NL1022371C2 - Novel metalloprotease containing a thrombospondin domain (MPTS protein) is useful to treat aggrecan associated disease including rheumatoid arthritis and osteoarthritis - Google Patents

Abstract

A new metalloprotease containing a thrombospondin domain (MPTS protein) is useful to treat aggrecan associated disease including rheumatoid arthritis and osteoarthritis : Independent claims are also included for the following: (1) a nucleic acid molecule (N1) encoding a metalloprotease containing a thrombospondin domain (MPTS protein) which encodes: (a) a polypeptide comprising the 959, 947, 1690 or 947 amino acid sequences fully defined in the specification, or a polypeptide having at least 35% to one of those sequences; (b) comprises the 2879, 3263, 5338 or 4086 nt sequence fully defined in the specification, or a sequence having at least 75% to one of those sequences; (c) comprises a sequence whose complement hybridizes to (a) or (b) under stringent conditions; and (d) is a fragment comprising the functional domain of (a), (b) or (c); (2) a nucleic acid complementary to N1, preferably an antisense nucleic acid molecule; (3) an expression cassette comprising the one of the above nucleic acids under control of a transcription initiation region and a transcription termination region; (4) a vector comprising the above nucleic acid and/or expression cassette; (5) a host cell transformed with the above nucleic acid, expression cassette or vector or a cell arising from that cell; (6) producing an MPTS protein; (7) a polypeptide (P1) encoded by the above nucleic acid or produced by the above method; (8) an antibody or its fragment or derivative specific for P1; (9) a hybridoma producing the above antibody; (10) identifying a modulator of MPTS, comprising contacting P1 with a substrate in the presence of a candidate and determining P1 activity; (11) identifying an agonist or antagonist of P1, comprising producing P1 from cells expressing P1, contacting P1 with a sample containing a candidate agonist/antagonist and determining inhibition or activation of binding P1 binding activity; and (12) identifying a P1 binding partner, comprising contacting P1 with a binding partner and determining P1 activity. ACTIVITY : Osteopathic; antiarthritic; antipsoriatic; antirheumatic. No supporting data given. MECHANISM OF ACTION : Metalloprotease agonist/antagonist; metalloprotease. No supporting data given.

Description

New metallo-proteases with thrombospondin domains and therefore coding nucleic acid compositions 5 This is a cleavage of NL · 1022252.

The field of the invention relates to proteaseo, in particular metallo-proteases with thrombospondin domains.

The cartilage matrix consists of 70% collagen and 20-30% proteoglycans by dry weight of the tissue. The proteoglycan components provide mechanical flexibility to stressed tissues and give the cartilage its viscoelastic properties. Loss of it quickly leads to structural damage, as is particularly often observed in arthritic disorders of the joint and joint damage.

Aggrecane is an important proteoglycan of cartilage. Aggrecan is a large 210 kDa protein with three globular domains, G1, G2 and G3. The G1 and G2 domain of the protein are close to the amino-terminus of the protein and the intervening inter-global domain has sites that are sensitive to proteolysis. The area between G2 and G3 is heavily glycosylated and linked to oligosaccharides and glycosaminoglycans (GAGs), thereby forming the mature proteoglycan. In arthritic cartilage, core protein fragments of 55 kDa were observed and are believed to be the result of cleavage of the core protein in the G1 and G2 inter-global domain, between asparagine 341 and phenylalanine 342. This cleavage can be performed by many matrix metallo-proteinases such as MMP-1, -2, -3, -7, -8, -9 and -13 are caused. Moreover, 60 kDa aggrecan fragments with a -COOH terminus of glutamic acid were identified, indicative of a cleavage site between glutamic acid 373 and alanine 374. Matrix metallo proteases are unable to cleave at this site. The unique endopeptidase activity responsible for this cleavage was called "aggrecanase".

The G1 domain of the core protein forms stable temar complexes through binding to hyaluronic acid and connects proteins in the matrix. Any enzymatic cleavage in this region destabilizes the structure of the cartilage matrix, leading to loss of the major proteoglycan aggrecane, and exposure of type II collagen to collagenases, resulting in loss of cartilage and thereby leading to the loss of cartilage and thus the 1 0223 71 - 2 development of joint disorders. Because many of the anti-arthritis drugs are not targeted to the aggrecanase, and are unable to block the cleavage of aggrecan, the aggrecanase cleavage site plays a key role in the proteolytic degradation of aggrecan.

Aggrecane as such is considered an important target for arthritis drugs. Aggrecan fragments released into the synovial fluid are the first detectable event in the development of rheumatoid and osteoarthritis. This protease has been intensively searched for. Despite the efforts made, the search for human aggrecanase has been in vain.

There is great interest in the identification of the aggrecanase as such, as well as for the gene encoding this activity.

The following references relate to this field. U.S. Patents 5,872,209 and 5,427,954, and WO 99/0900; WO 98/55643; WO 98/51665; and WO 97/18207.

Other references include: Abbasdale, "Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family," J. Biol. Chem. (Aug. 1999) 274: 23443-50; Amer et al., "Generation and Characterization of Aggrecanase. A soluble, cartilage-derived aggrecan degrading activity," J Biol Chem (March 5, 1999) 274 (10): 6594-6601; Amer et al., "Cytokine-induced cartilage proteoglycan degradation is mediated by aggrecanase," Osteoarthritis Cartilage (May 1998) 6 (3): 214-28;

Billington et al., "Aggrecan degrading activity associated with chondrocyte membranes," Biochem J (Nov. 15, 1998) 336 (Pt 1): 207-12; Buttner et al., "Membrane type 1 matrix metalloproteinase (MT1-MMP) cleaves the recombinant aggrecan substrate rAgglmut at the "aggrecanase" and the MMP sites. Characterization of MT1-25 MMP catabolic activities on the interglobular domain of aggrecan, "Biochem J (July 1, 1998) 333 (Pt 1): 159-65; Flannery et al.," Expression of ADAMTS homologues in articular cartilage, "Biochem. Biophys, Res Commun. (July 1999) 260: 318-22; Hurskainen et al., "ADAM-TS5, ADAM-TS6, and ADAM-TS7, Novel members of a New Family or Zinc Metalloproteases," J. Biol. Chem. (Sept. 1999) 274: 25555-25563 Hughes et al., "Differential expression of aggrecanase and matrix metalloproteinase activity in chondrocytes isolated from bovine and porcine articular cartilage," J Biol Chem (Nov. 13, 1998) 273 (46) : 30576-82; Die et al., "Characterization of aggrecan in" / / / / o

J

retained and lost from the extracellular matrix or articular cartilage. Involvement of carboxyl-terminal processing in the catabolism of aggrecan, "J. Biol Chem (July 10, 1998) 273 (28): 17451-8; Kuno et al.," ADAMTS-1 is an active metalloproteinase associated with the extracellular matrix "J. Biol. Chem. (June 1999) 274: 18821-6; Kuno et al., 5 "AD AMTS-1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region," J. Biol. Chem. ( May 1998) 273: 13912-7; Kuno et al., "The exon / intron organization and chromosomal mapping of the mouse AD AMTS-1 gene encoding and ADAM family protein with TSP motifs," Genomics (Dec. 1997) 46: 466 -71; Kuno et al., "Molecular cloning or a gene encoding a new type or metalloproteinase disintegrin family protein with thombospondin motifs as an inflammation associated gene," J. Biol Chem. (Jan. 1997) 272: 556-62 Sandy et al., "Chondrocyte-mediated catabolism or aggrecan: aggrecanase-dependent cleavage induced by interleukin-1 or retinoic acid can be inhibited by glucosamine," Biochem J (Oct. 1 1998) 335 (Pt 1): 59-66; Tang & Hong, "ADAMTS: a novel family of proteases 15 with ADAM protease domain and thrombospond in 1 repeats," FEBS Lett. (Feb. 1999) 445: 223-5; Tortorella et al., Purification and cloning of aggrecanase-1: a member of the ADAMTS family of proteins, "Science (June 1999) 284: 1664-6; Vankemmelbeke et al.," Coincubation of bovine synovial or capsular tissue with cartilage generates a soluble Aggrecanase activity, "Biochem Biophys Res Commun (Feb. 24, 1999) 255 (3): 686-91; and Vasquez et al.," METH-1, a human ortholog or ADAMTS-1, and METH-2 are members of a new family of proteins with angioinhibitory activity, "J. Biol. Chem. (Aug. 1999) 274: 23349 57.

The present invention is directed to novel metallo-proteinases with thrombospondin domain (s) (MPTS proteins) and polypeptides related thereto, as well as nucleic acid compositions encoding them, which are provided. The subject polypeptide and nucleic acid compositions which are the subject of the present invention may find use in a variety of applications, including diagnostic applications, in tests on a therapeutic agent, as well as therapeutic applications for a variety of conditions. Methods are also provided for the treatment of diseases associated with the activity of the aggrecanase, e.g. disorders characterized by the presence of aggrecan cleavage products, as in rheumatoid and osteoarthritis.

"·"; 7 4

The following is a brief description of the Figures:

Figure 1A shows the sequence of a nucleic acid encoding MPTS-15, an MPTS protein of the present invention. Figure 1B shows the amino acid sequence of MPTS-15. Figure 1C shows the arrangement of the amino acid sequence of the present MPTS-15, with the amino acid sequence of ADAMTS-6, a sequence described in Hurskainen et al., J. Biol. Chem. (Sept. 1999) 274: 25555-25563.

Figure 2A shows the sequence of a nucleic acid encoding MPTS-10, an MPTS protein of the present invention. Figure 1B shows the amino acid sequence of MPTS-10. Figure 3A shows the sequence of a nucleic acid encoding MPTS-19, an MPTS protein of the present invention. Figure 3B shows the amino acid sequence of MPTS-19.

Figure 4A shows the sequence of a nucleic acid encoding MPTS-20, an MPTS protein of the present invention. Figure 4B shows the amino acid sequence of 15 MPTS-20.

New MPTS proteins and related polypeptides are also provided here, as well as nucleic acid compositions encoding them. The present polypeptide and / or nucleic acid compositions find use in a variety of different applications, including research, testing / discovery of, preparation of, diagnostic and therapeutic agents. Methods are also provided for treating disorders associated with MPTS, including the aggrecanase function, e.g. diseases characterized by the presence of aggrecan cleavage products, such as rheumatoid and osteoarthritis.

Metallo-proteinases with thrombospondin domain (s) (also called 25 MPTS protein, ADAMTS proteins or aggrecanase proteins) are also provided, as well as related polypeptide compositions. When the term polypeptide compositions is used herein, reference is made to both full-length protein and to parts or fragments thereof. Also included in that term are all variations on the naturally occurring protein, as described in more detail below. In the following description of the present invention, the term "MPTS" is used to refer not only to the specific human MPTS proteins described herein (i.e., MPTS-10; MPTS-15; MPTS-19; MPTS-20). ), but is also applicable to homologues thereof expressed in non-human species such as e.g. the mouse, rat and other species of mammals.

Specific human MPTS proteins of interest are MPTS-10, MPTS-15, MPTS-19, and MPTS-20. MPTS-15 has an amino acid sequence shown in FIG. 1B is shown and is identified by SEQ ID NO: 1. MPTS-10 has an amino acid sequence shown in FIG. 2B is shown and is identified by SEQ ID NO: 03. MPTS-19 has an amino acid sequence shown in FIG. 3B is shown and is identified by SEQ ID 10 NO: 05. MPTS-20 has an amino acid sequence shown in FIG. 4B is shown and is identified by SEQ NO) NO: 07. The present MPTS proteins have, based on their amino acid sequence, a molecular weight of at least about 90 kDa, wherein the molecular weight based on the amino acid sequence may be substantially higher in certain embodiments. The true molecular weight of the present MPTS proteins can vary due to glycosylation and / or other post-translational modifications.

Also provided by the present invention is MPTS polypeptide compositions. The term polypeptide compositions, as used herein, refers to full-length proteins and to parts or fragments thereof. The term also encompasses variations of the naturally occurring proteins, where such variations are homologous or largely similar to the naturally occurring protein, wherein the naturally occurring protein may be the human protein, mouse protein or protein of any other species that is naturally an MPTS. protein, usually a mammalian species. A candidate homologous protein largely corresponds to an MPTS protein of the present invention, and therefore is an MPTS protein of the present invention, if the candidate protein has a sequence that is at least 35%, usually at least about 45%, and more common has at least about 60% sequence similarity to the MPTS protein, as determined by the MegAlign DNAstar (1998) cluster algorithm as described in DG Higgins and PM Sharp, "Fast and Sensitive Multiple Sequence Alignments on a Microcomputer," (1989) Cabios, 5 151-153 (The parameters used are -. -. ·? 1 'ί 6 ktupl 1, gpa penalty 3, window 5 and saved diagonals 5). In the following description of the present invention, the term "MPTS protein" refers not only to the human MPTS proteins, but also to homologues thereof found in non-human species, e.g. mouse, rat and other mammalian species.

MPTS proteins are also provided which are largely identical to the described proteins, whereby largely identical is meant that the protein has a similarity in the amino acid sequence, with that of one of the described proteins of at least 60%, usually at least about 65 %, and more generally at least about 70%. In many preferred embodiments, the sequence similarity is at least about 90%, usually at least about 95%, and more generally at least about 99%, over the entire length of the protein.

In many embodiments, the proteins of the present invention are enzymes, in particular proteases, and more particularly metallo-proteinases. The present protein of these embodiments is characterized by the fact that it has agrecanase activity. The present proteins as such are capable of cleaving aggrecan in an inter-globular domain, in particular between the G1 and G2 domains, and more particularly on the GIu373-AIa374 binding of human aggrecan, thereby producing a cleavage product with the N-terminal sequence ARGSVIL.

In addition to the proteins described above, homologues or proteins (or fragments thereof) from other species such as other animal or plant species are also provided, such homologues of proteins being derived from a variety of species types, usually mammals. rodents like the mouse; pets, e.g. horse, cow, dog, cat; and from humans. By homologous is meant that a protein has a similarity in the amino acid sequence of at least about 35%, usually at least about 40% and more generally at least about 60%, with one of the specific human MPTS proteins identified above (i.e. a protein with an amino acid sequence of SEQ ED NO: 01, 03, 05 or 07), wherein the determination of the similarity in amino acid sequence is described as supra.

- ->>

The proteins of the present invention are present in a non-naturally occurring environment, e.g. they are separated from the environment in which they occur naturally. In certain embodiments, the subject proteins are in a composition enriched in the subject protein, compared to the environment in which it occurs naturally. For example, a purified protein is provided, wherein purified means that the protein is present in a composition that is largely free of non-MPTS proteins, with largely free meaning that less than 90%, usually less than 60%, and more generally less than 50% of the composition consists of non-MPTS proteins. The proteins of the present invention may also be present as an isolate, by which is meant that the protein is largely free of other proteins and other naturally occurring biological molecules such as oligosaccharides, polynucleotides and fragments thereof, and the like, the term "largely free "it is meant that at least 70%, usually less than 60% and more generally less than 50% of the composition containing the isolated protein, consists of another naturally occurring biological molecule. In certain embodiments, the proteins are present in substantially pure form, wherein "largely pure form" means that it is pure at least 95%, usually at least 97%, and more generally at least 99%.

In addition to naturally occurring proteins, polypeptides that deviate from the naturally occurring protein, e.g. MPTS polypeptides. With MPTS

polypeptide is intended to be an amino acid sequence encoded by an open reading frame (ORF) of the gene encoding the MPTS, which will be discussed in more detail below, including the full-length protein, as fragments thereof, in particular biologically active fragments and / or fragments corresponding to functional domains, e.g. the protease domain, thrombospondin domain, and the like, and including fusions of the subject polypeptides to other proteins or parts thereof. Interesting fragments will typically have a length of about 10 az, usually at least about 50 az, and may be 300 az, or longer, but usually do not exceed 1000 az in length, the fragment being a contiguous one. set of amino acids identical to the subject protein of at least about 10 az, usually at least about 15 az, and in many embodiments of at least about 50 az in length. Where the fragment is an MPTS-15 fragment, it preferably comprises a major portion of the protease domain of the wild-type protein, a major portion being at least 50%, usually at least 60%, and more generally at least 70% of the sequence of this domain of the MPTS-15 protein. For example, the MPTS-15 fragment usually comprises a sequence which, after alignment with the sequence residues of the protease domain of the wild-type sequence, shows a similarity to the ordered region of the wild-type sequence of at least 50%, usually at least 60% and more generally 10 is at least 70%, with the percentage of similarity being much higher in many embodiments, e.g. 75, 80, 85, 90 or 95%, or higher, e.g. 99%.

The subject proteins and polypeptides can be obtained from natural sources, or produced synthetically. The proteins may, for example, come from biological sources expressing the proteins, such as synoviocytes, chondrocytes, cartilage and the like. The present proteins may also be from a synthetic source, for example by expression in a suitable host of a gene encoding the protein. protein of interest, as discussed in more detail below.

Any suitable protein purification method can be used, whereby suitable methods for protein purification are described in the Guide to Protein Purification, (Deuthser ed.) 20 (Academic Press, 1990). For example, from the original source, e.g.

chondrocytes or an expression host, a lysate are prepared that is purified by HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, and the like. Also provided are nucleic acid compositions encoding MPTS proteins, or fragments thereof, as well as the MPTS homologues of the present invention. By nucleic acid composition is meant a composition comprising a sequence DNA with an open reading frame encoding an MPTS polypeptide of the present invention, i.e. an mpts gene, and capable of being expressed as MPTS under the right conditions. . This term also includes nucleic acids that are homologous or largely similar or identical to the IV; v v "· '· v' f i.

9 nucleic acids that encode MPTS proteins. Thus, the present invention provides genes encoding the human MPTS protein of the present invention, and homologues thereof. The human MPTS gene is shown in FIG. 1A, the sequence shown in FIG. IA shown is identified as SEQ ID NO: 02, infra. The human MPTS 10 gene is shown in FIG. 2A, the sequence shown in FIG. 2A is shown is identified as SEQ ID NO: 04, infra. The human MPTS19 gene is shown in FIG. 3A, the sequence shown in FIG. 3 A is shown is identified as SEQ ID NO; 06, infra. The human MPTS20 gene is shown in FIG. 4A, the sequence shown in FIG. 4A is shown as SEQ ID NO: 08, infra.

Any species can serve as a source of homologous genes, e.g. primate species, in particular human; rodents such as combs and mice, canine, feline, cattle, sheep, horses, yeast, nematodes, etc. Between mammalian species, e.g. human and mouse, homologues must show great similarity in sequence, e.g. at least 75% identity in sequence, usually at least 90% and more generally at least 95% identity in nucleotide sequence. The similarity in sequence is calculated based on a reference sequence, which may consist of a sub-set of a larger sequence, such as a conserved motif, a coding region, a flanking region, etc. A reference sequence will usually be at least about 18 nt. be more long, more usually at least about 30 nt, and may extend to the entire sequence being compared. The algorithms for sequence analysis are known in the art, such as BLAST, described by Altschul et al. (1990), J. Mol. Biol. 215-403-10 (with basic settings, i.e. parameters w = 4 and T = 17). The sequences provided herein are essential for the recognition of MPTS in data files, and include aggrecanase, related and homologous proteins, and the nucleic acids encoding them. In particular, in certain embodiments, nucleic acids that are substantially the same length as the nucleic acids identified by SEQ ED NO.02, 04, 06 and 08, and that have a sequence similarity to one of those over the entire length of the nucleic acid sequences of at least about 99%.

- / t 10

Nucleic acids encoding the proteins and polypeptides of the present invention can be cDNA or genomic DNA or fragments thereof. By the term "MPTS gene" is meant an open reading frame encoding specific MPTS proteins and polypeptides, and introns, as well as the 5 'and 3' non-coding nucleotide sequences involved in regulation and expression, up to about 20 kb after the coding region, but possibly further in each of the directions. The gene can be introduced into a suitable vector as an extrachromosomal element, or for integration into the genome of a host.

The term "cDNA" includes, as used herein, all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, the sequence elements being the exons and the 5 'and 3' non-coding regions. In general, upon removal, by splicing the RNA in the nucleus, of any introns present, mRNA species have contiguous exons, creating a continuous open reading frame encoding the MPTS protein.

An interesting genomic sequence comprises the nucleic acid present between the start codon and the stop codon, as defined herein in the sequence list, which includes all introns that are usually present in a native chromosome. Furthermore, this may include the 5 'and 3' untranslated regions that occur in the mature mRNA. Furthermore, this may include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc, including about 1 kb, but possibly more, flanking genomic DNA at the 5 'or 3' end of the written off region. The genomic DNA can be isolated as a fragment of 100 kbp or smaller, and largely free from flanking chromosomal sequences. The genomic DNA flanking the coding region on the 3 'or 5' side, or the internal regulatory sequences that are sometimes found in introns, contain sequences that are required for proper tissue and stage specific expression.

The nucleic acid compositions of the present invention can encode all or part of the MPTS protein. Single or double-stranded fragments of the DNA sequence can be obtained by standard methods, by restriction.

η enzyme digestion, by PCR amplification, etc, chemical synthesis of ofigonucleotides.

The majority of the DNA fragments will be at least 15 nt, usually at least 18 nt or 25 nt, and can be at least 50 nt.

The present genes are isolated and obtained in largely pure form, generally other than as an intact chromosome. Typically, the DNA will be obtained in a form that is substantially free of other nucleic acid sequences that do not contain an MPTS gene sequence or fragment thereof, generally at least 50%, usually at least about 90% pure, and it is typically "recombinant" , ie it is flanked by one or more nucleotides that are not normally associated with the naturally occurring chromosome.

In addition to the multitude of uses discussed in more detail in the following sections, the subject nucleic acid compositions find use in the preparation of all, or part of, the MPTS polypeptides as described above. Use is made of the polynucleotide provided (eg, a polynucleotide with a sequence of SEQ ID NO: 02, 04, 06 or 08), the corresponding cDNA, or the full-length gene, for the expression of a portion, or the whole of the gene product. Constructs of polynucleotides with the sequences SEQ (NO): 02, 04, 06 or 08 can be generated synthetically. Alternatively, one-step assembly of a gene and total plasmid from large amounts of oligodeoxyribonucleotides are described by e.g. Stemmer et al., Gene (Amsterdam) (1995) 164 (1): 49-53. This method describes the assembly PCR (the synthesis of long DNA sequences from large amounts of oligodeoxyribonucleotides (oligos)). The method is derived from DNA shuffling (Stemmer, Nature (1994) 370: 389-391), and is not dependent on the DNA ligase, but instead uses DNA polymerase, for building up during the assembly process, of longer DNA fragments. The appropriate polynucleotide constructs are purified by standard recombinant DNA techniques, as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory manual, 2 "edition, (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, / 12 and under current regulations described in United States Dept of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research

Polynucleotide molecules comprising a polynucleotide sequence provided herein are multiplied by introducing the molecule into a vector. Viral and non-viral vectors, including plasmids, are used. The choice of the plasmid depends on the cell type in which the multiplication is desired, and the purpose of the multiplication. Certain vectors are useful for amplification and preparation of large quantities of the desired DNA sequence. Other vectors are suitable for transfer and expression in cells in an intact animal or person. The choice of the correct vector is within the competence of the skilled person. Many vectors are available commercially. The partial or complete polynucleotide is introduced into a vector, typically by DNA ligase attachment of a cleaved fragment to a cleaved restriction site in the vector. Alternatively, the desired nucleotide sequence can be introduced in vivo by homologous recombination. Typically this is accomplished by attaching regions with homology to the vector to the flanks of the desired nucleotide sequence. Homologous regions are added, for example, by ligation of oligonucleotides, or by the polymerase chain reaction with primers comprising both the homologous region and a portion of the desired nucleotide sequence.

An expression cassette can be used for expression. The gene product encoded by a polynucleotide of the invention is expressed in any suitable expression system, for example bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells are described in U. S. Patent No. 5,654,173. In the expression vector, a polynucleotide encoding an MPTS, e.g. as described by SEQ ID NO: 02, 04, 06 and 08, linked to a regulatory sequence such that the correct expression properties are obtained. These may include promoters (attached on the 5 'side of the coding sequence or on the 3' side of the non-coding sequence), enhancers, terminators, operators, repressors, and inductors. The promoters can be regulated or constitutive. In some cases, it may be desirable to use conditionally active promoters, such as tissue-specific or developmental stage-specific promoters. These are linked to the desired nucleotide sequence by techniques described above for linking to vectors. Any technique known in the art can be used. In other words, the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, the coding region being operably linked, under transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to the present MPTS gene, or may be from exogenous source.

Expression vectors generally have useful restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selection marker active in the expression host may be present. Expression vectors can be used for the production of fusion proteins, wherein the exogenous fusion peptide provides additional functionality, i.e., increased protein synthesis, stability, reactivity with defined sera, an enzyme marker, e.g. β-galactosidase, etc.

Expression cassettes can be made that include a translation initiation region, the gene or a fragment thereof, and a translation stop region. In particular, the use of sequences is of interest that allow the expression of functional epitopes or domains, usually at least about 8 amino acids, more usually at least about 15 amino acids in length, up to about 25 amino acids up to the entire open reading frame of the gene. . After introduction of the DNA, the cells containing the construct are selected by means of a selection marker, the cells are expanded and then used for expression.

The MPTS proteins and polypeptides can be expressed in prokaryotes or eukaryotes depending on the purpose of the expression by known procedures. For large-scale production, a single-cell organism such as E. coli, B. subtitis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, in particular mammals, e.g. COS 7 cells, HEK 293, CHO, Xenopus 0223 71 14 oocytes, etc., are used as expression host cells. In some situations, it is desirable to express the gene in eukaryotic cells, the expressed protein taking advantage of native folding and post-translatial modifications. Small peptides can also be produced in the laboratory. Polypeptides that form sub-5 sets of the complete protein sequence can also be used to identify and examine portions of the protein that are important for its functioning.

Specific expression systems of interest include expression systems derived from bacteria, yeast, insect cells and mammalian cells. Representative systems for each of these categories are given below:

Bacteria: Expression systems in bacteria include those described in Chang et al., Nature (1978) 275: 615; Goeddel et al., Nature (1979) 281: 544; Goeddel et al., Nucleic Acids Res. (1980) 8: 4057; EP 0 036,776; U.S. Patent No. 4,551,433; De Boer et al., Proc. Natl. Acad Sci. (USA) (1983) 80: 21-25; and Siebenlist et al., Cell (1980) 15: 269.

Yeast. Expression systems in yeast include those described in Hinnen et al., Proc. Natl. Acad Sci. (USA) (1978) 75: 1929; Ito et al., J. Bacteriol. (1983) 153: 163; Kurtz et al., Mol. Cell. Biol. (1986) 6,142; Kunze et al, J. Basic Microbiol. (1985) 25: 141; Gleeson et al, J. Gen. Microbiol. (1986) 132: 3459; Roggenkamp et al., Mol. Gene. Genet.

20 (1986) 02: 302; Das ei al., J. Bacteriol. (1984) 158: 1165; De Louvencourt et al., J.

Bacteriol. (1983) 154: 737; Van den Berg et al., Bio / Technology (1990) 8: 135; Kunze et al, J. Basic Microbiol. (1985) 25: 141; Cregg et al., Mol. Cell. Biol. (1985) 5: 3376; U.S. Patent Nos. 4,837,148 and 4,929,555; Beach and Nurse, Nature (1981) 300: 706; Davidow et al,

Curr. Genet. (1985) 10: 380; Gaillardin et al., Curr. Genet. (1985) 10:49; Ballance et al., Biochem. Biophys. Res. Commun. (1983) 112: 284-289; Tilbum et al., Gene (1983) 26: 205-22 1; Yelton et al., Proc. Natl. Acad Sci. (USA) (1984) 81: 1470-1474; Kelly and Hynes, EMBOJ. (1985) 4: 475479; EP 0 244,234; and WO 91/00357.

"· ·> / J

15

Insect cells The expression of heterologous genes in insects can take place as described in U.S. Pat. Patent No. 4,745.05 1; Friesen et al, "The Regulation of Baculovirus Gene Expression", in: The Molecular Biology Of Baculoviruses (1986) (W. Doerfler, ed.); EP 0 127,839; EP 0,155,476; and Vlak et al., J. Gen. Virol (1988) 69: 765-776; Miller et al., 5 Ann. Rev. Microbiol. (1988) 42: 177; Carbonell et al., Gene (1988) 73: 409; Maeda et al., Nature (1985) 315: 592-594; Lebacq-Verheyden et al., Mol Cell Biol. (1988) 8: 3129; Smith et al., Proc. Natl. Acad. Sci. (USA) (1985) 82: 8844; Miyajima et al., Gene (1987) 58: 273; and Martin et al, DNA (1988) 7:99. Many baculoviral strains and variants and the corresponding permissive insect host cells from hosts are described in Luckow et al., Bio / Technology (1988) 6: 47-55, Miller et al., Generic Engineering (1986) 8: 277-279 , and Maeda et al., Nature (1985) 315: 592-594.

Mammalian cells Mammalian expression can occur as described in Dijkema et al, EMBOJ (1985) 4: 761, Gorman et al, Proc. Natl. Acad. Sci. (USA) (1982) 79: 6777, Boshart et al., Cell (1985) 41: 521, and U.S. Pat. Patent No. 4,399,216. Other features of mammalian expression are illustrated and described in Ham and Wallace, Meth. Etc. (1979) 58:44, Barnes and Sato, Anal Biochem. (1980) 102: 255; U.S. Patent Nos. 4,767,704; 4,657,866; 4,927,762; 4,560,762; WO 90/103430; WO 87/00195 and U.S. RE 30,985.

When using one of the above host cells, or other suitable host cells or organisms, for replication and / or expression of the polynucleotides of the invention, the resulting replicated nucleic acid, RNA, expressed protein or polypeptide, falls within the The scope of the present invention as a product of the host cell or organism can be recovered by any means known in the art.

When a gene corresponding to a selected polynucleotide is identified, its expression in the cell in which the gene is native can be regulated. For example, an endogenous gene of a cell can be regulated by an exogenous regulatory sequence, as described in U.S. Pat. Patent No. 5,641,670.

The present polypeptide and nucleic acid compositions find use in a variety of applications, including general applications, diagnostic applications, 16 and research, testing / discovery / preparation of therapeutic compositions, and methods for their use.

The present nucleic acid compositions find use in a variety of general applications. Interesting general applications include: 5 the identification of MPTS homologues; as a source of new promoter elements; identification of MPTS expression regulating factors; as probes and primers in hybridization applications, e.g. PCR; the identification of expression patterns in biological specimens; the preparation of cells or animal models for the MPTS function; making in vitro models for the MPTS function; etc.

Homologues of the present genes can be obtained by a number of methods

identified. A fragment of the cDNA that is provided can be used as a hybridization probe against a cDNA library of the target organism of interest. The probe can be a large fragment, or one or more shorter degenerate primers. Nucleic acids with sequence identity are detected by hybridization under low stringent conditions, for example at 50 ° C and 6xSSC (0.9 M

sodium chloride / 0.09 M sodium citrate) and continue to rinse bound at 55 ° C in 1x SSC (0.15 M sodium chloride / 0.15 M sodium citrate). The sequence identity can be determined by hybridization under stringent conditions, for example at 50 ° C or higher and with 0.1xSSC (15 mM sodium chloride / 15 mM sodium citrate). Nucleic acids with an area 20 with substantial similarity to the sequences in which pre-mixing is carried out, e.g. allelic variants, genetically modified versions of the gene, etc., bind under stringent hybridization conditions to the sequences provided. By using probes, in particular labeled probes from the DNA sequence, one can isolate homologous or related genes.

The sequence of the 5 'flanking region can be used for promoter elements including enhancer binding sites, which provide for developmental regulation in tissues in which the present MPTS gene is expressed. The tissue-specific expression is useful in determining the expression pattern, and to provide promoters that imitate the native expression pattern. The polymorphies occurring in the promoter region naturally by nature are useful in determining the natural variation in expression, in particular those that may be associated with diseases.

Alternatively, mutations can be made in the promoter region to determine the effect of altered expression in experimentally defined systems. The methods for the identification of specific DNA motifs concerning the binding of transcription factors are known in the art, e.g. sequence similarity with known binding motifs, gel retardation testing, etc. See, for example, Blackwell et al, (1995) Mol. Med. 1: 194-205; Mortlock et al., (1996) Genome Res. 6: 327-33; and Joulin and Richard-Foy (1995), Eur. J. Biochem. 232: 620-626.

The regulatory sequences can be used for the identification of cis active sequences necessary for transcription or translation regulation of the MPTS gene expression, in particular at different tissues or stages of development, and for the identification of cis active sequences and trans active factors that regulate or mediate the MPTS gene expression. Such transcription or translation regulatory regions can be operably linked to an MPTS gene to promote the expression of wild-type or altered MPTS or other proteins of interest in cultured cells or in embryonic fetal or adult tissues, and for gene therapy.

Small DNA fragments are useful as primers for PCR, hybridization test probes, etc. Larger DNA fragments, i.e., greater than 100 nt, are useful for the production of the encoded polypeptide, as described in the previous section. For use in geometric amplification reactions as geometric PCR, a primer pair will be used. The exact composition of the primer sequences is not crucial to the invention, but for most applications, the primers will hybridize to the subject sequence under stringent conditions, such as in the science is known. It is preferred if a primer pair is selected that will generate an amplification product of at least 50 nt, preferably at least about 100 nt. The algorithms for the selection of primer sequences are well known and can be purchased in commercially available software packages. Amplification primers hybridize with complementary strands of DNA and will trigger the reaction towards each other.

18

The DNA can also be used to identify the gene in a biological specimen. The manner in which the cells test with a probe for the presence of certain nucleotide sequences such as genomic DNA or RNA is known from the literature. Briefly, DNA or mRNA is isolated from a cell sample. The mRNA can be amplified by RT-PCR to form a complementary DNA strand with reversed transcriptase, followed by polymerase chain reaction amplification with primers specific to the present DNA sequence. Alternatively, the mRNA sample can be separated by gel electrophoresis, transferred to a suitable support, e.g. nitrocellulose, nylon, etc., and then tested with a probe that is a fragment of the present DNA. Other techniques such as oligonucleotide ligation assays, in situ hybridizations and hybridization to DNA probes arranged on a solid chip can also be used. Detection of mRNA that hybridizes to the present sequence is indicative of the MPTS gene expression in a sample.

The sequence of the MPTS gene, including the flanking promoter regions and coding regions, can be mutated, in various ways known in the art, to make targeted changes in the power of the promoter, sequence of the encoded protein, etc. The DNA sequence or protein product of such a mutation will usually substantially correspond to the sequences provided herein, ie will deviate in at least one nucleotide or amino acid, respectively, and may deviate in at least two, but no more than about ten nucleotides. or amino acids. The sequence changes may involve substitutions, insertions, deletions, or a combination thereof. Deletions can include larger changes, such as deletion of a domain or an exon. Other interesting modifications include labeling an epitope, e.g. with the FLAG system, HA, etc. For research on sub-cellular localization, fusion proteins with green fluorescent proteins (GFP) can be used.

The techniques for in vitro mutagenesis of cloned genes are known. Examples of protocols for site-directed mutagenesis can be found in Gustin et al (1993), Biotechniques 14:22; Barany (1985), Gene 29: 303-13. Colicelli et al. (1985), Mol. Gene. Genet. 199: 537-9; and Prentski et al. (1984), Gene 19 29: 303-13. Methods for site-directed mutagenesis can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, CSH Press 1989, p. 15.3-15.108; Weiner et al. (1993), Gene 126: 35-41; Sayers et al. (1992), Biotechniques 13: 592-6; Jones and Winistorfer (1992), Biotechniques 12: 528-30; Barton et al., (1990) Nucleic Acids Res 18: 7349-55; Marotti and Tomich (1989), Gene Anal Tech. 6: 67-70; and Zhu (1989), Anal Biochem 177: 120-4. Such mutated genes can be used to investigate the structure-function relationships of an MPTS protein or to alter the properties of the protein that affect its function or regulation.

The present nucleic acids can be used to generate transgenic, non-human animals or specific gene modifications in all cell lines. Transgenic animals can be made by homologous recombination, thereby changing the endogenous locus. Alternatively, a nucleic acid construct is randomly integrated into the genome. The stable integration vectors include plasmids, retroviruses, and other viruses, YACs, and the like.

The modified cells or animals are useful in research into the MPTS function and regulation. The use of the present genes is important for the construction of transgenic animal models of MPTS related disorders, including aggrecanase related disorders, e.g. disorders associated with agrecanase activity such as arthritis. Such transgenic animal models of the present invention include endogenous MPTS gene knockouts, wherein the expression of endogenous MPTS is at least reduced or eliminated, the animals also typically having an MPTS peptide of the present invention, e.g. express the specific MPTS proteins of the present invention, or a fragment thereof. When a nucleic acid with a sequence found in the human MPTS gene is introduced, the introduced nucleic acid may be the complete, or part of, the sequence of the MPTS gene. A detectable marker such as lac Z can be introduced into the MPTS locus, with up-regulation of gene expression resulting in an easily detectable change in the phenotype. It is also possible to allow expression of the gene or variants thereof. Take place in cells or tissues in which it is usually not expressed, at a level that is usually not realized in such cells or tissues.

The DNA constructs for homologous recombination will comprise at least a portion of an MPTS gene of the present invention, the gene comprising the desired modification (s), and containing regions of homology with the target locus. The DNA constructs for random integration do not have to contain homologous regions for bringing about recombination. For convenience, markers for positive and negative selection are included. Methods for making cells with homologous recombination directed gene modifications are known in the art. For various techniques for transfection of mammalian cells, see Keown et al. (1990). Meth. Enzymol. 185: 527-537.

For embryonic stem (ES) cells, an ES cell line can be used, or the embryonic cells can be obtained fresh from the host, e.g. from the mouse, rat, guinea pig, etc. Such cells are grown on an appropriate fibroblast nutrient layer in the presence of the leukemia inhibitory factor (LEF). If the ES or embryonic cells are transformed, then they can be used for the production of transgenic animals. After transformation, the cells are plated on a nutrient layer in the correct medium. Cells containing the construct can be detected using a selective medium. After sufficient time has elapsed for colonies to grow, they are picked up and analyzed for whether homologous recombination or integration of the construct has taken place. The positive colonies can then be used for embiyo manipulation and blastocyst injection. The blastocysts are obtained from 4-6 week old super-ovulating females. The ES cells are trypsinized, and the modified cells are injected into the blastocoel or blastocyst. After injection, the blastocysts are placed back into the uterus horn of fake pregnant females. The females are then allowed to carry out the pregnancy and the resulting offspring is tested for construct. If a different phenotype of the blastocyst and the genetically modified cells was provided, the chimeric offspring can be easily detected.

• 3 0 2 2:, 21

The chimeric animals are tested for the presence of the modified gene and the males and females with the modification are allowed to mate with each other for the production of homozygous offspring. If the changes in the gene are lethal at some point in the development, the tissues or organs may be maintained as allogeneic or congenic grafts, or in vitro. The transgenic animals can be any non-human mammal, such as laboratory animals, pets, etc. The transgenic animals can be used for functional testing, drug testing, etc., e.g. to determine the effect of a candidate drug on aggrecanase activity.

Also provided are methods for diagnosing disorders based on the observed levels of an MPTS protein or on the level of expression of the gene in an important biological sample. As used herein, the term samples includes biological fluids such as blood , cerebrospinal fluid, tear fluid, saliva, lymph, dialysis fluid, and the like, organs or fluids derived from tissue culture. The cells can be dissociated, in the case of solid tissues, or tissue sections can be analyzed. Alternatively, a lysate can be made from the cells.

A number of methods are available for determining the level of expression of a gene or protein in a given sample. The diagnosis for lack or occurrence of altered amounts of normal or abnormal MPTS in a patient's sample can be performed by a number of methods. Detection may use, for example, cell staining or histological sections with labeled antibodies performed according to existing methods. The cells are permeabilized for staining cytoplasmic molecules. The antibodies of interest are added to the cell sample, and incubated for a time sufficient to allow binding of the epitope, usually at least about 10 minutes. The antibody can be labeled with radioisotopes, enzymes, fluorescents, chemiluminescents or other labels for direct detection. Alternatively, a second antibody step is used to amplify the signal. Such reagents are known in the art. For example, the primary antibody may be conjugated to biotin, with peroxidase conjugated avidin being added to horseradish as a second step reagent. Alternatively, the second antibody can be conjugated to a fluorescent compound, e.g. fluorescein, rhodamine, Texas red, etc. The final detection takes place with a substrate that undergoes a color change in the presence of the peroxidase. The absence or occurrence of antibody binding can be determined by various methods, including flow cytometry of single cells, microscopy, radiography, scintillation counting, etc.

Alternatively, one can focus attention on the expression of the MPTS gene. To determine whether sequence polymorphism in an MPTS coding region or in control regions 10 is associated with a disease, biochemical testing can be performed. Disorders associated with disorders can include deletion or truncation of the gene, mutations that affect the level of expression, that affect the activity of the protein, etc.

Changes in the promoter or enhancer sequence that affect the levels of expression of MPTS can be compared to the levels of expression of the normal allele in various ways known in the art. Methods for determining the potency of the promoter or enhancer include the quantification of the expressed natural protein; insertion of a variant of a control element into a vector with a reporter gene such as β-galactosidase, ludferase, chloramphenicol, acetyltransferase, etc. that allow for easy quantification, and the like.

For analyzing nucleic acids for the presence of a specific sequence, e.g. a polymorphism associated with spike, a number of methods are available. If large quantities of DNA are available, genomic DNA is used immediately. Alternatively, the region of interest is cloned into a suitable vector and grown to sufficient amounts for analysis. The cells expressing an MPTS protein can be used as a source of mRNA, which can be tested directly, or reversed to cDNA for analysis. The nucleic acid can be amplified by conventional techniques such as the polymerase chain reaction (PCR) to obtain sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki et al. (1985), Science 239: 487, and an overview of techniques can be found in Sambrook et al. Molecular Cloning: A Laboratory manual. CHS Press 1989, p. 14.2-14.33. Alternatively, science has various methods that use oligonucleotide ligation as a means for the detection of polymorphies, see, for example, Riley et al (1990), Nucl. Acids Res. 18: 2887-2890; and Delahunty et al. (1996), Am. J. Hum. Genet. 58: 1239-1246.

A detectable label can also be included in the amplification reaction.

Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phyco-eggytrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2 ', 7'-dimethoxy-4', 5'-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2 ', 4', 7 ', 4.7, hexachlorofluorecein (HEX), 5-carboxyfluoresceme (5-FAM) or N, N, N', N, -tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels such as e.g. 32 P, 35 S, 3 H; etc. The label can be part of a two-step system, wherein the amplified DNA is conjugated to biotin, haptens, etc. that have a high affinity binding partner, e.g. avidin, specific antibodies, etc., wherein the binding partner is conjugated to a detectable label. The label can be conjugated to one or both primers. Alternatively, the pool of nucleotides used in the amplification is labeled so that the label is incorporated into the amplification product.

The nucleic acid sample, e.g. the amplified or cloned fragment is analyzed by one of the methods known in the art. The nucleic acid can be sequenced with the dideoxy or other method, and the base sequence is compared with a wild-type gene sequence. Hybridization through Southern blots, dot blots, etc. with the variant sequence can also be used to determine their presence. The hybridization pattern of a control and a variant sequence with arranged oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. 5,445,934, or in WO 95/35505, can also be used as a means for detecting the presence of variants. Single-strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE) and: heterologous analysis in gel matrices is used to detect conformational changes made to the DNA sequence by DNA sequence variation as change in electrophoretic mobility. Alternatively, when a polymorphism creates or destroys a restriction endonuclease recognition site, it is possible to digest the sample with that endonuclease and fractionate the product to size to determine whether the fragment has been digested. Fractionation is carried out by gel or capillary electrophoresis, in particular with acrylamide or agarose gels.

Test for mutations in the MPTS can be based on the functional or antigenic characteristics of the protein. Protein truncation assays are useful for detecting deletions that affect the biological activity of the protein. Various immunoassays designed to detect polymorphisms in MPTS proteins can be used in the test. When many different genetic mutations give rise to a certain disease phenotype, functional protein tests have proven to be an effective test agent. The activity of the encoded MPTS protein can be determined by comparison with the wild-type protein.

The diagnostic methods of the present invention in which the level of expression of the MPTS gene of interest is determined will typically involve the comparison of the MPTS nucleic acid abundance in a sample of interest with that of a control value, determine relative differences, wherein the difference can be determined quantitatively and / or qualitatively, whereby the difference is related to the presence or absence of an abnormal MPTS gene expression pattern. Those skilled in the art will be familiar with a variety of methods for determining the nucleic acid abundance in a sample, certain methods of interest including those described in Pietu et al., Genome Res. (June 1996) 6: 25 492-503; Zhao et al., Gene (April 24, 1995) m 156: 207-213; Soares, Curr. On in. Biotechnol.

(October 1997) 8: 542-546; Raval, J. Pharmacol Toxicol Methods (November 1994) 32: 125-127; Chalifour et al., Anal. Biochem (February 1, 1994) 216: 299-304; Stolz & Tuan, Mol. Biotechnol (December 1996) 6: 225-230; Hong et al., Bioscience Reports (1982) 2: 907; and 25

McGraw, Anal. Biochem. (1984) 143: 298. Also of interest are the methods described in WO 97/27317, the description of which is incorporated herein by reference.

The subject polypeptides find use in various test methods designed to detect therapeutic agents. In vitro assays can be used in which the activity of the MPTS polypeptide, e.g. the aggrecanase activity of an MPTS polypeptide is determined in the presence of a candidate therapeutic agent, and is compared to a control, i.e. the activity in the absence of the candidate therapeutic agent. The activity can be determined in a number of different ways, the activity generally being determined as the ability to cleave aggrecan, or at least a fragment thereof, as well as a recombinant polypeptide containing the aggrecan cleavage site, as described above. Such tests are described in U.S. Pat. Patent No. 5,872,209 and WO 99/05921, as well as in Amer et al., J. Biol. Chem. (March 1999) 274: 6594-6601.

In tests, also non-human transgenic animals expressing functional MPTS are of interest, such animals being described as above. In many embodiments the animals lack endogenous MPTS. When using such animals for use in testing, a test compound (s) is administered to the animal and the resulting changes in the phenotype, e.g. the presence of aggrecane produced by cleavage of the Glu373-Ala374 binding compared to a control.

Alternatively, the binding activity of MPTS and candidate MPTS modulating agents can be determined in in vitro models.

A variety of other reagents can be included in the tests, depending on the specific test protocol used. These include reagents such as salts, natural proteins, e.g. albumin, detergents, etc., which are used to facilitate optimal protein-protein binding and / or the reduction of non-specific or background interactions. One can use reagents that improve the efficiency of the test, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc.

1022371 26

With the above methods, a variety of different candidate therapeutic agents that serve as MPTS agonists or antagonists can be tested. The candidate agents include many chemical classes, although they are typically organic molecules, preferably small organic compounds with a molecular weight of more than 50, and less than about 2,500 daltons. Candidate agents have functional groups that are necessary for structural interaction with proteins, in particular hydrogen bonding, and typically have at least one amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often include cyclic carbon or heterocyclic structures, and / or aromatic or poly-aromatic structures that are substituted with one or more of the above functional chemical groups. Candidate agents also occur among the biomolecules, including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, and derivatives, structural analogs, or combinations thereof.

The candidate agents were obtained from a wide range of sources, including 15 banks of synthetic or natural compounds. For example, agents are available for random and targeted synthesis of a wide range of organic compounds and biomolecules, including the expression of randomized oligonucleotides and oligopeptides. As an alternative, banks of natural compounds in the form of bacterial, fungal, plant and animal extracts are available, or these can easily be formulated. In addition, natural or synthetically produced libraries and compounds can be easily modified with conventional chemical, physical and biochemical agents, and used for the production of combined libraries. Targeted or random chemical modification such as acylation, alkylation, esterification, amidification etc. are used for the production of structural analogues.

In many embodiments, test methods that identify agents that selectively modulate, i.e., inhibit the subject MPTS enzyme, but not other proteases, are of particular interest.

"O ΐ li" 27

The nucleic acid composition of the present invention also find use as therapeutic and therapeutic agents in situations where it is desired to enhance the MPTS activity of the host. The MPTS genes, gene fragments or encoded proteins or protein fragments are useful in gene therapy for the treatment of disorders associated with 5 MPTS defects, including aggrecanase defects. Expression vectors can be used to introduce the gene into a cell. Such vectors generally have handy restriction sites located near the promoter sequence to allow the insertion of nucleic acid sequence.

Transcription cassettes can be made that include a transcription initiation region, the target gene or fragment thereof, and a transcription termination region. The transcription cassette can be inserted with a variety of vectors, e.g. plasmid; retrovirus, lentivirus; adenovirus, and the like, wherein the vectors are capable of being maintained in the cells for a short or stable period, usually for a period of at least about one day, more usually a period of at least about 15 several days to several weeks.

The gene or protein can be introduced into tissues and host cells via a number of routes, including viral infection, microinjection or vesicle fusion. Jet injection may also be used for intramuscular administration, as described by Furth et al (1992), Anal. Biochem. 205: 365-368. The DNA can be coated on gold micro-particles, and administered intradermally by a particle bombardment device or a "gene gun" as described in the literature (see, for example, Tang et al (1992), Nature 356: 152-154) wherein gold micro-projectiles were coated with the DNA which were then bombarded into skin cells.

The present invention provides methods for modulating MPTS, and in many embodiments of aggrecanase activity in the cell, including methods for increasing the MPTS activity (eg methods for amplification), as well as methods for reducing or inhibiting the MPTS activity, e.g. methods for stopping or limiting the cleavage of aggrecan. In such methods, an effective amount of a modulating agent is contacted with the cell.

J

28

Methods for modulating, including enhancing and inhibiting, MPTS activity in a host are also provided. In such methods, an effective amount of active reagent that modulates the activity of an MPTS protein in vivo, e.g. an agent that usually enhances or inhibits the target MPTS activity administered to the host. The active agent can consist of a variety of different compounds, including naturally occurring or synthetic compounds with small molecules, an antibody, fragment or derivative thereof, and an antisense compound, and the like.

Of particular interest in certain embodiments are agents that reduce the MPTS activity, including agents that reduce the aggrecanase activity, e.g. reduce aggrecan cleavage, by at least a 10-fold, usually at least about 20-fold, and more usually at least about 35-fold, as determined by the assay described in Amer et al (1999) supra. In many embodiments of particular interest, the use of compounds that reduce agrecanase activity by at least 100-15 fold is compared to a control.

It is also important to use agents that, while ensuring a reduction in MPTS, including agrecanase activity, do not substantially reduce the activity of other proteases, if they do. For example, the agents in this embodiment are selective inhibitors of MPTS. An agent is considered to be selective if it provides the aforementioned reduction in aggrecanase activity, but does not substantially reduce the activity of other proteases, or at least one protease, meaning substantially less than a 10-fold reduction, usually less than a 5-fold reduction, and in many cases less than a single reduction, the activity being determined as described in Amer et al., (1999) supra. Naturally occurring, or synthetic compounds with small molecules include many chemical classes, although they are typically organic molecules, preferably small organic compounds with a molecular weight of more than 50, and less than about 2,500 daltons. Candidate agents have functional groups that are necessary for the structural interaction with proteins, in particular hydrogen bonding, and typically have at least one amine, carbonyl hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often include cyclic carbon or heterocyclic structures, and / or aromatic or poly-aromatic structures that are substituted with one or more of the above functional chemical groups. Candidate agents also occur among the biomolecules, including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, and derivatives, structural analogs, or combinations thereof.

As active agents, also antibodies of interest are the target MPST, e.g. aggrecanase activity, if not inhibit in the host, then reduce. Suitable antibodies are obtained by immunizing a host animal with peptides comprising all or part of the target protein, e.g. MPTS-15, MPTS-19, or MPTS-120. Suitable host animals include the mouse, rat, sheep, goat, hamster, rabbit, etc. The source of the protein immunogen can be the mouse, human, rat, monkey, etc. The host animal will generally be from a species other than the immunogen, e.g. human MPTS is used for mouse immunization, etc.

The immunogen can be the entire protein, or fragments and derivatives thereof. Preferred immunogens include all or part of MPTS, wherein the residues bearing post-translational modifications as glycosilations are found on the native target protein. Immunogens comprising the extracellular domain are produced in a variety of ways known in the art, e.g. by expression of cloned genes by conventional recombinant methods, isolation from HEC, etc.

For the preparation of polyldonal antibodies, the first step is the immunization of the host animal, the target protein preferably being in substantially pure form, with a contamination of less than about 1%. The immunogen may consist of the entire target protein, fragments or derivatives thereof. To enhance the immune response of the host animal, the target protein can be combined with an adjuvant, wherein suitable adjuvants are alum, dextran, sulfate, large polymer anions, oil & water emulsions, e.g. Freund's adjuvant, Freund's complete adjuvant, and the like. The 1022371 target protein can also be conjugated to synthetic carrier proteins or synthetic antigens. A variety of hosts can be immunized for the production of polyclonal antibodies. Such hosts include rabbits, guinea pigs, rodents, e.g. mice, rats, sheep, goats, and the like. The target protein is usually administered intradermally to the host, followed by one or more, usually at least two, additional booster doses. After immunization, blood can be collected from the host, followed by separation of serum and blood cells. The Ig present in the resulting antiserum must be further fractionated by methods known in the art such as ammonium salt fractionation, DEAE chromatography and the like.

Monoclonal antibodies are prepared by conventional techniques. In general, the spleen, and / or lymph nodes of an immunized host are the source of plasma cells. For production of hybridoma cells, the plasma cells are immortalized by fusion with myeloma cells. The culture supernatant of individual hybridomas is tested by standard techniques to identify those who produce antibodies with the desired specificity. Suitable animals for the production of monoclonal antibodies against the human protein include the mouse, rat, guinea pig, etc. To raise antibodies against the mouse protein, the animal will generally be a hamster, guinea pig rabbit, etc. The antibody can be purified from the culture supernatants or ascites fluid by conventional techniques, e.g. with affinity chromatography with insoluble carrier MPTS, protein A sepharose, etc. It is therefore an object of the invention to provide monoclonal antibodies that specifically bind to MPTS proteins of the present invention, more particularly the antibodies that aggrecanase inhibit activity, and the antibodies that are human or humanized.

The antibody can be produced as a single chain instead of the conventional multimeric structure. Single-chain antibodies are described in Jost et al. (1994) J.B.C. 269: 26267-73., And others. The DNA sequences encoding the variable region of the heavy chain and the variable region of the light chain are ligated to a spacer encoding at least about 4 amino acids of small neutral 31 amino acids, including glycine and / or serine. The protein encoded by this fusion allows assembly of a functionally variable region that has retained the specificity and affinity of the original antibody.

For in vitro use, in particular for injection into humans, it is desirable to reduce the antigenicity of the antibody. An immune response of a recipient to the blocking agent will potentially shorten the time that the therapy is effective. The methods for humanizing antibodies are known in the art. The humanized antibody may be the product of an animal with transgenic human immunoglobulin constant region genes (see, for example, WO 90/10077 and WO 90/04036).

Alternatively, the antibody of interest can be manipulated with recombinant DNA techniques to substitute the CH1, CH2, CH3, hinge domains and / or the framework domain with the corresponding human sequences (see WO 92/02190).

The use of Ig cDNA for the construction of chimeric immunoglobulin genes is known in the art (Liu et al (1987) P.N.A.S. 84: 3439 and (1987) J, Immunol.

15 139: 3521). From a hybridoma or other cell that produces the antibody, mRNA is produced

isolated and used for the production of cDNA. The cDNA in question can be amplified with the polymerase chain reaction with specific primers (U.S. Patent Nos. 4,683,195 and 4,683,202). Alternatively, a gene bank is constructed and tested for the sequence of interest. The sequences of human constant region genes can be found in Kabat et al. (1991) Sequences of Proteins or Immunological Interest.

N.I.H. Publication No. 91-3242. Genes for the human C region are easily obtained from clones. The choice of the iso-type will be determined by the desired effector functions, such as complement fixation or activity in antibody-dependent cellular cytotoxicity. Preferred isotypes are IgG1, IgG3 and IgG4. From the human light chain constant regions, and the kappa or lambda can be used. The chimeric, humanized antibody is then expressed by conventional methods.

In still other embodiments, the antibodies may be fully human antibodies. For example, xenogenic antibodies that are identical to human antibodies 32 can be used. By xenogenic antibodies is meant antibodies corresponding to human antibodies, i.e., they are wholly human antibodies, except that they are produced in a non-human host that has been genetically engineered to express human antibodies, e.g. WO 98/50433; WO 98/24893 5 and WO 99/53049.

Antibody fragments such as Fv, F (ab ') 2 and Fab can be prepared by cleaving the intact protein e.g. by a protease or by chemical cleavage. For example, a chimeric gene encoding a del of the F (ab ') 2 fragment would comprise DNA sequences encoding the CH1 domain and hinge region of the H chain, followed by a translation stop codon, yielding the truncated molecule.

For the construction of oligonucleotides for use as primers for introduction of useful restriction sites in the J region, for subsequent linking of V region segments to the human C region segments, the consensus sequences of H and J regions can be used. C region DNA can be modified by means of plaster-directed mutagenesis to make a restriction site at the analog position in the human sequence.

Expression vectors include plasmids, retroviruses, YACs, episodes from EBV, and the like. A useful vector is one that encodes a functional complete human CH or CL immunoglobulin sequence, with the appropriate restriction sites engineered so that any VH or VL sequence can be easily inserted and expressed. In such vectors, splicing usually takes place between the splice donor site in the introduced J region, and the splice acceptor site that precedes the human C region, and also at the splice regions that occur within the human CH exons. Polyadenylation and transcription termination take place at native chromosomal sites downstream of the coding regions. The resulting chimeric antibody can be coupled to a strong promoter, including the retroviral LTRs, e.g. the SV-40 early promoter (Okayama et al. (1983) Mol. Cell. Bio. 3: 280), Rous sarcoma virus LTR (Gorman el al. (1982) PNAS 79: 6777), and moloney 33 mouse myeloma leukemia virus LTR (Grosschedl et al. (1985) Cell 41: 885): native Ig promoters, etc.

In still other embodiments of the invention, the active agent is an agent that modulates and generally down-regulates the expression of the gene encoding the target protein in the host. For example, antisense molecules can be used to down-regulate the expression of MPTS in cells. The antisense reagent may consist of antisense oligonucleotides (ODN), in particular synthetic ODN, with chemical modifications of native nucleic acids, or nucleic acid constructs that express such an antisense molecule as RNA. The antisense sequence is complementary to the mRNA of the target gene, and inhibits the expression of the target gene products. Antisense molecules inhibit gene expression by various mechanisms, e.g. by reducing the amount of mRNA available for translation, by activating RNAse H, or by steric hindrance. One or a combination of antisense molecules can be administered, wherein a combination can comprise several different sequences.

Antisense molecules can be produced by expression of the whole, or part of, the target gene sequence in an appropriate vector, the translation orientation being oriented such that an antisense strand is produced as an RNA molecule. Alternatively, the antisense molecule can be a synthetic oligonucleotide. Antisense oligonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides in length, and no more than about 500, usually no more than about 50, and more usually no more than 35 nucleotides in length wherein the length is dependent on the inhibition efficiency, specificity, including lack of cross-reactivity, and the like. Short oligonucleotides of 7 to 8 bases in length were found to be strong and selective inhibitors of gene expression (see Wagner et al. (1996), Natural Biotechnol. 14: 840-844).

A specific region of the endogenous sense strand mRNA sequence is selected to be complemented by the antisense sequence. An empirical method can be used to select a specific sequence for the oligonucleotide

; Kf c to o I

34, wherein various candidate sequences are tested for inhibition of the expression of the target gene in an in vitro or animal model. A combination of sequences can also be used, with various regions of the mRNA sequence being selected for antisense compaction.

Antisense oligonucleotides can be chemically synthesized by methods known in the art (see Wagner et al (1993), supra, and Milligan et al., Supra.). Preferred oligonucleotides are chemically modified from the native phosphodiester structure to increase their intracellular stability and binding aphimity. A number of such modifications that alter the chemistry of the skeleton, sugars, or heterocyclic bases have been described in the literature.

Useful changes in skeletal chemistry are phosphorothioates; phosphorithioates, wherein both non-bridging oxygen is replaced by sulfur; phosphoramidites; alkyphosphotristers and borane phosphates. A-chiral phosphate derivatives include 3'-0'-5'-S-phosphorothioate, 3'-S-5'-O-phosphorothioate, 3'-CH2-5'-O-phosphonate and 3'-NH-5 ' -0-15 phosphoramidate. Peptide nucleic acids replace the total ribose phosphodiester skeleton with a peptide bond. Sugar modifications are also applied to improve stability and affinity. The t-anomer of deoxyribose can be used with the base turned over with respect to the natural β-anomer. The 2'-OH of the ribose sugar can be changed to form 2-O-methyl or 2-O-allyl sugars, which gives resistance to degradation, without affecting the affinity. Correct base pairing must be maintained with modifications to the heterocyclic bases. Useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2'-deoxycitidine and 5-bromo-2'-deoxycytidine for deoxycytidine. 5-propynyl-2'-deoxyuridine and 5-propynyl-2'-deoxycytidine have been shown to increase affinity and biological activity upon substitution for deoxythymidine and deoxycytidine, respectively.

As an alternative to anti-sense inhibitors, catalytic nucleic acid compounds, e.g. ribozymes, antisense conjugates, etc. are used to inhibit gene expression. Ribozymes can be synthesized and administered to the patient in vitro, or can be encoded on an expression vector whose ribozyme is synthesized in the target cell (see, for example, International patent application WO 9523225, and Beigelman et al. (1995) Nucl Acids Res. 23: 4434-42) Examples of oligonucleotides with catalytic activity are described in WO 9506764. Conjugates of antisense ODN with a metal complex, e.g. terpyridyl Cu (II), capable of mediating mRNA hydrolysis, is described in Bashkine et al. (1995), Appl. Biochem. Biotechnol. 54: 43-56.

It is therefore an object of the invention to provide a method for modulating the activity of the MPTS in a host, said method comprising: administering an effective amount of an MPTS modulating agent to said host, and more specifically, such a method wherein said modulating agent is a small molecule, an antibody, or a nucleic acid.

As already mentioned above, an effective amount of the active agent is administered to the host, "effective amount" signifying a dose sufficient to achieve a desired result. In general, the desired result is at least a gain or reduction in MPTS, e.g. aggrecanase, activity, as determined from the production of aggrecan cleavage product, as compared to a control.

In the present methods, the active agent (s) can be used with any handy agent capable of resulting in the desired modulation of MPTS activity, e.g. to achieve the desired reduction in the production of aggrecan cleavage product are used. The agent can be incorporated into a variety of formulations for therapeutic administration. More specifically, the agents of the present invention may be formulated in pharmaceutical compositions by combination with the appropriate pharmaceutically acceptable carriers or diluents, and may be formulated in tablets, capsules, powders, in solid, semi-solid, liquid or gaseous forms. granules, ointments, solutions, suppositories, injections, inhalants and aerosols are formulated.

The administration of the agents as such can be by various means, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal, etc. administration.

'·, · 36

In pharmaceutical dosage forms, the agents can be administered in the form of their pharmaceutically acceptable salts, or they can be administered individually, or in the appropriate association, as well as in combination with other pharmaceutically active compounds.

For oral preparations, the agents may be used individually, or in combination with appropriate additives for making tablets, powders, granules or capsules, for example with conventional additives such as lactose, mannitol, corn starch, or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrants such as corn starch, potato starch or sodium carboxymethyl cellulose; with lubricants such as talc, magnesium stearate; and, if desired, diluents, buffering agents, humectants, preservatives, and flavorings.

The agents can be formulated for injection by dissolving, suspending or emulsifying them in an aqueous or non-aqueous solvent such as vegetable or equivalent oils, synthetic aliphatic glycerides, esters or higher aliphatic acids or propylene glycol; and, if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers, and preservatives.

The agents can be administered by inhalation in an aerosol formulation. The compounds of the present invention can be formulated in pressurized propellants such as dichlorodifluoromethane, propane, nitrogen and the like.

In addition, the agents can be made into suppositories by mixing them with an emulsifying base or water-soluble base. The compounds of the present invention can be administered rectally in the form of a suppository. The suppository may include vehicles such as cocoa butter, carbo waxes and polyethylene glycols that melt at body temperature but are solid at room temperature.

Unit dosage forms for oral and rectal administration such as syrups, elixirs and suspensions may be provided, wherein each dosage unit, for example, a teaspoon, tablespoon, tablet or suppository, contains a predetermined amount of the composition containing one or more inhibitors. Similarly, dosage forms for injection or intravenous administration may contain the inhibitors in a composition as a solution in sterile water, physiological salt or another pharmaceutically acceptable carrier.

The term "unit dosage form" as used herein refers to physically discrete units suitable as unit dosage for human and animal individuals, each unit containing a predetermined amount of the compounds of the present invention calculated in an amount sufficient to produce the desired effect, together with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the new unit dosage form of the present invention depend on the specific compound used and the effect that one wants to achieve, and the pharmacodynamics associated with each compound in the host.

Pharmaceutically acceptable excipients such as vehicles, adjuvants, carriers or diluents are readily available to the public. In addition, pharmaceutically acceptable auxiliaries such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like are readily available to the public.

When the agent is a polypeptide, polynucleotide, analog or mimetic thereof, e.g. an anti-sense composition, it can be introduced into tissues or host cells via a number of routes, including by viral infection, micro-injection or vesicle fusion. Jet injection may also be used for intramuscular administration, as described by Furth et al. (1992), Anal. Biochem. 205: 365-368. The DNA can be coated on gold microparticles and administered intradermally with a particle bombing device, or "gene gun," as described in the literature (see, for example, Tang et al. (1992), Nature 356: 152-154), where gold micro -projectile are coated with therapeutic DNA, and then bombarded into cells of the skin.

It will be apparent to those skilled in the art that the amount of the dose may vary as a function of the specific compound, severity of symptoms and the sensitivity of the individual to side effects. Preferred dosages for a given compound can be easily determined by those skilled in the art by a variety of means.

1 ··· <A O i l 38

The present methods find use in the treatment of a variety of disorders involving MPTS activity, including disorders involving the aggrecanase activity. Of particular interest is the use of the present methods in the treatment of conditions characterized by the presence of aggrecan cleavage products, in particular the 60 kDa aggrecan cleavage products with an ARGS N-terminus. Specific diseases characterized by the presence of such methods include: rheumatoid arthritis, osteoarthritis, infectious arthritis, gouty arthritis, psoriatic arthritis, spondolysis, sport injury, joint trauma, lung diseases, fibrosis, and the like.

By treatment, it is meant that at least relief of the symptoms associated with the pathological condition with which the patient is treated occurs, wherein relief in a broad sense is used to refer to at least a reduction in the magnitude of a parameter, e.g. a symptom associated with the pathological state being treated, such as hyperphosphatemia. Treatment as such includes situations in which the pathological condition, or at least the associated symptoms, are completely inhibited, e.g. that they are prevented from occurring or stopped, e.g. terminated so that the host no longer suffers from the pathological condition, or at least from the symptoms characteristic of the pathological condition.

A variety of hosts can be treated with the present methods. In general, such hosts are "mammals" or "mammalian", these terms being widely used to describe organisms that fall within the class of mammals, including the orders of carnivores (eg dogs and cats), rodents (eg the mouse guinea pigs and rats) and primates (eg humans, chimpanzees and monkeys). In many embodiments, the hosts will be people.

Sets of unit doses of the active agent are usually provided, usually in oral or injectable doses. In such sets, in addition to the containers containing the unit doses, a package leaflet will be included that describes the use and benefits of the drug in the treatment of the disease of interest. The preferred compounds and unit doses are as described above.

39

Finally, the object of the present invention is: (i) A test method for the identification of MPTS modulating agents, said method comprising: contacting MPTS proteins as defined herein with a substrate, in the presence of a potential modulating agent ; and determining the effect of said modulating agent on the activity of said protein.

(ii) The method as defined in (i), wherein said substrate contains a glu-ala bond.

(Iii) The method as defined in (ii), wherein said substrate is aggrecane or a fragment thereof.

In addition, an object of the invention is a method of treating a host suffering from a disease associated with the activity of MPTS, specifically the disease characterized by the presence of aggrecan. cleavage products, said method comprising: administering to said host an MPTS modulating agent, specifically an antagonist, and using an MPTS modulating agent, which is available or obtained, using the method described herein for preparing a medicament for the treatment of a syndrome associated with MPTS activity specifically where said syndrome is characterized by the presence of aggrecan cleavage products, such as arthritis.

Examples Example 1

A ranked nucleic acid with 699 known metallo-proteinase genes and new ESTs available in public and commercial databases was constructed. These sequences on the ranking were selected by a search with an initial set of known metallo-protease protein sequences from all species. These protein sequences are in 9 o 7 i 'J λ. L0 640 were used to find corresponding sequences in human nucleotide at the protein (codon) level. Redundant sequences were eliminated and the remaining sequences were assembled and clustered, and the unique sequence of 699 sequences was arranged.

The resulting arrangement was used to test genes expressed in primary cultures of chondrocyte. A reasonable number of metallo-proteinases, known to be expressed by these cells, were identified. However, a number of ESTs for new proteins were also identified. With these ESTs, four different MPTS proteins, i.e., MPTS15, MPTS10, MPTS19, MPTS20, were then identified by examining databases and in PCR protocols.

Example 2

MPTS-10 expression

The COS-7 mammalian cell system is an example of a system for expressing mpts-10. The nucleotide sequence encoding mpts-10, including the secretion signal sequence, was ligated into a pcDNA3.1 plasmid (In Vitrogen, Carlsbad, CA, USA). 2 micrograms of the resulting plasmid was combined with lipofectamine (Life Technologies, Rockville, MD, USA). The mixture was then added to COS-7 cells that had grown to a density of about 90% confluence in 6-well plates. After 6 hours, fresh medium was added to the cells, and after 24 hours, the cells were rinsed and fresh, serum-free medium with bovine aggrecan (0.1 mg / ml, Sigma, St. Louis, MO) was added. The cells were incubated for a further 48 hours. 500 microliters of culture fluid was taken from each well and concentrated 10-fold. Two microliters of chondroitininase ABC and keratinase (10 µl / ml, Sigma, St. Louis, MO, USA) were added to the samples, and incubated overnight at 37 ° C. The samples were boiled in SDS-PAGE loading buffer, electrophoresed on a polyacrylamide gel, and transferred to a PVDF membrane. A Western blot with an anti-neo-epitope antiserum generated by aggrecan cleavage by aggrecanase was performed.

(i i »41

Another example of a mpts-10 expression system is the baculovirus expression system. The DNA sequence containing the coding sequence for mpts-10 (including the sequences coding for the secretion signal sequence) and cloned into the pcDNA3.1 vector was modified by PCR such that the coding sequence and the translation stop codon were flanked by Not-1 (N-terminal side) and Sfi-1 (C-terminal side). The primer used for the N-terminal end was GATCGCGGCCGCTATGGTGGACACGTGGCCTCTATGGCTCC, and the primer used for the C-terminal end was TGAGGCCTTCAGGGCCGATCACTGTGCAGAGCACTCACCCCAT. The digested fragment was ligated into vector pVL1392-U, which was also digested with Not 1 and Sfi-1. PVL1392-U is a derivative of the baculoviral transfer plasmid pVL1392 (PharMingen, San Diego, CA USA) in which the multiple cloning site was modified to contain Not-1 and Sfi-1. The overhanging ends generated by digestion with Not 1 and Sfi 1 were complementary to the overhanging ends of PCR amplified DNA digested with Not 1 and Sfi 1. The ligated DNA was transferred to bacterial cells and a clone was selected containing the plasmid and the correct mpts sequence. The plasmid was produced and purified. The mpts-10 sequence was standardized using techniques (Baculovirus Expression Vectors: A Laboratory Manual from David O'Reilly, Lois Miller and

Verne Luckow, W.H. Freeman and Co., New York, USA) transferred to a baculovirus vector. Five plaques of purified virus preparations were prepared from the vims preparation. Suspended Sf9 cells were infected with each of the plaque-purified virus preparations, with a multiplicity of 0.5. The culture fluid was harvested three days after infection. The samples were incubated with bovine aggrecan (Sigma,

St. Louis, MO, USA) for aggrecanase activity tested at a concentration of 0.1 mg / ml. The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with a 42 antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

Another method for expressing mpts-10 was the drosophila expression system. The DNA fragment containing the sequences encoding the mpts-10, flanked by Not-1 and Sfi-1 generated by PCR (see above), was cloned into plasmid Cmk 33. Cmk33 is a plasmid derived from pMK33 / pMtHγ (Li, Bin et al Biochem J (1996) 313, 57-64) such that Not-1 and Sfi-1 are located at the cloning site. The overhanging ends that were created by digesting this plasmid are compatible with the overhanging ends that were created in the digested DNA containing the mpts-10 fragment (see above). A plasmid containing the correct sequence of mpts-10 was amplified and purified. With standard techniques (Li, Bin et al. Biochem J (1996) 313, 57-64), Drosophila (S2) cells were transformed with the plasmid. The samples were tested for aggrecanase activity after incubating with bovine aggrecan (Sigma, St. Louis, MO, USA) at a concentration of 0.1 mg / ml. The culture fluid was recovered 2 days after infection. The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

20

Example 3

MPTS-15 expression

The COS-7 mammalian cell system is an example of a system for expressing mpts-15. The nucleotide sequence encoding mpts-15, including the secretion signal sequence, was ligated into a pcDNA3.1 plasmid (In Vitrogen, Carlsbad, CA, USA). 2 micrograms of the resulting plasmid was combined with lipofectamine (Life Technologies, Rockville, MD, USA). The mixture was then added to COS-7 cells that had grown in 6 well plates to a density of about 90% confluence. After 6 hours, fresh medium was added to the cells, and after 24 hours the cells were rinsed and fresh, serum-free medium with bovine aggrccane (0.1 mg / ml, Sigma, St. Louis, MO ) added. The cells were incubated for a further 48 hours. 500 microliters of culture fluid was taken from each well and concentrated 10-fold. Two microliters of chondroitininase ABC and keratinase (10 µl / ml, Sigma, St. Louis, MO, USA) were added to the samples, and incubated overnight at 37 ° C. The samples were boiled in SDS-PAGE loading buffer, electrophoresed on a polyacrylamide gel, and transferred to a PVDF membrane. A Western blot with an anti-neo-epitope antiserum generated upon aggrccane cleavage by aggrecanase was performed.

Another example of a mpts-15 expression system is the baculovirus expression system. The DNA sequence containing the coding sequence for mpts-15 (including the sequences coding for the secretion signal sequence) and cloned into the pcDNA3.1 vector was modified by PCR such that the coding sequence and the translation stop codon were flanked by Not-1 (N-15 terminal side) and Sfi-1 (C-terminal side). The primer used for the N-terminal end was GATCGCGGCCGCTATGGAAATTTTGTGGAAGACGTTG, and the primer used for the C-terminal end was TGAGGCCTTCAGGGCCGATCTTAAAGCAAAGTTTCTTTTGGT. After amplification by standard PCR methods, the fragment was digested with Not 1 and Sfc-1. The digested fragment was ligated into pVL1392-U vector, which was also digested with Not 1 and Sfi-1. PVL1392-U is a derivative of the baculoviral transfer plasmid pVL1392 (PharMingen, San Diego, CA USA) in which the multiple cloning site was modified to contain Not-1 and Sfi-1. The overhanging ends generated by digestion with Not 1 and Sfi 1 were complementary to the overhanging ends of PCR amplified DNA digested with Not 1 and Sfi 1. The ligated DNA was transferred to bacterial cells and a clone was selected that contained the plasmid and the correct mpts sequence. The plasmid was produced and purified. The mpts-15 sequence was made using standard techniques (Baculovirus Expression Vectors: A Laboratory Manual by David O'Reilly, Lois Miller and "; i". I [44

Veme Luckow, W.H. Freeman and Co., New York, USA) transferred to a baculovirus vector. Five plaques of purified virus preparations were prepared from the virus preparation. Suspended Sf9 cells were infected with each of the plaque-purified virus preparations, with a multiplicity of 0.5. The culture fluid was harvested three days after infection. The samples were tested for aggrecanase activity at a concentration of 0.1 mg / ml after incubation with bovine aggrecan (Sigma, St. Louis, MO, USA). The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

Another method for expressing mpts-15 was the drosophila expression system. The DNA fragment containing the sequences encoding the mpts-15 flanked by Not-1 and Sfi-1 generated by PCR (see above) was cloned into plasmid Cmk 33. Cmk33 is a plasmid derived from pMK33 / pMtHy (Li, Bin et al Biochem J (1996) 313, 57-64), such that Not-1 and Sfi-1 are located at the cloning site. The overhanging ends that were generated by digestion of this plasmid are compatible with the overhanging ends that were formed in the digested DNA containing the mpts-15 fragment (see above). A plasmid containing the correct sequence of mpts-15 was amplified and purified. With standard techniques (Li, Bin et al. Biochem J (1996) 313, 57-64), Drosophila (S2) cells were transformed with the plasmid. The culture fluid was recovered 2 days after infection. The samples were tested for aggrecanase activity after incubation with bovine aggrecan (Sigma, St. Louis, MO, USA) at a concentration of 0.1 mg / ml. The samples were incubated overnight at 37 ° C with chondroitinase ABC ai keratinase (10 h / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope resulting from cleavage of the aggrecan by agrecanase.

i! . · - ·.

II \ j / 45

Example 4

MPTS-19 expression

The COS-7 mammalian cell system is an example of a system for expressing mpts-1 (). The nucleotide sequence encoding mpts-1 (J, including the secretion signal sequence, was ligated into a pcDNA3.1 plasmid (In Vitrogen, Carlsbad, CA, USA). Of the resulting plasmid, 2 micrograms were combined with lipofectamine (Life Technologies, Rockville, MD, USA) The mixture was then added to COS-7 cells that had grown to a density of about 90% confluence in 6-well plates After 6 hours, fresh medium was added to the cells and after 24 hours Cells were rinsed and fresh, serum-free bovine aggrecan medium (0.1 mg / ml, Sigma, St. Louis, MO) was added The cells were incubated for a further 48 hours, 500 microliter of culture fluid was taken from each well and 10-fold concentrated, two microliters of chondroitininase ABC and keratinase (10 µl / ml, Sigma, St. Louis, MO, USA) were added to the samples, and incubated overnight at 37 ° C. The samples were incubated in SDS -PAGE loading buffer cooked, electrophoresed on a polyacr ylamide gel, and transferred to a PVDF membrane. A Western blot with an anti-neo-epitope antiserum generated upon aggrecan cleavage by aggrecanase was performed.

Another example of a system for expression of mpts-19 is the baculovirus expression system. The DNA sequence containing the coding sequence for mpts-19 (including the sequences coding for the secretion signal sequence) and cloned into the pcDNA3.1 vector was modified by PCR such that the coding sequence and the translation stop codon were flanked by Not-1 (N-25 terminal side) and Sfi-1 (C-terminal side). The primer used for the N-terminal end was GATCGCGGCCGCTATGCCCGGCGGCCCCAGTCCCCG. and the primer used for the C-terminal end was TGAGGCCTTCAGGGCCGATCTCAGCGGCGGGCAACCCGCTG After amplification by standard PCR methods, the fragment was digested with Not 1 and Sfc-1. The fragment digested was vectored in pVL1392-U vector, which was also digested with Not 1 and Sfi-1. PVL1392-U is a derivative of the baculoviral transfer plasmid pVL1392 (PharMingen, San Diego, CA USA) in which the multiple cloning site was modified to contain Not-1 and Sfi-1. The overhanging ends generated by digestion with Not 1 and Sfi 1 were complementary to the overhanging ends of Not 1 and Sfi 1 PCR digested PCR amplified DNA. The ligated DNA was transferred to bacterial cells and a clone was selected containing the plasmid and the correct mpts-19 sequence. The plasmid was produced and purified. The mpts-19 sequence was standardized using 10 techniques (Baculovirus Expression Vectors: A Laboratory Manual by David O'Reilly, Lois Miller and

Veme Luckow, W.H. Freeman and Co., New York, USA) transferred to a baculovirus vector. Five plaques of purified virus preparations were prepared from the virus preparation. Suspended Sf9 cells were infected with each of the plaque-purified virus preparations, with a multiplicity of 0.5. The culture fluid was harvested three days after infection. The samples were incubated with bovine aggrecan (Sigma,

St. Louis, MO, USA) for aggrecanase activity tested at a concentration of 0.1 mg / ml. The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

Another method for expressing mpts-19 was the drosophila expression system. the DNA fragment containing the sequences encoding the mpts-19 flanked by Not-1 and Sfi-1 generated by PCR (see above) was cloned into plasmid Cmk 33. Cmk33 is a plasmid derived from pMK33 / pMfHγ (Li, Bin et al Biochem J (1996) 313, 57-64) such that Not-1 and Sfi-1 are located at the cloning site. The overhanging ends that were generated by digestion of this plasmid are compatible with the overhanging ends that were generated in the digested DNA containing the mpts-19 fragment (see above). A plasmid containing the correct sequence of mpts-19 was amplified and purified.

47

With standard techniques (Li, Bin et al. Biochem J (1996) 313, 57-64), Drosophila (S2) cells were transformed with the plasmid. The culture fluid was recovered 2 days after infection. The samples were tested for aggrecanase activity after incubation with bovine aggrecan (Sigma, St. Louis, MO, USA) at a concentration of 0.1 mg / ml. The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

Example 5

MPTS-20 expression

The COS-7 mammalian cell system is an example of a system for expressing mpts-20. The nucleotide sequence encoding mpts-10, including the secretion signal sequence, was ligated into a pcDNA3.1 plasmid (In Vitrogen, Carlsbad, CA, USA). 2 micrograms of the resulting plasmid was combined with lipofectamine (Life Technologies, Rockville, MD, USA). The mixture was then added to COS-7 cells that had grown to a density of about 90% confluence in 6-well plates. After 6 hours, fresh medium was added to the cells, and after 24 hours, the cells were rinsed and fresh, serum-free medium with bovine aggrecan (0.1 mg / ml, Sigma, St. Louis, MO) was added. The cells were incubated for a further 48 hours. 500 microliters of culture fluid was taken from each well and concentrated 10-fold. Two microliters of chondroitininase ABC and keratinase (10 µl / ml, Sigma, St. Louis, MO, USA) were added to the samples, and incubated overnight at 37 ° C. The samples were boiled in SDS-PAGE loading buffer, electrophoresed on a polyacrylamide gel, and transferred to a PVDF membrane. A Western blot with an anti-neo-epitope antiserum generated upon aggrecan cleavage by aggrecanase was performed.

Another example of a mpts-20 expression system is the baculovirus expression system. The DNA sequence that contained the coding sequence for mpts-20; 48 (including the sequences encoding the secretion signal sequence) and cloned into the pcDNA3.1 vector, was modified by PCR such that the coding sequence and the translation stop codon were flanked by Not-1 (N-terminal side) ) and Sfi-1 (C-terminal side). The primer used for the N-terminal end was GATCGCGGCCGCTGCGCTGTGATGAGTGTGCCTG, and the primer used for the C-terminal end was TGAGGCCTTCAGGGCCGATCTTATAAAGGCCTTGAGAAAACAG. The digested fragment was ligated into vector pVL1392-U, which was also digested with Not 1 and Sfi-1. PVL1392-U is a derivative of the baculoviral transfer plasmid pVL1392 (PharMingen, San Diego, CA USA) in which the multiple cloning site was modified to contain Not-1 and Sfi-1. The overhanging ends that were generated by digestion with Not 1 and Sfi 1 were complementary to the overhanging ends of PCR amplified DNA digested with Not 1 and Sfi 1.

The ligated DNA was transferred to bacterial cells and a clone was selected containing the plasmid and the correct mpts sequence. The plasmid was produced and purified. The mpts-20 sequence was transferred to a baculovirus vector using standard techniques (Baculovirus Expression Vectors: A Laboratory Manual from David O'Reilly, Lois Miller and Veme Luckow, W. H. Freeman and Co., New York, USA). Five plaques of purified virus preparations were prepared from the virus preparation. Suspended Sf9 cells were infected with each of the plaque-purified virus preparations, with a multiplicity of 0.5. The culture fluid was harvested three days after infection. The samples were tested for aggrecanase activity at a concentration of 0.1 mg / ml after incubation with bovine aggrecan (Sigma, St. Louis, MO, USA). The 25 samples were incubated overnight at 37 ° C with chondroitinase ABC and keratinase (10 u / ml). The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

1022371 49

Another method for expressing mpts-20 was the drosophila expression system. the DNA fragment representing the sequences encoding the mpts-20. flanked by Not-1 and containing Sfi-1 generated by PCR (see above) was cloned into plasmid Cmk 33. Cmk33 is a plasmid derived from pMK33 / pMtHy (Li, Bin et al. Biochem J (1996) 313, 57-64), such that Not-1 and Sfi-1 are at the cloning site. The overhanging ends that were generated by digestion of this plasmid are compatible with the overhanging ends that were created in the digested DNA containing the mpts-10 fragment (see above). A plasmid containing the correct sequence of mpts-10 was amplified and purified.

With standard techniques (Li, Bin et al. Biochem J (1996) 313, 57-64), Drosophila (S2) cells were transformed with the plasmid. The culture fluid was recovered 2 days after infection. The samples were tested for aggrecanase activity at a concentration of 0.1 mg / ml after incubation with bovine aggrecan (Sigma, St. Louis, MO, USA). The samples were incubated overnight at 37 ° C with chondroitininase ABC and keratinase (10 h / ml).

The samples were then tested by Western blotting with an antibody that reacts with a neo-epitope caused by cleavage of the aggrecan by agrecanase.

Example 6 Purification of MPT-10. 15. 19 and 20:

Mpts-10, 15, 19 and 20 were purified from the culture fluid of the expression systems using the above chromatographic procedures. For example, the culture fluid was adjusted with respect to pH, filtered, and then placed on a column packed with sulfopropyl sepharose FF (Amersham-Pharmacia Biotech, Puscataway, NJ, USA). After washing with a buffer consisting of 10 mM CaCl 2, 0.1 M NaCl, and 0.05%

Mash 35 at a pH resulting in retention of the mpts on the column eluted with a 0.1 M to 1.0 M NaCl gradient. The fractions from the column were tested for the presence of aggrecanase activity as described above and recorded. A column with phenylsepharose or Sephacryl S-200 can also be used for the purification.

50

SEQUENTLIST

<110> Hoffman-La Roche AG

<· * · <120> New Metailo proteases with thrombospondin domain ring nucleic acid compositions encoding them.

<130> 20594 <150> 60 / 184,152 10 <151> 18-02-2000 <160> 10 <170> FastSEQ for Windows Version 4.0 15 <210> 1 <211> 959 <212> PRT <213> human <220> <223> Xaa on 909 can be any amino acid <223> Xaa on 921 can be any amino acid <223> Xaa on 928 can be any amino acid 25 <223> Xaa can be any amino acid 51 <400> 1

With Glu lie Leu Trp Lys Thr Leu Thr Trp He Leu Ser Leu lie With 15 10 15

Ala Ser Ser Glu Phe His Ser Asp His Arg Leu Ser Tyr Ser Ser Gin 5 20 25 30

Glu Glu Phe Leu Thr Tyr Leu Glu His Tyr Gin Leu Thr He Pro He 35 40 45

Arg Val Asp Gin Asn Gly Ala Phe Leu Ser Phe Thr Val Lys Asn Asp 50 55 60 10 Lys His Ser Arg Arg Arg Arg Ser With Asp Pro lie Asp Pro Gin Gin 65 70 75 80

Ala Val Ser Lys Leu Phe Phe Lys Leu Ser Ala Tyr Gly Lys His Phe 85 90 95

His Leu Asn Leu Thr Leu Asn Thr Asp Phe Val Ser Lys His Phe Thr 15 100 105 110

Val Glu Tyr Trp Gly Lys Asp Gly Pro Gin Trp Lys His Asp Phe Leu 115 120 125

Asp Asn Cys His Tyr Thr Gly Tyr Leu Gin Asp Gin Arg Ser Thr Thr 130 135 140 20 Lys Val Ala Leu Ser Asn Cys Val Gly Leu His Gly Val He Ala Thr 145 150 155 160

Glu Asp Glu Glu Tyr Phe He Glu Pro Leu Lys Asn Thr Thr Glu Asp 165 170 175

Ser Lys His Phe Ser Tyr Glu Asn Gly His Pro His Val He Tyr Lys 25 180 185 190

Lys Ser Ala Leu Gin Gin Arg His Leu Tyr Asp His Ser His Cys Gly 195 200 205

Val Ser Asp Phe Thr Arg Ser Gly Lys Pro Trp Trp Leu Asn Asp Thr 210 215 220 30 Ser Thr Val Ser Tyr Ser Leu Pro He Asn Asn Thr His He His 225 230 235 240

Arg Gin Lys Arg Ser Val Ser He Glu Arg Phe Val Glu Thr Leu Val 245 250 255

Val Ala Asp Lys With With Val Gly Tyr His Gly Arg Lys Asp He Glu 35 260 265 270

His Tyr He Leu Ser Val With Asn He Val Ala Lys Leu Tyr Arg Asp 275 280 285

Ser Ser Leu Gly Asn Val Val Asn lie lie Val Ala Arg Leu He Val 290 295 300 1 0 223 71 52

Leu Thr Glu Asp Gin Pro Asn Leu Glu He Asn His His Ala Asp Lys 305 310 315 320

Ser Leu Asp Ser Phe Cys Lys Trp Gin Lys Ser lie Leu Ser His Gin 325 330 335 5 Ser Asp Gly Asn Thr lie Pro Glu Asn Gly He Ala His His Asp Asn 340 345 350

Ala Val Leu He Thr Arg Tyr Asp He Cys Thr Tyr Lys Asn Lys Pro 355 360 365

Cys Gly Thr Leu Gly Leu Ala Ser Val Ala Gly With Cys Glu Pro Glu 10 370 375 380

Arg Ser Cys Ser lie Asn Glu Asp He Gly Leu Gly Ser Ala Phe Thr 385 390 395 400 lie Ala His Glu lie Gly His Asn Phe Gly With Asn His Asp Gly lie 405 410 415 15 Gly Asn Ser Cys Gly Thr Lys Gly His Glu Ala Ala Lys Leu With Ala 420 425 430

Ala His He Thr Ala Asn Thr Asn Pro Phe Ser Trp Ser Ala Cys Ser 435 440 445

Arg Asp Tyr He Thr Ser Phe Leu Asp Ser Gly Arg Gly Thr Cys Leu 20 450 455 460

Asp Asn Glu Pro Pro Lys Arg Asp Phe Leu Tyr Pro Ala Val Ala Pro 465 470 475 480

Gly Gin Val Tyr Asp Ala Asp Glu Gin Cys Arg Phe Gin Tyr Gly Ala 485 490 495 25 Thr Ser Arg Gin Cys Lys Tyr Gly Glu Val Cys Arg Glu Leu Trp Cys 500 505 510

Leu Ser Lys Ser Asn Arg Cys Val Thr Asn Ser Pro Ala Ala Glu 515 520 525

Gly Thr Leu Cys Gin Thr Gly Asn lie Glu Lys Gly Trp Cys Tyr Gin 30 530 535 540

Gly Asp Cys Val Pro Phe Gly Thr Trp Pro Gin Series Asp Gly Gly 345 550 555 560

Trp Gly Pro Trp Ser Leu Trp Gly Glu Cys Ser Arg Thr Cys Gly Gly 565 570 575 35 Gly Val Ser Ser Ser Leu Arg His Cys Asp Ser Pro Ala Pro Ser Gly 580 585 590

Gly Gly Lys Tyr Cys Leu Gly Glu Arg Lys Arg Tyr Arg Ser Cys Asn 595 600 605

Thr Asp Pro Cys Pro Leu Gly Ser Arg Asp Phe Arg Glu Lys Gin Cys 40 610 615 620

YOU

53

Ala Asp Phe Asp Asn With Pro Phe Arg Gly Lys Tyr Tyr Asn Trp Lys 625 630 635 640

Pro Tyr Thr Gly Gly Gly Val Lys Pro Cys Ala Leu Asn Cys Leu Ala 645 650 655 5 Glu Gly Tyr Asn Phe Tyr Thr Glu Arg Ala Pro Ala Val lie Asp Gly 660 665 670

Thr Gin Cys Asn Ala Asp Ser Leu Asp lie Cys lie Asn Gly Glu Cys 675 680 685

Lys His Val Gly Cys Asp Asn lie Leu Gly Ser Asp Ala Arg Glu Asp 10 690 695 700

Arg Cys Arg Val Cys Gly Gly Asp Gly Ser Thr Cys Asp Ala He Glu 705 710 715 720

Gly Phe Phe Asn Asp Ser Leu Pro Arg Gly Gly Tyr With Glu Val Val 725 730 735 15 Gin lie Pro Arg Gly Ser Val His lie Glu Val Arg Glu Val Ala With 740 745 750

Ser Lys Asn Tyr. He Ala Leu Lys Ser Glu Gly Asp Asp Tyr Tyr He 755 760 765

Asn Gly Ala Trp Thr He Asp Trp Pro Arg Lys Phe Asp Val Ala Gly 20 770 775 780

Thr Ala Phe His Tyr Lys Arg Pro Thr Asp Glu Pro Glu Ser Leu Glu 785 790 795 800

Ala Leu Gly Pro Thr Ser Glu Asn Leu He Val With Val Leu Leu Gin 805 810 815 25 Glu Gin Asn Leu Gly He Arg Tyr Lys Phe Asn Val Pro lie Thr Arg 820 825 830

Thr Gly Ser Gly Asp Asn Glu Fall Gly Phe Thr Trp Asn His Gin Ser 835 840 845

Trp Ser Glu Cys Ser Ala Thr Cys Ala Gly Gly Lys With Pro Thr Arg 30 850 855 860

Gin Pro Thr Gin Arg Ala Arg Trp Arg Thr Lys His He Leu Ser Tyr 865 870 875 880

Ala Leu Cys Leu Leu Lys Lys Leu He Gly Asn lie Ser Cys Arg Phe 885 890 895 35 Ala Ser Ser Cys Asn Leu Pro Lys Glu Thr Leu Xaa Leu Tyr Tyr 900 905 910

He Pro Phe Val Phe Asn Leu With Xaa Phe Val Gin He Cys Trp Xaa 915 920 925

Asn Thr Ser Trp His Asn Glu Cys Leu Cys Trp Cys Phe Ser Gin Asp 40 930 935 940 | j I i i

"J \ d-C *. V. I

54

Tyr Leu Glu Gly Gly Leu Phe Ala Phe Arg Glu His He Leu Gly 945 950 955 <210> 2 5 <211> 2879

<212> DNA

<213> human <400> 2 10 atggaaattt tgtggaagac gttgacctgg attttgagcc tcatcatggc ttcatcggaa 60 tttcatagtg accacaggct ttcatacagt tctcaagagg aattcctgac tcatcttgaa 120 cactaccagc taactattcc aataagggtt gatcaaaatg gagcatttct cagctttact 15 iso gtgaaaaatg ataaacactc aaggagaaga cggagtatgg accctattga tccacagcag 240 gcagtatcta agttattttt taaactttca gcctatggca agcactttca tctaaacttg 300 20 actctcaaca cagattttgt gtccaaacat tttacagtag aatattgggg gaaagatgga 360 ccccagtgga aacatgattt tttagacaac tgtcattaca caggatattt gcaagatcaa 420 cgtagtacaa ctaaagtggc tttaagcaac tgtgttgggt tgcatggtgttattgctaca 25480 gaagatgaag agtattttat cgaaccttta aagaatacca cagaggattc caagcatttt 540 agttatgaaa atggccaccc tcatgttatt tacaaaaagt ctgcccttca acaacgacat 600 30 ctgtatgatc actctcattg tggggtttcg gatttcacaa gaagtggcaa accttggtgg 660 ctgaatgaca catccactgt ttcttattca ctaccaatta acaacacaca tatccaccac 720 agacagaaga gatcagtgag cattgaacgg tttgtggaga cattggtagt ggcagacaaa 35 780 atgatggtgg gctaccatgg ccgcaaagac attgaacatt acattttga g tgtgatgaat 840 attgttgcca aactttaccg tgattccagc ctaggaaacg ttgtgaatat tatagtggcc 900 1022371 55 cgcttaattg ttctcacaga agatcagcca aacttggaga taaaccacca tgcagacaag 960 tccctcgata gcttctgtaa atggcagaaa tccattctct cccaccaaag tgatggaaac 1020 5 accattccag aaaatgggat tgcccaccac gataatgcag ttcttattac tagatatgat 1080 atctgcactt ataaaaataa gccctgtgga acactgggct tggcctctgt ggctggaatg 1140 tgtgagcctg aaaggagctg cagcattaat gaagacattg gcctgggttc agcttttacc 10 1200 attgcacatg agattggtca caattttggt atgaaccatg atggaattgg aaattcttgt 1260 gggacgaaag gtcatgaagc agcaaaactt atggcagctc acattactgc gaataccaat 1320 15 cctttttcct ggtctgcttg cagtcgagac tacatcacca gctttctaga ttcaggccgt 1380 ggtacttgcc ttgataatga gcctcccaag cgtgactttc tttatccagc tgtggcccca 1440 ggtcaggtgt atgatgctga tgagcaatgt cgtttccagt atggagcaac ctcccgccaa.

20 1500 tgtaaatatg gggaagtgtg tagagagctc tggtgtctca gcaaaagcaa ccgctgtgtc 1560 accaacagta ttccagcagc tgaggggaca ctgtgtcaaa ctgggaatat tgaaaaaggg 1620 25 tggtgCtatc agggagattg tgttcctttt ggcacttggc cccagagcat agatgggggc 1680 tggggtccct ggtcactatg gggagagtgc agcaggacct gcgggggagg cgtctcctca 1740 tccctaagac actgtgacag tccagcacct tcaggaggtg gaaaatattg ccttggggaa 30 1800 aggaaacggt atcgctcctg taacacagat ccatgccctt tgggtccccg agattttcga 1860 gagaaacagt gtgcagactt tgacaatatg cctttccgag gaaagtatta taactggaaa 1920 35 ccctatactg gaggtggggt aaaaccttgt gcattaaact gcttggctga aggttataat 1980 ttctacactg aacgtgctcc tgcggtgatc gatgggaccc agtgcaatgc ggattcactg 2040 gatatctgca tcaatggaga atgcaagcac gtaggctgtg ataatatttt gggatctgat 40 2100 'f! i · ;. .4 'J (! 56 gctagggaag atagatgtcg agtctgtgga ggggacggaa gcacatgtga tgccattgaa 2160 gggttcttca atgattcact gcccagggga ggctacatgg aagtggtgca gataccaaga 2220 5 ggctctgttc acattgaagt tagagaagtt gccatgtcaa agaactatat tgctttaaaa 2280 tctgaaggag atgattacta tattaatggt gcctggacta ttgactggcc taggaaattt 2340 gatgttgctg ggacagcttt tcattacaag agaccaactg atgaaccaga atccttggaa 10 2400 gctctaggtc ctacctcaga aaatctcatc gtcatggttc tgcttcaaga acagaatttg 2460 ggaattaggt ataagttcaa tgttcccatc actcgaactg gcagtggaga taatgaagtt 2520 15 ggctttacat ggaatcatca gtcttggtca gaatgctcag ctacttgtgc tggaggtaag 2580 atgcccacta ggcagcccac ccagagggca agatggagaa caaaacacat tctgagctat 2640 gctttgtgtt tgttaaaaaa gctaattgga aacatttctt gcaggtttgc ttcaagctgt 20 2700 aatttaccaa aagaaacttt gctttaatta tattatattc catttgtttt caacctcatg 2760 taatttgtgc agatttgttg gtaaaataca tcttggcaca atgagtgtct ctgctggtgc 2820 25 ttctcccaag actatcttga aggtgggctg tttgcctttc gtgaacacat tcttggtat 2879 <210> 3

<211> 947 30 <212> PRT

<213> human <400> 3

With Ala Pro Ala Cys Gin lie Leu Arg Trp Ala Leu Ala Leu Gly Leu 35 1 5 10 15

Gly Leu With Phe Glu Val Thr His Ala Phe Arg Ser Gin Asp Glu Phe 20 25 30

Leu Ser Ser Leu Glu Ser Tyr Glu He Ala Phe Pro Thr Arg Val Asp 35 40 45

UJs, 57

His Asn Gly Ala Leu Leu Ala Phe Ser Pro Pro Pro Pro Arg Arg Gin 50 55 60

Arg Arg Gly Thr Gly Ala Thr Ala Glu Ser Arg Leu Phe Tyr Lys Val 65 70 75 80 5 Ala Ser Pro Ser Thr His Phe Leu Leu Asn Leu Thr Arg Ser Ser Arg 85 90 95

Leu Leu Ala Gly His Val Ser Val Glu Tyr Trp Thr Arg Glu Gly Leu 100 105 110

Ala Trp Gin Arg Ala Ala Arg Pro His Cys Leu Tyr Ala Gly His Leu 10 115 120 125

Gin Gly Gin Ala Ser Ser His Val Ala lie Ser Thr Cys Gly Gly 130 135 140

Leu His Gly Leu lie Val Ala Asp Glu Glu Glu Tyr Leu lie Glu Pro 145 150 155 160 15 Leu His Gly Gly Pro Lys Gly Ser Arg Ser Pro Glu Glu Ser Gly Pro 165 170 175

His Val Val Tyr Lys Arg Ser Ser Leu Arg His Pro His Leu Asp Thr 180 185 190

Ala Cys Gly Val Arg Asp Glu Lys Pro Trp Lys Gly Arg Pro Trp Trp 20 195 200 205

Leu Arg Thr Leu Lys Pro Pro Ala Arg Pro Leu Gly Asn Glu Thr 210 215 220

Glu Arg Gly Gin Pro Gly Leu Lys Arg Ser Val Ser Arg Glu Arg Tyr 225 230 235 240 25 Val Glu Thr Leu Val Val Ala Asp Lys With With Val Ala Tyr His Gly 245 250 255

Arg Arg Asp Val Glu Gin Tyr Val Leu Ala He With Asn lie Val Ala 260 265 270

Lys Leu Phe Gin Asp Ser Ser Leu Gly Ser Thr Val Asn He Leu Val 30 275 280 285 '

Thr Arg Leu He Leu Leu Thr Glu Asp Gin Pro Thr Leu Glu He Thr 290 295 300

His His Ala Gly Lys Ser Leu Asp Ser Phe Cys Lys Trp Gin Lys Ser 305 310 315 320 35 He Val Asn His Ser Gly His Gly Asn Ala He Pro Glu Asn Gly Val 325 330 335

Ala Asn His Asp Thr Ala Val Leu lie Thr Arg Tyr Asp He Cys lie 340 345 350

Tyr Lys Asn Lys Pro Cys Gly Thr Leu Gly Leu Ala Pro Val Gly Gly 40 355 360 365 1022371 58

With Cys Glu Arg Glu Arg Ser Cys Ser Val Asn Glu Asp He Gly Leu 370 375 380

Ala Thr Ala Phe Thr lie Ala His Glu lie Gly His Thr Phe Gly With 385 390 395 400 5 Asn His Asp Gly Val Gly Asn Ser Cys Gly Ala Arg Gly Gin Asp Pro 405 410 415

Ala Lys Leu With Ala Ala His He Thr With Lys Thr Asn Pro Phe Val 420 425 430

Trp Ser Ser Cys Ser Arg Asp Tyrlie Thr Ser Phe Leu Asp Ser Gly 10 435 440 445

Leu Gly Leu Cys Leu Asn Asn Arg Pro Pro Arg Gin Asp Phe Val Tyr 450 455 460

Pro Thr Val Ala Pro Gly Gin Ala Tyr Asp Ala Asp Glu Gin Cys Arg 465 470 475 480 15 Phe Gin His Gly Val Lys Ser Arg Gly Leu Gin Arg Ala Val Val Ser 485 490 495

Glu Gin Glu Gin Pro Val His His Gin Gin His Pro Gly Arg Arg Gly 500 505 510

His Ala Val Pro Asp Ala His His Arg Gin Gly Val Val Leu Gin Thr 20 515 520 525

Gly Leu Cys Pro Leu Trp Val Ala Pro Arg Gly Cys Gly Arg Ser Leu 530 535 540

Gly Ala Val Asp Ser With Gly Asp Cys Ser Arg Thr Cys Gly Gly Gly 545 550 555 560 25 Val Ser Ser Ser Ser His Cys Asp Ser Pro Arg Pro Thr lie Gly 565 570 575

Gly Lys Tyr Cys Leu Gly Glu Arg Arg Arg His Arg Ser Cys Asn Thr 580 585 590

Asp Asp Cys Pro Pro Gly Ser Gin Asp Phe Arg Glu Val Gin Cys Ser 30 595 600 605 '

Glu Phe Asp Series Pro Phe Arg Gly Lys Phe Tyr Lys Trp Lys Thr 610 615 620

Tyr Arg Gly Gly Gly Val Lys Ala Cys Ser Leu Thr Cys Leu Ala Glu 625 630 635 640 35 Gly Phe Asn Phe Tyr Thr Glu Arg Ala Ala Ala Val Val Asp Gly Thr 645 650 655

Pro Cys Arg Pro Asp Thr Val Asplie Cys Val Ser Gly Glu Cys Lys 660 665 670

His Val Gly Cys Asp Arg Val Leu Gly Ser Asp Leu Arg Glu Asp Lys 40 675 680 685 'i Ο ί i 5'9

Cys Arg Val Cys Gly Gly Asp Gly Ser Ala Cys Glu Thrlie Glu Gly 690 695 700

Val Phe Ser Pro Ala Ser Pro Gly Ala Gly Tyr Glu Asp Val Val Trp 705 710 715 720 5 lie Pro Lys Gly Ser Val His lie Phe lie Gin Asp Leu Asn Leu Ser 725 730 735

Leu Ser His Leu Ala Leu Lys Gly Asp Gin Glu Ser Leu Leu Glu 740 745 750

Gly Leu Pro Gly Thr Pro Gin Pro His Arg Leu Pro Leu Ala Gly Thr 10 755 760 765

Thr Phe Gin Leu Arg Gin Gly Pro Asp Gin Val Gin Ser Leu Glu Ala 770 775 780

Leu Gly Pro He Asn Ala Ser Leu lie Val With Val Leu Ala Arg Thr 785 790 795 800 15 Glu Leu Pro Ala Leu Arg Tyr Arg Phe Asn Ala Pro He Ala Arg Asp 805 810 815

Ser Leu Pro Pro Tyr Ser Tip His Tyr Ala ^ Pro Trp Thr Lys Cys Ser 820 825 830

Pro Ser Val Gin Ala Val Ala Arg Cys Arg Arg Trp Ser Ala Ala Thr 20 835 840 845

Lys Leu Asp Ser Ser Ala Val Ala Pro His Tyr Cys Ser Ala His Ser 850 855 860

Lys Leu Ala Gin Lys Gin Ala Arg Leu Gin His Gly Ala Leu Pro Gin 865 870 875 880 25 Asp Trp Val Val Gly Thr Val Ala Leu Gin Pro Gin Leu Ala With Gin 885 890 895

Gly Val Arg Ser Arg Ser Val Val Cys Gin Ala Pro Arg Leu Cys Arg 900 905 910

Glu Glu Lys Ala Leu Asp Asp Ser Ala Cys Pro Gin Pro Arg Pro Pro 30 915 920 925 '

Val Leu Arg Pro Ala Thr Ala Pro Leu Ala Leu Arg Ser Gly Gly Pro 930 935 940

Arg Leu Val 945 35 <210> 4 <211> 3263 <212> DNA <213> human 60 <400> 4 ttccatccta atacgactca ctatagggct cgagcggccg cccgggcagg tgtggacacg 60 5 tggcctctat ggctcccgcc tgccagatcc tccgctgggc cctcgccctg gggctgggcc 120 tcatgttcga ggtcacgcat gccttccggt ctcaagatga gttcctgtcc agtctggaga 180 gctatgagat cgccttcccc acccgcgtgg accacaacgg ggcactgctg gccttctcgc 10240 cacctcctcc ccggaggcag cgccgcggca cgggggccac agccgagtcc cgcctcttct 300 acaaagtggc ctcgcccagc acccacttcc tgctgaacct gacccgcagc tcccgtctac 360 15 tggcagggca cgtctccgtg gagtactgga cacgggaggg cctggcctgg cagagggcgg 420 cccggcccca ctgcctctac gctggtcacc tgcagggcca ggccagcagc tcccatgtgg 480 ccatcagcac ctgtggaggc ctgcacggcc tgatcgtggc agacgaggaa gagtacctga 20540 ttgagcccct gcacggtggg cccaagggtt ctcggagccc ggaggaaagt ggaccacatg 600 tggtgtacaa gcgttcctct ctgcgtcacc cccacctgga cacagcctgt ggagtgagag 660 25 atgagaaacc gtggaaaggg cggccatggt ggctgcggac cttgaagcca ccgcctgcca 720 ggcccctggg gggggcaggcaggcagggagggggggggggggggggggggggggggggggggggggg tacgt ggagaccctg gtggtggctg acaagatgat ggtggcctat cacgggcgcc 30840 gggatgtgga gcagtatgtc ctggccatca tgaacattgt tgccaaactt ttccaggact 900 cgagtctggg aagcaccgtt aacatcctcg taactcgcct catcctgctc acggaggacc 960 35 agcccactct ggagatcacc caccatgccg ggaagtccct ggacagcttc tgtaagtggc 1020 agaaatccat cgtgaaccac agcggccatg gcaatgccat tccagagaac ggtgtggcta 1080 accatgacac agcagtgctc atcacacgct atgacatctg catctacaag aacaaaccct 40 1140 b / ·, 61 gcggcacact aggcctggcc ccggtgggcg gaatgtgtga gcgcgagaga agctgcagcg 1200 tcaatgagga cattggcctg gccacagcgt tcaccattgc ccacgagatc gggcacacat 1260 5 tcggcatgaa ccatgacggc gtgggaaaca gctgtggggc ccgtggtcag gacccagcca 1320 agctcatggc tgcccacatt accatgaaga ccaacccatt cgtgtggtca tcctgcagcc 1380 gtgactacat caccagcttt ctagactcgg gcctggggct ctgcctgaac aaccggcccc 10 1440 ccagacagga ctttgtgtac ccgacagtgg caccgggcca agcctacgat gcagatgagc 1500 aatgccgctt tcagcatgga gtcaaatcgc gaggtctgca gcgagctgtg gtgtctgagc 1560 15 aagagcaacc ggtgcatcac caacagcatc ccggccgccg agggcacgct gtg ccagacg 1620 cacaccatcg acaaggggtg gtgctacaaa cgggtctgtg tccccCttgg gtcgcgccca 1680 gagggtgtgg acggagcctg ggggccgtgg actccatggg ggactgcagc cggacctgtg 20 1740 gcggcggcgt gtcctcttct agccgtcact gcgacagccc caggccaacc atcgggggca 1800 agtactgtct gggtgagaga aggcggcacc gctcctgcaa cacggatgac tgtccccctg 1860 25 gctcccagga cttcagagaa gtgcagtgtt ctgaatttga cagcatccct ttccgtggga 1920 aattctacaa gtggaaaacg taccggggag ggggcgtgaa ggcctgctcg ctcacgtgcc 1980 tagcggaagg cttcaacttc tacacggaga gggcggcagc CGTGGTGGAC gggacaccct 30 2040 gccgtccaga cacggtggac atttgcgtca gtggcgaatg caagcacgtg ggctgcgacc 2100 gagtcctggg ctccgacctg cgggaggaca agtgccgagt gtgtggcggt gacggcagtg 2160 35 cctgcgagac catcgagggc gtcttcagcc cagcctcacc tggggccggg tacgaggatg 2220 tcgtctggat tcccaaaggc tccgtccaca tcttcatcca ggatctgaac ctctctctca 2280 gtcacttggc cctgaaggga gaccaggagt ccctgctgct ggaggggctg cctgggaccc 40 2340> 022371 62 cccagcccca ccgtctgcct ctagctggga ccacctttca actgcgacag gggccagacc 2400 aggtccagag cctcgaagcc ctgggaccga gcatc tctcatcgtc atggtgctgg 2460 5 cccggaccga gctgcctgcc ctccgctacc gcttcaatgc ccccatcgcc cgtgactcgc 2520 tgccccccta ctcctggcac tatgcgccct ggaccaagtg ctcgcccagt gtgcaggcgg 2580 tagccaggtg caggcggtgg agtgccgcaa ccaagctgga cagctccgcg gtcgcccccc 10 2640 actactgcag tgcccacagc aagcttgccc aaaagcaagc gcgcctgcaa cacggagcct 2700 tgcctcaaga ctgggttgta ggaactgtcg ctctgcagcc gcagcttgcg atgcaaggcg 2760 15 tgcgcagccg ctcggtcgtg tgccaagcgc cgcgtctctg ccgcgaagaa aaggcgctgg 2820 acgacagcgc atgcccgcag ccgcgcccac ctgtactgag gcctgccacg gccccacttg 2880 ccctccggag tggcggccct cgactggtct gagtgcaccc ccagctgcgg gccgggcctc 20 2940 cgccaccgcg tggtcctttg caagagcgca gaccaccgcg ccacgctgcc cccggcgcac 3000 tgctcacccg ccgccaagcc accggccacc atgcgctgca acttgcgccg ctgccccccg 3060 25 gcccgctggg tggctggcga gtggggtgag tgctctgcac agtgcggcgt cgggcagcgg 3120 cagcgctcgg tgcgctgcac cagccacacg ggccaggcgt cgeacgagtg cacggaggcc 3180 ctgcggccgc cgactagtaa gcttcgtcga cccgggaatt aattccggac cggtacctgc 30 3240 aggcgtacca gctttcccta tag 3 263 <210> 5 35 <211> 1690 <212> PRT <213> liumane O i · t 63 <400> 5

Pro Val Pro Ala With Pro Gly Gly Pro Ser Pro Arg Ser Pro Ala Pro 15 10 15

Leu Leu Arg Pro Leu Leu Leu Leu Cys Ala Leu Ala Pro Gly Ala 5 20 25 30

Pro Gly Pro Ala Pro Gly Arg Ala Thr Glu Gly Arg Ala Ala Leu Asp 35 40 45 lie Val His Pro Val Arg Val Asp Ala Gly Gly Ser Phe Leu Ser Tyr 50 55 60 10 Glu Leu Trp Pro Arg Ala Leu Arg Lys Arg Asp Val Ser Val Arg Arg 65 70 75 80

Asp Ala Pro Ala Phe Tyr Glu Leu Gin Tyr Arg Gly Arg Glu Leu Arg 85 90 95

Phe Asn Leu Thr Ala Asn Gin His Leu Leu Ala Pro Gly Phe Val Ser 15 100 105 110

Glu Thr Arg Arg Arg Gly Gly Leu Gly Arg Ala His lie Arg Ala His 115. 120 125

Thr Pro Ala Cys His Leu Leu Gly Glu Val Gin Asp Pro Glu Leu Glu 130 135 140 20 Gly Gly Leu Ala Ala He Ser Ala Cys Asp Gly Leu Lys Gly Val Phe 145 150 155 160

Gin Leu Ser Asn Glu Asp Tyr Phe lie Glu Pro Leu Asp Ser Ala Pro 165 170 175

Ala Arg Pro Gly His Ala Gin Pro His Val Val Tyr Lys Arg Gin Ala 25 180 185 190

Pro Glu Arg Leu Ala Gin Arg Gly Asp Ser Ser Ala Pro Ser Thr Cys 195 200 205

Gly Val Gin Val Tyr Pro Glu Leu Glu Pro Arg Arg Glu Arg Trp Glu 210 215 220 30 Gin Arg Gin Gin Trp Arg Arg Pro Arg Leu Arg Arg Leu His Gin Arg 225 230 235 240

Ser Val Ser Lys Glu Lys Trp Val Glu Thr Leu Val Val Ala Asp Ala 245 250 255

Lys With Val Glu Tyr His Gly Gin Pro Gin Val Glu Ser Tyr Val Leu 35 260 265 270

Thr lie With Asn With Val Ala Gly Leu Phe His Asp Pro Gly 275 280 285

Asn Pro lie His lie Thr He Val Arg Leu Val Leu Leu Glu Asp Glu 290 295 300 64

Glu Glu Asp Leu Lys lie Thr His His Ala Asp Asn Thr Pro Lys Ser 305 310 315 320

Phe Cys Lys Trp Gin Lys Ser Asn With Lys Gly Asp Ala His Pro 325 330 335 5 Leu His His Asp Thr Ala Leu Leu Thr Arg Lys Asp Leu Cys Ala 340 345 350

Thr With Asn Arg Pro Cys Glu Thr Leu Gly Leu Ser His Val Ala Gly 355 360 365

With Cys Gin Pro His Arg Ser Cys Ser He Asn Glu Asp Thr Gly Leu 10 370 375 380

Pro Leu Ala Phe Thr Val Ala His Glu Leu Gly His Ser Phe Gly lie 385 390 395 400

Gin His Asp Gly Ser Gly Asn Asp Cys Glu Pro Trap Gly Lys Arg Pro 405 410 415 15 Phe He With Ser Pro Gin Leu Leu Tyr Asp Ala Ala Pro Leu Thr Trp 420 425 430

Ser Arg Cys Ser Arg Gin Tyr He Thr Arg Phe Leu Asp Arg Gly Trp 435 440 445

Gly Leu Cys Leu Asp Asp Pro Pro Ala Lys Asp He He Asp Phe Pro 20 450 455 460

Ser Val Pro Pro Gly Val Leu Tyr Asp Val Ser His Gin Cys Arg Leu 465 470 475 480

Gin Tyr Gly Ala Tyr Ser Ala Phe Cys Glu Asp With Asp Asn Val Cys 485 490 495 25 His Thr Leu Trp Cys Ser Val Gly Thr Thr Cys His Ser Lys Leu Asp 500 505 510

Ala Ala Val Asp Gly Thr Arg Cys Gly Glu Asn Lys Trp Cys Leu Ser 515 520 525

Gly Glu Cys Val Pro Val Gly Phe Arg Pro Glu Ala Val Asp Gly Gly 30 530 535 540

Trp Ser Gly Trp Ser Ala Trp Ser lie Cys Ser Arg Ser Cys Gly With 545 550 555 560

Gly Val Gin Ser Ala Glu Arg Gin Cys Thr Gin Pro Thr Pro Lys Tyr 565 570 575 35 Lys Gly Arg Tyr Cys Val Gly Glu Arg Lys Arg Phe Arg Leu Cys Asn 580 585 590

Leu Gin Ala Cys Pro Ala Gly Arg Pro Ser Phe Arg His Val Gin Cys 595 600 605

Ser His Phe Asp Ala With Leu Tyr Lys Gly Arg Leu His Thr Trp Val 40 610 615 620 65

Pro Val Val Asn Asp Val Asn Pro Cys Glu Leu His Cys Arg Pro Ala 625 630 635 640

Asn Glu Tyr Phe Ala Glu Lys Leu Arg Asp Ala Fall Val Asp Gly Thr 645 650 655 5 Pro Cys Tyr Gin Fall Arg Ala Ser Arg Asp Leu Cys lie Asn Gly Ile 660 665 670

Cys Lys Asn Val Gly Cys Asp Phe Glu lie Asp Ser Gly Ala With Glu 675 680 685

Asp Arg Cys Gly Val Cys His Gly Asn Gly Ser Thr Cys His Thr Val 10 690 695 700

Ser Gly Thr Phe Glu Glu Ala Glu Gly Leu Gly Tyr Val Asp Val Gly 705 710 715 720

Leu lie Pro Ala Gly Ala Arg Glu Ile Arg Ile Gin Glu Val Ala Glu 725 730 735 15 Ala Ala Asn Phe Leu Ala Leu Arg Ser Glu Asp Pro Glu Lys Tyr Phe 740 745 750

Leu Asn Gly Gly Trp Thr Ile Gin Trp Asn Gly Asp Tyr Gin Val Ala 755 760 765

Gly Thr Thr Phe Thr Tyr Ala Arg Arg Gly Asn Trp Glu Asn Leu Thr 20 770 775 780

Ser Pro Gly Pro Thr Lys Glu Pro Val Trp Ile Gin Leu Leu Phe Gin 785 790 795 800

Glu Ser Asn Pro Gly Val His Tyr Glu Tyr Thr Ile His Arg Glu Ala 805 810 815 25 Gly Gly His Asp Glu Val Pro Pro Val Phe Ser Trp His Tyr Gly 820 825 830

Pro Trp Thr Lys Cys Thr Val Thr Cys Gly Arg Gly Val Gin Arg Gin 835 840 845

Asn Val Tyr Cys Leu Glu Arg Gin Ala Gly Pro Val Asp Glu Glu His 30 850 855 860

Cys Asp Pro Leu Gly Arg Pro Asp Asp Gin Gin Arg Lys Cys Ser Glu 865 870 875 880

Gin Pro Cys Pro Ala Arg Trp Trp Ala Gly Glu Trp Gin Leu Cys Ser 885 890 895 35 Ser Ser Cys Gly Pro Gly Gly Leu Ser Arg Arg Ala Val Leu Cys Ile 900 905 910

Arg Ser Val Gly Leu Asp Glu Gin Ser Ala Leu Glu Pro Pro Ala Cys 915 920 925

Glu His Leu Pro Arg Pro Pro Thr Glu Thr Pro Cys Asn Arg His Val 40 930 935 940 1 022371 '66

Pro Cys Pro Ala Thr Trp Ala Val Gly Asn Trp Ser Gin Cys Ser Val 945 950 955 960

Thr Cys Gly Glu Gly Thr Gin Arg Arg Asn Val Leu Cys Thr Asn Asp 965 970 975 5 Thr Gly Val Pro Cys Asp Glu Ala Gin Gin Pro Ala Ser Glu Val Thr 980 985 990

Cys Ser Leu Pro Leu Cys Arg Trp Pro Leu Gly Thr Leu Gly Pro Glu 995 1000 1005

Gly Ser Gly Ser Gly Ser Ser His Glu Leu Phe Asn Glu Ala Asp 10 1010 1015 1020

Phe lie Pro His His Leu Ala Pro Arg Pro Ser Pro Ala Ser Ser Pro 1025 1030 1035 1040

Lys Pro Gly Thr With Gly Asn Ala lie Glu Glu Glu Ala Pro Glu Leu 1045 1050 1055 15 Asp Leu Pro Gly Pro Val Phe Val Asp Asp Phe Tyr Tyr Asp Tyr Asn 1060 1065 1070

Phe lie Asn Phe His Glu Asp Leu Ser Tyr Gly Pro Ser Glu Glu Pro 1075 1080 1085

Asp Leu Asp Leu Ala Gly Thr Gly Asp Arg Thr Pro Pro Pro His Ser 20 1090 1095 1100

Arg Pro Ala Ala Pro Ser Thr Gly Ser Pro Val Pro Ala Thr Glu Pro 1105 1110 1115 1120

Pro Ala Ala Lys Glu Glu Gly Val Leu Gly Pro Trp Ser Pro Ser Pro 1125 1130 1135 25 Trp Pro Ser Gin Ala Gly Arg Ser Pro Pro Pro Pro Ser Glu Gin Thr 1140 1145 1150

Pro Gly Asn Pro Leu lie Asn Phe Leu Pro Glu Glu Asp Thr Pro lie 1155 1160 1165

Gly Ala Pro Asp Leu Gly Leu Pro Ser Leu Ser Trp Pro Arg Val Ser 30 1170 1175 1180

Thr Asp Gly Leu Gin Thr Pro Ala Thr Pro Glu Ser Gin Asn Asp Phe 1185 1190 1195 1200

Pro Val Gly Lys Asp Ser Gin Ser Gin Leu Pro Pro Pro Trp Arg Asp 1205 1210 1215 35 Arg Thr Asn Glu Val Phe Lys Asp Asp Glu Glu Pro Lys Gly Arg Gly 1220 1225 1230

Ala Pro His Leu Pro Pro Arg Pro Ser Ser Thr Leu Pro Pro Leu Ser 1235 1240 1245

Pro Val Gly Ser Thr His Ser Ser Pro Ser Pro Asp Val Ala Glu Leu 40 1250 1255 1260 / .. H? ' il "67

Trp Thr Gly Gly Thr Val Ala Trp Glu Pro Ala Leu Glu Gly Gly Leu 1265 1270 1275 1280

Gly Pro Val Asp Ser Glu Leu Trp Pro Thr Val Gly Val Ala Ser Leu 1285 1290 1295 5 Leu Pro Pro lie Ala Pro Leu Pro Glu With Lys Val Arg Asp Ser 1300 1305 1310

Ser Leu Glu Pro Gly Thr Pro Ser Phe Pro Ala Pro Gly Pro Gly Ser 1315 1320 1325

Trp Asp Leu Gin Thr Val Ala Val Trp Gly Thr Phe Leu Pro Thr Thr 10 1330 1335 1340

Leu Thr Gly Leu Gly His With Pro Glu Pro Ala Leu Asn Pro Gly Pro 1345 1350 1355 1360

Lys Gly Gin Pro Glu Ser Leu Ser Pro Glu Val Pro Leu Ser Ser Arg 1365 1370 1375 15 Leu Leu Ser Thr Pro Ala Trp Asp Ser Pro Ala Asn Ser His Arg Val 1380 1385 1390

Pro Glu Thr Gin Pro Leu Ala Pro Ser Leu Ala Glu Ala Gly Pro Pro 1395 1400 1405

Ala Asp Pro Leu Val Val Arg Asn Ala Ser Trp Gin Ala Gly Asn Trp 20 1410 1415 1420

Ser Glu Cys Ser Thr Thr Cys Gly Leu Gly Ala Val Trp Arg Pro Val 1425 1430 1435 1440

Arg Cys Ser Ser Gly Arg Asp Glu Asp Cys Ala Pro Ala Gly Arg Pro 1445 1450 1455 25 Gin Pro Ala Arg Arg Cys His Leu Arg Pro Cys Ala Thr Trp His Ser 1460 1465 1470

Gly Asn Trp Ser Lys Cys Ser Arg Ser Cys Gly Gly Gly Ser Ser Val 1475 1480 1485

Arg Asp Val Gin Cys Val Asp Thr Arg Asp Leu Arg Pro Leu Arg Pro 30 1490 1495 1500

Phe His Cys Gin Pro Gly Pro Ala Lys Pro Pro Ala His Arg Pro Cys 1505 1510 1515 1520

Gly Ala Gin Pro Cys Leu Ser Trp Tyr Thr Ser Ser Trp Arg Glu Cys 1525 1530 1535 35 Ser Glu Ala Cys Gly Gly Gly Glu Gin Gin Arg Leu Val Thr Cys Pro 1540 1545 1550

Glu Pro Gly Leu Cys Glu Glu Ala Leu Arg Pro Asn Thr Thr Arg Pro 1555 1560 1565

Cys Asn Thr His Pro Cys Thr Gin Trp Fall Val Gly Pro Trp Gly Gin 40 1570 1575 1580 68

Cys Ser Ala Pro Cys Gly Gly Gly Val Gin Arg Arg Leu Val Lys Cys 1585 1590 1595 1600

Val Asn Thr Gin Thr Gly Leu Pro Glü Glu Asp Ser Asp Gin Cys Gly 1605 1610 1615 5 His Glu Ala Trp Pro Glu Ser Ser Arg Pro Cys Gly Thr Glu Asp Cys 1620 1625 1630

Glu Pro Val Glu Pro Pro Arg Cys Glu Arg Asp Arg Leu Ser Phe Gly 1635 1640 1645

Phe Cys Glu Thr Leu Arg Leu Leu Gly Arg Cys Gin Leu Pro Thr lie 10 1650 1655 1660

Arg Thr Gin Cys Cys Arg Ser Cys Ser Pro Pro Ser His Gly Ala Pro 1665 1670 1675 1680

Ser Arg Gly His Gin Arg Val Ala Arg Arg 1685 1690 15 <210> 6 <211> 5338 · <212> DNA <213> human 20 <400> 6 ccggttcctg ccatgcccgg cggccccagt ccccgcagcc ccgcgcctgcgggggcggcggcggcggcggcggcggcggcggggcggcggcggcggcggcgggg accgagggcc gggcggcact ggacatcgtg cacccggttc gagtcgacgc ggggggctcc 180 ttcctgtcct acgagctgtg gccccgcgca ctgcgcaagc gggatgtatc tgtgcgccga 240 30 gacgcgcccg ccttctacga gctacaatac cgcgggcgcg agctgcgctt caacctgacc 300 gccaatcagc acctgctggc gcccggcttt gtgagcgaga cgcggcggcg cggcggcctg 360 ggccgcgcgc acatccgggc ccacaccccg gcctgccacc tgcttggcga ggtgcaggac 35420 cctgagctcg agggtggcct ggcggccatc agcgcctgcg acggcctgaa aggtgtgttc 480 cagctctcca acgaggacta cttcattgag cccctggaca gtgccccggc ccggcctggc 540 69 cacgcccagc cccatgtggt gtacaagcgt caggccccgg agaggctggc acagcggggt 600 gattccagtg ctccaagcac ctgtggagtg caagtgtacc cagagctgga gcctcgacgg 660 5 gagcgttggg agcagcggca gcagtggcgg cggccacggc tgaggcgtct acaccagcgg 720 tcggtcagca aagagaagtg ggtggagacc ctggt ggtag ctgatgccaa aatggtggag 780 taccacggac agccgcaggt tgagagctat gtgctgacca tcatgaacat ggtggctggc 10840 ctgtttcatg accccagcat tgggaacccc atccacatca ccattgtgcg cctggtcctg 900 ctggaagatg aggaggagga cctaaagatc acgcaccatg cagacaacac cccgaagagc 960 15 ttctgcaagt ggcagaaaag catcaacatg aagggggatg cccatcccct gcaccatgac 1020 actgccatcc tgctcaccag aaaggacctg tgtgcaacca tgaaccggcc ctgtgagacc 1080 ctgggactgt cccatgtggc gggcatgtgc cagccgcacc gcagctgcag catcaacgag 20 1140 gacacgggcc -tgccgctggc cttcactgta gcccacgagc tcgggcacag ttttggcatt 1200 cagcatgacg gaagcggcaa tgactgtgag cccgttggga aacgaccttt catcatgtct 1260 25 ccacagctcc tgtacgacgc cgctcccctc acctggtccc gctgcagccg ccagtatatc 1320 accaggttcc ttgaccgtgg gtggggcctg tgcctggacg accctcctgc caaggacatt 1380 atcgacttcc cctcggtgcc acctggcgtc ctctatgatg taagccacca gtgccgcctc 30 1440 cagtacgggg cctactctgc cttctgcgag gacatggata atgtctgcca cacactctgg 1500 tgctctgtgg ggaccacctg tcactccaag ctggatgcag ccgtggacgg cacccggtgt 1560 35 ggggagaata agtggtgtct cagtgggg ag tgcgtacccg tgggcttccg gcccgaggcc 1620 gtggatggtg gctggtctgg ctggagcgcc tggtccatct gctcacggag ctgtggcatg 1680 ggcgtacaga gcgccgagcg gcagtgcacg cagcctacgc ccaaatacaa aggcagatac 40 1740 1022 3 71 70 tgtgtgggtg agcgcaagcg cttccgcctc tgcaacctgc aggcctgccc tgctggccgc 1800 ccctccttcc gccacgtcca gtgcagccac tttgacgcca tgctctacaa gggccggctg 1860 5 cacacatggg tgcccgtggt caatgacgtg aacccctgcg agctgcactg ccggcccgcg 1920 aatgagtact ttgccgagaa gctgcgggac gccgtggtcg atggcacccc ctgctaccag 1980 gtccgagcca gccgggacct ctgcatcaac ggcatctgta agaacgtggg cfcgtgacttc 10 2040 gagattgact ccggtgctat ggaggaccgc tgtggtgtgt gccacggcaa cggctccacc 2100 tgccacaccg tgagcgggac cttcgaggag gccgagggcc tggggtatgt ggatgtgggg 2160 15 ctgatcccag cgggcgcacg cgagatccgc atccaagagg ttgccgaggc tgccaacttc 2220 ctggcactgc ggagcgagga cccggagaag tacttcctca atggtggctg gaccatccag 2280 tggaacgggg actaccaggt ggcagggacc accttcacat acgcacgcag gggcaactgg 20 2340 gagaacctca cgtccccggg tcccaccaag gagcctgtct ggatccagct gctgttccag 2400 gagagca acc ctggggtgca ctacgagtac accatccaca gggaggcagg tggccacgac 2460 25 gaggtcccgc cgcccgtgtt ctcctggcat tatgggccct ggaccaagtg cacagtcacc 2520 tgcggcagag gtgtgcagag gcagaatgtg tactgcttgg agcggcaggc agggcccgtg 2580 gacgaggagc actgtgaccc cctgggccgg cctgatgacc aacagaggaa gtgcagcgag 30 2640 cagccctgcc ctgccaggtg gtgggcaggt gagtggcagc tgtgctccag ctcctgcggg 2700 cctgggggcc tctcccgccg ggccgtgctc tgcatccgca gcgtggggct ggatgagcag 2760 35 agcgccctgg agccacccgc ctgtgaacac cttccccggc cccctactga aaccccttgc 2820 aaccgccatg taccctgtcc ggccacctgg gctgtgggga actggtctca gtgctcagtg 2880 acatgtgggg agggcactca gcgccgaaat gtcctctgca ccaatgacac cggtgtcccc 40 2940 71 tgtgacgagg cccagcagcc agccagcgaa gtcacctgct ctctgccact ctgtcggtgg 3000 cccctgggca cactgggccc tgaaggctca ggcagcggct cctccagcca cgagctcttc 3060 5 aacgaggctg acttcatccc gcaccacctg gccccacgcc cttcacccgc ctcatcaccc 3120 aagccaggca ccatgggcaa cgccattgag gaggaggctc cagagctgga cctgccgggg 3180 cccgtgtttg tggacgactt ctactacgac tacaatttca tcaatttcca cgaggatctg 1 0 3240 tcctacgggc cctctgagga gcccgatcta gacctggcgg ggacagggga ccggacaccc 3300 ccaccacaca gccgtcctgc tgcgccctcc acgggtagcc ctgtgcctgc cacagagcct 3360 15 cctgcagcca aggaggaggg ggtactggga ccttggtccc cgagcccttg gcctagccag 3420 gccggccgct ccccaccccc accctcagag cagacccctg ggaacccttt gatcaatttc 3480 ctgcctgagg aagacacccc cataggggcc ccagatcttg ggctccccag cctgtcctgg 20 3540 cccagggttt ccactgatgg cctgcagaca cctgccaccc ctgagagcca aaatgatttc 3600 ccagttggca aggacagcca gagccagctg ccccctccat ggcgggacag gaccaatgag 3660 25 gttttcaagg atgatgagga acccaagggc cgcggagcac cccacctgcc cccgagaccc 3720 agctccacgc tgcccccttt gtcccctgtt ggcagcaccc actcctctcc tagtcctgac 3780 gtggcggagc tgtggacagg aggcacagtg gcctgggagc cagctctgga gggtggcctg 30 3840 gggcctgtgg acagtgaact gtggcccact gttggggtgg cttctctcct tcctcctccc 3900 atagcccctc tgccagagat gaaggtcagg gacagttccc tggagccggg gactccctcc 3960 35 ttcccagccc caggaccagg ctcatgggac ctgcagactg tggcagtgtg ggggaccttc 4020 ctccccacaa ccctgactgg cctcgggcac atgcctgagc ctgccctgaa cccaggaccc 4080 aagggtcagc ctgagtccct cagccctgag gtgcccctga gctctaggct gctgtccaca 40 4140 72 ccagcttggg acagccccgc caacagccac agagtccctg agacccagcc gctggctccc 4200 agcctggctg aagcggggcc ccccgcggac ccgttggttg tcaggaacgc cagctggcaa 4260 5 gcgggaaact ggagcgagtg ctctaccacc tgtggcctgg gtgcggtctg gaggccggtg 4320 cgctgtagct ccggccggga tgaggactgc gcccccgctg gccggcccca gcctgcccgc 4380 cgctgccacc tgcggccctg tgccacctgg cactcaggca actggagtaa gtgctcccgc 10 4440 agctgcggcg gaggttcctc agtgcgggac gtgcagtgtg tggacacacg ggacctccgg 4500 ccactgcggc ccttccattg tcagcccggg cctgccaagc cgcctgcgca ccggccctgc 4560 15 ggggcccagc cctgcctcag ctggtacaca tcttcctgga gggagtgetc cgaggcctgt 4620 ggcggtggtg ageageageg tctagtgacc tgcccggagc caggcctctg egaggaggeg 4680 ctgagaccca acaccacccg gccctgcaac acccacccct gcacgcagtg ggtggtgggg 20 4740 ccctggggcc agtgctcagc cccctgtggt ggtggtgtcc agcggcgcct ggtcaagtgt 4800 gtcaacaccc agacagggct gcccgaggaa gacagtgacc agtgtggcca cgaggcctgg 4860 25 cctgagagct cccggccgtg tggcaccgag gattgtga gc ccgtcgagcc tccccgctgt 4920 gagcgggacc gcctgtcctt cgggttctgc gagacgctgc gcctactggg ccgctgccag 4980 ctgcccacca tccgcaccca gtgctgccgc tcgtgctctc cgcccagcca cggcgccccc 30 5040 tcccgaggcc atcagcgggt tgcccgccgc tgactgtgcc aggatgcaca gaccgaccga 5100 cagacctcag tgcccaccac gggctgtggc ggagctcccg ccccctgcgc cctaatggtg 5160 35 ctaaccccct ctcactaccc ageageagge tggggacctc ctccccctca aaaaaggtat 5220 ttttttattc taacagtttg tgtaacattt attatgattt tacataaatg agcatctacc 5280 attccaaagc aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaa 40 5338/1 73 <210> 7 <211> 947 <212> PRT 5 <213> human <400> 7

With Gin Phe Val Ser Trp Ala Thr Leu Leu Thr Leu Leu Val Arg Asp 15 10 15 10 Leu Ala Glu With Gly Ser Pro Asp Ala Ala Ala Ala Val Arg Lys Asp 20 25 30

Arg Leu His Pro Arg Gin Val Lys Leu Leu Glu Thr Leu Ser Glu Tyr 35 40 45

Glu He Val Ser Pro lie Arg Val Asn Ala Leu Gly Glu Pro Phe Pro 15 50 55 60

Thr Asn Val His Phe Lys Arg Thr Arg Arg Series Asn Ser Ala Thr 65 70 75 80

Asp Pro Trp Pro Ala Phe Ala Ser Ser Ser Ser Ser Thr Ser Ser 85 90 95 20 Gin Ala His Tyr Arg Leu Ser Ala Phe Gly Gin Gin Phe Leu Phe Asn 100 105 110

Leu Thr Ala Asn Ala Gly Phe He Ala Pro Leu Phe Thr Val Thr Leu 115 120 125

Leu Gly Thr Pro Gly Val Asn Gin Thr Lys Phe Tyr Ser Glu Glu Glu 25 130 135 140

Ala Glu Leu Lys His Cys Phe Tyr Lys Gly Tyr Val Asn Thr Asn Ser 145 150 155 160

Glu His Thr Ala Val He Ser Leu Cys Ser Gly With Leu.Gly Thr Phe 165 170 175 30 Arg Ser His Asp Gly Asp Tyr Phe lie Glu Pro Leu Gin Ser With Asp 180 185 190

Glu Gin Glu Asp Glu Glu Glu Gin Asn Lys Pro His lie He Tyr Arg 195 200 205

Arg Ser Ala Pro Gin Arg Glu Pro Ser Thr Gly Arg His Ala Cys Asp 35 210 215 220

Thr Ser Glu His Lys Asn Arg His Ser Lys Asp Lys Lys Lys Thr Arg 225 230 235 240

Ala Arg Lys Trp Gly Glu Arg He Asn Leu Ala Gly Asp Val Ala Ala 245 250 255 1022371 74

Leu Asti Ser Gly Leu Ala Thr Glu Ala Phe Ser Ala Tyr Gly Asn Lys 260 265 270

Thr Asp Asn Thr Arg Glu Lys Arg Thr His Arg Arg Thr Lys Arg Phe 275 280 285 5 Leu Ser Tyr Pro Arg Phe Val Glu Val Leu Val Val Ala Asp Asn Arg 290 295 300

With Val Ser Tyr His Gly Glu Asn Leu Gin His Tyr He Leu Thr Leu 305 310 315 320

With Ser lie Val Ala Ser lie Tyr Lys Asp Pro Ser lie Gly Asn Leu 10 325 330 335 lie Asn lie Val lie Val Asn Leu He Val He His Asn Glu Gin Asp 340 345 350

Gly Pro Ser He Ser Phe Asn Ala Gin Thr Thr Leu Lys Asn Phe Cys 355 360 365 15 Gin Trp Gin His Ser Lys Asn Ser Pro Gly Gly lie His His Asp Thr 370 375 380

Ala Val Leu Leu Thr Arg Gin Asp lie Cys Arg Ala His Asp Lys Cys 385 390 395 400

Asp Thr Leu Gly Leu Ala Glu Leu Gly Thr lie Cys Asp Pro Tyr Arg 20 405 410 415

Ser Cys Ser He Ser Glu Asp Ser Gly Leu Ser Thr Ala Phe Thread 420 425 430

Ala His Glu Leu Gly His Val Phe Asn With Pro His Asp Asp Asn Asn 435 440 445 25 Lys Cys Lys Glu Glu Gly Val Lys Ser Pro Gin His Val With Ala Pro 450 455 460

Thr Leu Asn Phe Tyr Thr Asn Pro Trp With Trp Ser Lys Cys Ser Arg 465 470 475 480

Lys Tyr lie Thr Glu Phe Leu Asp Thr Gly Tyr Gly Glu Cys Leu Leu 30 485 490 495

Asn Glu Pro Glu Ser Arg Pro Tyr Pro Leu Pro Val Gin Leu Pro Gly 500 505 510

He Leu Tyr Asn Val Asn Lys Gin Cys Glu Leu lie Phe Gly Pro Gly 515 520 525 35 Ser Gin Val Cys Pro Tyr With With Gin Cys Arg Arg Leu Trp Cys Asn 530 535 540

Asn Val Asn Gly Val His Lys Gly Cys Arg Thr Gin His Thr Pro Trp 545 550 555 560

Ala Asp Gly Thr Glu Cys Glu Pro Gly Lys His Cys Lys Tyr Gly Phe 40 565 570 575 \ f 75

Cys Val Pro Lys Glu With Asp Val Pro Val Thr Thr Asp Gly Ser Trp Gly 580 585 590

Ser Trp Ser Pro Phe Gly Thr Cys Ser Arg Thr Cys Gly Gly Gly lie 595 500 605 5 Lys Thr Ala lie Arg Glu Cys Asn Arg Pro Glu Pro Lys Asn Gly Gly 610 615 620

Lys Tyr Cys Val Gly Arg Arg With Lys Phe Lys Ser Cys Asn Thr Glu 625 630 635 640

Pro Cys Leu Lys Gin Lys Arg Asp Phe Arg Asp Glu Gin Cys Ala His 10 645 650 655

Phe Asp Gly Lys His Phe Asn lie Asn Gly Leu Leu Pro Asn Val Arg 660 665 670

Trp Val Pro Gin Tyr Ser Gly lie Leu With Lys Asp Arg Cys Lys Leu 675 680 685 15 Phe Cys Arg Val Ala Gly Asn Thr Ala Tyr Tyr Gin Leu Arg Asp Arg 690 695 700

Val lie Asp Gly Thr Pro Cys Gly Gin Asp Thr Asn Asp lie Cys Val 705 710 715 720

Gin Gly Leu Cys Arg Gin Ala Gly Cys Asp His Val Leu Asn Ser Lys 20 725 730 735

Ala Arg Arg Asp Lys Cys Gly Val Cys Gly Gly Asp Asn Ser Ser Cys 740 745 750

Lys Thr Val Ala Gly Thr Phe Asn Thr Val His Tyr Gly Tyr Asn Thr 755 760 765 25 Val Val Arg lie Pro Ala Gly Ala Thr Asn lie Asp Val Arg Gin His 770 775 780

Ser Phe Ser Gly Glu Thr Asp Asp Asp Asn Tyr Leu Ala Leu Ser Ser 785 790 795 800

Ser Lys Gly Glu Phe Leu Leu Asn Gly Asn Phe Val Val Thr With Ala 30 805 810 '815

Lys Arg Glu lie Arg lie Gly Asn Ala Val Val Glu Tyr Ser Gly Ser 820 825 830

Glu Thr Ala Val Glu Arg lie Asn Ser Thr Asp Arg He Glu Gin Glu 835 840 845 35 Leu Leu Leu Gin Val Leu Ser Val Gly Lys Leu Tyr Asn Pro Asp Val 850 855 860

Arg Tyr Ser Phe Asn lie Pro lie Glu Asp Lys Pro Gin Gin Phe Tyr 865 870 875 880

Trp Asn Ser His Gly Pro Trp Gin Ala Cys Ser Lys Pro Cys Gin Gly 40 885 890 895 76

Glu Arg Lys Arg Lys Leu Val Cys Thr Arg Glu Ser Asp Gin Leu Thr 900 905 910

Val Ser Asp Gin Arg Cys Asp Arg Leu Pro Gin Pro Gly His Ile Thr 915 920 925 5 Glu Pro Cys Gly Thr Asp Cys Asp Leu Arg Trp Ala Thr Val Phe Ser 930 935 940

Arg Pro Leu 945 10 <210> 8 <211> 4086 <212> DNA <213> human 15 <400> 8 ggtcgtggtg ctggagttta agttgagtag taggaatgcg gtagtagtta ggataatata 60 aatagttaaa ttaagaatgg ttatgttagg gttgtacggt agaactgcta ttattcatcc 120 20 tatgtgggta attgaggagt atgctaagat tttgcgtagc tgggtttggt ttaatccacc 180 tcaactgcct gctatgatgg ataagattga gagagtgagg agaaggctta cgtttagtga 240 gggagagatt tggtatatga ttgagatggg ggctagtttt tgtcatgtga gaagaagcag 25300 gccggatgtc agaggggtgc cttgggtaac ctctgggact cagaagtgaa agggggctat 360 tcctagtttt attgctatag ccattatgat tattaatgat gagtattgat tggtagtatt 420 30 ggttatggtt cattgtccgg agagtatatt gttgaagagg atagctatta gaaggattat 480 ggatgcggtt acttgcgtga ggaaatactt gatggcagct tctgtggaac gagggtctat 540 ttttttggtt agaactggaa taaaagctag catgtttatt tctaggccta ctcaggtaaa 35600 aaatcagtgc gagcttagcg ctgtgatgag tgtgcctgca aagatggtag agtagatgac 660 gggggagggg tgggaagcac catgcagttt gtatcctggg ccacactgct aacgctcctg 720 '0 23 2 71-77 gtgcgggacc tggccgagat ggggagccca gacgccgcgg cggccgtgcg caagg acagg 780 ctgcacccga ggcaagtgaa attattagag accctgagcg aatacgaaat cgtgtctccc 840 5 atccgagtga acgctctcgg agaacccttt cccacgaacg tccacttcaa aagaacgcga 900 cggagcatta actctgccac tgacccctgg cctgccttcg cctcctcctc ttcctcctct 960 acctcctccc aggcgcatta ccgcctctct gccttcggcc agcagtttct atttaatctc 10 1020 accgccaatg ccggatttat cgctccactg ttcactgtca ccctcctcgg gacgcccggg 1080 gtgaatcaga ccaagtttta ttccgaagag gaagcggaac tcaagcactg tttctacaaa 1140 15 ggctatgtca ataccaactc cgagcacacg gccgtcatca gcctctgctc aggaatgctg 1200 ggcacattcc ggtctcatga tggggattat tttattgaac cactacagtc tatggatgaa 1260 caagaagatg aagaggaaca aaacaaaccc cacatcattt ataggcgcag cgccccccag 20 1320 agagagccct caacaggaag gcatgcatgt gacacctcag aacacaaaaa taggcacagt 1380 aaagacaaga agaaaaccag agcaagaaaa tggggagaaa ggattaacct ggctggtgac 1440 25 gtagcagcat taaacagcgg cttagcaaca gaggcatttt ctgcttatgg taataagacg 1500 gacaacacaa gagaaaagag gacccacaga aggacaaaac gttttttatc ctatccacgg 1560 tttgtagaag tcttggtggt ggcagacaac agaatggttt cataccatgg a gaaaacctt 30 1620 caacactata ttttaacttt aatgtcaatc gtagcctcta tctataaaga cccaagtatt 1680 ggaaatttaa ttaatattgt tattgtgaac ttaattgtga ttcataatga acaggatggg 1740 35 ccttccatat cttttaatgc tcagacaaca ttaaaaaact tttgccagtg gcagcattcg 1800 aagaacagtc caggtggaat ccatcatgat actgctgttc tcttaacaag acaggatatc 1860 tgcagagctc acgacaaatg tgatacctta ggcctggctg aactgggaac catttgtgat 40 1920 C 'l \ / i! ! ! / / 78 ccctatagaa gctgttctat tagtgaagat agtggattga gtacagcttt tacgatcgcc 1980 catgagctgg gccatgtgtt taacatgcct catgatgaca acaacaaatg taaagaagaa 2040 5 ggagttaaga gtccccagca tgtcatggct ccaacactga acttctacac caacccctgg 2100 atgtggtcaa agtgtagtcg aaaatatatc actgagtttt tagacactgg ttatggcgag 2160 tgtttgctta acgaacctga atccagaccc taccctttgc ctgtccaact gccaggcatc 10 2220 ctttacaacg tgaataaaca atgtgaattg atttttggac caggttctca ggtgtgccca 2280 tatatgatgc agtgcagacg gctctggtgc aataacgtca atggagtaca caaaggctgc 2340 15 cggactcagc acacaccctg ggccgatggg acggagtgcg agcctggaaa gcactgcaag 2400 tatggatttt gtgttcccaa agaaatggat gtccccgtga cagatggatc ctggggaagt 2460 tggagtccct ttggaacctg ctccagaaca tgtggagggg gcatcaaaac agccattcga 20 2520 gagtgcaaca gaccagaacc aaaaaatggt ggaaaatact gtgtaggacg tagaatgaaa 2580 tttaagtcct gcaacacgga gccatgtctc aagcagaagc gagacttccg agatgaacag 2640 25 tgtgctcact ttgacgggaa gcattttaac atcaacggtc tgcttcccaa tgtgcgctgg 2700 gtccctcaat acagtggate tctgatgaag gaccggtgca agttgttctg c agagtggca 2760 gggaacacag cctactatca gcttcgagac agagtgatag atggaactcc ttgtggccag 30 2820 gacacaaatg atatctgtgt ccagggcctt tgccggcaag ctggatgcga tcatgtttta 2880 aactcaaaag cccggagaga taaatgtggg gtttgtggtg gcgataattc ttcatgcaaa 2940 35 acagtggcag gaacatttaa tacagtacat tatggttaca atactgtggt ccgaattcca 3000 gctggtgcta ccaatattga tgtgcggcag cacagtttct caggggaaac agacgatgac 3060 aactacttag ctttatcaag cagtaaaggt gaattcttgc taaatggaaa ctttgttgtc 40 3120 79 acaatggcca aaagggaaat tcgcattggg aatgctgtgg tagagtacag tgggtccgag 3180 actgccgtag aaagaattaa ctcaacagat cgcattgagc aagaactttt gcttcaggtt 3240 5 ttgtcggtgg gaaagttgta caaccccgat gtacgctatt ctttcaatat tccaattgaa 3300 gataaacctc agcagtttta ctggaacagt catgggccat ggcaagcatg cagtaaaccc 3360 tgccaagggg aacggaaacg aaaacttgtt tgcaccaggg aatctgatca gcttactgtt 10 3420 tctgatcaaa gatgcgatcg gctgccccag cctggacaca ttactgaacc ctgtggtaca 3480 gactgtgacc tgaggtgggc cactgttttc tcaaggcctt tataaatgaa ttgtgagagt 3540 15 cttgcaggag gtcccagcag gagaagcaaa aggagggga t gccggtcttt agttcccctt 3600 tcttgtgttt cagtgaaata agctttaacc aattctccat ccctctggaa ctgattatcc 3660 aagacataca tgtgcagatt tcttgttcac ctaagaatta aaaatagcta atagagtatg 20 3720 gcacttgcca aaaaaaattc agttgatcct cacmacttgc tgggtaggta ttagcattat 3780 gattgagtca cattgtacgt gaaaacttgt tttgaaagtc aaaagaaaag agggagaacc 3840 25 tcatccctca aagtacccat aatgacctat atctaccgag agtgtatacc acccagtaga 3900 agaactccta cacacctgaa agttgcagta cactaaggta gcgtcatgga agaaacaaga 3960 agaaaatgta tatatggatg tytgagatat tcaaacaatt ctgtgtttaa gaaaaaaaaa 30 4020 aaaaaaaaaa aaaaaaa & aa agtactctgc gttgttacca ctgcttgccc tatagtgagt 4080 cgtatt 4086 35 <210> 9 <211> 41

<212> DNA

<213> Artificial sequence 80 <220> <223> primer 5 <400> 9 gatcgcggcc gctatggtgg acacgtggcc tctatggctc c 41 <210> 10 10 <211> 43

<212> DNA

<213> Artificial sequence <220> 15 <223> primer <400> 10 tgaggccttc agggccgatc actgtgcaga gcactcaccc cat 43 20 1022 3 71

Claims (16)

1. An MPTS-20 protein in a different environment than in its natural environment. The protein of claim 1, wherein said protein has an amino acid sequence that is identical to SEQ ID NO: 07. A nucleic acid present in a environment other than its natural environment, said nucleic acid having a nucleotide sequence encoding an MPTS-20 protein. 10 A nucleic acid according to claim 3, wherein said nucleic acid has a nucleic acid sequence that is equal to, or substantially identical to, the nucleotide sequence of SEQ ID NO: 08. 5. An expression cassette containing a transcription initiation region that is functional in an expression host, a nucleotide sequence according to claims 3 or 4, under transcription regulation of said transcription initiation region, and a transcription termination region that is functional in said expression host contains. A cell containing an expression cassette according to claim 5, as part of an extrachromosomal element or, by inserting said expression cassette into said host cell, integrated into the genome of a host cell. The cellular progeny of the host cell according to claim 6. A monoclonal antibody that specifically binds to an MPTS protein according to claim 1. A method for producing an MPTS protein, said method comprising: growing a cell according to claim 6, wherein said protein is expressed; and . isolating said protein that is substantially free of other proteins. An MPTS protein as in claim 1 or 2 when produced by a process according to claim 9. 5 A method for testing for identification of MPTS modulating agents, said method comprising: contacting MPTS protein according to claim 1, with a substrate in the presence of a potential modulating agent; and determining the effect of said modulating agent on the activity of said protein. The method of claim 11, wherein said substrate contains a glu-ala bond. The method of claim 12, wherein said substrate is aggrecane or a fragment thereof. 14. A method of treating a host suffering from a disease associated with MPTS activity, specifically where said disease is characterized by the presence of aggrecan cleavage products, said method comprising: administering to said host a MPTS modulating agent, specifically an antagonist. 15. The use of an MPTS modulating agent, obtainable or obtained by the method of claim 11, for the preparation of a medicament for the treatment of a disease associated with MPTS activity, specifically where said disease is characterized by the presence of aggrecan cleavage products, such as arthritis. 16. The invention as hereinbefore described herein. J