JP4920201B2 - Method for measuring a specific base in a nucleic acid - Google Patents

Description

  The present invention relates to a method for measuring a specific base in a nucleic acid using a labeled nucleotide monomer, in particular, a new concept measurement method in which the specific base is methylated cytosine, cytosine, or a ratio of methylated cytosine to unmethylated cytosine. It is. It is also a method for measuring methylated nucleic acid.

  Currently, methods for measuring methylated cytosine in nucleic acids are widely used in gene expression studies, but general methods for measuring any specific base in nucleic acids of several hundred base pairs in a short time are known. It is not done. Moreover, the method for measuring methylated cytosine in nucleic acids has not yet been simplified.

That is, in order to examine the number of specific bases present in a region in a nucleic acid having a certain length, for example, about 50 to 1000 base pairs, it is necessary to sequence the region.
Similarly, in order to examine the number of methylated cytosines in CpG islands existing in a certain region, it is necessary to determine the sequence after uracilizing the nucleic acid. However, operations such as purification and separation are essential for sequencing. These operations are complicated, and it takes a long time (for example, at least 3 days or more) to obtain a result.

Currently, there are three typical methods for measuring methylated cytosine.
(1) A method for cleaving a target nucleic acid using a methylation-sensitive restriction enzyme (Non-patent Document 1)
After digesting genomic DNA with a methylation sensitive restriction enzyme, a nucleic acid amplification reaction is performed. Digested nucleic acid, that is, non-methylated nucleic acid is not amplified, but undigested nucleic acid is amplified. Therefore, the presence or absence of a band is determined by electrophoresis. However, this method has a limitation in the base sequence that can be analyzed because a methylation sensitive restriction enzyme is used. A false positive occurs if there is a cleavage residue after restriction enzyme treatment. It simply detects the presence or absence of amplification. The operation requires electrophoretic separation. As a result, there was a problem in quantification and operability.
In the method, the measurable nucleic acid is 3 to 30 base pairs.

(2) Methylation specific PCR (MSP) (non-patent document 2)
Genomic DNA is treated with bisulfite. In this treatment, methylated cytosine remains cytosine and all unmethylated cytosine is converted to uracil. PCR is carried out using primers designed to have several methylation sites in the primer sequence. The PCR product is subjected to electrophoresis, and methylated cytosine is detected by the presence or absence of a band. Although this method has no restriction on the base sequence, it is difficult to design a methylation-specific primer. The method also requires separation by electrophoresis.
Also in this method, the measurable nucleic acid is limited to 3 to 30 base pairs.

(3) Bisulfite genomic sequencing method (Non-patent Document 3)
The genomic DNA is treated with bisulfite and then sequenced. In this method, a nucleic acid having a length of several hundred bases can be measured, but the operation is complicated. Operations such as subcloning and electrophoretic separation are required, which is not convenient.

Singer-Sam, J. (1990) Mol. Cell. Biol. 10, 4987-4989 JAMESG. Herman et al., Proc. Natl. Acad. Sci. USA, 93, 9821-9826, 1996 Grunau, C. et al., Nucleic Acids Res., 29, 65, 2001

  Therefore, in view of the above situation, the object of the present invention is to shorten a specific base in a nucleic acid having several hundred base pairs, particularly methylated cytosine or unmethylated cytosine in a nucleic acid, or both by the same operation. To provide a new method (quantitative) that can be specifically and accurately measured with time, convenience, and excellent sensitivity.

  As a result of intensive experiments on the above problems, the present inventors conducted a nucleic acid polymerization reaction in a nucleic acid polymerization system containing a labeled nucleotide monomer using a target nucleic acid as a template, and before and after the reaction, the fluorescence of the nucleic acid polymerization system. It was found that a specific base can be measured easily and in a short time by measuring the change or amount of change of the character. The present invention has been completed based on such findings.

That is, the present invention mainly provides Invention 1, Invention 2, Invention 3, and Invention 4. Moreover, the related invention is provided.
Invention 1 is a method for measuring a specific base in a nucleic acid characterized by comprising the following procedure.
1) A nucleic acid polymerization reaction is performed once or a plurality of times in the following nucleic acid polymerization system I, and the fluorescence character change or change amount before and after the nucleic acid polymerization reaction of the nucleic acid polymerization system is measured (hereinafter referred to as measurement system I). Based on the measured value, the specific base in the nucleic acid is measured.
Nucleic acid polymerization system I: comprising the following components: (A) target nucleic acid as template, (B) (a) fluorescent dye, (b) quencher substance, and (c) immunity containing fluorescent dye or quencher substance At least one labeled nucleotide monomer labeled with at least one substance selected from the group consisting of related substances, (C) one or a pair of primers, and (D) at least one nucleic acid synthase.

  Inventions 2 to 4 are improvements or developments of Invention 1, and related inventions described later in the text or as Inventions 5 to 10 are for suitably carrying out Inventions 1 to 4.

  The present invention is a nucleic acid consisting of several hundred base pairs in a method that does not require at least one of the operations (required in the prior art) such as electrophoresis, restriction enzyme digestion, and sequencing. It has become possible to measure specific bases such as methylated cytosine and cytosine. As a result, specific bases in nucleic acids consisting of hundreds of base pairs, particularly methylated cytosine and cytosine, can be specifically and accurately measured in a short time, simply and with excellent sensitivity. , To elucidate the mechanism of carcinogenesis and promote the development of anticancer drugs.

Hereinafter, the present invention will be described in detail.
Before describing the present invention in detail, the terms used throughout this specification, including the claims, are defined. Unless otherwise defined, terms used in the present invention have the same meaning as terms generally used at the time of filing in biology, molecular biology, genetics or genetic engineering, microbiology or microbial engineering, etc. is there.

  A labeled or unlabeled nucleotide monomer refers to a nucleotide that can be incorporated into a nucleic acid polymer by at least one nucleic acid synthase. Preferably, it is a mononucleotide as a component of the nucleic acid of the oligonucleotide, but in the present invention, in addition to the mononucleotide, a 2-30 mer oligonucleotide is included. Preferable examples include nucleotide monophosphate (NMP), diphosphate (NDP), and triphosphate (NTP). A more preferred example is triphosphate. Examples of bases include nucleic acid constituents, that is, adenine (A), guanine (G), uracil (U), cytosine (C), thymine (T), derivatives thereof, and trace components contained in RNA. Can do. The sugar is ribose, deoxyribose, dideoxyribose or the like. If the oligonucleotide hybridizes to the template nucleic acid, it is incorporated into the nucleic acid polymer in the nucleic acid polymerization system by using a nucleic acid synthesizing enzyme (eg, DNA polymerase) and ligase that does not have exonuclease activity. It is.

  The labeled nucleotide monomer refers to a nucleotide monomer labeled with at least one selected from the group consisting of fluorescent dyes, quencher substances, immune related substances and the like described later. Then, each of the nucleotide monomers labeled with a fluorescent dye, a quencher substance, or an immune-related substance (hereinafter, these substances may be simply referred to as a labeling substance or simply a labeling substance of the present invention) In some cases, it is also referred to as a fluorescence-labeled nucleotide). Further, among the fluorescently labeled nucleotides, those labeled with a donor fluorescent dye and an acceptor fluorescent dye are referred to as a donor labeled nucleotide and an acceptor labeled nucleotide, respectively. These are collectively referred to as labeled nucleotides. The labeled nucleotide will be described in detail later.

An unlabeled nucleotide refers to a nucleotide monomer that is not labeled with a labeling substance as described above.
A primer refers to one kind of oligonucleotide that specifically binds to a template nucleic acid and becomes a precursor of a nucleic acid polymer. A nucleic acid primer labeled with a fluorescent dye, a quencher substance, and an immune-related substance is sequentially referred to as a fluorescence-labeled primer, a quencher-labeled primer, and an immune-related substance-labeled primer. Moreover, it is collectively called a labeled primer.

The template nucleic acid can be a template for a nucleic acid polymer and is not particularly limited. Nucleic acid amplified by PCR method, nucleic acid or uracilized nucleic acid obtained by deamination of cytosine other than cytosine or methylated cytosine in amplified nucleic acid and converting it to uracil, uracilized nucleic acid treated with bisulfite, methylase It also means a methylated nucleic acid methylated with a nucleic acid or a nucleic acid obtained by amplifying them by a PCR method. It also means a methylated nucleic acid obtained by re-methylating a nucleic acid obtained by amplifying a methylated nucleic acid by a PCR method with a nucleic acid-specific methylase (Sss I (CpG) Methylase, Dnmt1, Dnmt3a, Dnmt3b). The nucleic acid is DNA or RNA. Of course, including genes. Moreover, the magnitude | size of a density | concentration or a magnitude | size does not ask | require.
In the present invention, a nucleic acid containing methylated cytosine which is one of the specific bases is referred to as a methylated nucleic acid.

  Any nucleic acid synthase may be used as long as it has an ability to synthesize a nucleic acid polymer by polymerizing the above-mentioned unlabeled nucleotide and labeled nucleotide, or a single thereof, using the template nucleic acid as a template. Good. Typical examples include DNA polymerases, RNA polymerases, reverse transcriptases, ligases, various kinases, nucleotide triphosphate production systems, and genetically engineered modified proteins. Enzymes having As the DNA polymerases, RNA polymerases and reverse transcriptases, ligases, various kinases, and enzymes containing a nucleotide triphosphate production system can be suitably used in the present invention. In the present invention, these are used alone or in combination.

  Of course, the enzyme may or may not contain various factors that sufficiently exert the activity of these enzymes. In the case of DNA polymerase, it may or may not have exonuclease activity. Either purified enzyme or crude enzyme may be used. In addition, the origin of the enzyme (microorganism, animal, plant) is not particularly limited. Those having heat resistance are preferred. Preferable specific examples include Vent (exo-) DNA Polymerase (derived from Thermococcus litoralis) lacking 3 ′ → 5 ′ exonuclease activity, 9 ° N DNA polymerase, Therminator DNA Polymerase (New England Biolabs, USA), Tgo (exo-) DNA Polymerase, Thermo Sequenase DNA Polymerase (Armersham), T7 Sequenase DNA Polymerase, ThermoSequenase II (Armersham Biosciences, USA), AmpliTaq DNA Polymerase, FS (Applied Biosystems, USA), Deep Vent (exo-) Examples include DNA Polymerase (New England Bioabs, USA) and Klenow Fragment.

  In the present invention, the term “measuring a specific base in a nucleic acid” or “measuring the concentration of a specific base in a nucleic acid” is not limited to quantitatively detecting the concentration of a specific base in a nucleic acid. , Qualitative detection, determining the quantity ratio or abundance ratio of specific bases in nucleic acids, quantification of nucleic acids containing specific bases (quantification of copy number, etc.), detection, judgment (confirmation) or presence It means that the ratio is determined, the fluorescence intensity of the nucleic acid polymerization system of the present invention is simply measured, and the like. In addition, an operation for determining a base sequence by a known method (basic biochemical experiment method, volume 4 (nucleic acid / gene experiment), edited by the Japanese Biochemical Society, Tokyo Chemical Dojin Co., Ltd.) or the like is also included.

  The nucleic acid polymerization reaction is not only a simple polymerization (synthesis or extension reaction) reaction, but also a nucleic acid amplification reaction, for example, PCR method, real-time quantitative PCR method, ICAN method, LAMP method, NASBA method, TAMA method. , LCR method, GenomiPhi method, hybridization reaction, extension, denaturation, etc. associated with these methods.

  The term “optical character” refers to various absorption spectra or fluorescence emission spectra of fluorescent dyes, quencher substances, nucleic acid-specific fluorescent dyes, and the like, and their absorption intensity, polarization, fluorescence emission, and fluorescence intensity. It means optical properties such as fluorescence lifetime, fluorescence polarization, fluorescence anisotropy, etc. (collectively referred to as “fluorescence intensity”). Further, it also refers to a property obtained by comprehensively evaluating measured values measured at least at one or more measurement wavelengths for at least one fluorescent dye labeled with a labeled nucleotide or the like.

  In the present invention, the term “from a change or amount of fluorescence intensity” is not only a change in fluorescence intensity based on the nucleic acid polymer of the present invention, but also when newly synthesized nucleic acid polymers are hybridized. Alternatively, it also means the change or amount of change in the fluorescence character before and after hybridization when the template nucleic acid and a newly synthesized nucleic acid polymer are hybridized. These changes occur, for example, based on the relationship between the donor fluorescent dye and the acceptor fluorescent dye, the relationship between the fluorescent dye and the base constituting the nucleic acid, or the relationship between the fluorescent dye and the quencher substance.

  Furthermore, it occurs due to the relationship between a nucleic acid-specific fluorescent dye that has entered a template nucleic acid or a newly synthesized nucleic acid polymer and a labeling substance such as a fluorescent dye that labels a labeled nucleotide monomer or a fluorescent dye via an immune-related substance, The amount of change in the luminescent character of the nucleic acid-specific fluorescent dye or the amount of change in the luminescent character of the fluorescent dye of the labeled nucleotide monomer is also included.

  The nucleic acid polymerization system can also include a labeled or unlabeled dideoxynucleotide monomer together with a labeled or unlabeled nucleotide monomer. In this case, the polymerization of the nucleic acid is stopped when the dideoxynucleotide is used in the reaction. When one type of target nucleic acid is used as a template, a large number of nucleic acid polymers having different chain lengths using the template as a template can be obtained. By analyzing and analyzing these nucleic acid polymers by an electrophoresis method, a liquid chromatography method or the like, important information about the target nucleic acid can be obtained. In such analysis / analysis, a change in the fluorescent character of the labeling substance is also used.

The labeling substance (fluorescent dye, quencher substance, immune-related substance) of the present invention, a labeled nucleotide monomer labeled with the substance, and a nucleic acid-specific fluorescent dye will be described in detail.
The fluorescent dye (sometimes referred to as “fluorescent substance”) in the present invention is a class of fluorescent dyes that are generally used for measuring and detecting nucleic acids by labeling a nucleic acid probe. For example, fluorescein or derivatives thereof (eg, fluorescein isothiocyanate (FITC) or derivatives thereof), Alexa 488, Alexa 532, cy3, cy5, 6-joe, EDANS, rhodamine 6G (R6G) or derivatives thereof {eg, tetramethylrhodamine (TMR), tetramethylrhodamine isothiocyanate (TMRITC), x-rhodamine}, Texas red, bodepy (BODIPY) FL {BODIPY is a trade name, FL is a trade name; manufactured by Molecular Probes, USA; the same applies below}, BODIPY FL / C3, BODIPY FL / C6, BODIPY 5-FAM, BODIPY TMR, or a derivative thereof {eg, BODIPY TR}, BODIPY (BO DIPY) R6G, BODIPY 564, BODIPY 581, BODIPY 493/503, Lissamine (trade name, Perkin Elmer, USA), and the like.

  Among the above, Lissamine, FITC, EDANS, 6-joe, TMR, Alexa 488, Alexa 532, BODIPY FL / C3, BODIPY R6G, BODIPY FL, Alexa 532, BODIPY FL / C6, BODIPY TMR, 5-FAM, BODIPY 493 / 503, BODIPY 564, BODIPY 581, Cy3, Cy5, Texas red, x-Rhodamine and the like can be mentioned as suitable ones.

  A quencher substance is a substance that acts on the fluorescent dye to suppress or quench its emission. For example, Dabcyl, QSY7 (Molecular Probes), QSY33 (Molecular Probes), Ferrocene or derivatives thereof, methyl viologen, N, N'-dimethyl-2,9-diazopyrenium, etc., preferably Dabcyl Can be mentioned.

  The immune-related substance of the present invention is an immune-related substance, that is, at least one selected from the group consisting of antigens, antibodies and anti-antibodies, and hapten-related substances, and consists of a set having a corresponding relationship with each other. is there. Either member of the set is then used to label the nucleotide monomer. The other is labeled with a fluorescent dye or quencher substance. Such a set is called an immune-related substance of the present invention.

  Illustratively, the above-described antigen or anti-antibody bound with a fluorescent dye or quencher substance is bound to the antibody. A labeled nucleotide monomer labeled with the antibody is incorporated into the polymerized nucleic acid. An antigen or anti-antibody (corresponding to the antibody) labeled or bound with the fluorescent dye or the like is reacted with the incorporated labeled nucleotide monomer antibody. The reaction in this case is based on affinity binding. As a result, interactions occur between fluorescent dyes (as will be understood from the description below), between fluorescent dyes and quencher substances, between nucleic acid-specific fluorescent dyes and fluorescent dyes, and the like.

In this case, the first labeling of the nucleotide monomer may be any of antigen, antibody and anti-antibody. Then, a substance containing an immune-related substance that reacts with the incorporated labeled nucleotide monomer may be reacted. And the substance which brings about the variation | change_quantity of a fluorescent character to the said substance should just be labeled. The relationship between the biotin-labeled nucleotide monomer of Examples described later and haptens such as streptavidin labeled with a fluorescent dye or the like may be used. In the present invention, the immunological substance-labeled nucleotide monomer includes a hapten-labeled nucleotide monomer.
It is more convenient to obtain the immuno-related substance-labeled nucleotide monomer by commissioned synthesis (Perkin Elmer, USA (http://www.perkinelmer.com)).

  The labeled nucleotide monomer of the present invention is a nucleotide monomer labeled with at least one of the above substances. The labeling site is a 5 ′ sugar moiety or its phosphate moiety, a 3 ′ sugar moiety and / or a phosphate moiety, and / or a base moiety. Either part is acceptable. The fluorescent dye is a dye as exemplified above, and means both a dye that can be a donor dye and a dye that can be an acceptor dye. Similarly, a quencher labeled nucleotide is a nucleotide monomer labeled with a quencher substance as exemplified above. Note that both the fluorescently labeled nucleotide monomer and the quencher labeled nucleotide monomer may be collectively referred to as “labeled nucleotide”. The same applies to fluorescently labeled dideoxynucleotides and quencher labeled dideoxynucleotides. In this case, since there is no OH group at the 3′-position of the sugar, when the nucleotide is used for the reaction in the nucleic acid polymerization, the nucleic acid polymerization reaction is stopped when the nucleotide is used.

  When the labeled nucleotide is labeled on the 3′OH group of the sugar, the nucleic acid polymerization reaction stops when the nucleotide is used for the polymerization reaction. When one type of target nucleic acid is used as a template, a large number of nucleic acid polymers having different chain lengths using the template as a template can be obtained. By analyzing and analyzing these nucleic acid polymers by an electrophoresis method, a liquid chromatography method or the like, important information on the target nucleic acid can be obtained. In such analysis / analysis, a change in the fluorescence intensity of the labeling substance is also used.

  In order to label the nucleotide monomer with a fluorescent dye or a quencher substance, a desired one of conventionally known labeling methods can be used. The labeling site is an OH group at the 5 ′ phosphate moiety, an OH group at the 5 ′, 3 ′ or 2 ′ position of the sugar moiety, an OH group at the base, or an amino group. When labeling an amino group, kit reagents such as Uni-link aminomodifier (CLONTECH, USA), Fluo Reporter Kit F-6082, F-6083, F-6084, F-10220 (any Also, it is convenient to use a molecular probe (Molecular Probes, USA). Then, the labeling substance molecule can be bound to the nucleotide monomer according to a conventional method.

When labeling an OH group, 5′Amino-Modifier C6 kit (Glen Research, USA) or the like is used. For example, when binding the labeling substance molecule to an OH group, first, for example, — (CH ₂ ) _n —SH is introduced into the OH group as a spacer according to a conventional method. In this case, n is 3-12. A labeled nucleotide monomer can be synthesized by binding the labeling substance having SH group reactivity or a derivative thereof to this spacer. The same applies when labeling an amino group. The various labeled nucleotide monomers synthesized may be purified by chromatography such as reverse phase to obtain the labeled nucleotide monomers of the present invention.
Currently, the above labeled nucleotide monomers are commercially available from Perkin Elmer (USA), Amersham Biosciences (UK), and the like. In addition, it is possible to save experimental time by obtaining consigned synthesis.

  The nucleic acid primer used in the present invention can be a precursor of a nucleic acid polymer, that is, a precursor, and is composed of an oligonucleotide. Either deoxyribose or ribose may be used. The chain length may be used for known nucleic acid synthesis and is not particularly limited. However, for example, it is 2 to 50 bases, preferably 5 to 40 bases, and more preferably 10 to 30 bases. Any base sequence that specifically hybridizes to the template nucleic acid may be used.

  The primer of the present invention can be used with or without being labeled with at least one of the fluorescent dye, quencher substance and immune-related substance. A preferred labeling site is a phosphate moiety at the 5 ′ end, an OH group or a base moiety at the 5 ′ position of the sugar obtained by dephosphorylating the phosphate, or both, a base moiety in the chain, or a base at the 3 ′ end. The OH group at the 2 ′ position of the moiety or sugar moiety, or both. Those in which the OH group at the 3 ′ position of the sugar moiety is not labeled are preferred. Of course, those labeled with the 3′OH group of the sugar at the 3 ′ end can also be used. However, in this case, it is simply used as a nucleic acid probe.

The oligonucleotide of the nucleic acid primer of the present invention can be produced by an ordinary method for producing an oligonucleotide. For example, it can be produced by a chemical synthesis method, a microbial method using a plasmid vector, a phage vector or the like. It is preferable to use a commercially available nucleic acid synthesizer.
In order to label the oligonucleotide with a fluorescent dye or a quencher substance, it may be performed in the same manner as in the case of the labeled nucleotide monomer. The most convenient method for synthesizing the oligonucleotide and the labeled nucleic acid primer is to perform consignment synthesis.

  In the present invention, the nucleic acid-specific fluorescent dye is a substance that emits fluorescence when bound to a nucleic acid. Examples of the nucleic acid species to be bound include a double-stranded nucleic acid and a single-stranded nucleic acid, and are not particularly limited. Any substance that emits fluorescence by binding to a nucleic acid may be used. For example, Oligreen (registered trademark, Molecular probes, USA), ethidium bromide, SYBR Green (registered trademark, the same applies below) 1 (trade name), Molecular probes, USA), SYBR Green 1 Nucleic Acid Gel Stain ( Product name, Molecular probes, USA), SYBR Green 2 (Product name, Molecular probes, USA), YOYO-1 (Product name, Molecular probes, USA), YOYO (Molecular probes, USA), TOTO (registered trademark, the same applies hereinafter) ) (Molecular probes, USA), YO-PRO-1 (trade name, Molecular probes, USA) and the like. These materials are preferably commercially available.

The present invention is composed of the following four main inventions and related inventions. Specifically, this will be described later with reference to the drawings. Related inventions are also described following the description of the drawings.
<Invention 1>
It is the measuring method of the specific base in the target nucleic acid characterized by including the following procedure.
1) Nucleic acid polymerization reaction is carried out once or a plurality of times (for example, 2 to 2000 times, preferably 2 to 200 times, more preferably 2 to 100 times) in the following nucleic acid polymerization system I. The change or amount of change in fluorescence character before and after is measured (measurement system I), and a specific base in the nucleic acid is measured based on the obtained measurement value.
Nucleic acid polymerization system I: comprising the following components: (A) target nucleic acid as template, (B) (a) fluorescent dye, (b) quencher substance, and (c) immunity containing fluorescent dye or quencher substance At least one labeled nucleotide monomer labeled with at least one substance selected from the group consisting of related substances, (C) a primer, and (D) at least one nucleic acid synthase.

<Invention 2>
In the method for measuring a specific base in a nucleic acid according to invention 1, wherein the specific base in the nucleic acid is methylated cytosine, and instead of the procedure 1) described in the invention 1, the procedure is replaced with the following procedures 1 and 2. is there.
1) Unmethylated cytosine contained in nucleic acid as a template is uracilized.
2) Nucleic acid polymerization reaction is carried out once or a plurality of times (for example, 2 to 2000 times, preferably 2 to 200 times, more preferably 2 to 100 times) in the following nucleic acid polymerization system II. The fluorescence character change or change amount before and after is measured (measurement system II), and methylated cytosine in the nucleic acid is measured based on the obtained measurement value.
Nucleic acid polymerization system II: Contains the following components: (A) Uracylated nucleic acid as template, (B) Labeled guanine nucleotide monomer as at least one kind of labeled nucleotide monomer, (C) Forward primer (forward primer) and reverse primer ( reverse primer), and (D) at least one nucleic acid synthase.

<Invention 3>
Invention 2 is a method in which a nucleic acid polymerization reaction is carried out by a PCR method using a pair of forward and reverse primers as primers and a labeled cytosine or guanine nucleotide monomer as at least one labeled nucleotide monomer. This is a method for measuring methylated cytosine in nucleic acids. In the present invention, a labeled cytosine or guanine nucleotide monomer is specifically incorporated.

In inventions 1, 2, and 3, an invention including the following procedure can be suitably implemented.
The nucleic acid polymerization reaction is performed once or a plurality of times (for example, 2 to 2000 times, preferably 2 to 200 times, more preferably 2 to 50 times) in the following nucleic acid polymerization system IIa, and before and after the nucleic acid polymerization reaction of the nucleic acid polymerization system The fluorescence character change or the amount of change is measured (measurement system IIa), and the specific base is measured based on the difference between the measurement values of measurement system II and measurement system IIa and the ratio thereof, or the single one. If the specific base is methylated cytosine and cytosine or a single one thereof, measure methylated cytosine and unmethylated cytosine, determine the ratio of methylated cytosine to unmethylated cytosine, or both Ask.
Nucleic acid polymerization system IIa: In the nucleic acid polymerization system II, (A) a target nucleic acid not subjected to urasylation treatment as a template nucleic acid instead of a uracilized nucleic acid, or a cytosine or a total cytosine that has the same base sequence but is not methylated Contains the same components as nucleic acid polymerization system II except that a target nucleic acid having a methylated one is used.

<Invention 4>
The measuring method of the specific base in the nucleic acid characterized by including the following procedure.
1) The nucleic acid polymerization reaction is performed once or a plurality of times (for example, 2 to 2000 times, preferably 2 to 200 times, more preferably 2 to 100 times) in the next nucleic acid polymerization system III.
Nucleic acid polymerization system III: includes the following components: (A) target nucleic acid as template, (B) at least one unlabeled nucleotide monomer, (C) either forward primer or reverse primer And (D) at least one nucleic acid synthase.
2) Removal of unreacted primer and unlabeled nucleotide monomer out of the nucleic acid polymerization system.
3) Fluorescence before and after the nucleic acid polymerization reaction of the nucleic acid polymerization system is performed once or plural times (for example, 2 to 2000 times, preferably 2 to 200 times, 2 to 100 times) in the next nucleic acid polymerization system IV. Character change or amount of change is measured (measurement system IV), and a specific base in the nucleic acid is measured based on the obtained measurement value.
Nucleic acid polymerization system IV: The following components are added to the nucleic acid polymerization system subjected to the operation of 3) above: (B) one kind of labeled nucleotide monomer, (C) forward primer (reverse primer) and reverse primer (reverse primer) Those who do not use in our nucleic acid polymerization system III.

  In this invention, when the specific base is methylated cytosine and cytosine, or one of them, before the procedure of 1) above, the procedure 1) of the invention 2 (non-methyl contained in the nucleic acid as a template) Add uracilated cytosine). Therefore, the nucleic acid as a template of the nucleic acid polymerization system III becomes a uracilized nucleic acid.

In the invention 4, when the following operation is added to the obtained measurement value, the measurement value (data) becomes more accurate.
In the same manner as described above except that the nucleic acid polymerization systems III and IV are replaced with the following nucleic acid polymerization systems IIIa and IVa, respectively, and the fluorescence character change or change amount before and after the nucleic acid polymerization reaction of the nucleic acid polymerization system is measured. The amount ratio of the specific base is determined based on the difference between the measured values described in the fourth aspect of the present invention and the ratio thereof, or one of them. When the specific base is methylated cytosine and / or cytosine, methylated cytosine, unmethylated cytosine and the ratio of methylated cytosine to unmethylated cytosine, or either of them can be determined.

Nucleic acid polymerization system IIIa: In nucleic acid polymerization system III, (A) a target nucleic acid that has not been uracilized as a template nucleic acid in place of uracilized nucleic acid, or a cytosine that has the same base sequence but is not methylated or all cytosine Contains the same components as nucleic acid polymerization system III except that a target nucleic acid having a methylated one is used.
Nucleic acid polymerization system IVa: In nucleic acid polymerization system IV, (A) a target nucleic acid not subjected to uracilization treatment as a template nucleic acid in place of uracilated nucleic acid, or a cytosine or a total cytosine that has the same base sequence but is not methylated Contains the same components as nucleic acid polymerization system IV except that a target nucleic acid having a methylated one is used.

  In the above invention 4, removal of the primer, labeled and unlabeled nucleotide monomers out of the nucleic acid polymerization system is achieved by molecular sieve filtering. That is, the nucleic acid polymerization system is filtered with a filter (for example, Microcon YM-10 10,000 MW (Millipore, USA)) capable of filtering molecules having a molecular weight equal to or lower than that of the primer. The filter is preferably a filter that can be applied to a centrifuge. The target nucleic acid as a template nucleic acid is suitably used when C or G, or C and G are present in the base sequence of the site where the primer hybridizes. When it does not exist, a method using a biotinylated primer described later, or a method using a primer that hybridizes to the oligonucleotide by binding an oligonucleotide having a specific base sequence to the 5 ′ end of the target nucleic acid is suitable. Can be used.

  The nucleic acid polymerization system may further contain at least one unlabeled nucleotide monomer. Further, (E) a nucleic acid-specific fluorescent dye may be included. The primer is composed of an oligonucleotide and may or may not be labeled with the labeling substance of the present invention.

The target nucleic acid is as described above.
The “at least one labeled nucleotide monomer” of the present invention is a kind of labeled nucleotide monomer labeled with at least one of the aforementioned labeling substances of the present invention. In the present invention, at least one kind is used. One kind may be used, but various labeled nucleotide monomers can be used in combination. Furthermore, it is more effective when used in combination with a nucleic acid-specific fluorescent dye. As a method of using the labeled nucleotide monomer, a known method can be suitably employed (International Publication No. 03/102179 pamphlet), and specific examples are given below. The labeled or unlabeled nucleotide monomer may be a labeled and unlabeled dideoxynucleotide monomer, or either one. As described above, the labeled and unlabeled nucleotide monomers are preferably triphosphates.
The nucleic acid synthase is as described above.

Any method can be used for producing a uracilized nucleic acid as long as cytosine other than methylated cytosine can be deaminated and converted to uracil. A conventionally known method can be employed. A method using bisulfite is preferable. Specific conditions of the method may be performed by a known method (see Non-Patent Document 3). For example, the conditions include 55 ° C. for 4 to 18 hours or 95 ° C. for 1 hour.
Since both methylated nucleic acids (including those in which all cytosines are methylated) and unmethylated nucleic acids are commercially available (CHEMICON INTERNATIONAL, USA), it is easy to use uracilized nucleic acids as a control for methylated nucleic acids. .

Conventionally known primers (see International Publication No. 03/102179 pamphlet and International Publication No. 02/08414 pamphlet) can be used conveniently.
It may be complementary to the template nucleic acid from one site at the 5 ′ end to one base before the methylated cytosine site. The 3 ′ end of the primer or the second base from the 3 ′ end may be complementary to the base (cytosine (C) or uracil (U)) of the methylation site.

In the present invention, a biotinylated primer in which biotin is bound to the 5 ′ end of the primer can be preferably used. All of the polymerized nucleic acids obtained by nucleic acid polymerization using the primer have biotin bonded to the 5 ′ end. Therefore, when avidin-coated beads are present in the nucleic acid polymerization system, the nucleic acid polymerized and synthesized on the beads binds to the beads. As a result, the synthesized and synthesized nucleic acid can be separated (removed) from the target nucleic acid as the original template nucleic acid, the unreacted labeled or unlabeled nucleotide monomer, or both nucleotide monomers. Therefore, under appropriate conditions, for example, conditions under which the template nucleic acid and the nucleic acid synthesized by polymerization are dissociated, or in an appropriate method, for example, the beads are subjected to an appropriate buffer (for example, shown in the Examples). It can be separated by washing. Thus, the target polymerized nucleic acid is obtained.
In the present invention, a method of appropriately combining the method using the biotinylated primer and the filtering method can also be suitably used. For example, the following combinations are possible.
(1) First, unreacted biotinylated primer and unreacted labeled or unlabeled nucleotide monomer are removed from the nucleic acid polymerization system by filtering.
(2) Next, the above-mentioned nucleic acid polymerization bead is added, and the polymerized nucleic acid is bound to the bead. Then, the target nucleic acid as the original template nucleic acid and the polymerized and synthesized nucleic acid are separated.

In the inventions 1 to 3, by carrying out a reaction (described later) that causes a change in the fluorescent character of the present invention in a system containing the nucleic acid (including a labeled nucleotide monomer) thus obtained, A specific base can be measured. This method has the effect of reducing the background of the measurement system.
In the invention 4, as described above, the procedure 3) of the invention 4 can be performed on the nucleic acid.
In Invention 4, it is preferable that such an operation is performed when the base sequence of the primer does not contain cytosine (C) and guanine (G), or C or G. If included, Invention 4 may be suitably implemented without performing such an operation. However, unreacted unlabeled nucleotide monomers and primers can be removed only by the filter filtration described above.
Therefore, a kit for measuring a specific base in a nucleic acid containing a biotinylated primer and avidin-coated beads is also one aspect of the present invention.
The biotinylated primer is conveniently obtained by commissioned synthesis (for example, Tsukuba Oligothase). Avidin-coated beads may be obtained commercially.

In addition, in the present invention, for example, when a double-stranded template nucleic acid is used as a target nucleic acid, attention is paid to one side. An oligonucleotide containing the same base sequence as the primer of the specific sequence or an oligonucleotide containing the same base sequence is bound to the 5 ′ end side of the template nucleic acid having a 5 ′ end. However, it is assumed that the base sequence does not hybridize to a template nucleic acid having a 3 ′ end or a base sequence on the 3 ′ end side of a uracilized nucleic acid. When the template nucleic acid to which the oligonucleotide is bound is replicated by the nucleic acid synthesis system of the present invention, the primer of the specific sequence can be bound to the 3 ′ end side. In the case of the present invention, for example, a sequence that does not contain C or G (for example, tttt ... tt, aaa ... a, or a base sequence comprising any combination of these bases) It is more preferable to design. The binding method is not particularly limited, and a known method using ligase can be used. By doing so, it is possible to design a primer that is not related (not appropriate) to the original target nucleic acid.
In the above oligonucleotide, those having the same number of bases as the primer or 1 to 50 bases, preferably 1 to 30 bases, more preferably 1 to 10 bases, can be preferably used. In addition, a primer having 1 to 10 bases, preferably 1 to 5 bases less than the primer can be suitably used.

Invention 4 is implemented as follows.
(1) An oligonucleotide having the same primer is bound to the 5 ′ end side of the target nucleic acid.
(2) The nucleic acid polymerization reaction of the procedure 1) of the invention 4 is performed using a primer corresponding to the target nucleic acid.
(3) Unreacted primer and unlabeled nucleotide monomer are removed from the nucleic acid polymerization system by filter filtration.

(4) The nucleic acid polymerized and synthesized in (2) above has a base sequence corresponding to an oligonucleotide having a specific sequence at the 3 ′ end. Using a primer having a specific sequence corresponding to the base sequence, the nucleic acid polymerization reaction of step 3) is performed.
In this way, the nucleic acid polymerization reaction can be carried out using the nucleic acid synthesized and synthesized in (2) above as a specific template.
The application as described above is not limited to the invention 4, and can be suitably applied to the inventions 1 to 3.
The synthesis of the oligonucleotide having the specific sequence or the same oligonucleotide as the primer and the synthesis for binding it to the target nucleic acid, and the synthesis of the primer having the specific sequence are conveniently performed by commissioned synthesis as described above.

In the present invention, the nucleic acid polymerization reaction may be performed with a pair (forward primer and reverse primer), or may be performed with only one of the pair.
When performed with only one, a single single-stranded template nucleic acid is generated from a single-stranded template nucleic acid in a single cycle of the polymerization reaction. n single-stranded new polymerized nucleic acids are generated from the polymerization reaction of n cycles. Then, the target labeled nucleotide monomer is incorporated into each nucleic acid chain. This is preferred.
The same applies when a pair of primers is used.

  The nucleic acid polymerization method is not particularly limited as long as it can polymerize a new nucleic acid using a target nucleic acid as a template. A method using a primer is preferred. A PCR method can also be suitably used.

  In addition to the components described above, the nucleic acid polymerization system may contain an appropriate buffer solution and trace components. Examples of the buffer solution include, but are not limited to, a Tris buffer solution and good. Examples of the trace component include Mg ions and K ions. In addition, DTT, 竈 -mercaptoethanol, EDTA, BSA, and the like may be included. These components can be used at conventionally known concentrations. It is preferable to use the one attached to the reagent kit such as a nucleic acid synthase as it is.

The reaction conditions may be known nucleic acid polymerization reaction conditions. Specifically, it was shown in the Examples.
Concentrations of main components of the nucleic acid polymerization system in the present invention are those of conventionally known nucleic acid polymerization reactions (for example, WO 03/102179 pamphlet, WO 02/08414 pamphlet, Non-patent documents 1 to 3). Reference) or those attached to the reagent kit may be used.

  If the conditions for the nucleic acid polymerization reaction are exemplified, the temperature is 10 ° C. to less than the nucleic acid denaturation temperature, and specifically depends on the type of nucleic acid synthase. For example, when DNA polymerase is used, the temperature is 10 ° C. to less than the nucleic acid denaturation temperature, preferably 30 to 95 ° C., more preferably 30 to 80 ° C. When RNA polymerase is used, it is 30 to 60 ° C., and when reverse transcriptase is used, it is 30 to 70 ° C. When the fluorescence intensity of the nucleic acid polymerization system is monitored as a function of time, the reaction time is up to an arbitrary time (including the stationary phase) when the reaction reaches the stationary phase. For example, it is 1 second to 10 hours, preferably 10 seconds to 2 hours, and more preferably 10 seconds to 1 hour.

Illustrating the concentration of the main components of the nucleic acid polymerization system,
Template nucleic acid: 1 to 10 ²⁰ copies, preferably 10 to 10 ¹⁵ copies; Labeled nucleotide monomer: 1 pM to 1 mM (as triphosphate), preferably 1 nM to 200 μM; Unlabeled nucleotide monomer: 1 pM to 1 mM as dNTP, Preferably 1 nM to 200 μM; primer: 1 nM to 100 μM, preferably 10 nM to 1 μM; nucleic acid synthase: 0.001 to 50 units, preferably 0.01 to 10 units; salt concentration: 0 to 2 molar, Preferably 0.1 to 1.0 molar; buffer: 0.1 to 200 mM, suitably 5 to 50 mM; pH: 6 to 10, preferably 6.5 to 9.5.

In the above-described method for measuring a specific base in a nucleic acid, data (measured value of change in fluorescence character) (T ₁ ) obtained using a labeled nucleotide monomer composed of _one kind of base, and another kind of base Accurate data can be obtained by obtaining the ratio (T ₁ / T ₂ ) (correction value) to the data (measured value of change in fluorescence character) (T ₂ ) obtained using the labeled nucleotide monomer.
In this case, the base of the labeled nucleotide monomer may be any of adenine, guanine, cytosine, and thymine, and is not particularly limited, but is preferably cytosine or thymine. More preferred is thymine. The labeling substance may be the same as or different from the method described above.
When this correction value and the number of specific bases in the target nucleic acid are plotted on a graph, the correction value and the number of specific bases in the target nucleic acid have a more relative relationship.

  In this correction method, the polymerization reaction for obtaining the measurement value and the polymerization reaction for obtaining the correction value may be performed in parallel, or the labeled nucleotide monomer for obtaining the measurement value and the label for obtaining the correction value. The nucleotide monomer may be subjected to a polymerization reaction in the same polymerization reaction system. However, in the latter case, the labeling substances of the labeled nucleotide monomers can be different from each other, and even those having a relationship between a donor fluorescent dye and an acceptor fluorescent dye and a relationship between a fluorescent light emitting dye and a quencher can be used. It is preferable to use those not present in the above. In the former case, the labeling substances may be the same or different. However, the bases only need to be different.

  The nucleic acid polymerization system may further contain at least one unlabeled nucleotide monomer. Further, (E) a nucleic acid-specific fluorescent dye may be included. The primer is composed of an oligonucleotide and may or may not be labeled with the labeling substance of the present invention.

The target nucleic acid is as described above.
The “at least one labeled nucleotide monomer” of the present invention is a kind of labeled nucleotide monomer labeled with at least one of the aforementioned labeling substances of the present invention. In the present invention, at least one kind is used. One kind may be used, but various labeled nucleotide monomers can be used in combination. Furthermore, it is more effective when used in combination with a nucleic acid-specific fluorescent dye. As a method of using the labeled nucleotide monomer, a known method can be suitably employed (see WO 02/08414 pamphlet and WO 03/102179 pamphlet). The labeled or unlabeled nucleotide monomer may be a labeled or unlabeled dideoxynucleotide monomer. As described above, it is preferable that the labeled and unlabeled nucleotide monomers are triphosphates.
The nucleic acid synthase is as described above.

As the primer, conventionally known primers (see WO 02/08414 pamphlet and WO 03/102179 pamphlet) can also be used conveniently.
It may be complementary to the template nucleic acid from one site at the 5 ′ end to one base before the methylated cytosine site. Further, the 3 ′ end of the primer or the second base from the 3 ′ end may be complementary to the base (C or U) of the methylation site.
In the present invention, a pair (forward primer and reverse primer) may be used, or only one of the pair may be used.

  In the nucleic acid polymerization reaction process of the present invention, a labeled nucleotide monomer is incorporated into the reaction product nucleic acid polymer, or a nucleic acid-specific fluorescent dye is bound, or they occur at the same time. Changes. In the present invention, the change or amount of change is measured.

It is presumed that the change of the fluorescent character is caused by at least one phenomenon of the group consisting of the following phenomena. And it is intricately engaged.
(1) Interaction between a nucleic acid-specific fluorescent dye and a fluorescent dye (FRET (fluorescence resonance energy transfer) phenomenon).
(2) Interaction between fluorescent dyes (FRET phenomenon).
(3) Interaction between quencher substance and fluorescent dye (fluorescence quenching phenomenon).
(4) Interaction between guanine base and fluorescent dye (fluorescence quenching phenomenon).
In the present invention, the interaction is a reaction in which one excitation energy moves to the other. Further, the “fluorescence quenching phenomenon” is sometimes simply referred to as “fluorescence quenching”.

Hereinafter, a preferable practical method for measuring a change or amount of fluorescence intensity is a method of measuring a fluorescence intensity of a nucleic acid polymerization system in real time to obtain a measurement value. In this case, it is desirable to use a commercially available apparatus that emits at least one type of incident light or excitation light and has at least one type of light receiving surface such as a photomultiplier, that is, has a multichannel. For example, a smart cycler (Takara Bio Inc.), ABI PRISM ^™ 7700 Sequence Detection System (SDS 7700) (PE Applied Biosystems), LightCycler ^™ System (Roche Diagnostics, Mannheim Germany) or the like may be used. In addition, when measuring the fluorescence intensity before and after the reaction, a microplate reader can be preferably used. For example, Spectra Max Genimi XS (Molecular devices, USA).

When an actual measurement value is obtained, at least one of the following is performed.
(1) Measurement of the nucleic acid polymerization system before and after the nucleic acid polymerization reaction.
(2) Measurement of a nucleic acid polymerization system using a system in which nucleic acid synthesis is not performed (for example, a system in which a template nucleic acid or a nucleic acid synthase is not added) as a control.
(3) The fluorescence intensity of the nucleic acid polymerization system at the time when the nucleic acid polymerization reaction is desired to be stopped (for example, when the reaction reaches equilibrium) is first measured, and then the nucleic acid denaturation treatment of the nucleic acid polymerization system (for example, at 90 to 99 ° C.) ), And then measure.
If necessary, the reaction product is preferably analyzed by electrophoresis or HPLC.
Further, it is preferable to carry out a blank reaction as necessary.

Hereinafter, the present invention 1 to 4 has been described with reference to the drawings. In addition, related inventions 5 to 10 have also been described.
1. Invention 1
The present invention 1 corresponds to claim 1 and is specifically illustrated in FIGS.
FIG. 1 shows an example in which a specific base (cytosine) in a target nucleic acid as a template is measured using a forward primer and labeled dGTP.
FIG. 2 is a diagram for explaining the correlation between the number of specific bases (cytosine) and the measured fluorescence character change amount (hereinafter referred to as fluorescence change amount) in Invention 1.
The nucleic acid polymerization system includes template nucleic acid A, a kind of primer that hybridizes to template nucleic acid A, labeled guanine nucleotide monomer, unlabeled adenine, cytosine, and thymine nucleotide monomer, nucleic acid-specific fluorescent dye, and nucleic acid synthase. .

1) First, the fluorescent character of the nucleic acid polymerization system is measured.
2) When a hybridization temperature is applied, the primer and the template nucleic acid hybridize. Next, when a nucleic acid synthesis temperature is applied, the nucleic acid polymerization reaction proceeds from the 3 ′ end of the primer to the 5 ′ end of the template nucleic acid. The reaction ends when the reaction reaches the 5 'end. A labeled guanine nucleotide monomer is incorporated according to the number of cytosine bases in the template nucleic acid. That is, the number of labeled guanine nucleotide monomers incorporated is equal to the number of cytosine bases in the template nucleic acid. Here, when the nucleic acid polymerization system is set to the nucleic acid denaturation temperature, the template nucleic acid forming the double strand and the synthesized single-stranded nucleic acid are separated from each other. This is one cycle.
When this polymerization reaction is repeated n cycles, n single-stranded nucleic acids (same nucleic acids) are synthesized.

3) At this point, the fluorescent character of the nucleic acid polymerization system is measured again.
4) The difference between the measured values of 1) and 3) (change in fluorescence character) is proportional to the number of cytosines in the template nucleic acid A. The amount of change is based on the FRET action between the nucleic acid-specific fluorescent dye bound to the synthesized single-stranded nucleic acid and the labeling substance of the incorporated labeled guanine nucleotide monomer.
5) Therefore, for the template nucleic acid (template nucleic acid B is shown as an example) in which the number of methylated cytosines contained in the nucleic acid is different, the operations from 1) to 4) above are performed, and the number of methylated cytosines and the measured values are obtained. When plotted on one graph, it becomes as shown in FIG.
From the above knowledge, the number of specific bases in the nucleic acid can be measured by performing the above operation.
That is, when a labeled cytosine, adenine, or thymine nucleotide monomer is used instead of the labeled guanine nucleotide monomer, guanine, thymine, and adenine can be measured from each labeled nucleotide monomer.

2. Invention 2
FIG. 3 is a diagram for explaining the invention 2 with a specific example. After bisulfate treatment of a double-stranded methylated nucleic acid, a labeled dGTP and a forward primer or reverse primer are used, and the nucleic acid is treated with the treated nucleic acid as a template. 1 shows the procedure of one example of conducting a polymerization reaction.
FIG. 4 shows a procedure of one example in which a nucleic acid polymerization reaction was performed using an unmethylated nucleic acid as a template as a control of the experiment of FIG.
FIG. 5 is a diagram for explaining the correlation between the number of methylated cytosines and the measured fluorescence change amount in Invention 2. The fluorescence change amount in this case is expressed as a value obtained by subtracting the measurement value of the unmethylated nucleic acid from the measurement value of the methylated nucleic acid.

In the example of FIG. 1, when a methylated nucleic acid or a uracilized nucleic acid is used as a template nucleic acid, the total number of cytosines or methylated cytosine in each nucleic acid can be measured. Thus, the ratio of methylated cytosine to unmethylated cytosine can also be measured. Since uracilized nucleic acid obtained from nucleic acid not containing methylated cytosine does not contain cytosine, methylated nucleic acid can also be measured (determined).
This invention is an invention according to one aspect of the present invention, wherein either a forward primer or a reverse primer is used as a primer.

  In the invention 2, as a control, the target nucleic acid not subjected to uracilation treatment as a template nucleic acid instead of the uracilized nucleic acid, or the base sequence is the same, but unmethylated cytosine or all cytosines are methylated. The nucleic acid polymerization reaction is performed once or multiple times in the nucleic acid polymerization system, including the same components as the nucleic acid polymerization system except that a target nucleic acid having a nucleic acid is used. Measuring the amount of methylated cytosine and unmethylated cytosine based on the difference between the measured value of the experimental system and the measured value of the control system and the ratio thereof, or either of them, and methylated cytosine It is preferable to obtain the ratio of unmethylated cytosine and / or one of them because an accurate measurement can be obtained.

In the inventions 1 and 2, the nucleic acid-specific fluorescent dye that can be suitably used is preferably one that binds to a single-stranded nucleic acid and emits light with a higher fluorescence intensity. For example, what is described in the Example can be illustrated.
In inventions 1 and 2, the amount of change in the fluorescent character is based on the interaction between the nucleic acid-specific fluorescent dye and the labeling substance of the labeled nucleotide monomer, but the present invention is not limited to this example. The following examples can be used.

3. Invention 3
6, 7 and 8 are diagrams for explaining the third aspect of the present invention.
FIG. 6 shows a procedure of an example in which a double-stranded methylated nucleic acid is treated with bisulfate and then a nucleic acid polymerization reaction (PCR) is performed using the labeled nucleic acid as a template using labeled dCTP or labeled dGTP and forward primer and reverse primer. Is shown. However, the symbol: (child) is a nucleic acid polymerized and synthesized using uracilized nucleic acid as a template, and the symbol: (grandchild) is a nucleic acid polymerized and synthesized using (child) as a template.
FIG. 7 shows a procedure of an example in which a nucleic acid polymerization reaction was performed using an unmethylated nucleic acid as a template nucleic acid as a control for the experiment of FIG. Symbols: (child) and (grandchild) have the same meaning as in FIG.
FIG. 8 is a diagram for explaining the correlation between the number of methylated cytosines and the measured fluorescence change amount in Invention 3.

Invention 3 is an aspect of the invention described in claim 2, and in Invention 2, a pair of forward and reverse primers and a labeled cytosine or guanine nucleotide monomer are used as primers, and a nucleic acid polymerization reaction is performed by a PCR method. This is a method for measuring methylated cytosine in nucleic acids. In the present invention, a labeled cytosine or guanine nucleotide monomer is specifically incorporated.
The control experiment is similar to invention 2.

4). Invention 4
9, 10 and 11 illustrate invention 4.
In FIG. 9, after bisulfate treatment of double-stranded methylated nucleic acid, first, unlabeled dNTPs (representing a mixture of triphosphates of adenine, guanine, cytosine and thymine nucleotide monomers) and a reverse primer are used. Then, a nucleic acid polymerization reaction is performed using the treated nucleic acid as a template to amplify the template nucleic acid, and then unreacted primers and dNTPs remaining in the nucleic acid polymerization system (including the original template nucleic acid in some cases. These separations are described above. This is a procedure of an example in which the amplified template nucleic acid is further amplified using a labeled dCTP and a forward primer after performing a separation (removal) operation. In the figure, the symbol NNN3 ′ indicates a nucleic acid synthesized by polymerization using primer 1 as a template.
FIG. 10 shows a procedure of an example in which a nucleic acid polymerization reaction similar to that of FIG. 9 was performed using an unmethylated nucleic acid as a control for the experiment of FIG. In the figure, the symbol NNN3 ′ has the same meaning as in FIG.
FIG. 11 is a diagram for explaining the correlation between the number of methylated cytosines and the measured fluorescence change amount in Invention 4. The fluorescence change amount in this case is expressed as a value obtained by subtracting the measurement value of the unmethylated nucleic acid from the measurement value of the methylated nucleic acid.
9 and 10 described above, N in NNN3 ′ is any one of adenine, guanine, cytosine, thymine, and uracil, and may be the same or different from each other.

The method for measuring the specific base in the nucleic acid of the present invention is not limited to the above examples, and various modifications can be made. The modification is invention 4 and corresponds to claim 4. An example is shown in FIGS. Although the figure shows a method for measuring methylated cytosine as a specific base, the present invention is not limited to methylated cytosine.
The drawing consists of the following procedures.
1) First, the procedure of the invention 1 is performed. However, in this case, an unlabeled nucleotide monomer is used instead of the labeled guanine nucleotide monomer. The primer is a figure using a forward primer (however, the present invention is not limited to this example). The polymerization reaction is n cycles. The 3 ′ → 5 ′ strand of the double strand of the template nucleic acid serves as a template, and n polymerized nucleic acids are born.
2) The unreacted primer and unlabeled nucleotide monomers are removed from the polymerization reaction solution. The method of removal is as described above.

3) In place of the labeled guanine nucleotide monomer of Invention 1, a labeled cytosine nucleotide monomer and a reverse primer are added to the treatment solution of 2) (according to the figure).
4) The fluorescent character of the nucleic acid polymerization system is measured before the nucleic acid polymerization reaction.
5) The nucleic acid polymerization reaction is performed n times in the same manner as in 1) above. In this case, the template nucleic acid is a 5 ′ → 3 ′ strand of n polymerized nucleic acids and one original double strand. Therefore, there are n × n nucleic acids newly synthesized and incorporated with labeled cytosine nucleotide monomers.
6) Measure fluorescent character of nucleic acid polymerization system.
7) Measure the difference between the measured values of 4) and 6) (change in fluorescent character).
8) As in Invention 1, when the number of methylated cytosines and the measured values are plotted on one graph, the result is as shown in FIG.

In the invention 4, the procedure of 1) and the procedures of 4) to 6) may be reversed with the procedures of 2) and 3) in between. However, 7) and 8) are performed last.
In invention 4, as can be seen from the figure, the number of cytosines in the original nucleic acid coincides with the number of labeled cytosine nucleotide monomers incorporated into the single-stranded nucleic acid. Therefore, the measurement sensitivity is n times that of Invention 1. This method is suitable when the initial copy number of the template nucleic acid is small.

The polymerized nucleic acid synthesized in 1) and the polymerized nucleic acid synthesized in 5) can form a double strand. This acts to widen the range of combinations of the labeling substance, the labeled nucleotide monomer, and the nucleic acid-specific fluorescent dye when determining the amount of change in the fluorescent character. See below.
This method is not limited to the measurement of methylated cytosine, and is a general method for measuring a specific base in a nucleic acid in the same manner as in Invention 1.
When measuring methylated cytosine and the like by this method, it is preferable to perform a control experiment similar to the inventions 2 and 3.

5. Invention 5
In this invention, a fluorescent dye-labeled nucleic acid primer is used to newly polymerize and synthesize a nucleic acid following the 3 ′ end of the primer. In this case, the primer is designed so that the vicinity of the 3 ′ end of the primer of the synthesized polymerized nucleic acid has the following structure.
1) An unlabeled guanine nucleotide monomer or an unlabeled cytosine nucleotide monomer comes. The primer labeling substance interacts with cytosine or guanine to cause a change in the fluorescent character of the labeling substance.
2) A labeled nucleotide monomer comes. In this case, the combination of the labeling substance of the primer and the labeling substance of the labeled nucleotide monomer has a structure that interacts to cause a change in the fluorescent character.
The present invention is a method for measuring (determining, recognizing, and detecting) a base at a specific site of a target nucleic acid, in particular, methylated cytosine in a short time and simply.

6). Invention 6
The invention according to any one of Inventions 1 to 4, wherein a labeled dideoxynucleotide monomer labeled with a fluorescent dye is used as the labeled nucleotide monomer. This invention can measure methylated nucleic acid in a short time and easily. This is a method of monitoring the change in the fluorescence character of the nucleic acid polymerization system performing nucleic acid polymerization, and measuring the intensity of the fluorescence character in the nucleic acid polymerization system when the change is saturated. The methylated nucleic acid can be measured in a short time by comparing the measured value of the intensity of the fluorescent character before or at the start of the reaction or the corresponding non-methylated or non-uracilized nucleic acid. That is, the nucleic acid polymerization reaction time is short.

7). Invention 7
7. The method according to any one of the present inventions 1 to 6, wherein the template nucleic acid is polymerized from one or more nucleic acid primers immobilized on a solid surface.

8). Invention 8
A kit for measuring a specific base in a nucleic acid, comprising a component of at least one of the nucleic acid polymerization systems I, Ia, II, IIa, III, IIIa, IV, and IVa. is there.
9. Invention 9
The measurement method according to any one of the first to seventh aspects of the invention includes a procedure using a calibration curve.
10. Invention 10
A kit for measuring a specific base in a nucleic acid comprising a biotinylated primer and avidin-coated beads.

  Combinations of labeled nucleotide monomer labeling substances and the like, and combinations of these substances and nucleic acid-specific fluorescent dyes that cause changes in the fluorescent character of the nucleic acid polymerization system are conventionally known (WO 03/102179 pamphlet). In the present invention, known combinations can be suitably employed.

The following is a brief description.
1) Interaction between nucleic acid-specific fluorescent dyes and nucleic acid-specific dyes Nucleic acid-specific fluorescent dyes are used in nucleic acid polymers, double-stranded nucleic acid polymers, nucleic acid polymers / template nucleic acid complexes, nucleic acid primers / template nucleic acid complexes. Join.
In the process of incorporating a fluorescent dye-labeled nucleotide monomer into a nucleic acid polymer in the presence of a nucleic acid-specific fluorescent dye, the fluorescent-labeled nucleotide incorporated into the nucleic acid polymer synthesized by the nucleic acid-specific fluorescent dye is incorporated. The distance from the fluorescent dye is very close. Then, an interaction occurs between the fluorescent dye that labels the fluorescently labeled nucleotide incorporated into the nucleic acid polymer and the nucleic acid-specific fluorescent dye. And it brings about the change of fluorescence character intensity (henceforth fluorescence intensity for simplification). In the present invention, the specific base of the present invention can be measured by measuring or monitoring the amount of change. Specifically, a decrease in the fluorescence intensity of the nucleic acid-specific fluorescent dye or an increase in the fluorescence intensity of the fluorescent dye is measured.

  In this case, as the fluorescent dye, all of the fluorescent dyes can be used, but preferred are Lissamine, FITC, EDANS, 6-joe, TMR, Alexa 488, Alexa 532, BODIPY FL / C3, BODIPY R6G, BODIPY. Examples include FL, Alexa 532, BODIPY FL / C6, BODIPY TMR, 5-FAM, BODIPY 493/503, BODIPY 564, BODIPY 581, Cy3, Cy5, Texas red, x-Rhodamine and the like.

  Moreover, although all the above-mentioned nucleic acid-specific fluorescent dyes can be used, preferred are Sybr green 1, Sybr green 1 Nucleic Acid Gel Staining, and YO-PRO-1. Preferred combinations with fluorescent dyes are Syber green I or YO-PRO-1 and Texas red, Lissamine, 6-joe, TMR, Alexa 532, BODIPY R6G, Alexa 532, BODIPY TMR, BODIPY 564, BODIPY 581, Cy3, Cy5 And x-Rhodamine.

2) Interaction between fluorescent dyes When at least two kinds of fluorescently labeled nucleotides are incorporated into a nucleic acid polymer, the distance between the fluorescent dyes (A, B) labeled with the incorporated fluorescently labeled nucleotides is remarkably close, Interaction between fluorescent dyes that did not occur when dispersed in a solution occurs. And it brings about the change of the fluorescence intensity of a nucleic acid polymerization system. The specific base of the present invention can be measured by measuring the change in fluorescence intensity or by monitoring the change as a function of time.

  In this case, one of the interacting fluorescent dyes is a dye that gives excitation energy of the FRET phenomenon and is called a donor dye. The other is a dye that emits fluorescence upon receiving energy and is called an acceptor dye.

  For example, as a preferable donor dye, FITC, BODIPY FL, BODIPY FL-based dye, BODIPY 493/503, 5-FAM, BODIPY 5-FAM, Tetramethylrhodamine, 6-TAMRA and the like, more preferable FITC, BODIPY FL, BODIPY 493/503, BODIPY 5-FAM, Tetramethylrhodamine, 6-TAMRA and the like can be mentioned.

  Suitable acceptor dyes depend on the type of donor dye that forms the pair. For example, if Lissamine, BODIPY FL, BODIPY FL-based dye, BODIPY 493/503, 5-FAM, BODIPY 5-FAM, Tetramethylrhodamine, 6-TAMRA, etc. are used as donor dyes, Texas Red, Cy5, Cy5.5, rhodamine X, BODIPY 581/591, etc. can be used as acceptor dyes. This method measures the decrease in the fluorescence intensity when measuring the fluorescence intensity of the donor dye, and the increase in the fluorescence intensity when measuring the fluorescence intensity of the acceptor dye.

3) Interaction of fluorescent dye-labeled nucleotide monomer with fluorescent dye and guanine base When fluorescent dye-labeled nucleotide monomer is incorporated into polymerized nucleic acid, the fluorescent dye of the labeled nucleotide monomer is present in the vicinity. Interaction with guanine base occurs. In this case, it is preferred to use a labeled cytosine nucleotide monomer. 1 to 3 bases from the base of the labeled nucleotide in the polymer nucleic acid itself incorporating the labeled nucleotide monomer, or in the strand of the nucleic acid (template nucleic acid or newly polymerized nucleic acid) that forms a duplex with its own strand It is only necessary that an unlabeled guanine nucleotide monomer is present apart (counting the corresponding base as 1).
In this case, the specific base of the present invention is measured by measuring the amount of decrease in the fluorescence intensity of the fluorescent dye.

  As the fluorescent dye to be labeled in this case, all of the above-mentioned fluorescent dyes can be used, but preferred ones are FITC, EDANS, 6-joe, TMR, Alexa 488, Alexa 532, BODIPY FL / C3, BODIPY R6G. BODIPY FL, Alexa532, BODIPY FL / C6, BODIPY TMR, 5-FAM, BODIPY 493/503, BODIPY 564, BODIPY 581, R6G, TAMRA, x-Rhodamine and the like.

4) Interaction between fluorescent dye and quencher substance In the combination of 2) above, one is a quencher substance. The quencher substance plays the role of a donor dye, and the fluorescent dye plays the role of an acceptor. The specific nucleic acid of the present invention is measured by measuring the amount of change (increase) in the fluorescence intensity of the fluorescent dye.
Quencher substances (also called “fluorescence quenchers”) that can be used in this method include, for example, Dabcyl, QSY7 (Molecular Probes), QSY33 (Molecular Probes) or derivatives thereof, methyl viologen, N, N′-dimethyl-2,9-diazopyrenium and the like, preferably Dabcyl and the like can be exemplified.

5) Interaction between the labeled substance of the labeled nucleic acid primer and the labeled substance of the incorporated labeled nucleotide monomer In this case, rather than measuring the specific base in the nucleic acid, the measurement (judgment and recognition) of the base at the specific site of the target nucleic acid ). For example, it can be used to easily detect whether cytosine at a specific site of a nucleic acid is methylated. In this case, the labeled site of the labeled nucleic acid primer is preferably the 3 ′ end or the vicinity thereof.
The interrelationship between the labeling substances may be either 1), 2) or 4) above. If there is a change in fluorescence intensity in the nucleic acid polymerization system, a base capable of hydrogen bonding with the base of the labeled nucleotide monomer incorporated near the 3 ′ end of the primer will be present in the template nucleic acid.

6) Interaction between the fluorescent dye of the fluorescent dye-labeled nucleic acid primer and the unlabeled guanine or / and cytosine present in the vicinity of the 3 'end of the polymer nucleic acid newly synthesized at the 3' end of the primer. Similarly, it is a method for determining, recognizing and detecting a base at a specific site of a target nucleic acid.
The interrelationship between the fluorescent dye and guanine or cytosine at a specific site is the same as 3) above. If there is a change in fluorescence intensity in the nucleic acid polymerization system, it is a polymerized nucleic acid newly synthesized at the 3 ′ end of the primer, and guanine or / and cytosine are present near the 3 ′ end. That is, cytosine or / and cytosine exists in the target nucleic acid.

Next, an Example and a comparative example are given and this invention is demonstrated concretely. However, the present invention is not limited to these examples.
The template, primer, and labeled primer used in this example were obtained by commissioned synthesis (Tsukuba Oligo Service (http://www.tos-bio.com)).
In this example, the labeled nucleotide monomer and the unlabeled nucleotide monomer are referred to as a fluorescently labeled mononucleotide and an unlabeled mononucleotide, respectively.
In this embodiment, the change in the fluorescence character is simply referred to as the change in fluorescence intensity.

Example 1
A primer extension reaction was performed using the synthetic oligonucleotides described in SEQ ID NOs: 1 to 5 as templates and SEQ ID NO: 6 as primers. At that time, a fluorescently labeled mononucleotide obtained by labeling dGTP with Texas Red (maximum absorption wavelength / maximum fluorescence wavelength = 593 nm / 612 nm, Perkin Elmer, USA) was used. YOYO-1 (Molecular probes, USA), which is a nucleic acid binding dye, was used as a donor of FRET fluorescence energy. As the DNA polymerase, Vent (exo-) DNA Polymerase (New England Biolabs, USA) having high incorporation efficiency of the modified mononucleotide was used. The following reaction solution was prepared to a final volume of 25 μl, and the reaction was carried out for 15 cycles at 94 ° C. for 15 seconds and 60 ° C. for 15 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 2μM dATP
・ 2μM dCTP
・ 2μM dTTP
・ 1μM dGTP
・ 1μM Texas Red-5-dGTP
・ 1 x YOYO-1
・ 200nM Primer 6
40nM synthetic single-stranded template DNA 1-5
・ 0.25U (unit) Vent (exo-) DNA Polymerase

  A smart cycler (Takara Bio Inc., Japan) was used for fluorescence detection. At that time, a filter set for detecting FRET was used. That is, excitation was performed at 450-495 nm, and Ch1 (505-537 nm) in the system was used for detection of YOYO-1, and Ch4 (605-800 nm) was used for detection of Texas Red.

The change in Ch1 fluorescence intensity in each template is shown in FIG. 12, and the change in Ch4 fluorescence intensity is shown in FIG. The fluorescence intensity did not change in the template 1 and the blank with no template added, and the fluorescence intensity corresponding to Ch4 Texas Red increased as the number of cytosines in the template increased.
After completion of the reaction, the number of cytosines in the template and the amount of change in fluorescence intensity were plotted on the X and Y axes, respectively (FIG. 14). The numbers of cytosines contained in the sequences of templates 1 to 5 are 0, 1, 3, 6, and 11, respectively. The increase in the fluorescence intensity of Texas Red was related to the number of cytosines in the template. Thus, it was shown that the number of cytosines in the template can be quantified from the amount of change in fluorescence intensity using FRET between the nucleic acid binding dye and the fluorescently labeled mononucleotide.

Example 2
Primer extension reaction was performed in an experimental system in which Texas Red labeled-dGTP in the reaction solution used in Example 1 was replaced with biotin labeled-dGTP. After completion of the reaction, streptavidin-Texas Red (Perkin Elmer USA) was added and incubated at room temperature for 20 minutes. Then, the fluorescence intensity value of 612 nm which is the maximum fluorescence wavelength of Texas Red at the excitation wavelength of 495 nm was measured with a fluorescence plate reader (SpectraMax Genemi XS, Molecular Device, USA). The number of cytosines in the template and the obtained fluorescence intensity values were plotted on the X and Y axes, respectively (FIG. 15). As a result, similar to the result of Example 1, the fluorescence intensity value at 612 nm corresponding to Texas Red increased as the number of cytosines in the template increased. Thus, it was revealed that the number of cytosines in the template can be quantified from the fluorescence intensity value after completion of the reaction.

Example 3
A primer extension reaction was performed using the synthetic oligonucleotides described in SEQ ID NOs: 1 to 5 as templates and SEQ ID NO: 6 as primers. At that time, fluorescently labeled nucleotides in which thymine was labeled with Texas Red were used. The following reaction solution was prepared so as to have a final volume of 25 μl, and the reaction was carried out for 15 cycles at 94 ° C. for 15 seconds and 65 ° C. for 15 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 2μM dATP
・ 2μM dCTP
・ 2μM dGTP
・ 1μM dTTP
・ 1μM Texas Red-5-dTTP
・ 1 x YOYO-1
・ 200nM Primer 6
40nM synthetic single-stranded template DNA 1-5
・ 0.25U (unit) Vent (exo-) DNA Polymerase

A smart cycler was used to detect fluorescence.
The change in Ch4 fluorescence intensity in each template is shown in FIG. The fluorescence intensity considered to be derived from Texas Red-dTTP increased in all template addition systems. Here, in order to correct the amount of change in fluorescence intensity obtained in Example 1, the amount of change in fluorescence intensity of Ch4 obtained in Example 1 was divided by the value obtained with Texas Red-dTTP. The obtained fluorescence intensity ratio and the number of cytosines in the template were plotted (FIG. 17). As a result, the calculated value and the number of cytosines in the template showed a relative relationship. It was shown that a more accurate cytosine content can be measured by correcting using the same number of bases (nucleotides) contained between the templates.

Example 4
A primer extension reaction was performed using the synthetic oligonucleotides described in SEQ ID NOs: 7 to 10 as templates and SEQ ID NO: 6 as primers. At that time, a fluorescence-labeled mononucleotide obtained by labeling dCTP with Fluorescein Chlorotriazinyl (maximum absorption wavelength / maximum fluorescence wavelength = 492 nm / 514 nm, Perkin Elmer USA) was used. The following reaction solution was prepared so as to have a final volume of 20 μl. The reaction was carried out for 15 cycles at 94 ° C. for 15 seconds and 60 ° C. for 15 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 2μM dATP
・ 2μM Fluorescein Chlorotriazinyl-4-dCTP
・ 2μM dTTP
・ 2μM dGTP
・ 200nM Primer 6
40nM synthetic single-stranded template DNA 7-10
・ 0.25U (unit) Vent (exo-) DNA Polymerase

A light cycler system was used to detect fluorescence. At that time, F1 in the system was used for fluorescence detection. The excitation intensity was fixed at 75%.
After completion of the reaction, the number of guanines in the template and the amount of change in fluorescence intensity were plotted on the X and Y axes, respectively (FIG. 18). The amount of change in fluorescence intensity of F1 was appropriately related to the number of guanines in the template. Thus, it was shown that the number of guanines in the template can be quantified from the amount of change in fluorescence intensity.

Example 5
Using the synthetic oligonucleotides shown in SEQ ID NOs: 11 to 14 as templates, an extension reaction was performed using the primers shown in SEQ ID NO: 6. The following reaction solution was prepared to a final volume of 20 μl, heat-denatured at 95 ° C. for 15 seconds, and then subjected to 50-cycle thermal cycling at 94 ° C. for 20 seconds and 60 ° C. for 20 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 50μM dNTPs
・ 200nM Primer 6
0.2nM synthetic single-stranded template DNA 11-14
・ 0.25U (unit) Vent (exo-) DNA Polymerase

  After the reaction, in order to remove unreacted dNTPs and primers in the reaction solution, the reaction mixture was centrifuged with Microcon YM-10 10,000 MW (Millipore, USA). Reagents were added to the supernatant to the following final concentration to prepare a total volume of 25 μL.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase buffer ・ 200 nM primer 15
・ 5μM dATP
・ 2μM dTTP
・ 2μM dGTP
2 μM Texas Red label-dCTP
・ 1 x YOYO-1
・ 0.25U (unit) Vent (exo-) DNA Polymerase

  The prepared reaction solution was heat-denatured at 95 ° C. for 15 seconds, and then subjected to 50-cycle thermal cycling with 94 ° C. for 20 seconds and 60 ° C. for 20 seconds as one cycle. The fluorescence intensity value in the final cycle and the number of cytosines in the template were plotted on the Y and X axes, respectively (FIG. 19). As a result, it was possible to predict the amount of cytosine in the template from the fluorescence intensity value.

Example 6
Universal methylated DNA, universal unmethylated DNA (Chemicon International, USA) was used as control DNA to validate this procedure.
The purchased genomic DNA was uracilized (converted to sodium bisulfite) using CpGenome ™ kit (Chemicon International, USA) addressed to 10 μg. Subsequently, purification was performed according to the attached instruction manual. Reagents were added to the modified DNA thus treated so as to have the following final concentration to prepare a total volume of 100 μL. Heat denaturation at 95 ° C. for 30 seconds, 94 ° C. for 30 seconds, and 65 ° C. for 60 seconds were performed for 80 cycles.

・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 20μM dATP
・ 20μM dGTP
・ 20μM dTTP
・ 20μM dCTP
-1.0 μM primer 16 (5 'biotinylation)
・ 1.0U (unit) Vent (exo-) DNA Polymerase

  Streptavidin-coated magnetic beads (Dynabeads M-270 Streptavidin, Dynal) were washed and equilibrated with washing buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2M NaCl). Beads were added to the solution after completion of the reaction, mixed, and reacted at room temperature for 1 hour. The beads were washed 4 times with a washing buffer and then equilibrated 4 times with a 1 × Vent (exo-) DNA Polymerase-attached buffer, and then a reagent was added to the solution to the following final concentration to prepare a total volume of 100 μL. After heat denaturation at 95 ° C. for 15 seconds, the reaction was carried out for 80 cycles at 94 ° C. for 20 seconds and 60 ° C. for 60 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 20μM dATP
・ 20μM Fluorescein Chlorotriazinyl-4-dCTP
・ 20μM dTTP
・ 20μM dGTP
・ 1.0 μM Primer 17
・ 1.0U (unit) Vent (exo-) DNA Polymerase

  A smart cycler was used to detect fluorescence. The fluorescence intensity of Ch1 decreased by 30 RFU from the initial intensity in the universal methylated DNA addition system. On the other hand, the fluorescence intensity hardly changed in the universal unmethylated DNA addition system (3RFU). Thus, it was possible to discriminate methylated and unmethylated DNA from the amount of change in fluorescence intensity. Since the amount of change corresponds to the number of methylated cytosines, the number of methylated cytosines can be measured from the calibration curve.

Example 7
It is known that the methylation level of the promoter region of glutathione-S-transferase (GSTP1) is an indicator of prostate cancer. Therefore, the degree of methylation of the cancer tissue sample was measured using DNA extracted from the prostate cancer tissue sample and methylated control DNA.
DNA was extracted from cancer tissue samples using standard protocols (proteinase K, phenol, chloroform). 10 μg each of the extracted DNA, commercially available universal methylated DNA, and universal unmethylated DNA was converted into sodium bisulfite. After purification, the reagent was added to the modified DNA to the following final concentration to prepare a total volume of 100 μL. Heat denaturation at 95 ° C. for 15 seconds, 94 ° C. for 20 seconds, and 65 ° C. for 60 seconds was performed for 80 cycles.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 20μM dATP
・ 20μM dGTP
・ 20μM dTTP
・ 20μM dCTP
1.0 μM primer 16
・ 1.0U (unit) Vent (exo-) DNA Polymerase

  After completion of the reaction, the reaction solution was centrifuged with Microcon YM-10 10,000 MW to remove unreacted dNTPs and primers. Reagents were added to the supernatant to the following final concentration to prepare a total volume of 100 μL. After heat denaturation at 95 ° C. for 15 seconds, the reaction was carried out for 80 cycles at 94 ° C. for 20 seconds and 60 ° C. for 60 seconds.

(Reaction solution)
・ 1 × Vent (exo-) DNA Polymerase attached buffer ・ 10μM dATP
・ 5μM Texas Red-dGTP
・ 5μM dGTP
・ 10μM dTTP
・ 10μM dCTP
・ 1.0 μM Primer 17
・ 1.0U (unit) Vent (exo-) DNA Polymerase
・ 1 × YOYO-1

  The primer 17 used in the second primer extension reaction is designed such that a region other than the CpG sequence is converted into U (T) on the 3 ′ side (actually from the 3 ′ side). 1, 2, 3, 8, 9, 10, 12, 19, 23). Therefore, the primer extension product amplified by the first primer extension reaction is used as a template, and genomic DNA is not used as a template.

  A smart cycler was used to detect fluorescence. The fluorescence intensity of Ch4, which is considered to be derived from Texas Red-dGTP, increased 24 RFU from the initial intensity in the universal methylated DNA addition system. On the other hand, the fluorescence intensity of the universal unmethylated DNA addition system hardly changed. In the prostate cancer tissue sample addition system, there was an increase of 20 RFU compared to the initial intensity. Thus, the presence of methylated cytosine in the nucleic acid could be determined by the amount of change in fluorescence intensity. For all samples, the methylation ratio was analyzed by the bisulfite sequencing method, which is an existing methylated DNA measurement method, and data supporting the above results were obtained. That is, about 85% and 80% of cytosine of CpG of universal methylated DNA and prostate cancer tissue-derived DNA remained cytosine, respectively, and all cytosine of universal unmethylated DNA was converted to thymine. Thus, in order to quantify the number of methylated cytosines in the template nucleic acid, it was effective to compare using methylated and unmethylated DNA as a control.

SEQ ID NO: 1
5'-atgtgtgtgtgtgtgtgtgtgtgtgagtgtgtgtgtgtgtgtgtgtacggtctacactgtcgag-3 '
SEQ ID NO: 2
5'-atgtgtgtgtgtgtgtgtgtgtgtgagtgcgtgtgtgtgtgtgtgtacggtctacactgtcgag-3 '
SEQ ID NO: 3
5'-atgtgtgtgtgtgcgtgtgtgtgtgagtgcgtgtgtgtgtgtgtgcacggtctacactgtcgag-3 '
SEQ ID NO: 4
5'-atgtgcgtgtgtgcgtgtgtgcgtgagtgcgtgtgtgcgtgtgtgcacggtctacactgtcgag-3 '
SEQ ID NO: 5
5'-atgcgtgcgtgcgtgcgtgcgtgcgagcgtgcgtgcgtgcgtgcgtacggtctacactgtcgag-3 '

SEQ ID NO: 6
5'-ctcgacagtgtagaccg-3 '
SEQ ID NO: 7
5'-gtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatgtatcccggtctacactgtcgag-3 '
SEQ ID NO: 8
5'-cacctccgcctccacctccgcctccacctccgcctccacctccgcctccacctccgcctccacctccgcctccacctccgcctccccggtctacactgtcgag-3 '
SEQ ID NO: 9
5'-ccctcccccgccccctcccccaccccctcccccgccccctcccccaccccctcccccgccccctcccccaccccctcccccgccccctcccccacccccggtctacactgtcgag-3 '
SEQ ID NO: 10
5'-ccctcccccaccccctcccccaccccctcccccaccccctcccccaccccctcccccaccccctcccccaccccctcccccccccccctcccccacccccggtctacactgtcgag-3 '

SEQ ID NO: 11
5'-tcagctgagtccatgtaaggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggcggtctacactgtcgag-3 '
SEQ ID NO: 12
5'-tcagctgagtccatgtaaggggggggggggcggggggggggggggcggggggggggggggcggggggggggggggcggggggggggggggcggtctacactgtcgag-3 '
SEQ ID NO: 13
5'-tcagctgagtccatgtaaggggcggggggggcggggggggcggggggggcggggggggcggggggggcggggggggcggggggggcggggcggtctacactgtcgag-3 '
SEQ ID NO: 14
5'-tcagctgagtccatgtaacggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggcggtctacactgtcgag-3 '
SEQ ID NO: 15
5'-tcagctgagtccatgtaa-3 '

SEQ ID NO: 16
5'-tccctaccaaacacatactcctacct-3 '
SEQ ID NO: 17
5'-tgttgtttgtttattttttaggttt-3 '

  The present invention makes it possible to specifically and accurately measure specific bases in nucleic acids consisting of several hundred base pairs, particularly methylated cytosine and cytosine, in a short time, simply and with excellent sensitivity. It promotes the elucidation of cancer mechanisms and the development of anticancer drugs.

It is a figure explaining the procedure of the invention. It is a figure explaining the correlation of the number of the specific bases (cytosine) in Invention 1, and the measured fluorescence character variation | change_quantity. It is a figure explaining the procedure of the invention 2. It is a figure explaining the procedure of the control experiment of the invention 2. It is a figure explaining the correlation of the number of the chilled cytosine in invention 2, and the measured fluorescence variation | change_quantity.

It is a figure explaining the procedure of the invention 3. It is a figure explaining the procedure of the control experiment of the invention 3. It is a figure explaining the correlation of the number of methylated cytosines in the invention 3, and the measured fluorescence variation | change_quantity. It is a figure explaining the procedure of the invention 4. It is a figure explaining the procedure of the control experiment of invention.

It is a figure explaining the correlation of the number of methylated cytosines in the invention 4, and the measured fluorescence variation | change_quantity. It is a figure which shows the example which monitored the fluorescence intensity of the reaction process in the case of performing the nucleic acid polymerization reaction of this invention using the nucleic acid containing various numbers of cytosines as a template. It is a figure which shows the example which monitored the fluorescence intensity of the reaction process in the case of performing the nucleic acid polymerization reaction of this invention using the nucleic acid containing various numbers of cytosines as a template. It is a figure which shows the correlation of the cytosine number in a template nucleic acid, and fluorescence intensity variation | change_quantity. It is a figure which shows the correlation of the cytosine number in a template nucleic acid, and fluorescence intensity variation | change_quantity.

It is a figure which shows the example which monitored the fluorescence intensity of the reaction process in the case of performing the nucleic acid polymerization reaction of this invention using the nucleic acid containing various numbers of cytosines as a template. It is a figure which shows the correlation of the cytosine number in a template nucleic acid, and fluorescence intensity variation | change_quantity. It is a figure which shows the correlation of the number of guanines in a template nucleic acid, and a fluorescence intensity variation | change_quantity. It is a figure which shows the correlation of the cytosine number in a template nucleic acid, and fluorescence intensity variation | change_quantity.

Claims (7)

The measuring method of the specific base in the nucleic acid characterized by including the following procedure.
1) performs one or more times a nucleic acid polymerization reaction in a nucleic acid polymerization system below, by measuring the fluorescence character change or variation before and after the nucleic acid polymerization reaction in a nucleic acid polymerization system, based on the measurement values obtained, in a nucleic acid The specific base is measured.
Nucleic acid polymerization system: Contains the following components:
(A) a target nucleic acid as a template,
(B) (a) a fluorescent dye, or (c) labeled with immune-related substance containing a fluorescent color element, labeled nucleotide monomers bases which form the specific base and base pair,
(C) One of the forward primer and the reverse primer ,
( D) at least one nucleic acid synthase , and
(E) A nucleic acid-specific fluorescent dye that emits fluorescence by binding to a nucleic acid and can cause a FRET phenomenon with the fluorescent dye . A method for measuring a guanine base in a nucleic acid, comprising the following procedure.
1) performs one or more times a nucleic acid polymerization reaction in a nucleic acid polymerization system below, by measuring the fluorescence character change or variation before and after the nucleic acid polymerization reaction in a nucleic acid polymerization system, based on the measurement values obtained, in a nucleic acid Measure guanine base.
Nucleic acid polymerization system: Contains the following components:
(A) a target nucleic acid as a template,
(B) (a) labeled with a fluorescent quencher fluorescent dye, or (c) an immune-related substance containing a fluorescent color element for fluorescence quenching by interaction with guanine nucleotide by interacting with guanine nucleotide, labeled cytosine Nucleotide monomers,
(C) One of a forward primer and a reverse primer, and (D) at least one nucleic acid synthase. A method for measuring methylated cytosine in a nucleic acid, comprising the following procedure.
1) Unmethylated cytosine in the target nucleic acid as a template is uracilized.
2) performs one or more times a nucleic acid polymerization reaction in a nucleic acid polymerization system below, by measuring the fluorescence character change or variation before and after the nucleic acid polymerization reaction in a nucleic acid polymerization system, based on the measurement values obtained, in a nucleic acid Methylated cytosine is measured.
Nucleic acid polymerization system: Contains the following components:
(A) the target nucleic acid treated with uracilation ,
(B) (a) a fluorescent dye, or (c) labeled with immune-related substance containing a fluorescent color element, labeled guanine nucleotide monomer,
(C) One of the forward primer and the reverse primer ,
( D) at least one nucleic acid synthase , and
(E) A nucleic acid-specific fluorescent dye that emits fluorescence by binding to a nucleic acid and can cause a FRET phenomenon with the fluorescent dye . A method for measuring methylated cytosine in a nucleic acid, comprising the following procedure.
1) Unmethylated cytosine in the target nucleic acid as a template is uracilized.
2) performs one or more times a nucleic acid polymerization reaction in a nucleic acid polymerization system below, by measuring the fluorescence character change or variation before and after the nucleic acid polymerization reaction in a nucleic acid polymerization system, based on the measurement values obtained, in a nucleic acid Methylated cytosine is measured.
Nucleic acid polymerization system: Contains the following components:
(A) the target nucleic acid treated with uracilation ,
(B) (a) a fluorescent dye, or (c) labeled with immune-related substance containing a fluorescent color element,-labeled cytosine nucleotide monomers or labeled guanine nucleotide monomer,
(C) a pair of primers,
( D) at least one nucleic acid synthase , and
(E) A nucleic acid-specific fluorescent dye that emits fluorescence by binding to a nucleic acid and can cause a FRET phenomenon with the fluorescent dye . A method for measuring methylated cytosine in a nucleic acid, comprising the following procedure.
1) Unmethylated cytosine in the target nucleic acid as a template is uracilized.
2 ) The nucleic acid polymerization reaction is performed once or a plurality of times in the next nucleic acid polymerization system III.
Nucleic acid polymerization system III: Contains the following components:
(A) a target nucleic acid as a template,
(B ) an unlabeled nucleotide monomer,
(C) off O either one of word Dopuraima over及 beauty reverse primer, and (D) at least one nucleic acid-synthesizing enzyme.
3 ) In the next nucleic acid polymerization system IV, the nucleic acid polymerization reaction is performed once or multiple times, and the fluorescence character change or change amount before and after the nucleic acid polymerization reaction of the nucleic acid polymerization system is measured. Based on the obtained measurement value, The methylated cytosine is measured.
Nucleic acid polymerization system IV:
(A) 2 ) the nucleic acid polymerized and synthesized in the nucleic acid polymerization solution III (B) a labeled cytosine nucleotide monomer labeled with a fluorescent dye ,
(C) those who are not used in full O word Dopuraima over及 beauty reverse primer U Chino nucleic acid polymerization system III.
(D) at least one nucleic acid synthase, and
(E) A nucleic acid-specific fluorescent dye that emits fluorescence by binding to a nucleic acid and can cause a FRET phenomenon with the fluorescent dye . The method for measuring a specific base in a nucleic acid according to any one of claims 1 to 5, wherein a biotinylated primer is used as a primer to perform nucleic acid polymerization of a target nucleic acid as a template nucleic acid. The method for measuring a specific base in a target nucleic acid according to any one of claims 1 to 4, wherein the nucleic acid polymerization system further comprises (B ') an unlabeled nucleotide monomer.

Images