMIETEK. LY3177833 (206762) was purchased from MedKoo.

Antibody against HSP90 (H-114) was purchased from Santa Cruz Biotechnology. Antibodies against CDC7 (ab10535) , p-MCM2 (S53), (ab109133), and MCM2 (ab4461) were from Abeam.

Example 2: Pooled ‘stress lethal’ CRISPR screen

The kinome gRNA library was introduced into Hep3B and Huh7 cells by lentiviral transduction. Cells stably expressing gRNA were cultured for 14 days. The abundance of each gRNA in the pooled samples was determined by Illumina deep sequencing. gRNAs prioritized for further analysis were selected by the fold depletion of abundance in T14 sample compared with that in TO sample, using methods as described previously (Evers et al (2016), Nat. Biotechnol, Vol. 34(6): 631-633).

Example 3: Compound screen

A. Induction of senescence screens.

A compound screen including 10 chemical probes that targeting the 14 genes identified by the CRISPR screen was performed. Compounds used for the screen are described in Figure 1E. Each compound was evaluated in two liver cancer cell lines (Hep3B and Huh7) and two normal cell lines (BJ and RPE-1) using 5 concentrations. The screens were performed in three biological replicates of each line. Senescence associated-p-galactosidase staining was assessed over 4 days after treatment.

B. Killing senescent cells screen.

For the GPCR compound library screen, cells were screened for sensitivity against a panel of 260 small-molecule inhibitors from a GPCR compound library (L2200, Selleck Chemicals). Briefly, Huh7 cells were treated with 10 μΜ XL413 for 5 days to induce senescence and then control cells and XL413-treated cells were plated in 96well plates. All compounds from GPCR library were tested at 4 different concentrations. Each plate included 8 wells of DMSO (negative control) and 8 wells of 10 μΜ PAO (positive control). Viable cell number in each well was determined using the CellTiter-Blue reagent (Promega). The relative survival of different cell lines in the presence of drug was normalized against control conditions (untreated cells) after subtraction of background signal.

Staining of β-qalactosidase activity

Senescent cells Histochemical Staining Kit (CS0030-1KT) from Sigma was applied according to the manufacturer’s instructions.

Protein lysate preparation and immunoblots

Cells were washed with PBS and lysed with RIPA buffer supplemented with protease inhibitor (Roche) and Phosphatase Inhibitor Cocktails II and III (Sigma). All lysates were freshly prepared and processed with Novex NuPAGE Gel Electrophoresis Systems (Invitrogen).

Immunohistochemical staining

HCC specimens were obtained from 80 patients who underwent curative surgery in Eastern Hepatobiliary Hospital of the Second Military Medical University in Shanghai, China. Patients were not subjected to any preoperative anti-cancer treatment. Ethical approval was obtained from the Eastern Hepatobiliary Hospital Research Ethics Committee, and written informed consent was obtained from each patient. Overall survival was defined as the length of time between the surgery and death. Patients were censored on the date of the last follow-up or death. Immunohistochemical score was independently assessed by 2 pathologists without knowledge of patient characteristics. The immunostaining score was evaluated on the basis of percentage score x intensity score.

Plasmids

All lentiviral shRNA vectors were retrieved from the arrayed TRC human genomewide shRNA collection.

shCDC7#1: TRCN0000003168_

CCGGGCCACAGCACAGTTACAAGTACTCGAGTACTTGTAACTGTGCTGTGGCTTT TT (SEQ ID NO:1);

shCDC7#2: TRCN0000196542_

CCGGGAAGCTTTGTTGCATCCATTTCTCGAGAAATGGATGCAACAAAGCTTCTTTT TTG (SEQ ID NO:2).

Long-term cell proliferation assays

Cells were seeded into 6-well plates (1.5-3 χ 10⁴ cells per well) and cultured both in the absence and presence of drugs as indicated. Within each cell line, cells cultured at different conditions were fixed with 4% paraformaldehyde (in PBS) at the same time. Afterwards, cells were stained with 0.1% crystal violet (in water).

Incucyte® cell proliferation assay

Indicated cells were cultured and seeded into 96-well plates at a density of 10001500 cells per well. 24 hours later, drugs were added at indicated concentrations. Cells were imaged every 4 hours in IncuCyte ZOOM (Essen Bioscience). Phasecontrast images were collected and analyzed to detect cell proliferation based on cell confluence.

Results

A stress lethal CRISPR screen combined with a secondary compound screen confirms inhibition of CDC7 as a potential senescence-induction strategy in liver cancer. It has been demonstrated that the CRISPR-Cas9 system can be used in functional genetic screens in the form of pooled guide RNA (gRNA) libraries (Evers et al (2016), Nat Biotechnol, Vol.34(6), pages 631-633).

To probe kinome pathways required for liver cancer cells viability systematically, we set out to screen a gRNA library representing the full complement of human kinases. Hep3B and Huh7 cells were infected with the lentiviral kinome gRNA collection and cultured for 14 days. After this, changes in library representation after 14 days of culture were determined by next generation sequencing of the barcode identifiers present in each gRNA vector (Figure 1A-B). For hits selection, we focused on the top 50 most strongly depleted gRNAs in each cell line for follow-up experiments. We identified 38 commonly deleted gRNAs in Hep3B and Huh7 cells. Among these 38 hits, 10 of them are known essential genes (PSMD6, PSMD6, PSMB2, KPNB1, RPL11, RPS13, PSMD11, NUP98, PSMC4, RPL3, and COPB1). Among the 28 remaining potential targets, a total of 14 genes (CDC7, CDK1, PLK1, FGFR4, CDK2, WEE1, CHEK1, CDK9, CDK12, AURKA, CSNK1A1, AURKB, ATR, and CDK13) are targetable with commercial small molecule compounds (Figure 1C).

In order to further find a potential senescence-induction strategy in liver cancer, we performed a compound screen including 10 chemical probes that targeting the 14 drugable genes identified by the CRISPR screen. Each compound was evaluated in two liver cancer cell lines (Hep3B and Huh7) and two normal cell lines (BJ and RPE-

1) using 5 drug concentrations (Figure 1D).

Senescence associated beta (□□-galactosidase (ΒΑ-β-gal) staining was assessed 4 days after treatment. XL413, a potent ATP-competitive inhibitor of CDC7 kinase, was one of the most potent compound in induction of the senescence marker only in liver cancer cells (Figure 1E). Taken together, our screening results prompted us to investigate the suitability of CDC7 inhibition as a potential senescence-induction strategy in cancer, for example liver cancer.

Clinical significance of CDC7 expression in Hepatocellular carcinoma (HCC) patients

We compared CDC7 expression in a panel of normal cell lines and liver cancer cell lines. Liver cancer cell lines indeed express higher levels of CDC7 compared to the non-cancer cell lines (Figure 2A). We evaluated the expression levels of CDC7 in the GSE14520 cohort and the TCGA database, which provide data on gene expression for both non-tumor and HCC tissues. CDC7 expression was selectively upregulated in tumor tissue in both cohorts (Figure 2B). We also analyzed CDC7 expression in HCC samples using immunohistochemistry. We found that the protein levels of

CDC7 are increased in HCC tissues compared with the paired non-cancerous tissues (Figure 2C). Importantly, nuclear accumulation of CDC7 was observed in some of HCC tissues (Figure 2C). When DNA replication is initiated, the MCM complex is loaded at origins in an inactive form and is then activated during S phase, in a manner that requires both CDC7 and CDK activities. The nuclear accumulation of CDC7 in HCC cells is highly suggestive of the dependence of HCC cells on CDC7.

To investigate the prognostic value of CDC7 in HCC patients, we analyzed the clinical relevance of CDC7 expression in the TCGA database (n=361) and 80 HCC tissues with complete follow-up data using immunohistochemistry. For TCGA database, the patients were divided into high, median, or low CDC7 expression groups according to the mRNA level. Remarkably, we observed that patients with the highest tumor levels of CDC7 exhibited the worst survival outcomes (Figure 2D). In our cohort, patients (n=80) were divided into high (score 2-3) or low (score 0-1) CDC7 expression groups according to the immunostaining scores. High expression of CDC7 was also found to be significantly associated with reduced overall survival (Figure 2E). These results indicate that higher CDC7 expression is significantly associated with poor prognosis of HCC patients. The strong correlation between the expression levels of CDC7 and the prognosis of HCC patients suggest that CDC7 may be a potential target for HCC patients.

CDC7 inhibition in p53 mutant liver cancer cells

We tested all CDC7 shRNAs present in the TRC human shRNA library. shRNAs #1 and #2 were selected for further studies based on their knockdown efficiency (Figure 3A). Colony formation assays confirmed that silencing of CDC7 with shRNA#1 and #2 obviously impaired the proliferation of Hep3B and Huh7 cells (Figure 2B). This impairment correlated with cell senescence as shown by increased ΒΑ-β-gal positive cells (Figure 3C). However, SK-Hep1 and Huh6 cells, who carry a wildtype p53 gene, are resistant to CDC7 knockdown (Figure 3B-C).

Next, we examined the sensitivity of liver cancer cells and normal cells to XL413, a potent ATP-competitive inhibitor of CDC7 kinase (Koltun et al (2012), Bioorg Med Chem Lett, Vol.22 (11), pages 3727-3731). We treated the panel of eleven liver cancer cell lines and four normal cell lines with increasing concentration of XL413 for about 2 weeks in colony formation assays. The panel of liver cancer cell lines and normal cell lines exhibited differential responses to CDC7 inhibition. Figure 3D shows that the effective concentration of XL413 for p53 mutant or null liver cancer cells ranged from < 2.5 μΜ, while p53 wild-type liver cancer cell lines and normal cells did not show a lethal dose at 10 μΜ.

To further characterize the effects of XL413 on senescence induction, p53 mutant or null liver cancer cells (Hep3B, Huh7, MHCC97H and PLC/PRF/5), p53 wild-type liver cancer cell lines (SK-Hep1 and Huh6), and normal cell lines (BJ, TIG-3, RPE-1, and MCF-10A) were analyzed by SA-p-gal staining upon XL413 treatment (10 μΜ) over 96 hr. As reported in Figure 3E, while most of the p53 mutant liver cancer cells were SA-p-gal positive upon XL413 treatment, p53 wild-type liver cancer cells and normal cells were mainly SA-p-gal negative after XL413 treatment.

To investigate the signaling pathway involved in the effects of XL413 on liver cancer cells, we performed RNAseq analysis in which two different liver cancer cell lines (Hep3B and Huh7) and two normal cell lines (BJ and TIG-3), were treated for 96 hr with 10 μΜ XL413. Gene set enrichment analysis indicated that the genes regulated by XL413 in liver cancer cell lines were enriched for the senescence-associated upregulated genes (a 77 gene signature in senescent cells, including CDKN1A, CDKN2B, CDKN2D, etc.). Remarkably, we did not observe this enrichment in the normal cell lines (Figure 3F).

Furthermore, we examined the sensitivity of liver cancer cells (both p53 mutant and wild-type cell lines) to two new-generation CDC7 inhibitor. We found that both LY3177833 and TAK931 showed more potent effect in p53 mutant liver cancer cells compared with p53 wild-type liver cancer cell lines (Figure 4A-D). For SA-p-gal staining, most of the p53 mutant liver cancer cells were ΒΑ-β-gal positive upon LY3177833 or TAK931 treatment. However, p53 wild-type liver cancer cells were mainly SA-p-gal negative after the treatment (Figure 4E-F).

Given that pharmacological inactivation of CDC7 induces senescence in p53 mutant liver cancer cells but not in p53-wild type cells, our data indicate that CDC7 inhibition may provide a therapeutic option for senescence-induction in cancer patients, including liver cancer patients with p53 mutation.

AZD8055 and AZD2014 selectively kills XL413-treated cells, TAK-931-treated cells and LY3177833-treated cells.

Although therapy-induced senescence could improve long-term outcomes of patients with liver cancer, the viable senescent cells have potential detrimental effects.

To screen for compounds that selectively inhibit or prevent the survival of senescent cells, Huh7 cells were treated with 10 μΜ XL413 for 5 days and then control cells and XL413-treated cells were plated in 96-well plates. For the screen, we tested compounds from GPCR library. All compounds were tested at 4 different concentrations. Of the 260 compounds tested, we found a total of 10 compounds could kill the XL413-treated cells at 5 μΜ. Among these 10 compounds active against XL413-treated cells, 9 compounds also significantly inhibited or prevented survival of untreated Huh7 cells. For instance, treatment with AZD8055 efficiently killed XL413-treated cells, as shown in long-term proliferation assays and IncuCyte® caspase-3/7 apoptosis assay (Figure 5A-B). Biochemical analysis indicated that the selective effect of AZD8055 is derived from the stronger suppressive activity on mTOR signaling for XL413-treated cells (Fig. 5C). Another mTOR inhibitor AZD2014 also exhibit similar selective killing effects on senescent cells (Figure 5D-E).

To assess whether the in vitro findings can be recapitulated in vivo, Huh7 cells were injected in nude mice. Upon tumor establishment, xenografts were treated with vehicle, XL413, AZD8055, or combination for about 20 days. As shown in Figure 5F, the combination of XL413 and AZD8055 elicited a potent growth inhibition of Huh7 cells.

The experiment using Huh7 cells was repeated using MHCC97H, a human HOC cell line with high metastatic potential that was established by the Liver Cancer Institute of Fudan University (Shanghai, China) (Li et al, (2001) World J Gastroenterol, Vol 7, pages 630-636. In order to validate the in vitro findings, we used immunodeficient mice xenografted with human MHCC97H cells. About 1 week after injection of tumor cells, palpable tumors were present in all animals, and cohorts of mice were treated with vehicle, the CDC7-targeted drugs XL413 (100mgkg-1), the mTOR inhibitor AZD8055 (20mgkg-1), or the combination of CDC7 inhibitor plus AZD8055 for 21 days. Our results show that the combination of XL413 and AZD8055 elicited a potent growth inhibition of MHCC97H HCC tumors compared with XL413 or AZD8055 alone (Figure 5G). At last, we sequential treated liver cancer cells (Huh7 and Hep3B cell lines) using different combination using two CDC7 inhibitor (LY3177833 at 5μΜ or TAK931 at 0.313μΜ) and two mTOR inhibitors (AZD8055 or AZD2014, tested in 4 concentrations including 0 nM, 100 nM, 200 nM, and 400 nM), we found that the senescence induced by both CDC7 inhibitors (LY3177833 and TAK-931) provides acquired vulnerability of liver cancer cells (Huh7 and Hep3B cell lines),which sensitized said cells to mTOR inhibition with AZD2014 and/or AZD8055 (see Fig. 6, A-D).

Claims

CONCLUSIONS

A CDC7 inhibitor and an mTOR inhibitor for use in the treatment of cancer in a patient.

A CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to claim 1, wherein the cancer has a mutated p53 gene or a mutant p53 protein or an mRNA expressing a mutant p53 protein expressed brings.

A CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any of the preceding claims, wherein the CDC7 is provided to the patient simultaneously, separately or sequentially with the mTOR inhibitor.

A CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any one of the preceding claims, wherein the treatment is initiated by the administration of the CDC7 inhibitor to the individual.

A CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any of the preceding claims, wherein the CDC7 inhibitor is administered to the patient before the mTOR inhibitor is administered to the patient.

CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any of the preceding claims, wherein the cancer is selected from the group consisting of liver cancer, lung cancer, non-small lung cancer and colon cancer, preferably liver cancer.

A CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any of the preceding claims, wherein the patient is a human patient.

The CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to any of the preceding claims, wherein the CDC7 inhibitor is selected from the group consisting of TAK-931, XL413 and LY3177833 and the mTOR inhibitor is selected from the group consisting of AZD8055, AZD2014.

The CDC7 inhibitor and mTOR inhibitor for use in the treatment of cancer in a patient according to claim 8, wherein:

the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD8055 or;

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD8055 or;

the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD8055 or;

the CDC7 inhibitor is LY3177833 and the mTOR inhibitor is AZD2014 or

- the CDC7 inhibitor is TAK-931 and the mTOR inhibitor is AZD2014 or;

the CDC7 inhibitor is XL413 and the mTOR inhibitor is AZD2014.

A CDC7 inhibitor for use in the treatment of cancer in a patient, the treatment further comprising the use of an mTOR inhibitor.

A CDC7 inhibitor for use in the treatment of cancer in a patient according to claim 10, wherein the cancer has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

A MTOR inhibitor for use in the treatment of cancer in a patient, the treatment further comprising the use of a CDC7 inhibitor

The mTOR inhibitor for use in the treatment of cancer in a patient according to claim 12, wherein the cancer has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

A combination comprising a CDC7 inhibitor and an mTOR inhibitor.

The combination of claim 14 for use as a medicine, preferably for use as a medicine in the treatment of cancer in a patient, more preferably for use in the treatment of cancer in a patient, wherein the cancer is a mutated p53- gene or express a mutant p53 protein or an mRNA encoding a mutant p53 protein.

16. A kit consisting of

a) a CDC7 inhibitor in a first unit dosage form;

b) an mTOR inhibitor in a second unit dosage form;

c) container means for containing the first unit dosage form and second unit dosage forms, and optionally, instructions for use.

The kit of claim 16 for use as a medicine, preferably for use as a medicine in the treatment of cancer in a patient, more preferably for use in the treatment of cancer in a patient, wherein the cancer is a mutated p53- gene, or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

A combination treatment comprising the simultaneous, separate or sequential administration of an effective amount of a CDC7 inhibitor and an mTOR inhibitor to a patient for use in cancer treatment.

The combination treatment according to claim 18, wherein the cancer has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

A method for treating cancer in a patient, the method comprising the simultaneous, separate or sequential administration of an effective amount of a CDC7 inhibitor and an mTOR inhibitor administration to the patient.

The method of claim 20, wherein the cancer has a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein.

A method for selecting a cancer patient suitable for simultaneous, separate, or sequential treatment with a CDC7 inhibitor and an mTOR inhibitor, the method comprising the steps of:

a) Providing a sample comprising cancer cell material from the patient; and

b) Detect in the sample from step a) whether the cancer has a mutated p53 gene or express a mutant p53 protein or an mRNA encoding a mutant p53 protein, wherein as the sample from step a) a mutated p53 gene or expresses a mutant p53 protein or an mRNA encoding a mutant p53 protein, indicating that the cancer patient is suitable for simultaneous, separate or sequential treatment with a CDC7 inhibitor and an mTOR inhibitor.

An in vitro or in vivo method for treating cancer cells, the method comprising treating the cancer cells with a CDC7 inhibitor and an mTOR inhibitor, preferably wherein the in vivo method does not include a human subject.

1/24