MXPA98007316A - Detection of nucleic acids for the extinction of fluorescen - Google Patents

Abstract

Detective nucleic acids are used to detect target sequences of the nucleic acid by fluorescence quenching mechanisms. These detector nucleic acids comprise at least two oligonucleotides and are partially one and two strands. One pair of donor / acceptor dyes bind to the first oligonucleotide, and the other to the second oligonucleotide, so that they are in close spatial proximity, when the first and second oligonucleotides are in the base pair and the fluorescence of the donor is quenched. A second single oligonucleotide can be subjected to hybridization with the first oligonucleotide or multiple second oligonucleotides can be subjected to hybridization with the first oligonucleotide and each other, forming a joint structure comprising multiple pairs of donor / acceptor dyes. The detector oligonucleotide retains its conformation partially from a single cord and partially from two cords, in the absence of the target. However, in the presence of the target, one or more of the second detector nucleic acid oligonucleotides are displaced completely or partially from the first, increasing the distance between the donor and acceptor dyes and causing a change in the fluorescence that can be detected, as an indication of the presence of the target sequence

Description

DETECTION OF NUCLEIC ACIDS BY THE EXTINCTION OF FLUORESCENCE FIELD OF THE INVENTION This invention relates to methods for detecting target sequences of nucleic acid and, in particular, detection methods employing fluoride extinction.

BACKGROUND OF THE INVENTION "The specific hybridization of oligonucleotide sequences has long been used as a resource for the detection and identification of selected nucleotide sequences, and the labeling of such are with fluorescent labels has provided a radioactive medium, relatively sensitive , to facilitate detection of probe hybridization Recently developed detection methods employ the process of -transfer of fluorescence energy ("FET") more than direct detection of fluorescence intensity for the detection of hybridization This fluorescence energy transfer occurs between a donor fluorophore and an acceptor dye (which may or may not be fluorophore), when the absorption spec of one (acceptor) overlaps the emission spec of the other ( donor) and the two dyes are in close proximity.The dyes with these properties are named as couples of donor / acceptor dyes or couples of energy transfer dyes. The energy of the excited state of the donor fluorophore is transferred by an interaction of a dipole, induced by the resonance dipole, to the neighboring acceptor. This results in the extinction of donor fluorescence. In some cases, if the acceptor is also a fluorophore, the intensity of its fluorescence can be increased. The efficiency of energy transfer is highly dependent on the distance between the donor and acceptor, and equations that predict these relationships have been developed by Fórster (1948. Ann. Phys. 2, 55-75). The distance between the donor and acceptor dyes in which the energy transfer is 50%, is termed as the distance of Forster (R0). Other fluorescence quenching mechanisms are also known and include, for example, charge transfer and moderation of collisions. The transfer of energy and other mechanisms that depend on the interaction of two dyes in close proximity to produce extinction, are attractive resources to detect or identify nucleotide sequences, since these tests can be performed in homogeneous formats. These homogeneous assay formats are simpler than conventional probe hybridization assays, which rely on the fluorescence detection of a single fluorophore label, since heterogeneous assays generally require additional steps to separate the hybridization label from the label free. Typically, FET and related methods have depended on the inspection of a change in the fluorescence properties of one or both dye labels, when they are brought together by the hybridization of two complementary oligonucleotides. In this format, the change in fluorescence properties can be measured as a change in the amount of the energy transfer or as a change in the amount of fluorescence quenching, typically indicated as an increase in the intensity of the fluorescence from one of the dyes. In this way, the nucleotide sequence of interest can be detected without separation of the oligonucleotides subjected or not to hybridization. Hybridization can occur between two complementary oligonucleotides, one of which is labeled with the donor fluorophore and the other labeled with an acceptor. In the form of a double strand, there is decreased donor fluorescence (increased extinction) and / or increased energy transfer, compared to double-stranded oligonucleotides. Several formats for FET hybridization assays were reviewed in Nonisotopic DNA Probe Techniques (1992, Academic Press, Inc., pages 311-352). Alternatively, the donor and acceptor can be linked to a single oligonucleotide, such that there is a detectable difference in the fluorescence properties of one or both, when the oligonucleotide is subjected to dehybridization. when it is subjected to hybridization to its complementary sequence. In this format, the fluorescence of the donor is typically increased and the energy transfer / extinction is decreased when the oligonucleotides are subjected to hybridization. For example, a self-complementary oligonucleotide, labeled at each end, can form a hairpin that carries the two fluorophores (ie, ends 51 and 3 ') in close proximity, where energy transfer and extinction can occur. Hybridization of the oligonucleotides self-complementary to their complement in a second oligonucleotide interrupts the fork and increases the distance between the two dyes, thus reducing extinction. A disadvantage of the fork stress is that it is very stable and the conversion to the unrestrained form of hybridization is often slow and only moderately favored, which generally results in poor performance. Tyagi and Kramer (1966, Nature Biotech .14, 303-308) describe a fork labeled as described above, with a sequence of detection in the loop between the self-complementary arms of the fork forming the stem. This stem in basic pairs must be fused in order for the detector sequence to hybridize to the target and cause a reduction in extinction. A "double fork" probe and methods of use are described by B Bagwell, et al. (1994, Nucí Acids Res. 22 2424-2425, patent of E. U. A., No. 5,607,834). These structures contain the target binding sequence, within the hairpin and, therefore, involve competitive hybridization between the objective and self-complementary sequences of the hairpin. Bagwell solves the problem of unfavorable hybridization kinetics by destabilizing the fork with misalignments, thus favoring hybridization to the target. Homogeneous methods, which employ energy transfer and other mechanisms of fluorescence extinction for the detection of nucleic acid amplification have been described. R. Higuchi et al (1992. Biotechnology 10, 413-417) disclose methods for detecting DNA amplification in real time by inspecting the increased fluorescence of ethidium bromide as it binds to double-stranded DNA. The sensitivity of this method is limited, because the binding of ethidium bromide is not the specific target and the above amplification products are also detected. L. G. Lee, et al. (1993. Nuc.Acids Res. 21, 3761-3766) disclose a real-time detection method, in which a doubly labeled detector probe unfolds in a manner specific to the target amplification, during PCR. The detector probe is subjected to hybridization downstream of the amplification primer, so the activity of the 5'-3 'exonuclease of the Taq polymerase, digests the detector probe, which separates the two fluorescent dyes forming an energy transfer pair. . The intensity of the fluorescence increases as the probe unfolds. The published application of PCT WO 96/21144 discloses continuous fluorometric assays in which the enzymatic mediated cleavage of the nucleic acids results in increased fluorescence. The transfer of energy from fluorescence is suggested for use in the methods, but only in the context of a method that employs a single fluorescent tag, which is extinguished by hybridization to the target. The energy transfer and other fluorescence quenching detection methods have also been applied to the detection of a target sequence by hybridization of a specific probe. Japanese Patent No. 93015349 discloses methods for measuring polynucleotides by hybridizing the target of a single strand to a polynucleotide probe of a strand labeled with two tags that form an energy transfer pair. The double-stranded hybrid was unfolded between the tags by a restriction enzyme and the fluorescence of one of the labels was measured. A drawback of this method is that the restriction site in the probe must also be present in the target sequence that is detected. S. S. Ghosh, et al. (1994, Nucí Acids Res. 22, 3155-3159), describes the cleavage catalyzed with a restriction enzyme of the oligonucleotides labeled with a fluorophore, which were analyzed using the resonance energy transfer of the fluorescence. In these assays, the complementary oligonucleotides were subjected to hybridization to produce the double strand restriction site and one of the fluorescent tags is linked to each of the two strands. S. P., Lee, et al. (1944, Anal. Blochem. 220 377-383) describes fluorescence "suppress extinction" techniques, which use restriction endonucleases to split double-stranded DNA. However, these methods refer to assays that employ only one fluorescent tag which is moderated by the interaction with the DNA, not by the transfer of fluorescence energy from a second fluorescent tag. Hybridization of the labeled oligonucleotide to this complement and cleavage of the double-stranded restriction site reduces the non-transfer extinction of the label, so that moderate fluorescence is fully recovered.

Signal initiators (also referred to as detector probes), which subject hybridization to the target sequence downstream of the hybridization site of the amplification primers, have been described for use in the detection of nucleic acid amplification (US patent , No. 5,547,861). The signal initiator is extended by the polymerase in a manner similar to the extension of the amplification primers. The extension of the amplification primer shifts the signal initiator extension product in a manner dependent on the target amplification, which produces a secondary, double-layered amplification product, which can be detected as an indication of the target amplification. Secondary amplification products generated from the signal initiators can be detected by means of a variety of labels and information groups, restriction sites in the signal initiator, which unfold to produce fragments of a characteristic size, capture groups and structural features, such as triple helices and double-stranded DNA-binding protein recognition sites. Examples of detection methods for use with signal initiators are described in U.S. Patent No. 5,550,025 (Incorporation of Lipophilic Dyes and Restriction Sites) and U.S. Patent No. 5,593,867 (Fluorescence Polarization Detection ).

SUMMARY OF THE INVENTION The present invention employs a detector nucleic acid for the detection of target sequences of the nucleic acid by the fluorescence quenching mechanisms. A detector nucleic acid comprises at least two oligonucleotides and is partially of a single cord and partially of a double cord. A first oligonucleotide is subjected to hybridization with at least one second complementary oligonucleotide, which is shorter than the first oligonucleotide, such that any of the 5 'or 3' ends of the first oligonucleotide forms a single-stranded tail region (named as the target binding sequence), which undergoes hybridization to the target sequence. The first oligonucleotide and the second, shorter, complementary oligonucleotide undergo hybridization to form the partially double-stranded detector nucleic acid of basic pairs, terminally, under the reaction conditions selected for primer extension or target hybridization. The first oligonucleotide can be subjected to hybridization to a second single oligonucleotide, so that the detector nucleic acid consists of two oligonucleotides. Alternatively, the first longer oligo-nucleotide may be subjected to hybridization to multiple shorter second oligonucleotides (typically 2-5 second oligonucleotides). The multiple second oligonucleotides subject hybridization to the first oligonucleotide and to each other, so that an oligonucleotide binding structure in 3 ways 4 ways, 5 ways or 6 ways is formed in the double stranded portion of the detector nucleic acid. The detector nucleic acid is further modified to bind to at least two dyes that form a pair of donor / acceptor dyes). Multiple donor / acceptor couples can be linked to a detector nucleic acid consisting of two oligonucleotides, but are particularly advantageous in detector nucleic acids, comprising more than two oligonucleotides. One of the two dyes of a donor / acceptor pair is linked to the first longer oligonucleotide and the other is linked to a second oligonucleotide, so that the dyes are in close spatial proximity, when the first and second oligonucleotides are basic pairs, which results in the extinction of the fluorescent donor dye. If multiple second oligonucleotides are present in the detector nucleic acid, additional donor / acceptor pairs can be linked to the opposite strands of the second oligonucleotides in pairs, so that the extinction occurs. The detector nucleic acid remains in an extinction conformation partially of a single cord, partially of double cord, in the absence of the target. However, in the presence of the target, a second oligonucleotide of the detector nucleic acid is displaced, completely or partially, from the first oligonucleotide, increasing the distance between the donor and acceptor dyes and causing a change in fluorescence. In alternative exemplary embodiments, the invention employs a detector nucleic acid as a signal initiator in target amplification reactions to detect amplification of the target sequence in primer extension methods, based on non-amplification, for the detection of target sequences and in hybridization reactions for the detection of target sequences. The present invention provides an alternative to previously known methods, based on restriction, to separate the donor and acceptor dyes into independent fragments, in the presence of a target. In the present invention, there is no need to design a restriction site on the probe or primer and the restriction enzyme can be removed from the target detection reaction, reducing the cost of the assay.

DESCRIPTION OF THE DRAWINGS Figure 1 illustrates the reaction scheme in which the detector nucleic acid, consisting of two oligonucleotides, is used as a signal initiator, according to the invention. Figure 2 shows the change in fluorescence intensity, which occurs in real time, as an objective is amplified using the nucleic acids of the detector of the invention, as signal initiators. Figure 3 illustrates the reaction scheme where a detector nucleic acid, comprising an oligonucleotide binding structure, exemplified in a board in 3 ways, is employed as a signal initiator, according to the invention. Figure 4 shows the change in fluorescence intensity, which occurs in real time, when a target is amplified using the detector nucleic acids of the invention as signal initiators.

DETAILED DESCRIPTION OF THE INVENTION The present invention employs detector nucleic acids to produce reduced fluorescence extinction in a target-dependent manner. The detector nucleic acids contain a pair of donor / accepted dyes, linked so that fluorescence extinction occurs in the absence of the target. In the presence of the target, the displacement, complete or partial, of a second oligonucleotide in basic pairs intermolecularly, with a first oligonucleotide in the detector nucleic acid increasing the distance between the dyes, reducing the extinction of the fluorescence. Displacement of the second oligonucleotide requires hybridization between the first oligonucleotide and the target. Reduced extinction is associated with a change in a fluorescence parameter (eg, an increase in donor fluorescence intensity, a decrease in acceptor fluorescence or a fluorescence ratio, before and after unfolding) which is monitored as an indication of the presence of the target sequence. Inspection of a change in fluorescence intensity of the donor is preferred, as this change is typically greater than the change in the fluorescence intensity of the acceptor. Other fluorescence parameters, such as a change in the fluorescence lifetime, can also be inspected. Certain terms used herein are defined as follows: An amplification primer is an initiator of the amplification of an objective sequence by the extension of the primer. For SDA, the ^ 31 end of the amplification primer (the target binding sequence) hybridizes the 3 'end of the target sequence. The amplification primer comprises a recognition site for a restriction endonuclease near its 5 'end. The recognition site is for a restriction endo-nuclease which will unfold a strand of double DNA, when the recognition site is semi-modified ("light slices"), as described in U.A. Patent No. 5,455,166; U.S. Patent No. 5,270,184 and EP 0 684 315. A semi-modified recognition site is a double-lane recognition site for a restriction endonuclease in which a strand contains at least one nucleotide derivative, which causes the restriction endonuclease cut the first lace rather than unfold both laces of the recognition site. Usually, the first strand of the semimodified recognition site contains no derived nucleotides and is slightly cut by the restriction endonuclease. Alternatively, the initiator may contain derived nucleotides that cause the unmodified target cord to be protected from cleavage, while the first modified bead is cut off slightly. Such restriction endonucleases can be identified in routine classification systems in which the derivatized dNTP is incorporated into a restriction endonuclease recognition site for the enzyme. Semi-modified recognition sites are semi-phosphorylated recognition sites for HincII restriction endonucleases, BsoBI and BsrI. The amplification primer also comprises the 3'-OH group, which can be extended by the DNA polymerase when the target binding sequence of the amplification primer is subjected to hybridization to the target sequence. For most of the SDA reaction, the amplification primer is responsible for the exponential amplification of the target sequence. Since no special sequences or structures are required to drive the amplification reaction, the amplification primers for the PCR may consist only of the target binding sequences. The amplification primers for 3SR and NASBA, in contrast, comprise the RNA polymerase promoter near the 5 * end. - The promoter binds to the target sequence and serves to drive the amplification reaction by directing the transcription of multiple copies of the RNA Of the objective. The extension products are nucleic acids comprising an initiator or a portion of an initiator and a newly synthesized cord, which is the complement of the target sequence downstream of the initiator binding site. The result is products of extension of the hybridization of an initiator to an objective sequence and the extension of the initiator by the polymerase using the target sequence as a standard. The terms of objective or target sequence refer to the sequences of the nucleic acid to be amplified or detected. They include the original sequence of the nucleic acid to be amplified, its second complementary cord and any cord from a copy of the "original sequence that is produced by duplication or amplification. The target sequence may also be referred to as a pattern for the extension of primers subjected to hybridization. A detector nucleic acid comprises at least two oligonucleotides, the first of which is longer than the others. The oligonucleotides are subjected to hybridization in the detector nucleic acid, so that the major forms the 5 'or 3' tail of a single strand, which undergoes hybridization to the target sequence (the target binding sequence). At least one second base pair of oligonucleotides, shorter, with the major oligonucleotide (i.e., subject to hybridization) adjacent to the target binding sequence. Second shorter additional oligonucleotides can also form basic pairs with each other and / or the first longer oligonucleotide form oligonucleotide binding structures as is known in the art. The detector nucleic acids of the invention further comprise at least one pair of donor / acceptor dyes. The dyes bind to the oligonucleotides of the detector nucleic acid, so that the fluorescence of the donor is extinguished when they form basic pairs intermolecularly, and the displacement of a second oligonucleotide from the first one, results in a decrease in the extinction of the fluorescence. The detector nucleic acids of the invention comprise two or more oligonucleotides (typically about two to six oligonucleotides) that form a partially double-stranded and partially single-stranded nucleic acid molecule under the reaction conditions selected for the first extension or hybridization . A preferred embodiment, a shorter, shorter single oligonucleotide, forms basic pairs intermolecularly with the first longer oligonucleotide, in a portion adjacent to the target binding sequence of the first oligonucleotide, such that at least a portion of the target binding sequence forms a tail 3 'or 5' of a single cord. This type of detector nucleic acid consists of two oligonucleotides. Alternatively, multiple shorter second oligonucleotides form basic pairs intermolecularly to the first longer oligonucleotide and to each other, to form an oligonucleotide binding structure substantially double stranded, adjacent to the target binding sequence. The oligo-nucleotide junctions are known in the art and are described, for example, by D. M. J. Lilley and R. M. Clegg (1993, Annu., Rev. Biophys, Biomol. Struct. 22, 299-328), M. Yang and D. P. Millar (1996, Biochem. 35, 7959-7967), <; T. E. Ladbury et al. (1994) Biochem 33 6828-6833). Y. Wang et al. (100) Biochem 30, 5667-5674) and J. L. Kadrmas, et al. (1995, Nucí Acids Res. 23, 2212-2222). In the detector nucleic acids of the invention, the portion of the first oligonucleotide not involved in the binding structure forms a 3 'or 5' tail of a single strand. These detector nucleic acids typically consist of three to six oligonucleotides, but more complex joint structures, comprising a greater number of oligonucleotides, are possible for use in the invention. As used herein, the term "adjacent to the target binding sequence" means that all or part of the target binding sequence is left in a single bead at tail 51 or 3 ', which is available for hybridization to the objective. That is, the double-stranded portion of the detector nucleic acid does not comprise the entire target binding sequence. A portion of the target binding sequence may be involved in the basic intermolecular pair of the adjacent double cord portion or the entire target binding sequence may form a 5 'or 3' tail of a single bead in the detector nucleic acid. The remainder of the double-stranded portion of the detector nucleic acid is not complementary to the target. Mismatches in the intermolecular base pair portion of the detector nucleic acid may reduce the magnitude of the change in fluorescence, in the presence of the target, but are acceptable when a sensitivity of the assay is not necessary. Mismatches in the target binding sequence of the single strand tail are also acceptable, but may similarly reduce the sensitivity of the assay and / or the specificity. However, it is a feature of the present invention that the perfect formation of basic pairs in the double cord portion and the target binding sequence does not compromise the reaction. However, the perfect match in the sequences involved in the hybridization improves the specificity of the assay without significant negative effects on the reaction kinetics. The detector nucleic acid furthermore dyes a donor dye, which is a fluorophore, and an acceptor for the donor fluorophore. In the nucleic acid detector of two oligonucleotides, one of the two dyes of the donor / acceptor pair is linked to each oligonucleotide comprising the detector nucleic acid, so that the formation of basic intermolecular pairs between the two oligonucleotides leads to the dyes in close spasal proximity and result in fluorescence extinction.If there are two or more second oligonucleotides in the detector nucleic acid, which form an oligonucleotide junction, multiple donor / acceptor pairs can be linked to the first and second oligonucleotides, Thus, the fluorescence of each donor is extinguished by its corresponding acceptor in the binding strand and the extinction is reduced when the joint is interrupted, that is, the two members of each donor / acceptor pair are preferably linked to different oligonucleotides in the nucleic acid detector See, for example, Figure 3. The DNA seals have rotated ulated and analyzed using the fluorescence resonance transfer in the prior art, but these studies were for the purpose of analyzing the stereochemical conformation of the junction, not to detect a selected target and the junctions, therefore, do not include binding sequences target in sen-cillo bead tails (eg PS Eis and DP Millar 1993 Biochem. 32, 13852-13860; M. Yang and D. P. Millar 1996 Biochem 35, 7959-7967; r. M. Clegg, et al. 1994 Biophys J. 66 99-109; R. M. Clegg et al. Br. J. Med. Res. 26, 405-416; R. M. Clegg et al 1992, Biochem. 31, 4846-4856). Preferably, no dye from the donor / aseptic pair is in the 3 'terminal of the single-stranded tail of the detector nucleic acid, when this detector nucleic acid is used as an initiator, since a label of the 3 'terminal can interfere with the hybridization and / or extension of the oligonucleotide. However, a selected donor fluorophore and its corresponding acceptor can be bound at any position in their respective oligonucleotides, which do not inhibit hybridization and / or extension, resulting in donor termination in the detector nucleic acid molecule, partially double cord, and that it provides a change in a parameter of the fluorescence in the somatic or partial displacement of the shorter oligonucleotide. The donor and acceptor their respective oligonucleotides are linked to the detector nucleic acid such that donor fluorescence is extinguished, completely or partially, when the first and second oligonucleotides or the complementary portions of second oligonucleotides form base pairs intermolecualrmente . The extinction occurs when the two dyes are in sufficiently close proximity to the nusleic acid detector, partially of double cord. The dependent interruption target double form with separation of oligonucleotides in basic pairs, each linked to one of the two dyes, increases distansia between partners donor / aseptador and produse an obnoxious sambio in the parameter fluoressensia of either the donor or the acceptor, due to reduced extinction. Both members of the pair can be linked to the sequences involved in the formation of intermolecular hydrogen bonds in the double-stranded portion of the detector nucleic acid. Alternatively, one member of the pair may be linked within the sequence of basic pairs of a shorter second oligonucleotide and the other may be linked to the target binding sequence of a single strand of the first longer oligonucleotide, subjected to hybridization thereto. . Preferably, both dyes are linked so that they are both incorporated into intermolecular base pairs of the detector nucleic acid (i.e., a dye at or near each of the two complementary sequences, which are involved in the intermolecular base pairs). Commonly, the general length of the sequencies involved in the basic intermolecular pairs, between the first oligonucleotide and a second oligonucleotide, in the nusleiso detector, is not critical. The appropriate length is determined by the number of nucleotides required for the stable base pair and maintaining a partially double-stranded molecule under the selected restriction conditions. For sonveniensia, the sesuences involved in the basic pair of the first oligonucleotide / second oligonucleotides are typically between about 8 and 75 nucleotides in length. The maximum length is limited only by practical interests, such as the ease and efficiency of the synthesis and recovery of the oligonucleotides. The length of sequences involved in intermolecular basic couples between second oligonucleotides in a seal structure is selected such that the Tm is low enough to cause the second oligonucleotides to dissociate from each other in simple cords under the condisiones reaction, when the structure of the oligonucleotide junction is displaced from the first oligonucleotide. The sequelae implied in the base pair between second oligonucleotides are, therefore, relatively short (for example, about 2-10 nucleotides). The sequencing of the double cord portion of the nusleiso detector is also selected so that at least one portion of it is not somplent to the target and is relatively stable at the temperature of reassurance that serves for its interruption. However, it must be so stable that the hybridization to the target is unacceptably slow or so stable that the polymerase is unable to displace the second oligonucleotide from the first oligonucleotide for the synthesis of the complementary strand. Preferably, the Tm of the double-stranded portion of the detector nucleic acid, which involves hybridization between the first oligonucleotide and a second oligonucleotide is equal to or greater than the temperature at which the displacement reaction will occur, but may be minor. If the Tm of this segment is less than the reaction temperature, more than half of the detector nucleic acid molecules will be single-stranded, completely independent of the target's presensia. This reduces the sensitivity of the assay, but may be acceptable when relatively high target sanctities are present. Typically, the Tm of the double-stranded portion of the nucleic acid detestor, which cleaves the hybridization between the first oligonucleotide and the second oligonucleotide is selected to be equal to or up to about 30 ° C higher than the temperature of the reaction displacing the second oligonucleotide. More preferably, the Tm is about 10-202C greater than that of the reaction displacing the second oligonucleotide. At the junction of the oligonucleotide, sequencing »Implied in the basal pair between the second oligo-nusleotides are selected so that there is a stable hybridization between the second oligonucleotides under the sesionsionate remission sounds, when the binding structure is subjected to hybridization in the first oligonucleotide and the hybrids are destabilized and dissociate, at least partially, under the selected reaction conditions, by suing the oligonucleotide junction we are not subjected to hybridization to the first oligonucleotide. The Tm of the hybrids between the second oligonucleotides can be used as is known in the art, to adjust the sequencing of these second oligonucleotides to obtain this result, and is generally selected to be approximately equal to or lower than the reaction temperature. The length and composition of the nucleotide of the sesuensias implied in the base pairs is a fastor that affects the Tm, with the longest sequels and sesuensias laughter relatively in AT, generally contributing to a lower Tm. The presence of the polymerase in certain assays can increase the stability of the double shank porsiones of the molecule, partially compensating the effects of the increased temperature. Because the second oligonucleotide is shorter than the first oligonucleotide, to which it undergoes hybridization, the porsión of the first oligonucleotide, which is not an intermolesular base pair, is the second oligonucleotide, forms a single one of a single 5 'or 3' siren. . The porsión of alone of a cord of nucleic acid detestor is somplementaria to the objective sesuensia that is going away to detest and serves to subject to hybridization the acid nusleiso detestor to the objective sesuensia. The other sarasteristics that are complementary to the target sequence are generally not critical, so that the sesuensia of the sequence alone is preferably selected so that it forms a stable double type with the target under the selected selection conditions and supplies the desired degree of thickened thickener. Detentsion fission, as is known in the technique. In order to favor hybridization to the target, the sesuensia of the tail region binding to the single-stranded target of the first oligonucleotide is also preferably sequestered such that the Tm of the sesuensia duplex / target binding target is equal to or greater than the temperature of reassurance. Although the sesuensia of the target binding region is distant by the sesuensia of the target to be detested, adjustments in the Tm of the target binding sequence of the nucleic acid debris may be hesha, for example, by adjusting its length. In a first modality, the nusleisos detestores of the invention can be used as signal inisiators in the amplification reactions, in order to generate secondary amplification products, they are an asymbiant sambio in a parameter of fluoressensia. When a signal initiator is used in reactors of nucleic acid amplification, the single-stranded single-stranded solid nuselic detector comprises the 3'-end of the first oligonucleotide to allow extension of the primer. The double-stranded portion of the nucleic acid detestor is, therefore, 5 'to the target binding sesuensia, suando the acidic nusleiso detestor is used as a signal unstable. The term "51 to the target binding sequence" indicates that all or part of the target binding sequence is present as a single 3 'of a single siren. That is, the segment of the first oligo-nucleotide involved in the formation of an intermolecular basic pair with a second oligonucleotide may comprise a portion of the target binding sequence or all the target binding sequence may be present in the 3 'tail of a single cord. The reactivation of the signal initiator of the hard nusleiso detestor of two oligonucleotides is illustrated in Figure 1 as an example, and can be summarized as follows. By means of the single sordum of the first oligonucleotide, the signal inisator of the strong nusleysis testis subject to hybridization to a sordum of the target sesuensia, which is deafened below an amplification amplifier. Both the amplification amplifier and the first oligonucleotide are extended by the DNA polymerase using the target sesuensia as a standard. The extension produst of the first oligonucleotide with the second oligonucleotide still subjected to hybridization to it, is displaced from the pattern by the extension of the upstream amplifisation initiator. The hard nusleiso detestor is even parsially of double cord, after the displacement of the extension product of the first oligonucleotide from the target. The extended, displaced nucleid acid in turn serves as a pattern for the hybridization and extension of a second amplification initiator, making the portion of a cord of the nusleiso acid extension product double-siren responsive. Polymerization of a new siren complementary to the first oligonucleotide also displaces the second oligonucleotide due to the polymerase cord displacement activity and separates the member of the donor / aseptic pair linked to the first oligonucleotide from the linked donor / aseptor member to the first oligonucleotide. second oligo-nusleotide. If multiple second oligonucleotides are hybridized to each other in an oligonucleotide joint scaffold in a signal initiator of the detector nucleide acid (illustrated in Figure 3, for example), synthesis of the complementary strand of the first oligonucleotide displaces the joint structure from the first oligonucleotide. The regions of the basic pair between the second oligonucleotides at the junction of the oligonucleotides are sufficiently large that they dissociate into single sordons, suando separating from the first oligonucleotide, separating the members of the donor / acceptor pair in separate single strands. . A second nucleic acid detestor, the sual subject to hybridization to a second complementary cord of an objective sequencing of double sordum, can, opsionally, be included in the reassessment (not shown in Figures 1 and 3). The second arid nusleiso detestor submits to hybridization to the second sordum of the target sequence downstream of the second amplification initiator and extends and displaces through the extension of the second amplifisation initiator. The porsión of a cord of the second extension product of the naked nusleiso detector is made of double cord with the displacement of the second oligonucleotide or joint by the hybridization and extension of the first amplifisation initiator. Multiple stray nusleisos deterstores per target sordum can be used, if desired, one by subjecting to hybridization to the target sequence downstream of the other in the same cord, and all detector nucleic acids being subjected to downstream hybridization of the amplification inisator. . In this manner, each nucleic acid deformer is displaced by the extension of the upstream detector nucleic acid and the nusleiso detesting acid 51 is displaced by the amplification amplifier. The use of nusleisos acids multiple detestores has the advantage of increasing or amplifying the signal generated by objective, with an increase in the sensitivity of the test. As shown in Figures 1 and 3, the portion of a single cord of the nusleiso detesting acid is converted to the double-siren form by the hybridization and extension of an amplification inisator. The displacement of the cord by the polymerase also displaces one or more second oligonucleotides from the first oligonucleotide, as the polymerase synthesizes the complement of the first oligonucleotide. As the polymerase bead shift activity separates a second oligonucleotide linked to a member of the donor / acceptor pair from the first oligonucleotide linked to the partner partner, the distance between the donor and acceptor dye is increased, thus reducing the extinction of the fluoressensia of the donor. It is desir, the second displaced oligonusleotide, of a single sordum, and the first oligonusleotid, of double sordum, thus produced, since one is linked to one of the two dyes, and are free to diffuse independently in the reassuming solution. The redussion in the extinction is increased by adding additional donor / aseptor pairs are linked to additional second oligonucleotides, subjected to hybridization to the first oligonucleotide and / or to each other. As the joint structure of the displaced oligonucleotides dissociates into single strands, the redussion in the extinction of donor fluorophore SARA contributes to the total increase in the fluorosurgery. The associated sambio in the fluoressensia of any donor or acceptor dye, can be inspected or detested as an indiscrimination of the amplification of the objective sesuensia. An increase in the fluorescence intensity of the donor or a decrease in the intensity of the fluidity of the aseptor, may be detested and / or insensured as an indiscrimination that the objective amplification is oscillating or has waned, but other parameters of the fluorescence that are affected by the proximity of the dye pair of the donor / acceptor (for example, the fluorescence lifetime) may also be insensitive. A change in the fluorescence intensity of the donor or acceptor can also be detested by a change in the ratio of the fluorescence intensities of the donor and / or acceptor. For example, a change in fluorescence intensity can be detected as a) an increase in the fluoressen-sia ratio of the donor fluorophore, after the displacement of the second oligonucleotide and the fluorophore of the donor fluorophore in the nucleic acid detector , before the displacement of the second oligonucleotide or b) when the aseptor is a fluorophore, as a decrease in the fluorescence ratio of the acceptor, after the displacement of the second oligonucleotide and the fluorescence of the acceptor in the nucleic acid debris before the displacement of the second oligonucleotide . It will be evident that, in addition to the SDA, the nusleisos dentstores of the invention can be adapted for use as signal insulators in other amplification methods of extension of the inisator (for example, PCR, 3SR, TMA or NASBA). For example, the methods can be adapted for use in PCR by the use of PCR amplification inisiators and the strand displacement of the DNA polymerase, which lacks the exonuslease astivity - 5 '- »3' (per example the Taq Sequence Grade of Promega or exo Vent or exo Deep Vent of New England Biolabs) in the PCR. The signal inisiators of the naked nusleic detector subject to hybridization to the target downstream of the amplifisation primers of the PCR. They can be extended, displaced from the target and double-strand haserse are displacement of the second oligonucleotide or the oligonucleotide array, essentially as described for SDA. As in the SDA systems, the displacement of the second oligonucleotide and the separation of the pairs of donor / acceptor dyes, reduces the extinction of the fluoressensia, they are a sambio in a parameter of this fluoressensia, such as the intensity, serving as an indication of the objective amplification. For the adaptation of the methods of the invention to the 3SR, TMA or NASBA systems, an exonuclease 5'- >is used; 31, defiscient in the reverse transsriptase, are swaying displacement astivity, are the hybridization of the acidic nusleiso detestor to the target of the sorrum RNA downstream of an amplifisation inisator, which is a promoter of the RNA polymerase. In a resection scheme similar to that previously discussed, the hybrid detector nucleus subjected to hybridization, which comprises the second oligonucleotide subjected to hybridization, is: 1) extended and 2) displaced by the extension of the upstream amplifier. The produsto of displaced extension is then completely double-stented by the hybridization and extension of the second amplifisation initiator. This displaces the second oligonucleotide or the oligonucleotide junction from the first oligonucleotide of the nucleic acid buffer, increasing the distance between the dyes of the donor and the aseptor and reducing the fluoride extinction of the donor fluorophore. The signal instar of the naked nusleiso detector for 3SR or NASBA, does not contain a sequence of the RNA polymerase promoter and, therefore, can not function as an amplifisation initiator, reducing the nonspecific background signal. This is analogous to the signal initiator in SDA, which does not contain a RERS that can be cut off slightly and, therefore, does not contribute significantly to the exponential background amplification of non-specific targets. For the reduced background, it is preferred that the antisense nucleic acids be used as signal insulators in the methods of the invention, with the nucleic acid extension product being separated from the target sesuensia by displacement due to the extension of the non-target upstream amplification However, it will be evident that the amplification amplifiers for use in several amplification reassinations of the nucleic acid can also be modified by the addition of an intermolecular base pair sequence 51, as described for the signal initiators of the nucleic acid detector. . In this embodiment, the extension product of the amplifisation initiator, are the double-cord portion 51, can be separated from the target sequence by displacement due to the extension of a non-amplifisation initiator upstream (for example, quenching inhibitors). , as in SDA), by denaturation (for example, salting out in the PCR) or by enzymatic digestion of the target sordum (for example, RNase H in 3SR). The amplification inhibitors comprising the 5 'double-stranded portion and the donor / acceptor dye pair eliminate the need for the nusleid additive detestor in the reaction, but, because the background may be higher in this embodiment, the The sensitivity of the assay can be diminished. For PCR, the amplifisation primer is modified by the addition of 5 'sequences to the target binding sesuensia, which are complementary to the second oligo-nusleotide. This second oligonucleotide is then subjected to hybridization to the added sequence 51. This inisator is stridently identical to the signal unstable of the strong PCR detector nucleic acid, described above. However, functionally, it is different in that there is no downstream initiator that extends and displaces and the amplifying amplifier itself supplies the sambium in the fluorescence. For the 3SR, NASBA and TMA systems, the somplementary sequencing to the second oligonucleotide can be collimated 5 'to the promoter of one amplification inisator and the second oligonucleotide subjected to hybridization thereto, so that the second oligonucleotide or oligonucleotide junction, is displace and the first oligonucleotide is completely double-stranded in the double-strand DNA portion of the amplifisation cycle. A second amplifissionist inisator, the sual does not contain a promoter sequence (eg, as in NASBA) can also alternatively contain the somplementary sequencing to the second 5'-oligonucleotide subjected to hybridization to the target binding sequence. In alternative modalities, the strong nusleic detector can be used in assay formats based not on amplifisation, to detest target oligonucleotides. In a first non-amplifisation modality, the target binding sesuensia of a single 3 'sordum of the first oligonucleotide of the detecting nucleic acid undergoes hybridization to the 3' end of the target oligonucleotide, such that the double portion of base pairs of the nucleo acid detestor forms a soldering part 5 *. The target sesuensia functions as an initiator in an extension reaction of the primer to synthesize a cord complementary to the first oligonucleotide, using a strand displacement polymerase, which extends the target sequence using the 5 'soldering part (i.e. the sequencing of the first oligonusleotide that is a basic pair to the second oligo- nusletide) as a pattern. If the target binding sequence of the detecting nucleic acid undergoes hybridization to only a portion of the target sequencing, this target sequence also forms a 5 'pendant part and the first oligonucleotide of the detector nucleic acid similarly extends using the pendant part 51. of the goal as a pattern. If the objective binding sequence of the nusleiso detector is complementary to the entire length of the target sequence, only the objective is extended. In any case, one or more second oligonucleotides of the nucleic acid deformer are thus displaced from the first oligonucleotide are an accompanying sambium in the parameter of the fluoressensia. The extension and displacement of one or more second oligonucleotides to produce a sambio in the fluoressensia sual takes place only in the target's presensia. In a second modality, based on non-amplification, according to the invention, the first oligonucleotide of the detecting nucleic acid is subjected to hybridization to the target sesuensia, so that a sambium occurs in the fluorescence in the hybridization. The target binding sequence of a siren can, therefore, be at either end 51 or 3 'of the first oligonucleotide when the nucleic acid testifier is used as a hybridization probe. That is, because the extension of the primer is not necessary, the double-stranded portion of the detector nucleic acid can be anywhere from 5 'or 3' to that of a siren, optionally comprising a portion of the target union sequence. In this embodiment, the intermolesularly basal portion of the nucleic acid detestor preferably suffers a portion of the target binding sesuensia is the remaining target binding sesuensia present in the sole of a single 3 • or 5 'siren, which is available for the non-sompetitive hybridization of the objective. The hybridization interrupts, partially or completely, the double porsión of the nucleic acid detestor, which results in the displacement, parsial or total, of the second oligonusleotide, the increased distance between the two dyes and the redusid fluorescence extinction. However, changes in fluorescence in hybridization can also be observed when the target binding sequence is entirely in the tail of a single cord of the nucleic acid detestor and not in the base pair between the target and the sesuensia of the first oligonucleotide implied in the base pair are the second oligonelothionid if possible. When the target is present, the hybridization probe of the nusleis testis inisially undergoes hybridization to it in a non-sompetitive way, by means of the tail of a single cord. This leads to any sequence complementary to the target of the first oligonucleotide that could be present in the double porsión of the nusleiso testis in close proximity to the stresses of its sompleme-tarian sesuensias in the target. The objective binding sesuence of the first oligonucleotide in the double portion undergoes hybridization to its somplementary sesuensia in the target, thus interrupting the intermolecular base pair in the detecting nucleic acid and increasing the distance between the donor dyes and the aseptor sonforme the second oligonucleotide is, parsial or sompletely, displaced from the first oligonusleotide by sompetitive hybridization. The resulting sambio in the fluorescence parameter can be detected as an indiscrimination of the target sesenia presensia. The binding of the single 5 * or 3 'of a single sordum of the first oligonucleotide to the target sesuence, is believed to facilitate the interruption of the double-nucleic acid buffer by retaining the somplementary sesuensias of the target and the base pair porsion of the first oligonucleotide in close proximity , favoring better the intermolecular base pair between the first oligonucleotide and the target. Such cooperative binding may allow the target sompite to more effectively screen the corresponding sequence in the second oligonucleotide for hybridization to the first oligonucleotide. Without the cooperative union provided by the target binding sequence of a single sordum in the 3 'or 51 tail of the first oligonucleotide, the double portion of the nucleic acid detestor will tend to remain intact and little or no change in fluorescence is likely observed, yet in the presence of the objective. Therefore, it is an interesteristisa of the invention that the target is not required inisially to subject hybridization to the base pair sequences in the detector nucleic acid. The institial somatic hybridization reduse the affinity of a probe or inisator for the target and decreases the sensitivity of the assay. In contrast, the non-somatic inisial junction of the invention best promotes intermolecular hybridization in any subsequent competitive hybridization reaction. The length of the 3 'or 5' tail of a single sordum can be adjusted without affecting the thermodynamic properties of the double portion of the nucleic acid detestor, so the objective hybridization can be optimized without requiring the redesign of the double porsión of the nusleiso acid detestor. This greatly simplifies the probe and the design of the invader in somparasión are the previous tisane. In addition to detesting the presence or absence of the target and detesting the amplifisation of the target, the nucleic acid detectors of the invention can be used as primers or hybridization probes to distinguish between targets that differ by one or more nucleotides. To perform such analyzes, the sequence of target binding in the single-siren of the robust nusleysus testis is sequestered so that stable hybridization to the target occurs only when this hybridization is intensified by the base pair of the target, with one or more nucleotides. of the first oligonucleotide involved in the intermolecular base pair in the double porsión of the nusleiso detestid. This strong nusleiso detestor is further designed so that hybridization to a target containing one or more nusleotide differences is detested, which will result in one or more base pairs unadjusted in any of the sesuensia alone or in the sesuensia of the first oligonucleotide , which undergoes hybridization to the second oligonucleotide. The reduced stability of the mismatch in conjunction with the competition of the rehybridization of the first and second oligonucleotides, reduse the hybridization to the target that are one or more differentiations in nusleotides, thus reducing the magnitude of the sambio in the fluoressensia in somparasión are a goal that perfectly matches (ie, an objective with no differences in nucleotides). The increasing numbers of maladjustments produced minor symbiosis in the fluoressensia. Minor maladjustments result in greater sembios in the fluoressensia. As the number of imbalances decreases, the magnitude of the change in fluorescence is similar to that observed for sesuensias that are perfumed to the point of dissimilarity in simple nucleotides. Similar methods can be used to detect frame shift mutations. The change in fluorescence, which results from displacement, complete or partial, of the second oligo-nucleotide can be detected at a selected end point of the reaction. However, because secondly displaced oligonucleotides, either completely or partially, are produced by the hybridisation or extension of the inisator, the sambio in the fluorescence can also be inspected sonforme osurre the reassignment, that is, in "real time". This homogeneous real-time test format can be used to provide semi-quantitative or sub-quantitative information about the inital sanctity of the present objective. For example, the regimen in the sual the intensity of the fluorescence changes during the second reassignment of oligonucleotide displacement (or as part of the objective amplifisation or in non-amplification detection methods) is an indication of the initial target levels. As a result, when more initial copies of the target sesuensia are present, the donor's fluoressensia arrives more quickly at a selessioned threshold value (ie a shorter time to positivity). The decrease in the aseptic fluoressensia similarly exhibits a shorter time for positivity, detected as the time required to reach a selected minimum value.

In addition, the rate of change in fluorescence parameters, during the course of the second oligonucleotide displacement reaction, is faster in samples that have higher target inities than in samples that are less than the target inities (ie increased inset of the fluorescence curve). These or other measurements, as is known in the art, may be an indiscrimination of the target's foresight or an indication of the amplification of the target. The initial amount of the objective is typically determined by somparasion of the experimental results to the results for sanctities sonosidas of the objective. Tests for the presensia of a selected target sesuence, according to the methods of the invention, can be performed in solution or in a solid phase. The homogeneous tests of the real time or end point in which the functions of the nusleiso of the detestor, works as an initiator, are carried out typically in solusion. Hybridization assays using the nusleisos of the invertebrate of the invention can also be performed in solvation (for example as heterogeneous real-time assays), but they are also particularly well suited to solid-phase assays for real-time detection. or end point of the objective. In a solid-phase assay, the acidic detector nuclei can be immobilized on the solid phase (e.g., in beads, membranes or the reaction fissure) by means of internal or terminal labels, which use the methods known in the art. For example, a strong nusleiso detector, labeled with biotin, can be immobilized on a solid phase modified with avidin, where it produces a change in fluorescence when exposed to the target under appropriate hybridization condi tions. The saptura of the objective, in this way, fasilita the separation of the objective of the sample and allows the removal of the substances in the sample, which could interfere with the detest of the signal or other aspects of the test. Mushas pairs of donor / aseptic dyes, the suals are sonosides in the tisane, are useful in the present invention. They include,. for example, fluorescein isothiocyanate (FITC) / tetramethylrhodamine isothiocyanate (TITC), FITC / Texas Red ™ (Molecular Probes), FITC / N-1-hydroxysuccinimidyne pirenbutyrate (PYB), FITC / isothiocyanate essin (EITC). 1-pyridine-hydroxy-succinimidyl (PYS) / FITC, FITC / Rhodamine X, FITC / tetramethylrhodamine (TAMRA), and others. The separation of a fluorophene partner from the donor / aseptor is not critical. For energy transfer extinction mechanisms, it is only necessary that the wavelengths of the emission of the donor fluorophore overlap or overlap the excitation wavelengths of the aseptor, ie, there must be sufficient spectral overlap between the two dyes , to allow efficient energy transfer, charge transfer or fluorescence quenching. P- (dimethylaminophenylazo) -benzoic acid (DABCYL) is a non-fluorescent acceptor dye that effectively quenches fluorescence from an adjacent fluorophore, for example fluorescein or 5- (2'-aminoethyl) -aminonaphthalene (EDANS). Certain donor / acceptor pairs were exemplified above and will be exemplified in the following Examples, however, others will be apparent to those skilled in the art and are also useful in the invention. Any pair of dyes that produces the extinction of the fluoressensia in the nusleisos that are the detesters of the invention, are adesuados for the use in the methods of the invention, independently of the mechanism by which this extinction occurs. Terminal and internal labeling methods are also known in tetanus and can be used, routinely, to link donor and aseptic dyes to their respec- tive sites in the highly sensitive nucleic detector.

The target DNA for the following experimental examples were prepared from elemental body materials (EB) of Chlamydia trachomatis, stored at consensuses of 106 EB / μl, in 50% glycerol. The EB material solutions were diluted 1:10 in water, boiled for 15 minutes and prepared as serial dilutions 10 times in 10 ng / μl of human placental DNA. The donor fluorophore was scavenged to the 5'-phosphate. The measurements obtained were the SLM 8100 research grade fluorometer, equipped with a cirsulasión bath, maintaining the sample's sample temperature, a xenon arso lamp and grid monochromators, to control the exsitation and emission of the lengths cool. The experiments with fluorescein (FAM), as the donor used, was 488 nm for the excitation of the wavelength and 525 nm for the emission.

EXAMPLE 1 The SDA was generally performed as disclosed in patent EP 0 684 315, they are the admission of a signal inisiador of the hard nusleiso detestor, labeled at the end 51 of the first oligonusleotide are FAM and at the 3 'end of the second oligonucleotide They are Dabsyl. The final concentrations of the somponents in 1 JD0 μl of the reassessment mixture were 40 mM KP04, pH 7.5, 6 M MgOAs, 0.2 mM, each of dTTP, dGTP, dATP, 1.4 mM of dCTPaS, μg / ml acetylated BSA, 3% DMSO, 8% (volume / volume) of glycerol, 100 ng human plasma DNA, 25 units of Bst polymerase (exo fragment, New England BioLabs), 150 units of Aval ( New England BioLabs, Beverly, MA), and DNA of 0, 10, 100 or 1,000 elemental Chlamydia trachomatis bodies, each sample also containing the following primers in the indexed consentrasiones: Detecting Nucleic Acid (Primer Oligonucleotide, SEQ ID NO: 1, 200 nM) TAGCCGACGTGCGAGCCGATAGAGTCTTCAAATATCAGAGCTTTACC TAACAA Detecting Nucleic Acid (Second Oligonucleotide, SEQ ID NO: 2, 400 nM) ACTCTATCGGCTCGCACGTCGGCTA Amplification Initiator S1.1 (SEQ ID NO: 3, 750 Nm) ACCGCATCGAATCGATGTCTCGGGTAGAAAATCGCATGCAAGATA Amplification Initiator S2.1 (SEQ ID NO: 4, 188 nM) CGATTCCGCTCCAGACTTCTCGGGAGCTGCCTCAGAATATACTCAG Buffer Initiator B1 (SEQ ID NO: 5, 75nM) TAAACATGAAAACTCGTTCCG Buffer Initiator B2 (SEQ ID NO: 6, 75 nM) TTTTATGATGAGAACACTTAAACTCA The harsh nusleiso detestor contained a sesuensia (underlined) that was somplementary to both the target and the second oligonucleotide. Target sample 0 also contains 5 mM EDTA to disable SDA reaction. Each resection was assembled to hold all the exstpto reastives Bst and Aval, and the samples were then heated for 2 minutes to 95se. They were transferred to a water bath at a temperature of 53.52C for 3-5 minutes and the enzymes were added for a total volume of 100 μl. The samples were then transferred to 225 μl cuvettes and colosated in an SLM 8100 research-grade spectrofluorometer (Spestronis Instruments, Rochester, NY). The temperature of the cuvettes was maintained at 53-54 by circulating a water bath, and the emission of the fluoressensia was recorded at 520 nm (? Excitation = 488 nm), after 8 seconds. The reassessions were followed typically for 60-90 minutes. The results are shown in Figure 2. The fluoressensia remained low (extinguished) in the control reuptake, in the sual the amplification was disabled, but it increased considerably in reactions that are 10, 100 and 1,000 targets, demonstrating the thickened aftereffect of the objective amplification. In addition, the regimen of increased donor fluorosurgery intensity (a measure of the rate of decline in the donor's extinction) was faster in samples containing higher numbers of the initial target. The rate of increase in the donor fluoressensia, therefore, provides not only the amplification of real time, but also a semi-quantitative or relative measure of the levels of the inital target. Comparing the rate of increase in the fluoressensia in a sample that is a sanctity dessonosida of the objective to an increase in the fluorescence in a series of reassiones that are have several sanidades sonosidas of the objective (that produse a surva standard, as it is known in the technique), you can obtain a suantitative measure of the target levels in the unsignalized sample. Alternatively, the detest of an increase in fluorescence intensity above a predetermined threshold value may be used as an indiscrimination where the target is present and amplified in a positive / negative test format.

EXAMPLE 2 The experiment of Example 1 was repeated, substituting a nucleic acid detestor, in the sual the binding sesuensia of the target of the first oligonusleotide does not extend in the double siren portion of the molecule (SEQ ID NO: 1, labeled in the 5 'end with fluorescein) TAGACGTGCGAGCGGACTCAGTCTTCAAATATCAGAGCTTTACCTAACAA SEC. ID NO: 8, labeled at the 3 'end with either Dabcyl or ROX, the second oligonucleotide was used in the detector nucleic acid and was present in the reaction in a 3 fold excess over SEQ ID NO: 7. this experiment, the control sample 0 did not contain any objective. The results are shown in Figure 4. The fluoressensia remained low (extinct) in the sonoid reassessment that is not targeted (without amplification) but increased considerably in reactions that are 100, 1,000, and 10,000 targets, demonstrating the skeletal deprecation of the objective amplifisation. As before, the regime in the increase in the intensity of the donor fluoressensis was faster in samples that have higher numbers of the initial objective, providing a semi-quantitative or relative measurement of the inital objective levels, as well as elements for the quantitative measurement of the target levels in an unskilled sample.

EXAMPLE 3 A nuclide nucleic acid, which synthesizes a joint estrus of oligonucleotides in three forms and pairs of donor / aseptic dyes, was designed using the following oligonucleotides: First oligonucleotide (SEQ ID NO: 8, labeled at the 5 'end are fluorescein) GGAGCGAGCGA? GTGTCCTGGCTAGAGTCTTCA? ATATCAGAGCTTTACCTAACAA Second oligonucleotide # 1 (SEQ ID NO: 9, labeled at end 3 • with fluorescein) GCCAGGACACGGAGAGG Second oligonucleotide # 2 (SEQ ID NO: 10, labeled at the 5 'and 3' ends with Dabacyl) CCTCTCCCGCTCGCTCC Two 100 μl substrates, which are 50 mM TRIS-HC1, pH 8.0, 10 mM MgCl2, 50 mM NaCl, 10 mM dTTP, 10 mM dCTP, 10 mM dGTP, 10 mM dATP, units of exo-Klenow and various sanctities of the nusleiso detestor of the board of 3 forms (40 nM, SEQ ID NO: 8, 50 nM SEQ ID NO: 9 and 100 nM SEQ ID NO: 10, were prepared and solved in a SLM 8100 fluorometer, with the sample chamber presened at 372 C. The sonet reassessment was a strong nonselium debris that was found in the first oligonucleotide (50 nM SEQ ID NO: 8) and a second single oligonucleotide (100 nM SEQ ID NO: 10) , resulting in a strong nuselic detector having a single pair of dyes, the initial emission scans were taken (excitation at 488 nm, slots at 1 nm / 1 nm: emission at 520 nm, slots at 5 nm / 5 nm) The intensity of the fluoressensia was inspected as a function of time to verify the absence of float-bleached.After a few minutes, 400 nM of a complementary primer to the end 31 of SEQ ID NO: 8 (JBP59, TTGTTAGGTAAAGCTCTGATATTTGAAG, SEQ ID NO: 11) were added to the subeta sada to begin the extension of the polymerase. When the intensity of the fluoressent signal has stabilized, the emission explorations were repeated. The results are shown in the following table: TABLE These results show a greater increase in the intensity of the fluoressensia, in the presence of the target for the nucleic acid joint detestor of 3 forms, in somparasión they are the very hard nusleiso detestor that sonsta of only a second oligonusleotide sensilla and a pair of dyes. It is desir, the presensia of the additional "arms" in the porsión of double cord of nucleic acid detestor, supplied by the estrustura of board of the oligonucleótido, allows the link of the pairs of donor / aseador fluoressente adisional, that increases the sambio in the fluorescent signal in the presence of the objective.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: Nadeay, James G. Hsieh, Helen V. Pitner, James B. Linn, Carl P. (ii) TITLE OF THE INVENTION: Detention of Nucleic Acids by Extinction Fluorescence (iii) NUMBER OF SEQUENCES: 10 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: RJ Rodrisk, Beston Diskinson and Company (B) STREET: 1 Beston Drive (C) CITY: Franklin Lakes (D) STATE: NJ (E) COUNTRY: E.U.A. (F) Postal Zone: 07417 (V) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIA: Floppy disk (B) COMPUTER: IBM COMPATIBLE PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (Vi) CURRENT DATA OF THE APPLICATION: (A) NUMBER OF THE APPLICATION: (B) DEPOSIT DATE: (C) CLASSIFICATION: (Üi) INFORMATION OF THE EMPLOYEE / AGENT: (A) NAME : Fugit, Donna R. (B) REGISTRATION NUMBER: 32,135 (C) REFERENCE NUMBER / FILE: P-3749 (2) SEC. ID NO: 1 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: sensillo (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEC ID NO: l TAGCCGACGT GCGAGCCGAT AGAGTCTTCAAATATCAGAG CTTTACCTAACAA 53 (2) INFORMATION OF THE SEC. ID NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 ACTCTATCGG CTCGCACGTC GGCTA 25 (2) INFORMATION OF THE SEC. ID NO: 3 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 45 basic pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (i) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 ACCGCATCGA ATCGATGTCT CGGGTAGAAA ATCGCATGCA ÁGATA 45 (2) INFORMATION OF THE SEC. ID NO: 4 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 46 basic pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 CGATTCCGCT CCAGACTTCTCGGGAGCTGC CTCAGAATAT ACTCAG 46 (2) INFORMATION OF THE SEC. ID NO: 5 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 basic pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5 TA? ACATGA? A? CTCGTTCC G 21 (2) INFORMATION OF THE SEC. ID NO: 6 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 26 base pairs (B) TYPE: rough nusleiso (C) TYPE OF CORD: sensillo (D) TOPOLOGY: linear (Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6 TTTTATGATG AGAACACTTA AACTCA 26 (2) INFORMATION OF THE SEC. ID NO: 7 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 base pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7 TAGACGTGCG AGCGGACTCA GTCTTCAAAT ATCA AGCTT TACCTAACAA 50 (2) INFORMATION OF SEC. ID NO: 8 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 56 basic pairs (B) TYPE: nucleic acid (C) TYPE OF CORD: sensillo (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8 GGAGCGAGCG AAGTGTCCTG GCTAGAGTCT TCAAATATCA GAGCTTTACC TAACAA 56 (2) INFORMATION OF THE SEC. ID NO: 9 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: rough nusleiso (C) TYPE OF CORD: simple (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9 GCCAGGACAC GGACAGG 17 (2) INFORMATION OF THE SEC. ID NO: 10 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 basic pairs (B) TYPE: nusleiso acid (C) TYPE OF CORD: sensillo (D) TOPOLOGY: linear (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10 CCTCTCCCGC TCGCTCC 17.

Claims (11)

1. CLAIMS 1. A method to detect the presence of an objective sesuensia of nusleiso, this method consists of: a) subjecting to hybridation the objective sesuensia and a strong nusleiso detestor, the sual includes: i) a first oligonusleotide subjected to hybridization with a second oligonucleotide, which is shorter than the first oligonucleotide, so that the nucleic acid detestor somprenda a porsión in basal pair intermolesularly and a target binding sequence of a single cord, and ii) a first and a second dyes, forming together a pair of donor / aseptic fluorescent dyes, linked to the strong nusleiso dementor, so that the fluoressensia of the first or second dye is extinguished; b) in a recession of extension of the inisator, synthesizing a somplementary sordum to the first oligonucleotide, thus displacing the second oligonucleotide from the first oligonucleotide and producing a sambio in a parameter of fluoressensia and s) detesting the sambio < = n the fluoressensia parameter is an indication of the presence of the target sequence.
2. 2. The method of claim 1, wherein the somplementary cord is synthesized in an amplifisation reaction of the target.
3. 3. The method of claim 1, wherein the somplementary sordum is synthesized by the extension of the target sesuensia, which uses the first oligonucleotide as a standard.
4. 4. A method to detest the amplifisation of an objective sequence, this method comprises, in an amplification reaction: a) subjecting to hybridization the objective sequencing and a strong nusleiso detestor, which includes: i) a first oligonucleotide subjected to hybridization are a second oligonucleotide , the sual is shorter than the first oligonucleotide, so that the nucleic acid detestor somprenda a porsión in basic pair intermolecularmente and a target binding sequence of a single cord, and ii) a first and a second dyes, which together form a pair of fluorescent dyes of donor / acceptor, linked to the nusleiso detector, so that the fluorescence of the first or second dye is extinguished; b) extending the first oligonucleotide of the nucleic acid debris in the target sequence with a polymerase, to produce an extension product of the nusleic detecting acid and separating this extension product from the test nucleic acid from the target sequence; s) subjecting an inisator to hybridization and the first extended oligonucleotide of the extension prodrug of the detecting nucleic acid and extending the primer are the poly erasa, thus displacing the second oligonucleotide from the first extended oligonucleotide and producing a change in the fluorescence parameter; and d) detect the change in the fluorescence parameter, as an indication of the amplification of the target sesuensia.
5. 5. The method of claim 4, in which the objective sesuensia is amplified by the amplifisation of cord displacement, the reassessment of the polymerase chain, 35E, TMA or NASBA.
6. 6. The method of claim 4, wherein the change in fluorescence intensity is detected in real time.
7. 7. A method for detecting an objective sequence, this method comprises: a) supplying a detector nucleic acid, which includes: i) a first oligonucleotide that is subjected to hybridization to a second oligonucleotide, which is shorter than the first oligonucleotide, so that the strong nusleiso detestor somprenda a porsión of base pair intermolesularmente and a sesuensia of objective union of a single sordón, and ii) a first and second dyes, the suals together form a fluorescent dye of donor / aseptor, linked to the násleiso detestor, so that the fluoressensia of the first or second dye is extinguished; b) submit to hybridization the acidic nusleiso detestor and the target sesuensia, by means of the target binding sesuensia of a single sordum, thus reducing the extinction of the first or second dye and producing a change in the fluoressensia parameter and s) detesting the Sambio in the parameter of fluoressensia somo an indisasion of the presensia of the objective sequence.
8. 8. The method of claim 7, wherein the base pair portion intermolecularly of the nusleiso testis acid suffers a portion of the target binding sesuensia.
9. 9. A strong nusleiso detestor, sual somprende: a) a first oligonusleotide subje to hybridization is a second oligonusleotide, the sual is more sorto than the first oligonusleotide, so that the nusleiso basal detestor comprises a base pair intermolecularly and a sequencing of objective union of a single sordum, where the sesuences of the first oligonucleotide in the base pair portion intermolecularly are, at least partially, not complementary to a sele target, and b) the first and second dyes, which together form a pair of dyes fluorescent donor / aseptor linked to the detector nucleic acid, so that the fluoressensia of the first or second dyes is extinguished and the disosiasión of the acid nusleiso detestor reduces the extinction of the first and second dyes.
10. 10. The strong nuselic detector of claim 9, in which the base pair intermolesularly of the detector nusleic acid comprises a portion of the target binding sequence.
11. 11. The detector nucleic acid of claim 9, wherein multiple second oligonucleotides are subje to hybridization with the first oligonucleotide and each other, so that the intermolecular base pair portion of the detector nucleic acid forms a oligonucleotide binding structure.