MXPA97010409A - Homologo de receptor de edg-2 hum - Google Patents

Abstract

The present invention provides nucleic acid and amino acid sequences that identify and encode a homologue of human EDG-2 receptor (hedg) expressed in human rheumatoid synovium. The present invention also provides probes for the detection of nucleotide sequences encoding HEDG or HEDG-like molecules, antisense molecules to nucleotide sequences, which encode HEDG, HEDG-based diagnostic tests that encode nucleic acid molecules , genetically engineered expression vectors and host cells for the production of purified HEDG, antibodies capable of specifically binding to HEDG, and antagonists and inhibitors with specific binding activity for the polypeptide HEDG

Description

HOMOLOGO DE RECEPTOR DE EDG-2 HUMANO TECHNICAL FIELD The present invention is in the field of molecular biology; more particularly, the present invention describes nucleic acid and amino acid sequences for a novel human EDG-2 receptor homolog.

BACKGROUND OF THE INVENTION The EDG-2 receptor is a putative G protein coupled to the seven transmembrane receptor (T7G), which was initially cloned from the sheep mRNA (GenBank U18405; Masan Ml et al. (1994) unpublished). Human edg-1 is commonly grouped with orphan receptors, since the endogenous ligand is not known (Hia T and Maciag T (1990), J. Biol. Chem. 265: 9308-13). Several T7G receptors have been classified as orphan receptors; These include brain CSF-1, the oncogene of more associated with epidemoid carcinoma, known RDC-1 of several major organs, and R334 of brain and rat testes. In some of these cases, a ligand was initially proposed and has been discontinued. Orphan receptors vary in number of amino acids, in molecular weight, in glycosylation sites and presence and number of disulfide bonds (Watson S and Arkinstall S (1994) The G-Protein Linked Receptor Facts Books, Academic Press, San Diego CA) . However, they are related to other T7Gs by their seven hydrophobic domains, which extend the plasma membrane and form a bundle of antiparallel a-helices. These transmembrane segments (TMS) are designated by Roman numerals l-VII and represent the structural and functional aspects of the receiver. In most cases, the bundle of helices forms a joint cavity; however, when the binding site must adapt to larger molecules, the N-terminal extracellular segment or one or more of the three extracellular loops participate in the binding and in the subsequent induction of conformational change in intracellular portions of the receptor. The activated receptor, in turn, interacts with an intracellular protein G complex, which mediates the additional activities of intracellular signaling, generally the production of second messengers such as cyclic AMP (cAMP), phospholipase C, inositol triphosphate or proteins of ion channel. T7G receptors are expressed and activated during numerous developmental and disease procedures. The identification of a novel T7G receptor provides the opportunity to diagnose or intervene in such procedures, and the receptor can be used to classify analyzes to identify physiological or pharmaceutical molecules which activate, prolong, or inhibit their activity.

DESCRIPTION OF THE INVENTION The subject of the invention provides a single nucleotide sequence, which encodes a novel human EDG-2 receptor homolog (HEDG). The cDNA, here designated as hedg, was identified and cloned using Incyte Clone No. 89853 from a collection of rheumatoid synovium cDNA. The invention relates to the use of nucleic acid sequences and amino acid sequences of HEDG or its variants, in the diagnosis or treatment of activated, inflamed or diseased cells and / or tissues associated with their expression. Aspects of the invention include hedg antisense DNA; cloning or expression vectors containing hedg; host cells or organisms transformed with expression vectors containing hedg; a method for the production and recovery of purified HEDG from host cells; and a purified protein, HEDG, which can be used to identify inhibitors for the sub-regulation of signal transduction involving HEDG.

BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A and 1B show the alignment of the nucleic acid sequence (coding region of SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) for HEDG. The alignment of the sequences was produced using the MacDNAasis software (Hitachi Software Engineering Co Ltd). Figure 2 shows the alignment of HEDG with sheep EDG-2 receptors (U 18405; SEQ ID NO: 3) and human EDG-1 (Gl 1 19130; SED ID NO: 4). Note that the Arg36 and Ser37 cleavage sites conserved from these T7G molecules. The sequences for Figure 2 were aligned using the multiple sequence alignment program of the DNAStar software (DNAStar Inc. Madison Wl).MODES FOR CARRYING OUT THE INVENTION As used herein and designated by the abbreviation in capitals, H EDG, refers to an EDG2 receptor homologue either naturally occurring or synthetically and active fragments thereof, which have the amino acid sequence of SEC ID NO: 2 In one embodiment, the polypeptide HEDG is encoded by A RN ms transcribed from A DNC, as designated by the lowercase abbreviation, hedg, of SEQ ID NO: 1. The novel human edg-2 receptor homolog, H EDG, which is the subject of this patent, was discovered among the partial cDNA sequences (Incyte clone 80853) expressed in the rheumatoid synovium collection. It is more distantly homologous to human edg-1, which was cloned from human vascular endothelial cells and expressed in epitheloid cells, fibroblasts, melanocytes, and cells of vascular smooth muscle.

An "oligonucleotide" is a stretch of nucleotide residues, which has a sufficient number of bases to be used as an oligomer, amplimer or probe in a polymerase chain reaction (PCR). Oligonucleotides are prepared from the genomic or cDNA sequence, and are used to amplify, reveal, or confirm the presence of a similar DNA or RNA in a particular cell or tissue. The oligonucleotides or oligomers comprise portions of the DNA sequence having at least about 10 nucleotides and as much as about 35 nucleotides, preferably about 25 nucleotides. The "probes" can be derived from nucleic acids of single or double chain structure of natural existence or recombinant or chemically synthesized. They are useful for detecting the presence of identical or similar sequences. A "portion" or "fragment" of a polynucleotide or nucleic acid comprises all or part of any nucleotide sequence having fewer nucleotides of about 6 kb, of presence less than about 1 kb, which can be used as a probe. Such probes can be labeled with reporter molecules using nick translation, Klenow fill reaction, PCR or other methods known in the art. After pre-testing to optimize the reaction conditions and to eliminate false positives, the nucleic acid probes can be used in Southern, northern or in situ hybridizations to determine whether the DNA or RNA encoding H EDG is present in a type of cell, tissue or organ. "Reporter" molecules are those radionuclides, enzymes, fluorescent, chemoluminescent or chromogenic agents, which are associated with, establish the presence of, and allow the quantification of a particular nucleotide or amino acid sequence. "Recombinant nucleotide variants" that encode HEDG can be synthesized or selected by making use of "redundancy" in the genetic code. Several codon substitutions, such as silent changes, which produce specific restriction sites, can be introduced to optimize cloning to a plasmid or viral expression vector in a particular prokaryotic or eukaryotic system, respectively. "Chimeric" molecules can be constructed by introducing all or part of the nucleotide sequence of this invention into a vector containing an additional nucleic acid sequence, which can be expected to change any (or more than one) of the following characteristics of HEDG: cell location, distribution, ligand binding affinities, interchain affinities, degradation / change regime, signaling, etc. "Active" refers to those forms, fragments or domains of any HEDG polypeptide, which retain the biological and / or immunological activities of any naturally occurring HEDG. "Naturally occurring HEDG" refers to a polypeptide produced by cells that have not been genetically engineered and specifically contemplates various polypeptides that arise from post-translational modifications of the polypeptide including, but is not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation. "Derivative" refers to those chemically modified polypeptides through any techniques such as ubiquitination, labeling (see above), pegylation (derivatization with polyethylene glycol), and insertion or substitution by chemical synthesis of amino acids such as ornithine, which is not of natural existence in human proteins. "Recombinant polypeptide variant" refers to any polypeptide that differs from naturally occurring HEDG through amino acid insertions, deletions and substitutions, created using recombinant DNA techniques. The guide to determine which amino acid residues can be replaced, added or deleted, without abolishing the activities of interest can be found by comparing the HEDG sequence with those of related polypeptides and minimizing the number of amino acid sequence changes made in regions highly conserved Amino acid "substitutions" are conservative in nature when they result from replacing one amino acid with another that has similar structural and / or chemical properties, such as the replacement of a leucine with an isoluezin or valine, an aspartate with glutamate, or a threonine with a serine. The "insertions" or "deletions" are typically on the scale of about 1 to 5 amino acids. The allowed variation can be experimentally determined by producing the peptide synthetically or by systematically making insertions, deletions, or substitutions of nucleotides in a hedg sequence using recombinant DNA techniques. When desired, a "leader sequence" can direct the polypeptide through the membrane of a cell. Said sequence can be naturally present on the polypeptides of the present invention or provided with heterologous sources through DNA techniques. An "oligopeptide" is a short stretch of amino acid residues and can be expressed from an oligonucleotide. This can be functionally equivalent to and of the same length as (or considerably shorter than) a "fragment", "portion" or "segment" of a polypeptide. Said sequences comprise a stretch of amino acid residues of at least about 5 amino acids, and usually at least about 17 or more amino acids, typically at least about 9 to 13 amino acids, and of sufficient length to exhibit biological activity and / or immunological. "Inhibitor" is any substance, which delays or prevents a chemical or physiological reaction or response. Common inhibitors include, but are not limited to, antisense molecules, antibodies or antagonists. The expression "normal" is a quantitative or qualitative measure for comparison. It is based on a statistically appropriate number of normal samples and is created to be used as a basis for comparison when carrying out diagnostic tests, clinical operation tests, or following patient treatment profiles. "Animal", as used herein, can be defined to include a human being, domestic species, (cats, dogs, etc.), agricultural (cows, horses, sheep, etc.), or test (mouse, rat, rabbit, etc.). The present invention provides a nucleotide sequence that uniquely identifies a novel seven transmembrane receptor, EDG-2 or human HEDG. Since HEDG is specifically expressed in the inflamed rheumatoid synovium, nucleic acids (hedg), polypeptides (HEDG) and antibodies to HEDG are useful in diagnostic assays, which monitor the increased production of the receptor. Excessive expression of HEDG is probably associated with the activation of T lymphocytes and other cells, which respond to inflammation and can result in the production of abundant protease and other molecules, which can lead to tissue damage or destruction. Therefore, a diagnostic test for excessive HEDG expression can accelerate the diagnosis and appropriate treatment of abnormal conditions caused by viral, bacterial or fungal infections; allergenic responses; mechanical damage associated with trauma; hereditary diseases; lymphoma or carcinoma; or other conditions, which activate the genes of lymphoid tissues. The nucleotide sequence encoding HEDG (or its complement) has numerous other applications in techniques known to those skilled in the field of molecular biology. These techniques include the use as hybridization probes, use in the construction of oligomers for PCR, the use for chromosome and gene mapping, the use in the recombinant production of HEDG, the use in the generation of antisense DNA or RNA, their chemical analogs and the like. The uses of the nucleotides encoding the HEDG, described herein, are illustrative of known techniques and are not intended to limit their use in any technique known to one skilled in the art. In addition, the nucleotide sequences described herein, can be used in molecular biology techniques that have not been developed, provided that the new techniques are based on properties of the nucleotide sequences that are currently known, v. gr., the triplet genetic code, specific base pair interactions, etc. It will be appreciated by those skilled in the art that as a result of the degeneracy of the genetic code, a multitude of nucleotide sequences encoding HEDG can be produced. Some carrying a minimal homology for the nucleotide sequence of the known HEDG and natural existence. The invention has specifically contemplated every possible variation of the nucleotide sequence that can be made by selecting combinations based on possible codon choices. These combinations are made according to the normal triplet genetic code as applied to the nucleotide sequence of the natural existence hedg, and all these variations will be considered as being specifically described. Although the nucleotide sequences, which encode the HEDG, its derivatives or its variants are preferably capable of hybridization to the nucleotide sequence of the naturally occurring hedg gene under severe conditions, it may be advantageous to produce the nucleotide sequences encoding the HEDG or its derivatives possessing a substantially different codon usage . The codons can be selected to increase the rate at which the expression of the peptide occurs in a prokaryotic or eukaryotic expression host according to the frequency with which the particular codons are used by the host. Other reasons for substantially altering the nucleotide sequence encoding the HEDG and / or its derivatives without altering the encoded aa sequence include the production of RNA transcripts that have more desirable properties, such as longer half-life, than transcripts produced from the sequence of natural existence. The nucleotide sequences encoding HEDG can be linked to a variety of other nucleotide sequences through well-established recombinant DNA techniques (Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Spring Harbor Col NY; or Ausubel FM et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York). Useful nucleotide sequences for binding to hedg include a determination of cloning vectors such as plasmids, cosmids, lambda phage derivatives, phagemids, and the like. Other vectors of interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, etc. In general, the vectors may contain a functional origin of replication in at least one organism, conventional restriction endonuclease sensitive sites, and selectable markers for the host cell. Another aspect of the present invention is to provide hedg-specific nucleic acid hybridization probes capable of hybridization with naturally occurring nucleotide sequences encoding HEDG. Said probes can also be used for the detection of similar T7G coding sequences and should preferably contain at least 50% of the nucleotides of the hedg sequence. The hybridization probes of the present invention may be derived from the nucleotide sequence of SEQ ID NO: 1 or from the genomic sequence including promoters, enhancer elements and introns of the native gene. Hybridization probes can be labeled through a variety of reporter molecules using well-known techniques.

PCR, as described in the patents of E.U.A. Nos. 4,683,195 and 4,965,188 provide additional uses for oligonucleotides based on the nucleotide sequences, which encode the HEDG. Said probes used in the PCR may be of recombinant origin, they may be chemically synthesized, or they may be a mixture of both. The oligomers may comprise a discrete nucleotide sequence employed under conditions optimized for the identification of hedg sequences in specific tissues or diagnostic use. The same two oligomers, a nested group of oligomers, or even a deposit of degeneration of oligomers can be employed under less stringent conditions for the identification of closely related DNAs or RNAs. Other means for producing hedg-specific hybridization probes include cloning of nucleic acid sequences encoding HEDG or HEDG derivatives to vectors for the production of mRNA probes. Such vectors are known in the art and are commercially available and can be used to synthesize RNA probes in vitro through the addition of the appropriate RNA polymerase such as T7 or SP6 RNA polymerase and appropriate reporter molecules. Now it is possible to produce a DNA sequence, or portions thereof, completely by synthetic chemistry. After synthesis, said nucleic acid sequence can be inserted into any of the many available DNA vectors and their respective host cells using techniques that are known in the art. In addition, synthetic chemistry can be used to introduce mutations to the nucleotide sequence. Alternatively, a sequence portion, in which a mutation is desired, may be synthesized and recombined with a larger portion of an existing genomic or recombinant sequence. The nucleotide sequence for hedg can be used in an assay to detect inflammation or disease associated with abnormal levels of HEDG expression. The DNA can be labeled by methods known in the art, added to a sample of fluid, cell or tissue from a patient and incubated under hybridization conditions. After an incubation period, the sample was washed with a compatible fluid, the reporter molecule is quantified and compared with a previously defined normal. If kinase expression is significantly different from normal expression, the assay indicates inflammation or disease. The nucleotide sequence for hedg can be used to construct hybridization probes for the mapping of the native gene. The nucleotide sequence can be mapped to a chromosome or to a specific region of a chromosome using known mapping techniques. These techniques include in situ hybridization of chromosomal extensions (Verma et al. (1988) Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York), chromosomal preparations classified by flow, or artificial chromosome constructions such as artificial yeast chromosomes ( YACs), bacterial artificial chromosomes (BACs), bacterial P1 constructs or collections of individual chromosome cDNAs. In situ hybridization of chromosomal preparations and other physical mapping techniques such as binding analysis using established chromosomal markers are invaluable for extending genetic maps. Examples of map data can be found in the annual Science Genome Issue (e.g., 1994, 265: 1981f). Usually locating a gene on the chromosome of another mammalian species can reveal associated markers, which can be used to help identify the human analog chromosome. The new nucleotide sequences can be assigned to chromosomal subregions through physical mapping. Mapping new genes or nucleotide sequences provides useful landmarks for researchers to search for diseased genes using positional cloning or other gene discovery techniques. Once a disease or syndrome, such as ataxia telangiectasia (AT), has been crudely localized by genetic binding to a particular genomic region, eg, AT a 11q22-23 (Gatti et al. (1988) Nature 336: 577-580), any sequence mapping that area can represent or reveal genes for further investigation. The nucleotide sequence of the present invention can also be used to detect differences in gene sequence between normal and carrier and affected individuals.

The nucleotide sequences encoding hedg can be used to produce a purified oligo- or polypeptide using well-known methods of recombinant DNA technology. Among the many publications that teach the expression of an isolated nucleotide sequence is that of Goeddel (1990 Gene Expression Technology, Methods and Enzymology, Vol. 185, Academic Press, San Diego CA). The oligopeptide can be expressed in a variety of host cells, either prokaryotic or eukaryotic. The host cells may be of the same species from which the nucleotide sequence was derived or from a different species. Advantages for producing an oligonucleotide through recombinant DNA technology include obtaining adequate amounts of the protein for purification and the availability of simplified purification procedures. Cells transformed with DNA encoding HEDG can be cultured under conditions suitable for the expression of T7Gs, their extracellular, transmembrane or intracellular domains and recovery of said peptides from cell culture. The HEDG (or any of its domains) produced through a recombinant cell can be secreted or it can be contained intracellularly depending on the particular genetic construct used. In general, it is more convenient to prepare recombinant proteins in secreted form. The purification steps vary with the production process and the particular protein produced. Ordinarily, an oligopeptide can be produced from a chimeric nucleotide sequence. This is achieved by ligating the hedg nucleotides or a desired portion of the polypeptide to a nucleic acid sequence encoding a polypeptide domain, which will facilitate the purification of the protein (Kroll DJ et al. (1993) DNA Cell Biol. 12: 441-53). In addition to recombinant production, fragments of HEDG can be produced through direct peptide synthesis using solid phase techniques (cf Stewart et al. (1969) Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco CA; Merrifield J. ( 1963) J. Am. Chem. Soc. 85: 2149-2154). Automatic synthesis can be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (ABI, Foster, California) according to the instructions provided by the manufacturer. In addition, a particular portion of HEDG can be mutated during direct synthesis and combined with other parts of the peptide using chemical methods. The HEDG for the induction of antibody does not require biological activity; however, the protein must be antigenic. The peptides used to induce specific antibodies may have a sequence of aa consisting of at least five amino acids, preferably at least 10 amino acids. These must resemble a portion of the amino acid sequence of the protein and may contain the entire sequence of a small natural existence molecule such as HEDG. An antigenic portion of HEDG can be fused to another protein such as a key limpet hemocyanin, and the chimeric molecule used for antibody production. Antibodies specific for HEDG can be produced by inoculating an appropriate animal with the polypeptide or an antigenic fragment. An antibody is specific for HEDG if it is produced against an epitope of the polypeptide and binds to at least part of the natural or recombinant protein. Antibody production includes not only the stimulation of an immune response by injection into animals, but also analogous steps in the production of synthetic antibodies, the classification of recombinant immunoglobulin collections (see Orlandi R. et al. (1989) PNAS 86: 3833-37, or Huse WD et al. (1989) Science 256: 1275-81) or in vitro stimulation of lymphocyte populations. Current technology (Winter G and Milstein C (1991) Nature 349: 293-299) provides a number of highly specific binding reagents based on the principles of antibody formation. These techniques can be adapted to produce molecules specifically by joining particular domains of HEDGs. A further embodiment of the present invention is the use of HEDG-specific antibodies, inhibitors, receptors or their analogs as bioactive agents to treat inflammation or disease, including, but not limited to, bacterial or fungal infections.; allergic responses; mechanical damage associated with trauma; hereditary diseases; lymphoma or carcinoma; or other conditions, which activate the genes of lymphoid tissues. The bioactive compositions comprising agonists, antagonists or inhibitors of HEDG can be administered in a suitable therapeutic dose determined by any of the various methodologies including clinical studies in mammalian species to determine the maximum tolerable dose and in normal human subjects to determine the dose safe. In addition, the bioactive agent can be formed as a complex with a variety of well-established compounds or compositions, which improve stability or pharmacological properties such as half-life. It is contemplated that a therapeutic, bioactive composition is delivered through intravenous infusion to the blood stream or any other effective means that can be used for the treatment of problems involving excess lymphocyte and leukocyte trafficking. Rheumatoid arthritis is currently evaluated based on swelling, response to NSAIDs, X-rays, etc. HEDG is most likely expressed on the surface of fibroblasts, T and B lymphocytes, monocyte / macrophages, or mast cells, which comprise inflamed synovium cells Once the appropriate standards are established, an assay for abnormal expression of HEDG it is a viable diagnostic tool to determine the degree to which the RA has progressed. The expression of HEDG in a sustained inflammatory response makes it a valuable therapeutic target for classifying drug collections. HEDG inhibitors are useful for the control of signal transduction and signaling cascades in rheumatoid synovium cells. The examples presented below are provided to describe the present invention. These examples are provided by way of illustration and are not included for the purpose of limiting the invention.

INDUSTRIAL APPLICABILITY I. Isolation of mRNA and Construction of the cDNA Collection The hedg sequence of this application was first identified in Incyte clone No. 80853, among the sequences comprising the rheumatoid synovium collection. The rheumatoid synovial tissue was obtained from the hip joint removed from a 68-year-old woman with erosive, nodular rheumatoid arthritis. The tissue was frozen, ground into a powder in a mortar and grinder, and used immediately in pH buffer containing guanidinium isothiocyanate. The lysis was followed by several extractions with phenol-chloroform and ethanol precipitations. Poly-A + mRNA was isolated using biotinylated oligo d (T) and streptavidin coupled to the paramagnetic particles (Poly (A) Tract Isloation System, Promega, Madison, Wl). Using this poly-A + mRNA, a cDNA library was constructed through Stratagene (La Jolla, CA). The cDNA synthesis was initiated with oligo d (T), and the adapter oligonucleotides were ligated onto cDNA molecules that allowed them to be inserted into the Uni-ZAP ™ vector system (Stratagene). Alternative unidirectional vectors may include, but are not limited to, pcDNA (Invitrogen, San Diego CA) and pSHIox-1 (Novagen, Madison Wl).

II. Isolation of cDNA Clones The phagemid forms of individual cDNA clones were obtained through the in-cut procedure. vivo, in which the host bacterial strain was co-infected both with the collection phage and with an auxiliary phage f1. The polypeptides or enzymes derived from both the phage containing the collection and the auxiliary phage grooved the DNA, initiated the new DNA synthesis of the sequences delineated on the target DNA, and created a circular phagemid DNA molecule with an individual chain structure. , smaller, which included all the pBluescript phagemid DNA sequences and the cDNA insert. The phagemid DNA was released from the cells and purified and used to reinfect fresh host cells (SOLR ™, Stratagene), where phagemid DNA of double-stranded structure was produced. The DNA was purified using the QIAWELL-8 Plasmid Purification System from QIAGEN® DNA Purification System (QIAGEN Inc. Chatsworth CA), an EMPORE ™ anion exchange resin system with membrane technology (3M, Minneapolis MN). The DNA was eluted from the purification resin and prepared for DNA sequencing and other analytical manipulations. lll. Sequencing of cDNA Clones The cDNA inserts of the randomized isolates from the placental collection were partially sequenced. Methods for sequencing DNA are well known in the art. Conventional enzymatic methods employed Klenow fragments of DNA polymerase, SEQUENASE® (US Biochemical Corp. Cleveland OH) or Taq polymerase to extend the DNA strands of an oligonucleotide primer reinforced to the DNA template of interest. Methods for the use of templates of both single and double chain structure have been developed. The chain termination reaction products were electrophoresed on urea-acrylamide gels and detected either by autoradiography (for radionuclide-labeled precursors) or by fluorescence (or fluorescently labeled precursors). Recent improvements in mechanized reaction preparation, sequencing and analysis using the fluorescent detection method have allowed the expansion in the number of sequences that can be determined per day using machines such as Catalyst 800 and Applied Biosystems 377 or 373 DNA sequencers .

IV. Homology Search of cDNA Clones and Deduced Proteins Each sequence thus obtained was compared with sequences in GenBank, using a search algorithm developed by Applied Biosystems and incorporated in the INHERIT ™ 670 Sequence Analysis System. In this algorithm, an algorithm was used. Pattern Specification Language (Pattern Specification Language, developed by TRW Inc., Los Angeles CA) to determine regions of homology. The three parameters determine how the sequence comparisons performed the window size, window deviation, and error tolerance. Using a combination of these three parameters, the DNA database was searched for sequences containing regions of homology to the sequence in question, and the appropriate sequences were classified with an initial value. Subsequently, these homologous regions were examined using dot matrix homology graphs to distinguish regions of homology from chance comparisons. Smith-Waterman alignments were used to present the results of the homology search. Peptide and protein sequence homologies were ascertained using the INHERIT ™ 670 Sequence Analysis System in a manner similar to that used in DNA sequence homologies. The Pattern Specification Language and the parameter windows were used to search the protein databases for sequences containing regions of homology, which were classified with an initial value. The dot matrix homology plots were examined to distinguish regions of significant homology from the opportunity comparisons. Alternatively, BLAST, which represents the Basic Local Aligment Search Tool, was used to search for local sequence alignments (Altschul SF (1993) J. Mol. Evol. 36: 290-300; Altschul, SF et al. (1990) J. Mol. Biol. 215: 403-10). BLAST produces alignments of both nucleotide and amino acid sequences to determine the similarity of the sequence. Due to the local nature of the alignments, BLAST is especially useful for determining exact comparisons or for identifying homologs. While it is ideal for combinations with hollows, it is inappropriate to perform the pattern style search. The fundamental unit of production of the BLAST algorithm is the High Classification Segment Pair (HSP). An HSP consists of two sequence fragments of arbitrary but equal lengths, whose alignment is locally external and for which the classification of the alignment satisfies or exceeds a threshold or cut classification set by the user. The BLAST aspect is to search for HSPs between a sequence in question and a database sequence, to evaluate the statistical significance of any comparisons found, and to report only those comparisons that satisfy the threshold of importance selected by the user. Parameter E establishes the statistically significant threshold to report the comparisons of the database sequence. E is interpreted as the superior union of the expected frequency of occurrence of opportunity of an HSP (or group of HSPs) within the context of the entire database search. Any database sequence, whose comparison satisfies E is reported in the program production.

V. Identification, Full Length Cloning, Sequencing and Translation The INHERIT ™ analysis results from the randomly collected and sequenced portions of clones from the rheumatoid synovium collection identified as Incyte 80853 as a homolog of the sheep EDG-2 receptor. The cDNA insert comprising Incyte 80853 was fully sequenced and used as the basis for the cloning of the full-length cDNA. The cDNA was extended to a full length using a modified XL-PCR method (Perkin Elmer) as described in the Serial Patent Application No. 08 / 487,112, filed on June 7, 1995, and the synovium cDNA library rheumatoid as a template. The primers were designed based on a known sequence; one primer was synthesized to initiate the extension in the antisense direction (XLR = TCATCTTGATTCCCCA TCCCTTCTG) and the other to extend the sequence in the direction of direction (XFL = AGTCTCCGAGTATTGGGTCCTGTG). The primers allowed the sequence to be extended "outward" by generating amplicons containing a new and unknown nucleotide sequence for the genes of interest. The primers were designed using Oligo 4.0 (National Biosciences Inc. Plymouth MN). In general, primers should be 22-30 nucleotides in length, have a GC content of 50% or more, and reinforce the target sequence at temperatures of approximately 68-72 ° C. Any stretching of nucleotides, which could result in hairpin structures and inator-initiator dimerizations were avoided. Following the instructions for the XL-PCR equipment and thoroughly mixing the enzyme and the reaction mixture, a high fidelity amplification is obtained. Starting with 25 pMol of each primer and the recommended concentrations of all other equipment components, the Peltier thermal cycler (PTC200, MJ Research, Watertown MA) and the following parameters were used: Step 1 94 ° C for 60 sec. (initial denaturation) Step 2 94 ° C for 15 sec. Step 3 65 ° C for 1 min. Step 4 68 ° C for 7 min. Step 5 Repeat steps 2-4 15 additional times Step 6 94 ° C for 15 sec. Step 7 65 ° C for 1 min.

Step 8 68 ° C for 7 min + 15 sec. / cycle Step 9 Repeat steps 6-8 11 additional times Step 10 72 ° C for 8 min. Step 11 4 ° C (and maintain) At the end of the 28 cycles, 50 μl of the reaction mixture was removed; and the remaining reaction mixture was operated for 10 additional cycles as noted above: Step 1 94 ° C for 15 sec. Step 2 65 ° C for 1 min. Step 3 68 ° C for (10 min. + 15 sec.) / Cycle Step 4 Repeat steps 1-39 additional times Step 5 72 ° C for 10 min. An aliquot of 5-10 μl of the reaction mixture was analyzed by electrophoresis on a low concentration agarose gel (approximately 0.6-0.8%) to determine successful reactions. Although all extensions potentially contained the full-length gene, some of the larger products or bands were selected and separated from the gel. In addition purification involved using a gel extraction method such as QIAQuick ™ (QIAGEN Inc.). After DNA recovery, the Klenow enzyme was used to convert the final nucleotide protrusions of shaved ends to facilitate religation and cloning. After precipitation with ethanol, the products were redissolved in 13 μl of ligation buffer.

Then, 1 μl of T4-DNA ligase (15 units) and 1 μl of T4 polynucleotide kinase were added, and the mixture was incubated at room temperature for 2-3 hours or overnight at 16 ° C. The cells of E ^. Competent coli (in 40 μl of appropriate media) were transformed with 3 μl of ligation mixture and cultured in 80 μl of SOC medium (Sambrook J. et al., supra). After incubation for one hour at 37 ° C, the whole transformation mixture was plated on Luria Bertani (LB) agar (Sambrook J. and others, supra) containing carbenicillin at 25 ml / L (2xCarb). The next day, 12 colonies were picked randomly from each plate and cultured in 150 μl of a LB / 2xCarb medium. placed in an individual cavity of a sterile, commercially available 96-well microtiter plate. The next day, 5 μl of each culture was transferred overnight to a 96-well non-sterile plate and after dilution with 1:10 with water, 5 μl of each sample was transferred to a PCR setup. For PCR amplification, 15 μl of the concentrated (1.33x) PCR mixture containing 0.75 Taq polymerase units, a vector primer and one or both gene-specific primers used for the extension reaction were added to each well. The amplification was performed using the following conditions: Step 1 94 ° C for 60 min. Step 2 94 ° C for 20 sec.

Step 3 55 ° C for 30 sec. Step 4 72 ° C for 9 sec. Step 5 Repeat steps 2-4 for an additional 29 times Step 6 72 ° C for 180 sec. Step 7 4 ° C (and maintain). The aliquots of these PCR reactions were performed on agarose gels together with molecular weight markers. The sizes of the PCR products were compared to the original, partial cDNAs, and appropriate clones were selected, ligated to the plasmid and sequenced. The nucleotide and amino acid sequences for human HEDG are shown in Figure 1. The hedg coding region starts at nucleotide 309 and ends at nucleotide 1403 of SEQ ID NO: 1. When the three possible translations of HEDG were searched against protein databases such as SwissProt and PIR, no exact comparisons were found. Figure 2 shows the comparison between the amino acid sequences of sheep HEDG, EDG-2 (U18405) and human EDG-1 (Gl 119130).

SAW. Antisense Analysis Knowledge of the complete, correct cDNA sequence of HEDG allows its use as a tool for antisense technology in the investigation of gene function. Oligonucleotides, cDNAs or genomic fragments comprising the antisense strand structure of hedg are used either [n vivo or in vitro to inhibit mRNA expression. Such technology is now well known in the art, and antisense molecules are designated at various locations along the nucleotide sequences. By treating the test cells or animals complete with said antisense sequences, the gene of interest can be effectively deactivated. Frequently, the function of the gene was ascertained by observing the behavior at an intracellular, cellular, tissue or organism level (eg, loss of differentiated function, changes in morphology, etc.). In addition to using the sequences constructed to interrupt the transcription of a particular open reading frame, modifications of gene expression are obtained by designing antisense sequences to intron regions, promoters / enhancer elements, or even trans-regulating regulation genes. Similarly, inhibition is achieved using the Hogeboom base pair methodology, also known as "triple helix" base pairs.

Vile. Expression of HEDG Expression of hedg is achieved by subcloning the cDNAs to appropriate expression vectors and transfecting the vectors to analogous expression hosts. In this particular case, the cloning vector previously used for the generation of the cDNA library also provides direct expression of the hedg sequences in EL coli. Upstream of the cloning site, this vector contains a promoter for β-galactosidase, followed by the sequence containing the amino-terminal Met and the 7 subsequent residues of β-galactosidase. Immediately after these eight residues is a gene-designed bacteriophage promoter useful for artificial primers and transcription and for providing a number of unique restriction sites for cloning. Induction of the transfected bacterial strain, isolated with IPTG using normal methods, produces a fusion protein corresponding to the first seven residues of β-galactosidase, approximately 15 residues of "linker", and the peptide encoded within the cDNA. Since the inserts of the cDNA clone are generated by an essentially random procedure, there is an opportunity in three that the included cDNA lies in the correct frame for the appropriate translation. If the cDNA is not in the proper reading frame, it is obtained by removing or inserting the appropriate number of bases by well-known methods, including in vitro mutagenesis, digestion with exonuclease III or "mung bean" nuclease, or the inclusion of an oligonucleotide linker of appropriate length. The hedg cDNA is released in other vectors that are known to be useful for the expression of the protein in specific hosts. Oligonucleotide primers containing cloning sites as well as a DNA segment (approximately 25 bases) sufficient for the hybridization of the stretches at both ends of the target cDNA are chemically synthesized by normal methods. These primers are then used to amplify the desired gene segment by PCR. The resulting gene segment is digested with appropriate restriction enzymes under normal conditions and isolated through gel electrophoresis. Alternatively, similar gene segments are produced by digestion of the cDNA with appropriate restriction enzymes. Using appropriate primers, the segments for coding the sequence of more than one gene are ligated together and cloned into appropriate vectors. It is possible to optimize expression by constructing said chimeric sequences. Suitable expression hosts for said chimeric molecules include, but are not limited to, mammalian cells such as Chinese Hamster Ovary (CHO) and human 293 cells, insect cells such as Sf9 cells, yeast cells such as Saccharomyces. cerevisiae, and bacteria such as EL coli. For each of these cell systems, a useful expression vector includes an origin of replication that allows propagation in bacteria and a selectable marker such as the β-lactamase antibiotic resistance gene to allow selection of the plasmid in the bacterium. In addition, the vector includes a second selectable marker such as the neomycin phosphotransferase gene to allow selection in transfected eukaryotic host cells. Vectors for use in eukaryotic expression hosts usually require RNA processing elements such as the 3 'polyadenylation sequences, if they are not part of the cDNA of interest. In addition, the vector contains promoters or enhancers, which increase the expression of the gene. These promoters are specific hosts and include MMTV, SV40 and metalothionin promoters for CHO cells; trp, lac, tac and T7 promoters for bacterial hosts; and an alpha factor, alcohol oxidase and promoters of PGH for yeast. Transcription enhancers, such as the rous sarcoma virus enhancer, are used in mammalian host cells. Once the homogeneous cultures of recombinant cells are obtained through normal culture methods, large quantities of recombinantly produced HEDG were recovered from the conditioned medium and analyzed using chromatographic methods known in the art.

Vlll. Isolation of Recombinant HEDG The HEDG is expressed as a chimeric protein with one or more additional polypeptide domains added to facilitate the purification of protein. Said purification facilitating domains includes, but is not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains allow purification on immobilized immunoglobulin, and the domain used in the FLAGS affinity extension / purification system (Immunex Corp. Seattle WA). The inclusion of a cleavage link sequence such as Factor XA or enterokinase (Invitrogen) between the purification domain and the HEDG sequence is useful to facilitate the expression of HEDG.

IX. Chimeric T7Gs test Chimeric T7Gs were constructed by combining the extracellular receptive sequences of a new isoform with the transmembrane and intracellular segments of a known isoform. Said chimeric molecules are useful for testing purposes. This concept was demonstrated by Kobilka et al. (1988, Science 240: 1310-1316) who created a series of α2-β2 adrenergic receptors (AR) by inserting progressively larger amounts of the a2-AR transmembrane sequence into β2-AR. The binding activity of known agonists changed as the molecule shifted from having more conformation than a2 to that of ß2, and the constructions of intermediates demonstrated specific mixed character. The specific character to bind antagonists, however, was correlated with the source of the Vil domain. The importance of the T7G VII domain for ligand recognition was also found in chimeras using two yeast a-factor receptors and is important since yeast receptors are classified as miscellaneous receptors. In this way, the functional role of the specific domains seems to be conserved across the T7G family without considering the category. In a parallel form, the internal segments or cytoplasmic domains of a particular isoform are exchanged with the analogous domains of a known T7G and used to identify the structural determinants responsible for coupling the receptors to tpmépcas G proteins (Dohlman et al. (1991) Annu Rev Biochem 60653-88) A chimeric receptor in which domains V, VI, and the intracellular connection loop of ß2-AR are substituted to a2-AR are shown to bind ligands with the specificity of a2-AR, but they stimulate cyclase from adenylate in the ß2-AR form This shows that for the adrenergic type receptors, the recognition of the G protein is present in the V and VI domains and their connection loops The opposite situation was predicted and observed for a chimera where the V tie? VI of a1-AR replaced the corresponding domain in ß2-AR and the resulting receptor binding ligands with specific character of ß2-AR and the change of phosphatidymositol mediated by activated G protein in the form of a1-AR Finally, the chimeras Constructs of the muscarinic receptors also showed that the V-? VI loop is the main determinant for the specific character of G protein activity (Bolander FF, supra) Chimeric or modified T7Gs containing substitutions in the extracellular and transmembrane regions have shown that both portions of the receptor determine the specific character of ligand binding. For example, two residues were conserved in the V domain of all the aryl-rhinoprotein receptors and the ratplanminine v snn nfir.p? apn? There is a potent agonist activity. It is believed that these serines are in the binding site of T7G and that they form hydrogen bonds with the catechol portion of the agonists. Similarly, an Asp residue present in the lll domain of all T7Gs, which bind biogenic amines is believed to be in the T7G binding site and to form an ion pair with the amine ligand group. The cloned T7Gs, functionalities are expressed in heterologous expression systems and their biological activity was analyzed (Marullo et al. (1988) Proc. Nati, Acad. Sci. 85-7551-55, King et al. (1990) Science 250: 121-23) . A heterologous system introduces genes for a mammalian T7G and a mammalian G protein in yeast cells. The T7G showed to have specific character of appropriate ligand and affinity and to initiate the appropriate biological activity, the growth arrest and morphological changes of the cells of the yeast. An alternative method for testing chimeric receptors is based on the procedure using the P2U purinergic receptor (P2U) as published by Erb et al. (1993, Proc.Nat.Acid.Sci.10449-53). The function is easily tested in cultured K562 leukemia cells, since these cells lack P2U receptors. K562 cells are transfected with expression vectors containing normal or chimeric P2U and loaded with fura-a, fluorescent probe for Ca + +. The activation of appropriately assembled and functional P2U receptors with UTP to extracellular ATP mobilizes intracellular Ca + +, which reacts with fura-a and is measured spectrofluorometrically. As with the previous T7G receptors, the chimeric genes are created by combining sequences for extracellular receptive segments of any newly discovered T7G polypeptide with the nucleotides for the transmembrane and intracellular segments of the known P2U molecule. Washing the transfected K562 cells in microcavities containing appropriate ligands activates binding and fluorescent activity by defining effectors of the T7G molecule. Once the ligand and function are established, the P2U system is useful to define the antagonists or inhibitors that block the binding and prevent said fluorescent reactions.

X. Production of HEDG Specific Antibodies Two aspects were used to give antibodies to H EDG, and each aspect is useful to generate both polyclonal and monoclonal antibodies. In one aspect, the denatured protein of the reverse phase H PLC separation is obtained in amounts up to 75 μg. The denatured protein is used to immunize mice or rabbits using normal protocols; about 100 micrograms are suitable for immunization of a mouse, while up to 1 mg can be used to immunize a rabbit. To identify mouse hybridomas, the protein is naturalized and radioiodinated and used to classify potential murine B-cell hybridomas for those that produce the antibody. This procedure requires only small amounts of protein, so 20 mg could be enough to label and classify several thousand clones. In the second aspect, the amino acid sequences of an appropriate HEDG domain, as inferred from the translation of the cDNA, were analyzed to determine regions of high antigenicity. Oligopeptides comprising appropriate hydrophilic regions, as illustrated in Figure 3, are synthesized and used in suitable immunization protocols to produce antibodies. The analysis to select appropriate epitopes is described by Ausubel FM et al. (Supra). The optimal amino acid sequences for immunization are usually in the C-terminus, the N-terminus and those hydrophilic, intervening regions of the polypeptide, which are likely to be exposed to the external environment when the protein is in natural conformation. Typically, the selected peptides, approximately 15 residues in length, are synthesized using an Applied Biosystems Peptide Synthesizer Model 431A using fmoc chemistry and coupled to key limpet hemocyanin (KLH, Sigma, St. Louis MO) by reaction with ester of M-maleimidobenzoyl-N-hydroxy-succinimide (MBS, see Ausubel FM et al., Supra). If necessary, a cysteine can be introduced at the N-terminus of the peptide to allow coupling to KLH. Rabbits can be immunized with the peptide-KLH complex in a complete Freund's assistant. The resulting antisera can be tested for antipeptide activity by binding the peptide to the plastic, blocking with 1% bovine serum albumin, reacting with antisera, washing and reacting with specific goat anti-rabbit IgG, affinity purified, labeled (radioactive or fluorescent). Hybridomas can be prepared and classified using normal techniques. Hybridomas of interest can be detected by classifying with labeled H EDG to identify those fusions that produce the monoclonal antibody with the desired specific character. In a typical protocol, the plate cavities (FAST, Becton-Dickinson, Palo Alto, CA) are coated, during incubation, with specific rabbit-anti-mouse antibodies purified by affinity (or suitable anti-species Ig) at 10 ° C. mg / ml. The coated cavities are blocked with 1% BSA, washed and incubated with supernatants of the hybridomas. After washing, the cavities are incubated with labeled H EDG at 1 mg / ml. Supernatants with specific antibodies bind more marked H EDG than the detectable above the background. Then the specific antibodies that produce clones can be expanded and subjected to 2 cycles of cloning at a limiting dilution. Cloned hybridomas are injected into mice treated with pristane to produce ascites, and the monoclonal antibody can be purified from mouse ascites fluid by affinity chromatography using Protein A. Monoclonal antibodies with affinities of at least 108 M *, preferably 109 to 10 10 or stronger, will typically be produced through normal procedures as described in Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Springer Harbor Laboratory , New York, and in Goding (1986) Monoclonal Antibodles Principles and Practice, Academic Press, New York, both incorporated herein by reference XI. Diagnostic Test Using Specific HEDG Antibodies Individual HEDG antibodies are useful for investigating signal transduction and diagnosis of infectious or hereditary conditions, which are characterized by differences in the amount or distribution of HEDG or products downstream of a cascade Signaling Since HEDG was found in a human rheumatoid collection, it appears to be over-regulated in cell types primarily involved in immune protection or defense. Diagnostic tests for HEDG include methods that use the antibody and a mark to detect HEDG in fluids of the human body, membranes, cells, tissues or extracts of said tissues The polypeptides and antibodies of the present invention are used with or without modification. Frequently, polypeptides and antibodies will be labeled by joining them, either covalently or non-covalently, with a substance, which provides a signal etectable A wide variety of brands and conjugation techniques are known and have been widely reported in the scientific and patent literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, chromogenic agents, magnetic particles and the like. The patents that teach the use of said marks include the patents of E.U.A. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Also, recombinant immunoglobulins can be produced as shown in the patent of E.U.A. No. 4,816,567, incorporated herein by reference. A variety of protocols for measuring soluble or membrane binding HEDG, using polyclonal or monoclonal antibodies specific for the protein, is known in the art. Examples include the enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and fluorescent activated cell sorting (FACS). A two-site monoclonal-based immunoassay is preferred using monoclonal antibodies reactive to two epitopes without interference to HEDG, but a competitive binding assay may be employed. These assays are described, inter alia, in Maddox, DE et al. (1983, J. Exp Med. 158: 1211).

XII. Purification of Native HEDG Using Specific Antibodies The native or recombinant HEDG was purified by immunoaffinity chromatography using antibodies specific for HEDG. In general, an immunoaffinity column is constructed by covalently coupling the anti-TRH antibody to an activated chromatographic resin. Polyclonal immunoglobulins will be prepared from immune serum either by precipitation with ammonium sulfate or by purification on immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Also, monoclonal antibodies are prepared from mouse ascites fluid by precipitation of ammonium sulfate or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently linked to a chromatographic resin such as activated CnBr-Sepharose (Pharmacia LKB Biotechnology). The antibody is coupled to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.

Said immunoaffinity columns are used in the purification of HEDG by preparing a cell fraction containing HEDG in a soluble form. This preparation is derived by solubilization of whole cells or a sub-cellular fraction obtained via differential centrifugation (with the addition of detergent or not) or by other methods well known in the art. Alternatively, the soluble HEDG containing a signal sequence is secreted in a useful amount to the medium in which the cells grow. A preparation containing soluble HEDG is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of HEDG (eg, pH regulators of high ionic strength in the presence of detergent). The column is then eluted under conditions that break the binding of the antibody / protein (eg, a pH regulator with a pH of 2-3 or a high concentration of a chaotrope such as urea ion or thiocyanate), and HEDG is collected.

XIII Drug Classification This invention is particularly useful for classifying therapeutic compounds using HEDG or its binding fragments in any variety of drug classification techniques. The polypeptide or fragment employed in said test is either free in solution, fixed to a solid support, exits a cell surface, or is located intracellularly. A method for classifying drugs utilizes eukaryotic or prokaryotic host cells, which are stably transformed with recombinant nucleic acids that express the polypeptide or fragment. The drugs are classified against said transformed cells in competitive binding assays. Said cells, either in a viable or fixed form, can be used for normal binding assays. They measure, for example, the formation of complexes between HEDG and the agent that is being tested. Alternatively, one can examine the decrease in complex formation between HEDG and a receptor caused by the agent being treated.

Thus, the present invention provides methods for classifying drugs or any other agents that can affect signal transduction. These methods, well known in the art, comprise contacting said agent with a H EDG polypeptide or fragment thereof and analyzing, (i) the presence of a complex between the agent and the HEDG polypeptide or fragment, or (ii) ) the presence of a complex between the HEDG polypeptide or fragment and the cell. In such competitive binding assays, the H EDG polypeptide or fragment is typically labeled. After a suitable incubation, the H EDG polypeptide or free fragment was separated from that present in the form of binding, and the amount of free label or no complex is a measure of the ability of the particular agent to bind to H EDG or to interfere with the formation of the HEDG complex and agent complex. Another technique for classifying the drug provides a high throughput classification for compounds that have adequate binding affinity to the HEDG polypeptide and is described in detail in European Patent Application 84/03564, published on September 13, 1984, incorporated herein. by reference. In summary, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with the HEDG polypeptide and washed. The bound HEDG polypeptide is then detected by methods well known in the art. The purified H EDG can also be coated directly onto plates for use in the aforementioned drug classification techniques. In addition, antibodies without neutralization can be used to capture the peptide and immobilize it on the solid support. This invention also contemplates the use of competitive drug classification assays wherein the neutralizing antibodies capable of binding H EDG, specifically compete with a test compound to bind to HEDG polypeptides or fragments thereof. In this manner, antibodies can be used to detect the presence of any peptide that shares one or more antigenic determinants with H EDG.

XIV. Rational Drug Design The objective of rational drug design is to produce structural analogs of biologically active polypeptides of interest or of small molecules with which they interact, agonists, antagonists, or inhibitors. Any of these examples can be used to design drugs, which are more active or stable forms of the polypeptide or that improve or interfere with the function of a polypeptide in vivo (cf Hodgson (1991) Bio / Technology 9: 19-21 , incorporated herein by reference). In one aspect, the three-dimensional structure of a protein of interest, or of a protein inhibitor complex, it is determined through x-ray crystallography, through computer modeling or, more typically, through a combination of the two aspects. Both the form and charges of the polypeptide must be ascertained to see the structure and to determine the active sites of the molecule. Less frequently, useful information regarding the structure of a polypeptide can be gained through modeling based on the structure of homologous proteins. In both cases, the relevant structural information is used to design efficient inhibitors. Useful examples of rational drug design include molecules that have improved activity or stability as shown by Braxton S and Wells JA (1992 Biochemistry 31: 7796-7801) or which act as inhibitors, agonists or antagonists of native peptides as shown by Athauda SB et al. (1993 J. Biochem.1 1 3: 742-746), incorporated herein by reference. It is also possible to isolate a specific antibody on the target, selected by functional assay, as described above, and then solve its crystal structure. This aspect, in principle, produces a farmanucleus on which the subsequent drug design can be based. It is possible to derive protein crystallography by generating anti-idiotypic antibodies (anti-ids) to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of the anti-ids could be expected to be an analogue of the original receiver. The anti-id can then be used to identify and isolate peptides from chemically or biologically produced peptide libraries. The isolated peptides could then act as the farmanucleus. By virtue of the present invention, a sufficient amount may be made available to perform such analytical studies as X-ray crystallography. In addition, the knowledge of the amino acid sequence of HEDG provided herein, will provide guidance for those who employ modeling techniques. by computer instead of or in addition to X-ray crystallography.

XV Identification of other Members of the Signal Transduction Complex The purified H EDG of the invention is a research tool for the identification, characterization and purification of interaction G proteins or other signal transduction pathway proteins. The radioactive labels are incorporated into an H EDG domain selected through various methods known in the art and used in vitro to capture interaction molecules. A preferred method involves labeling the primary amino groups in HEDG with Bolton-Hunter reagent 251 (Bolton, AE and H unter, WM (1973) Biochem J, 133: 529). This reagent has been used to label several molecules without concomitant loss of biological activity (Herbert CA et al. (1991) J. Biol. Chem. 266: 18989; McColl S. et al. (1993) J. Immunol. 150: 4550-4555 ). The labeled HEDG is useful as a reagent for the purification of molecules with which it interacts. In an affinity purification mode, membrane-bound H EDG is covalently coupled to a chromatography column. The cell-free extract derived from synovial cells or putative target cells is passed over the column, and the molecules with the affinity binding appropriate for HEDG. The HEDG complex is recovered from the column, dissociated and the recovered molecule is subjected to N-terminal protein sequencing. This amino acid sequence is then used to identify the captured molecule or to design degenerate oligonucleotide probes for the cloning of the relevant gene from an appropriate DNA library. In an alternative method, antibodies against H EDG, specifically antibodies, are developed. Monoclonal antibodies are classified to identify those that inhibit the binding of labeled HEDG. These monoclonal antibodies are then used therapeutically.

XVI. Use and Administration of Antibodies, Inhibitors or Antagonists Antibodies, inhibitors or antagonists of HEDG (or other treatments to limit signal transduction, LST), provide different effects when administered therapeutically. The LSTs are formulated in an aqueous, non-toxic, inert, pharmaceutically acceptable carrier medium, preferably at a pH of about 5 to 8, most preferably 6 to 8, although the pH varies according to the characteristics of the antibody, inhibitor or antagonist that is formulated, and the condition that will be treated The characteristics of LSTs include the molecule's solubility, half-life and antigenicity / immunogenicity These and other characteristics help define an effective vehicle Native human proteins are preferred as LSTs, but organic or synthetic molecules resulting from drug classifications are equally effective in particular situations LSTs are delivered through routes of administration including, but not limited to, topical creams and gels, transmucosal spray and spray, patches and bandages transdermal, injectable, intravenous and washing formulations, and liquids and pills orally administered formulated to resist stomach acid and enzymes The particular formulation, the exact dose, and the route of administration are determined by the attending physician, and vary according to each specific situation. These determinations are made considering multiple variables such as condition to be treated, the LST that will be administered, and the pharmacokinetic profile of the particular LST Additional factors, which are taken into account, include the severity of the patient's disease status, age, weight, gender, diet, time and frequency of administration, drug combination, reaction sensitivities, and tolerance / response to therapy Long-acting LST formulations are administered every 3 to 4 days, weekly, or once every two weeks, depending on the half-life and the clear regime of the particular LST. Normal amounts of doses vary from 0.1 to 100,000 micrograms, up to a total dose of approximately 1 g, depending on the route of administration. The guide of particular doses and methods of supply is provided in the literature; see patents of E. U.A. Nos. 4,657,760; 5,206,344; or 5, 225.212. Those skilled in the art will employ different formulations for different LSTs. Administration to cells, such as nerve cells, will need delivery in a form different from that of other cells such as vascular endothelial cells. It is contemplated that signal transduction to normal, trauma or diseases, which activate the activity of H EDG that can be treated with LSTs. These conditions or diseases are specifically diagnosed through the tests discussed above, and this test is performed in cases of suspected bacterial or fungal infections; allergic responses; mechanical damage associated with trauma; hereditary diseases; lymphoma or carcinoma; or other conditions that activate the genes of the lymphoid tissues. All publications and patents mentioned in the specification are incorporated herein by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in conjunction with the specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to said specific embodiments. In fact, several modifications of the modes described above for carrying out the invention, which are obvious to those skilled in the field of molecular biology or related fields, are within the scope of the claims.H.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: Coleman, Roger Gueler, Karl J. Au-Youg, Janice Bandman, Olga Seilhamer, Jeffrey J. (ii) TITLE OF THE INVENTION: HOMOLOGO DE RECEPTOR OF HUMAN EDG-2 (iii) NUMBER OF SEQUENCES: 6 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: INCYTE PHARMACEUTICALS, INC. (B) STREET: 3174 Porter Drive (C) CITY: Palo Alto (D) STATE: CA (E) COUNTRY: USA (F) CODE: 94304 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: DOS (D) SOFTWARE: FastSEQ Version 1.5 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: will be assigned (B) SUBMISSION DATE: June 20 of 1996 (C) CLASSIFICATION: (vii) DATA FROM THE PREVIOUS REQUEST: (A) SERIES NO. OF APPLICATION: 60 / 000,352 (B) DATE OF SUBMISSION: June 20, 1995 (vii) DATA FROM THE PREVIOUS APPLICATION: (A) SERIES NO. APPLICATION FORM: 08 / 567,817 (B) DATE OF SUBMISSION: December 6, 1995 (viii) INFORMATION OF THE APPORTER / AGENT: (A) NAME: Luther, Barbara J. (B) REG. NUMBER. : 33,888 (C) NO. REFER / PERMITTED: PF-0042 PCT (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 415-855-0555 (B) TELEFAX: 415-852-0195 (2) INFORMATION FOR SEC ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1875 base pairs (B) TYPE: nucleic acid (C) STRUCTURE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vii) IMMEDIATE SOURCE: (A) COLLECTION : Rheumatoid synovium (B) CLON: 80853 (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 1: GGCAGGTACG GCCGGATTCC CGGGTCGACC ACGCGTCCGC TCTCAAGGGA ACAGCTCCTG 60 CCCAGGTCTG TGGGTACTCA GCATGGATAT CAGTCTCCCT GTGAGTGATG GGAAAGAACT 120 AGCAGAGGTG GACGTCTGAT TTATGAAGCT CCCCATCCAC CTATCTGAGT ACCTGACTTC 180 TCAGGACTGA CACCTACAGC ATCAGGTACA CAGCTTCTCC TAGCATGACT TCGATCTGAT 240 CACCACACAA GAA? ATTTGT CTCCCGT? GT TCTGGGGCGT GTTCACCACC TACAACCACA 300 GAGCTGTCAT GGCTGCCATC TCTACTTCCA TCCCTGTAAT TTC? C? GCCC CAGTTCACAG 360 CCATGAATGA ACCACAQTCC TTCTACAACG AGTCCATTGC CTTCTTtTAT AACCGAAGTG 420 GAAAGCATCT TGCCACAGA? TGGAACACAG TCAGCAAGCT GGTGATGGGA CTTGG? ATCA 480 CTGTTTGTAT CTTCATCATG TTGGCCAACC TATTGGTCAT GGTGGCAATC TATOTCAACC 540 GCCGCTTCCA TTTTCCTATT TATTACCTAA TGGCTAATCT GGCTGCTGC? GACTPCTrTG 600 CTGGGTTGGC CTACTTCTAT CTCATGTTCA ACACAGßACC CAATACTCGG AGACTCACTG 660 TTAGCACATG GCTCCTTCGT CAGGGCCTCA TTGACACCAG CCTGACGGCA CTGTCGCCA 720 ACTTACTGGC TATTGCAATC GAGAGGCACA TTACGGTTTT CCGCATGCAG CTCCACACAC 780 GGATGAGCAA CCGGCGOGTA GTGGTGGTCA TTGTGGTCAT CTGOACTATG GCCATCGTTA 840 TGGGTGCTAT? CCCAGTGTG GGCTGGAACT GTATCTCTGA T? TTGA? AAT TGTTCCAACA 900 GGCACCCCT CTACAGTßAC TCTTACTTAG TCTTCTGGGC CATTTTCAAC TTGGTGACCT 960 TTGTGGTAAT GGTGGT CTC TATGCTCACA TCTT GGCTA TGTTCGCCAG AGGACTATGA 1020 GAATGTCTCG GCATAOTTCT GGACCCOGGC GGAATCGGGA TACCATGATG AGTCTTCTGA 1080 AGACTGTGGT CATTCTOCTT GGGGGCTCTTA TCATCTGCTG GACTCCTGOA TTGGTTTTGT 1140 TACTTCTACA CGTOTGCTGT CCACAGTGCG ACGTGCTGGC CTATGAGAAA TTCTTCCTTC 1200 TCCTTOCTGA ATTCAACTCT GCCATGAACC CCATCATTTA CTCCTACCGT GACAAAGAAA 1260 TGAGCGCCAC CTTTAGACAG ATCCTCTGCT GCCAGCGCAG TGAßAACCCC ACCGCCCCCA 1320 CAGAAGGCTC AGACCGCTCG GCTTCCTCCC TCAACCACAC CATCTTGGCT GßAGTTCACA 1380 GCAATGACCA CTCTOTGGTT TAGAACOGAA ACTGAß? TGA GGAACCAGCC GTCCTCTCTT 1 40 GGAGGATAAA CAAGCCTCCC CCTACCCAAT TGCCAGGGCA AGGTGGGGTG TGAGAGAGGA S00 GAAAAGTCAA CTCATGTACT TAAACACTAA CCAATGACAG TATTTGTTCC TGGACCCCAC 1560 AAGACTTGAT ATATATTGAA AATTAGCTTA TGTGACAACC CTCATCTTGA TCCCCATCCC 1620 TTCTGAAAGT AGGAAGTTGs AGCTCTTGCA ATGGAATTCA AGAACAGACT CTGGAGTGTC 1680 CATTTAGACT ACACTAACTA GACTTTTAAA AG? TTTTGTG TGGTTTGGTG CAAGTCAGAA 1740 TAAATTCTGG CTAGTTGAAT CCACAACTTC ATTTATATAC AGGCTTCCCT TTTTTATTTT 1800 TAAAGGATAC GTTTCACTTA ATAAACACGT TTATGCCTAA AAAAAAAAAA AAAAAAAAAAA 1860 AAAAAAAAAA AAAAC 1875 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 364 amino acids (B) TYPE: amino acid (C) STRUCTURE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vii) IMMEDIATE SOURCE: (A) COLLECTION: Rheumatoid synovium (B) CLON: 80853 (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Ala? La lie Ser Thr Ser He Pro to He Ser Gln Pro Gln Phe 1 5 10 15 Thr Wing Met Asn Glu Pro Gln Cys Phe Tyr Asn Glu Ser He Wing Phe 20 25 30 Phe Tyr Asn Arg Ser Gly Lys His Leu Ala Thr Glu Trp Asn Thr Val 40 45 Ser Lys Leu Val Mßt Gly Leu Gly He Thr Val Cys He Phe He Mßt 50 55 60 Leu Ala Asn Leu Leu Val Met Val Ala He Tyr Val Asn Arg Arg Phe 65 70 75 80 His Phe Pro He Tyr Tyr Leu Met Wing Asn Leu? The? La? La? Sp Phe 85 90 95 Phe? The Gly Leu Wing Tyr Phe Tyr Leu Met Phe? Sn Thr Gly Pro? Sn 100 105 110 Thr? Rg? Rg Leu Thr Val Ser Thr Trp Leu Leu? Rg Gln Gly Leu He 115 120 125? Sp Thr Ser Leu Thr? The Ser Val? La? Sn Leu Leu? The He? 130 135 140 Glu? Rg His He Thr Val Phe? Rg Met Gln Leu His Thr? Rg Met Ser 145 150 155 160? Sn? Rg? Rg Val Val Val Val Val Val He Trp Thr Met? La He 165 170 175 Val Met Gly? The He Pro Ser Val Gly Trp? Sn Cys He Cys? Sp He 180 185 190 Glu? Sn Cys Ser? Sn Met? The Pro Leu Tyr Ser? Sp Ser Tyr Leu Val 195 200 205 Phe Trp? The He Phe? Sn Leu Val Thr Phe Val Val Met Val Val Leu 210 215 220 Tyr? The His He Phe Gly Tyr Val? Rg Gln? Rg Thr Met? Rg Met Ser 225 230 235 240? Rg His Ser Ser Gly Pro? Rg? Rg? Sn? Rg Asp Thr Met Met Ser Leu 24S 250 25S Leu Lys Thr Val Val He Val Leu Gly Gly Phß He He Cys Trp Thr 260 265 270 Pro Gly Leu Val Leu Leu Leu Leu Asp Val Cys Cys Pro Gln Cys Asp 275 280 285 Val Leu? Tyr Glu Lys Phe Phe Leu Leu Leu? Glu Phe? Sn Ser 290 295 300? The Met? Sn Pro He He Tyr Ser Tyr? Rg? Sp Lys Glu Met Ser? La 305 310 315 320 Thr Phe? Rg Gln He Leu Cys Cys Gln? Rg Ser Glu? Sn Pro Thr? La 325 330 335 Pro Thr Glu Gly Ser? Sp? Rg S * r? La Ser Ser Leu? Sn His Thr He 340 345 350 Leu? the Gly Val His Ser? sn? sp His Ser Val Val 355 360 (2) IN FORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERIS: (A) LO NG ITU D: 393 amino acids (B) TI PO: amino acid (C) ESTR UCTU RA: ind ividual (D) ) TO POLYGES: linear (ii) MOLÉC LA TI: peptide (vii) FU ENTE I NM EDIATA: (A) COLLECTION: Gen Bank (B) CLON: U 1 8405 (ix) DESCRI PTION OF S EC U ENCIA: SEC IDNO: 3: Met? La? The? Ser Thr Ser Ser Pro Val Val Ser Gln Pro Gln Phe 1 5 10 15 Thr? The Met? Sn Glu Pro Gln Cys Phe Tyr Asn Glu Be He? The Phe 25 30 Phe Tyr? Sn? Rg Ser Gly Lys Tyr Leu? The Thr Glu Trp? Sn Thr Val 40 45 Ser Lys Leu Val Met Gly Leu Gly He Thr Val Cys He Phe He Met 50 55 60 Leu? La? Sn Leu Leu Val Met Val? La He Tyr Val Asn Arg Arg Phe 65 70 75 80 His Phe Pro He Tyr Tyr Leu Met Wing Asn Leu Wing? Wing Asp Phe 85 90 95 Phe Ala Gly Leu Ala Tyr Phe Tyr Leu Met Phe Asn Thr Gly Pro? Sn 100 105 110 Thr? Rg? Rg Leu Thr Val Ser Thr Trp Leu Leu? Rg Gln Gly Leu He 115 120 125? Sp Thr Thr Val Thr? The Ser Val? La? Sn Leu Leu? The He? La He 130 135 140 Glu? Rg His He Thr Val Phe? Rg Met Gln Leu His Thr? Rg Met Ser 145 150 155 160? Sn? Rg? Rg Val Val Val Val Val Val He Trp Thr Met? La He 165 170 175 Val Met Gly? The He Pro Ser Val Gly Trp? Sn Cys He Cys? Sp He 180 185 190 Glu? Sn Cys Ser Asn Met Wing Pro Leu Tyr Ser Asp Ser Tyr Leu Val 195 200 205 Phe Trp Wing He Phß? Sn Leu Val Thr Phe Val Val Met Val Val Leu 210 215 220 Tyr? His He Ph? Gly Tyr Val? Rg Gln? Rg Thr Met? Rg M? T S r 225 230 235 240 Arg His Being Ser Gly Pro Arg Arg Asn? Rg? Sp Thr Met Mßt Ser Leu 245 250 255 Leu Lys Thr Val Val lie Val Leu Gly? The Phe He He Cys Trp Thr 260 265 270 Pro Gly Leu Val Leu Leu Leu Leu? Sp Val Cys Cys Pro Gln Cys? Sp 275 280 285 Val Leu? Tyr Glu Lys Phe Phe Leu Leu Leu? Glu Phe? Sn Ser 290 295 300? The Met? Sn Pro He He Tyr Ser Tyr? Rg? Sp Lys Glu Met Ser? La 305 310 315 320 Thr Phß? Rg Gln He Leu Cys Cys Gln? Rg Ser Glu? Sn Thr Ser Gly 325 330 335 Pro Thr Glu Gly Ser? Sp? Rg Ser? La Ser Ser Leu? Sn His Thr He 340 345 350 Leu? La Gly Val His Ser? Sn? Sp Kis Ser Val Phe? Rg Lys Glu Thr 355 360 365 Lys Met? Rg Gly Gly His His Leu Leu? Rg? Sp Glu Glp Pro Pro Pro 370 375 380 Pro Glu? Rg Pro Gly Gln Gly? Rg Val 385 390 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERIS: (A) LENGTH: 381 amino acids (B) TYPE: amino acid (C) STRUCTURE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vii) IMMEDIATE SOURCE: (A) COLLECTION: GenBank (B) CLON: 119130 (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Mßt Gly Pro Thr Ser Val Pro Leu Val Lys? The His? Rg Ser Ser Val 1 5 10 15 Ser? Sp Tyr Val? Sn Tyr? Sp He He Val? Rg His Tyr? Sn Tyr Thr 20 25 30 Gly Lys Leu? Sn He Ser? La? Sp Lys Glu? Sn Ser He Lys Leu Thr 35 40 45 Ser Val Val Phe He Leu He Cys Cys Phe He He Leu Glu? Sn He 50 55 60 Phß Val Leu Leu Thr He Trp Lys Thr Lys Lys Phß His? Rg Pro Mßt 65 70 75 80 Tyr Tyr Phe He Gly? Sn Leu? The Leu Ser? Sp Leu Leu? The Gly Val 85 90 95? The Tyr Thr? La? Sn Leu Leu Leu Ser Gly? The Thr Thr Tyr Lys Leu 100 105 110 Thr Pro? Gln Trp Phß Leu? Rg Glu Gly Ser Met Phe Val? Leu 115 120 125 Ser? La Ser Val Phe Ser Leu Leu? La He? La He Glu? Rg Tyr He 130 135 140 Thr Mßt Leu Lys Met Lys Leu His? Sn Gly Ser? Sn? Sn Phe? Rg Leu 145 150 155 160 Phe Leu Leu I Will Be the Cys Trp Val I Ser Leu He Leu Gly Gly 165 170 175 Leu Pro He Met Gly Trp? Sn Cys He Will Be the Leu Ser Ser Cys Ser 180 185 190 Thr Val Leu Pro Leu Tyr His Lyß His Tyr He Leu Phe Cys Thr Thr 195 200 205 Val Phe Thr Leu Leu Leu Leu Ser He Val Xle Leu Tyr Cys? Rg He 210 215 220 Tyr Ser Leu Val? Rg Thr? Rg Ser? Rg? Rg Leu Thr Phe? Rg Lys? Sn 225 230 235 240 Be Ser Lys? Ser? Rg Be Ser Glu? Sn Val Ala Leu Leu Lys Thr 245 250 255 Val He He Val Leu Ser Val Phe He Ala Cys Trp Ala Pro Leu Phe 260 265 270 He Leu Leu Leu Asu Val Gly Cyß Lys Val Lys Thr Cys Asp He 275 280 285 Leu Phß Arg Ala Glu Tyr Phß Leu Val Leu Wing Val Leu Asn Ser Gly 290 29S 300 Thr Asn Pro He He Tyr Thr Leu Thr Asn Lys Glu Mßt Arg? Rg? La 305 310 315 320 Phß He Arg He Mee Ser Cys Cys Lys Cys Pro Ser Gly? Sp Ser? 325 330 335 Gly Lyß Phß Lys? Rg Pro He He Wing Gly Met Glu Phe Ser? Rg Ser 340 345 350 Lys Ser Asp Asn Ser Ser His Pro Gln Lys? Sp Glu Gly? Sp? Sn Pro 355 360 365 Glu Thr He Met Ser Ser Gly? Sn Val Asn Ser Ser Ser 370 375 380 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRUCTURE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vii) IMMEDIATE SOURCE: (A) Oligomer R (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 5: TCATCTTGAT CCCCATCCCT TCTG 24 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) STRUCTURE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vii) IMMEDIATE SOURCE: (A) Oligomer F (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 6: AGTCTCCGAG TATTGGGTCC TGTG 24

Claims (9)

1 .- A purified polynucleotide comprising a nucleic acid sequence encoding the polypeptide of SEQ ID NO: 2; or the component of said polynucleotide.

2. The polynucleotide according to claim 1, comprising the nucleic acid sequence for (hedg) of SEQ ID NO: 1. 3 - An antisense molecule comprising the complement of the polynucleotide of claim 2 or a portion thereof. 4. A pharmaceutical composition comprising the antisense molecule of claim 3 and a pharmaceutically acceptable excipient. 5. - A method for the treatment of a subject with a condition associated with the expression of altered hedg, which comprises administering an effective amount of the pharmaceutical composition of claim 4 to the subject. 6. A diagnostic composition comprising a oligonucleotide of the polynucleotide of claim 2. 7 '.- A diagnostic test for a condition associated with the expression of altered hedg comprising the steps of: a) providing a biological sample; b) combining the biological sample and the diagnostic composition of claim 6; c) allowing hybridization to occur between the biological sample and the diagnostic composition under suitable conditions; d) measuring the amount of hybridization to obtain a sample value; and e) comparing the sample value with the normal values to determine if the expression of hedg was altered. 8. An expression vector comprising the polynucleotide of claim 1. 9. A host cell transformed with the expression vector of claim 8. 10. A method for producing a polypeptide, said method comprises the steps of: a) culturing the host cell of claim 9 under conditions suitable for expression of the polypeptide; and b) recovering the polypeptide from the culture of the host cell. 1 1 .- A purified polypeptide (H EDG) comprising the amino acid sequence of SEQ ID NO: 2. 12 - A diagnostic composition comprising the polypeptide of claim 1 or a portion of the same. 1

3. - A pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable excipient. 1

4. - A method for the treatment of a subject with a condition associated with the expression of altered H EDG, which comprises administering an effective amount of the pharmaceutical composition of claim 13 to the subject. 1

5. An antibody specific for the polypeptide of claim 11, or a portion thereof. 1

6. A diagnostic composition comprising the antibody of claim 15. 1

7. A diagnostic test for a condition associated with the expression of altered HEDG comprising the steps of: a) providing a biological sample; b) combining the biological sample and the antibody of claim 15 under conditions suitable for complex formation; c) measuring the amount of complex formation between HEDG and the antibody to obtain a sample amount; and d) comparing the amount of complex formation in the sample with the normal amounts of complex formation, wherein a variation between the amount of sample and the normal amounts of complex formation establishes the presence of the condition. 1

8. A method for classifying a plurality of compounds for specific binding affinity with the polypeptide of claim 11 or any portion thereof comprising the steps of: a) providing a plurality of compounds; b) combining HEDG with each of the plurality of compounds for a sufficient time to allow binding under suitable conditions; and c) detecting the binding of HEDG to each of the plurality of compounds, thereby identifying the compounds that specifically bind HEDG. 1

9. A pharmaceutical composition comprising a compound of claim 18 and a pharmaceutically acceptable excipient. 20. A method for the treatment of a subject with a condition associated with the expression of altered HEDG comprising administering an effective amount of the pharmaceutical composition of claim 19 to the subject.