MXPA97007486A - Mutant of the type erythrina caffra inhibitor and the use of said mutant to purify proteases of being - Google Patents

Abstract

The present invention relates to a polypeptide which has an activity of a DE-3 inhibitor of Erythrina caffra and which reversibly and selectively binds serine proteases of a protein mixture which is obtained by culturing prokaryotic and eukaryotic cells. which have been transformed or transfected with a nucleic acid encoding said polypeptide in a manner that allows the host cells to express said polypeptide under suitable nutrient conditions and isolating said polypeptide, characterized in that the polypeptide has an amino acid sequence which is functionally analogous to SEQ ID NO: 2 has a partial region that is more than 85% homologous to the amino acid region 30-139 of this sequence, has two bisulfide bridges and begins at the N-terminus with SEQ ID NO: 4 or with SEC ID NO: 4 extended at the N-terminus by methionine and has a binding capacity for tissue plasminogen activators. 1.25 MU / ml and more and is particularly suitable for purifying activators of plasmigens such as tissue plasminogen activators (t-AP and derivative

Description

Mutant of the inhibitor type Erythrina caffra and the use of said mutant to purify serine proteases.

The invention relates to a new inhibitor of the type Erythrina caffra and its use to purify serine proteases.

The erythrin trypsin inhibitors (ITE) are effective reagents for the purification by affinity chromatography of serine proteases and especially of plasminogen activators (C. Heussen (1984) (22)), β-trypsin, α-chymotrypsin and thrombin (S.

Onesti et al. (1992) (34)). These trypsin inhibitors have been known for a long time (C. Heussen (1982) (23); F.J. Joubert (1982) (26); F.J. Joubert (1982) (27)).

The DE-3 inhibitor from E. caffra is particularly preferably suitable for the purification of plasminogen activators (F.J. Joubert (1987) (25)). The complete amino sequence of this inhibitor is also described in this publication. The DE-3 can be isolated and purified to REF: 25474 from the seeds of E. caffra (F.J. Joubert (1982) (26)). An ITE which is not cytotoxic is described in EP-B 0 218 479 (15).

A recombinant ITE is described by Teixeira et al., (1994) (45) the specific inhibitory activity of which for the tissue plasmid activator is 1.7 x 10 9 U / mmol. In contrast, the specific inhibitory activity of natural ITE is 1.94 x 10 U / mmol. The same applies to the inhibitory activity towards trypsin (2.63 x 10 12 /3.21 x 10 12). In this way the specific inhibitory activity of the recombinant ITE produced according to Texeira is 20% less for trypsin and 10% less for tissue plasminogen activator than the activity of natural ITE.

A modified form of ITE is described by Teixeira et al. (1994) (46) in which the N-terminal Val is replaced by Asp. Such modified ITE does not bind to tAP and shows no inhibitory activity towards tAP. The specific inhibitory activity towards trypsin is practically identical for natural ITE and Asp-modified ITE.

According to Teixeira the recombinant ITE is obtained by expression and purification by ammonium sulfate precipitation (80% saturation), dialysis against water and a decomposition with cyanogen bromide in which the N-terminal sequence including methionine is decomposes This is subsequently purified by gel filtration (Sephadex G50).

A purified polypeptide which has the activity of a DE-3 inhibitor from Erythrina caffra (also denoted ITE polypeptide in the following) is described in DE-A 44 24 171.2 (9) which, in contrast to the inhibitor isolated from natural sources, it has considerably higher specificity towards serine proteases.

An important additional criterion for the adaptability of an ITE polypeptide for the effective purification of serine proteases is the binding capacity for serine proteases.

The aim of the invention is therefore to improve the effectiveness of the binding capacity of an ITE polypeptide for the purification of serine proteases.

The invention relates to a polypeptide which has the activity of a DE-3 inhibitor from Erythrina caffra, reversibly and selectively binds a serine protease from a protein mixture where the polypeptide has an amino acid sequence which is functionally analogous to SEQ ID NO: 2, has a partial region that is more than 85% homologous to the amino acid region 39-139 of this sequence has two disulfide bridges and starts at the N-terminus with Ser and preferably with SEQ ID NO: 4. The binding capacity of this polypeptide for plasminogen activators is 1.25 MU / ml and more.

A polypeptide according to the invention is preferably encoded a) by a nucleic acid according to SEQ ID NO: 1, b) by a nucleic acid which hybridizes under stringent conditions with a DNA sequence showing a SEQ ID NO: 1 and begins at the N-terminus with a sequence of nucleic acid codes for SEQ ID NO: 4, c) by a nucleic acid which hybridizes under stringent conditions with one of the sequences mentioned in a) or b) without the degeneracy of the genetic code.

This has surprisingly resulted in the binding capacity for serine proteases being considerably increased by substitution by the N- terminus of Val for Ser in an ITE polypeptide. While the known ITE polypeptide begins at the N- terminus with the amino acid sequence Val-Leu-Leu-Asp (SEQ ID NO: 3), the ITE polypeptide according to the invention starts with Ser-Leu-Leu-Asp (SEC-ID-N0: 4).

These results are particularly surprising with respect to Teixeira et al. (1994) (46). A person skilled in the art would have to expect from these publications that modification of the N-terminus of the ITE would result in a modified ITE that has lost its specific inhibitory activity towards plasminogen activators and that its activity towards trypsin remains unchanged. This is even more surprising in this way that the specific activity for trypsin as well as the binding capacity for plasminogen activators and in particular for tissue plasminogen activators increases to a significant degree for a modified ITE according to the invention.

"A polypeptide with the activity of a DE-3 inhibitor of Erytrina caffra" is understood as a polypeptide which specifically binds serine proteases such as plasminogen activators, β-trypsin, α-chymotrypsin and / or thrombin. The link can inhibit the activity of serine proteases.

A "functionally analogous" ITE polypeptide is understood as a polypeptide which has the activity of a DE-3 inhibitor of Erythrina caffra. Modifications of the protein sequence are possible within the usual familiar framework for a person skilled in the art. However, in this regard it should be noted that the N- terminus should be identical to SEQ ID NO: (N-terminal Ser) and that the polypeptide must have two bisulfide bridges to fix the spatial structure. After recombinant production in prokaryotes the protein according to the invention can also additionally contain an additional N-terminal methionine (SEQ ID NO: 10). The positions of the bisulfide bridges correspond to those of the bisulfide bridges of the ITE polypeptide (Cys 39-Cys 83 and Cys 132-Cys 139 Lehle, K. et al. (1994) (30)). Likewise a partial region of the ITE polypeptide should be more than 85% homologous to the region of the sequence 39-139 of SEQ ID NO: 2. This partial region is preferably also the region of the 39-39 protein sequence according to with the invention and is preferably identical or essentially identical to the region of sequence 39-139 of SEQ ID NO: 2.

An ITE polypeptide (or a nucleic acid encoding such a polypeptide) is particularly preferably used whose amino acid sequence is identical or essentially identical to SEQ ID NO: 2. This has surprisingly also resulted in the binding capacity of the inhibitor for serine proteases being particularly high when, after recombinant production in prokaryotes, the N-terminal methionine is completely divided or at least to a large extent (preferably by far 85% in the preparation of the ITE polypeptide). The ITE polypeptide may differ in size. However, it preferably comprises 100-200 amino acids. particularly preferably about 139-173 amino acids.

The binding capacity of a serine protease inhibitor. it is understood as the amount of a serine protease (preferably a plasminogen activator) which can be removed from a solution by an immobilized inhibitor. The binding capacity is generally expressed as an activity matrix / ml [in the case of plasminogen activators as an amidolytic activity established in a U / ml matrix].

The activity of the plasminogen activator is determined after elution of the serine protease bound previously.

The activity is determined according to U. Kohnert et al. (1992) (29). For this the decomposition rate of the dihydrochloride of H-D-Ile-Pro-Arg-p-nitroanilide (S2288, Kabi Vitrum, Sweden) is measured photometrically via the absorbance at 405 nm.

The invention also relates to a process for the purification of a serine protease from a protein mixture by binding the serine protease to an immobilized ITE polypeptide which reversibly and selectively binds serine proteases, removing the unbound fractions from the protein mixture, separating the serine protease from the inhibitor, separating the immobilized inhibitor from the soluble serine protease and isolating the serine protease which is characterized in that an ITE polypeptide is used which is reversibly and selectively binds serine proteases from a protein mixture and where the polypeptide preferably has an amino acid sequence which is functionally analogous to SEQ ID NO: 2, has a partial region that is more than 85% homologous to the region of amino acids 30 - 139 of this sequence, has two bisulfide bridges beginning at the N-terminus with SEQ ID NO: or with SEC ID NO: 4 extended at the N-terminus by methionine.

Such ITE polypeptide is preferably produced prokaryotic or eukaryotic expression of an exogenous DNA. The purification and isolation is preferably achieved by chromatography on an anion exchanger, cation exchanger or a nickel chelate column.

The process according to the invention is particularly advantageous for the purification of plasminogen activators such as tissue plasminogen activators (t-AP) and derivatives (e.g., mutations and deletions) thereof. The T-AP is described in EP-B 0 093 619 (13), the tAP derivatives are described in US Pat. No. 5,223,256 (53), WO 90/09437 (54) and T.J.R. Harris (1987) (20).

The ITE polypeptide can be produced according to methods familiar to those skilled in the art. For this first a nucleic acid molecule (preferably DNA) is produced which qualifies it for an ITE polypeptide which starts at the N-terminus with SEQ ID NO.4 or with SEQ ID NO.4 extended at the N-terminus by methionine and it encodes an ITE polypeptide. The ITE polypeptide has an amino acid sequence that is functionally analogous to SEQ ID NO: 2, and contains a partial region that is more than 85% and preferably completely homologous to amino acid region 39-139 of SEQ ID NO: 2 and two disulfide bridges. In this respect it is also possible to use a sequence which codes for the same polypeptide within the scope of the degeneracy of the genetic code and / or is complementary to this sequence. A nucleic acid is also preferably used which hybridizes under stringent conditions with SEQ ID NO: 1 and which at the N-terminus codes for SEQ ID NO: 4 or for SEQ ID NO: 4 extended at the N-terminus by methionine. The DNA is cloned into a vector that can be transferred to a host cell and replicated there. In addition to the sequence of the ITE polypeptide, such vector contains operating elements which are necessary for the expression of the DNA. This vector which contains the DNA inhibitor and the operator elements is transferred to a vector which is capable of expressing the ITE polypeptide DNA. The host cell is cultured under conditions which allow expression of the ITE polypeptide. The ITE polypeptide is isolated from these cells. To do this, adequate measurements ensure that the ITE polypeptide can adopt an active tertiary structure in which it exhibits inhibitory properties.

In this regard, as already discussed, it is not necessary that the ITE polypeptide have the exact amino acid sequence corresponding to SEQ ID NO: 2 and SEQ ID NO: 4. ITE polypeptides are equally suitable which have essentially the same sequence and are polypeptides with the activity of a DE-3 inhibitor of Erythrina caffra. However, it is essential that the Val be replaced by Ser in the N-terminus. The amino acid sequences SEQ ID NO: 2 and 4 are preferably used which, in the case of expression in prokaryotic host cells but not after eukaryotic expression, may contain an N-terminal methionine. (SEQ ID NO: 10). However, methionine is generally separated in E. coli since the sequence begins at the N-terminus with Met-Ser (Dalborge H. et al (1990) (7)). Such a polypeptide in which Met is separated is preferred.

The invention also describes an isolated nucleic acid which encodes an ITE polypeptide that reversibly and selectively binds serine proteases to a protein mixture and where the protein has an amino acid sequence which is functionally analogous to SEQ ID NO: 2 , has a partial region that is more than 85% homologous to the amino acid region 30-139 of this sequence, has two bisulfide bridges and begins at the N-terminus with SEQ ID NO: 4 or with SEQ ID NO: 4 extended by the N-terminus by methionine. Such a nucleic acid is preferably identical to SEQ ID NO: 1 or to a nucleic acid encoding the same polypeptide within the scope of the degeneracy of the genetic code. For expression in eukaryotic and prokaryotic host cells the nucleic acid contains eukaryotic or prokaryotic transcription or translation signals at the 5 'end which are familiar to a person skilled in the art.

The nucleic acid is preferably used which hybridizes under stringent conditions with SEQ ID NO: 1 under standard conditions. Such standard conditions and methods for hybridization are known to a person skilled in the art and are described by J. Sambroo et al. (1989) (38) and B.D, Hames, S.G. Higgins (1985) (19). The standard protocols described in these publications are generally used for this purpose. A particular reference is made to Sambrook, Section IX (40), both publications are subject of disclosure of this invention. The standardized astringent conditions are also described in Holtke and Kessler (1990) (24).

The preferred astringent conditions are given when the hybridization is carried out in the presence of 1 mol / l of NaCl, 1% of SDS and 10% of dextran sulfate with subsequent double washing of the filter at room temperature for 5 minutes in 2 x SSC and one additional washing step for 30 minutes. This additional washing step can be carried out with 0.5 x SSC, 0.1% SDS, preferably with 0.2 x SSC, 0.1% SDS and particularly preferably with 0.1% SDS at 65 C.

The modifications can be proper to facilitate the construction of vectors or to optimize the expression. Such modifications are for example: -the modification of the nucleic acid to introduce several recognition sequences for restriction enzymes to facilitate the steps of ligation, cloning and mutagenesis -the modification of the nucleic acid to incorporate the preferred codons for the host cells -the extension of the nucleic acid by additional operator elements to optimize the expression in the host cell.

The inhibitor is preferably expressed in microorganisms such as E. coli. However, expression of eukaryotic cells such as yeast, CHO cells or insect cells is also possible.

The biologically functional Olásmidos or viral DNA vectors are used for this purpose which contain the nucleic acid according to the invention. The prokaryotic and eukaryotic host cells are stably transformed or transfected with such vectors.

The expression vectors must contain a promoter which allows them to express the inhibitory protein in the host organism. Such promoters are known to the person skilled in the art and are for example the lac promoter (Chang et al. (1977) (26), trp (Goddel et al. (1980) (18)), the? PL promoter (Shimatake). et al. (1981) (41)) and the Ts promoter (US Patent No. 4,689,406 (49)). Synthetic promoters are also suitable such as for example the tac promoter (US Patent 4,551,433 (48)). Coupled promoter systems are equally suitable as for example the T7-RNA polymerase / promoter system (Studier et al., (1986) (44)). The hybrid promoters comprise a bacteriophage promoter and the operator region of the microorganism (EP-A 0 267 851 (11)) are also suitable. In addition to the promoter, an effective ribosome binding site is also required. In the case of E. coli, this site-binding ribosome is called the Shine-Dalgarno (SD) sequence (Shine et al. (1975) (42); J. Sambrook et al (1989) (39)).

To improve expression it is possible to express the inhibitory protein as a fusion protein. In the case of the sequence of a DNA which codes for the N-terminal part of an endogenous bacterial protin or for another stable protein it is generally fused to the 5 'end of the coding sequence for the inhibitor protein. Examples of these are lacZ, trpE.

After expression the fused proteins are preferably divided with enzymes (eg, factor Xa) (Nagai et al. (1984) (32)). Additional examples of cleavage sites are the cleavage site of the IgA protease (WO 91/11520) (55) and the ubiquitous cleavage site (Miller et al., (1989) (31)). In such cases the ITE polypeptide according to the invention may additionally contain one or more additional amino acids at the N-terminus. However, an ITE polypeptide is preferably used that does not contain additional N-terminal amino acids and begins at the N-terminus with SEQ ID NO: 4.

The recombinant protein which is first obtained as inactive inclusion bodies can be converted into a soluble active protein by a process familiar to the person skilled in the art. For this purpose the inclusion bodies are for example solubilized with guanidine hydrochloride or urea in the presence of a reducing agent, reduced, the reducing agent is removed for example by dialysis and the solubilized protein is renatured preferably using a redox system such as glutathione reduced and oxidized or mixed disulfides.

Such methods are described, for example, in US Pat. No. 4,933,434 (52), EP-B 0 241 022 (16) and EP-A 0 219 874 (10). .

It is also possible to hide proteins as active proteins of microorganisms. A fused protein is preferably used for this which is composed of a signal sequence that is suitable for secretion of proteins in the host organism used (US Patent No. 4,336,336 (47)) and the nucleic acid which codes for the inhibitory protein. In this process the protein is also hidden in the medium (in the case of gram-positive bacteria) or in the periplasmic space (in the case of gram-negative bacteria). It is appropriate to incorporate a cleavage site between the signal sequence and the coding sequence for the inhibitor which allows the cleavage of the inhibitory protein either during processing or in an additional step. Such signal sequences are for example ompA (Ghrayeb et al., (1984) (17) and phoA (Oka et al. (1985) (33)).

The vectors additionally contain terminators. The terminators are DNA sequences which signal the end of a transcription process. They are generally characterized by giving structural features: a reversible reversible region rich in G / C that can form intramolecularly a double helix and a number of U (or T) residues. Examples are the trp attenuator and the terminator in phage DNA fd and rrnB (Brosius et al., (1981) (5)).

Expression vectors generally additionally contain selective markers to select transformed cells. Such selective markers are, for example, the resistant genes for ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin and tetracycline (Davies et al (1978) (8)). The selective markers are equally suitable as are the genes for substances that are essential for the photosynthesis of substances necessary for the cell such as histidine, tryptophan and leucine.

Numerous suitable bacterial vectors are known. For example, the vectors have been described for the following bacteria: Bacillus subtilis (Palva et al. (1982) (35)), E. coli (Aman et al. (1985) (1)); Studier et al. (1986) (44)), Streptococcus cremoris (Powel et al (1988) (37)); Streptococcus lividans and Streptomyces lividans (US Patent No. 4,747,056 (50)).

In addition to prokaryotic microorganisms it is also possible to express the inhibitory protein in eukaryotes (such as for example CHO cells, yeast or insect cells). Yeast and insect cells are preferred as a eukaryotic expression system. The expression in yeast can be reached by three types of yeast vectors (integrated YIp (plasmids integrating yeast), replicator vectors Yrp (yeast replicating plasmids) and episomal vectors (yeast episomal plasmids). described for example in SM Kingsman et al. (1987) (28).

Additional genetic engineering methods for constructing and expressing suitable vectors are described in J. Sambrook et al. (1989) (39).

After production, the recombinant ITE is purified chromatographically on an anion exchanger such as a Q-Sepharose® column, a cation exchanger (eg, based on sulfopropyl) or a nickel chelate column as described for example in Porath, J. & Olin, B. (1983) (36).

Surprisingly a recombinant ITE polypeptide is obtained after this purification process which, when on immobilized BrCN-Sepharose, has an increased binding capacity and an increased specific inhibitory activity for T-AP and t-AP derivatives.

An ITE polypeptide purified and produced in this way is obtained by culturing prokaryotic and eukaryotic host cells which are transformed or transfected with an exogenous DNA sequence encoding an ITE polypeptide that reversibly and selectively binds serine proteases from a mixture of protein, the protein contains an amino acid sequence which is functionally analogous to SEQ ID NO: 2, a partial region thereof being more than 85% homologous to the amino acid region 39-139 of this sequence, having two bisulfide bridges and starting at the N-terminus with SEQ ID NO: 4 or with SEQ ID NO: 4 extended at the N-terminus by methionine, in a form that allows the host cells to express the polypeptide under suitable nutrient conditions, and isolate the desired polypeptide which, compared to the natural ITE polypeptide of Erythrina caffra, has a higher binding capacity for the plasmigen activator of human tissue. The binding capacity is preferably between 1.25 and 1.6 MU / ml.

Such an inhibitory derivative preferably additionally has a specific inhibitory activity of 1.07 U / mg, preferably 1.5 U / mg or more towards trypsin. This high activity is obtained after the chromatographic purification on the anion exchanger, the cation exchanger or a nickel chelate column.

Additionally the invention describes a process for the production of a recombinant ITE polypeptide by culturing prokaryotic and eukaryotic host cells which are transformed or transfected with an exogenous DNA sequence encoding an ITE polypeptide that reversibly and selectively binds serine proteases from a protein mixture, the protein contains an amino acid sequence which is functionally analogous to SEQ ID NO: 2, a partial region thereof being more than 85% homologous to the amino acid region 39-139 of this sequence, having two bridges bisulfide and starting at the N-terminus with SEQ ID NO: 4 or with SEQ ID NO: 4 extended at the N-terminus by methionine, in a form that allows the host cells to express the polypeptide under suitable nutrient conditions, and isolate the ITE polypeptide of the host cells and chromatographic purification on the anion exchanger, the heat exchanger ations or a column of nickel chelate.

The serine proteases are purified using the recombinant ITE polypeptide according to methods familiar to the person skilled in the art (see, eg, F. J. Joubert (1987) (25)). For this purpose the ITE polypeptide is covalently bound to a matrix (eg, a CNBr-Sepharose column) and the protein mixture containing the serine protease is applied to the column under neutral conditions or slightly alkaline conditions and the Chromatography is carried out. It is eluted by pH decrease at one =. pH 5.5 or using buffer solutions containing chaotropic agents such as p. ex. KSCN. The eluate has a protein purity of about 95% relative to the serine protease.

The immobilization of the inhibitor and all additional steps of the process for the purification of serine and t-AP proteases can be carried out in a manner analogous to that of the isolation of the E. caffra DE-3 inhibitor. Such processes are described, for example, in EP-B 0 218 479 (15), EP-B 0 112 122 (14), US Patent 4,902,623 (51). It is convenient to immobilize on an inert support, preferably on CNBr-Sepharose®.

The microorganisms DSM 3689 and DSM 5443 mentioned in the application have been deposited on 09.04.1986 (DSM 3689) and 13.07.1989 (DSM 5443) in the "Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH", Mascheroder Weg IB, D-38124 Braunsch eig.

The following examples, publications and additional sequence protocols describe the invention the protected scope from which the patent claims derive. The described methods are to be understood as examples which describe the subject matter of the invention even after the modification.

Example 1 Expression of ITE polypeptide in E. coli a) Gene synthesis A corresponding nucleic acid sequence is derived from the amino acid sequence of a polypeptide ITE by Erythrina caffra (Joubert and Dowdle (1987) (27)) using the codons preferred by E. coli and synthesized by the method of Beattie and Fowler (1991) (2) . To facilitate cloning, a cleavage site for the restriction enzyme EcoRI is inserted at the 5 'end and a cleavage site for the restriction enzyme HindIII is inserted at the 3' end. The synthesized nucleic acid was separated with the enzymes EcoRI and HindIII and ligated with a pBS + cloning vector (Estratogene, US, Catalog No. 211201 (43), derived from a phage fl and a pBS plasmid from Estratogene with a T3 promoter gene and T7, a penicillin resistant gene, an origin fl, a ColE-1 origin, a lacl gene, a lacZ gene and a multiple cloning site) which was previously also digested with EcoRI and HindIII. The slurry mixture was transformed into Escherichia coli. The obtained clones were selected on ampicillin and analyzed by restriction with enzymes EcoRI and HindIII. The resulting clone, pBS + ITE, contains an additional EcoRI / HindIII fragment with a size of about 539 bp and has a SEQ ID NO: 9. b) Expression vector The pBS + ITE plasmid was cleaved with an EcoRI and HindIII restriction enzyme and the 539 bp fragment was isolated. The expression vector pBTacl (Boehringer Mannheim GmbH, Catalog No. 1081365 (3), based on pUC8, H. Haymerle et al (1986) (21)) was also digested with the EcoRI and HindIII enzymes and the vector fragment of approximately 4.6 kb in size It was isolated. Both fragments were ligated and transformed into E. coli (DSM 5443) together with the helper plasmid pUBS520 (Brinkman et al (1989) (4)) containing the lac repressor gene. The clones were selected by means of resistance to ampicillin and kanamycin mediated by the plasmids. The obtained plasmid pBTITE contains an additional EcoRI / HindIII fragment with a size of 539 bp compared to the initial vector pBTacl and can be used to express recombinant, unmodified ITE (recITE).

The DSM 3689 which contains a plasmid Iq can also be used in an analogous manner in place of DSM 5443. In this case the helper plasmid pUB520 is not required.

A PCR fusion was carried out for the mutation of the N- terminus and the introduction of a new promoter. The promoter of plasmid pDS46 / RBII (commercially available from Qiagen Company under the name pQE-6) was amplified using the oligonucleotides ITE-1 and ITE-2 (amplification product A). The synthetic sequence which codes for an ITE polypeptide was isolated from the plasmid pBTITE using the PCR primers ITE-3 and ITE-4, the ITE-3 primer is designed in such a way that the amplified product encodes an ITE polypeptide having the substitution of desired amino acid (Ser) (amplification product B). Both amplification products were fused by means of PCR and with the help of the initiators ITE-1 and ITE-4. The fusion product was separated with the two restriction enzymes BamHI and HindIII and purified. The plasmid pA27fd, EP-A O 382 174 (USP 5,223,256) (12) was (partially) treated with the two restriction enzymes BamHI and HindIII and the vector fragment of about 4600 bp in size was isolated. The vector fragment was ligated and transformed together with the helper plasmid pUBS520 (Brinkmann et al., 1989 (4)) in E. coli C600 + (DSM 5443). The clones were selected by means of resistance to ampicillin and kanamycin mediated by the plasmids. The obtained plasmid pITE-T2Lvs contains an additional HindIII fragment of about 350 bp compared to the initial pBTITE plasmid.

Table i: PCR starters Initiator Sequence 5'- > ITA-1 AAAGGATCCCTCGAGAAATCATAAAAA (SEQ ID NO: 5) ITE-2 CATAAGAATTCTGTTTCCTCTTTAATGAATTCTG (SEQ ID NO: 6) ITE-3. CAGAATTCTTATGTCATTATTAGA (SEQ ID NO: 7) ITE-4 AGAAGCTTTTATCAGCTG (SEQ ID NO: 8) c) Expression of a recombinant ITE polypeptide (Serite) in E. coli To examine the efficiency of expression the E. coli strain DSM 5443 was cultured with the pITE-T2Lvs and pUBS520 plasmids in LB medium (Sambrook et al. (1989) (38)) in the presence of ampicillin and kanamycin (50 μg / ml final concentration in each case) at an optical density (OD) of 0.6 to 550 nm. Expression was initiated by the addition of 5 mM IPTG. The culture was incubated for an additional 4 hours. Subsequently the E. coli were collected by centrifugation and resuspended in buffer (50 mM Tris-HCl pH 8, 50mM EDTA); E. coli were lysed by sonification. The insoluble protein fractions (inclusion bodies) were collected again by centrifugation and resuspended in the above-mentioned buffer by sonification. The suspension was mixed with application of 1/4 volume of buffer (250 mM Tris-HCl pH 6.8, 0.01 M EDTA, 5% SDS, 5% mercaptoethanol, 50% glycerol and 0.005% bromophenol blue) and analyzed with the 12.5% SDS polyacrylamide gel aid. As a control, the same preparation was treated using an E. coli culture (pITE-T2Lvs / pUBS520) which had not been mixed with IPTG and applied to the polyacrylamide gel. After coloring the gel with 0.2% coomassie blue R250 (dissolved in 30% methanol and 10% acetic acid) and decolouring the gel in a methanol-acetic acid mixture, a pronounced band with a molecular weight close to 22 kD is recognizable in the IPTG induced culture preparation. This band could not be found in the preparation of E. coli cells which had not been induced.

Example 2 Renaturation and purification of Serite 50 g of inclusion bodies (IBs) were solubilized with 0.1 M Tris-HCl pH 8.5, 6 M guanidine, 0.1 M DTE, lmM EDTA, (90 min at 25 ° C) and dialyzed against 3 mol / l guanidine / HCl then adjusting the pH value to 2.5 (HCl). The dialysate was centrifuged (SS34, 13000 rpm) and adjusted to a Cprot = 36.9 mg / ml by concentration in YM 10. A 1 1 reaction tank was filled with 0.1 M Tris / HCl, pH 8.5, 1 mM EDTA, lmM GSH, 0.1 mM GSSG. It was renatured at 20 ° C at a time interval of 30 min by the addition of 16 times of the dialysate.

Purification of Serite a) in an anion exchanger The Serite renatured in 0.1 M Tris / HCl, pH 8.5, 1 mM EDTA, lmM GSH, 0.1 mM GSSG. The renaturant was diluted 1: 2 with H20, adjusted to a pH of 8.0 with HCl and applied to a column of Q-Sepharose® equilibrated with 50 mM Tris / HCl, pH 8.0 (gel of 5 mg protein / ml). After washing the column with buffer and with 50 mM Na2HP04 / H3P04, pH 8.0 (five column volumes each time) is eluted with 50 mM Na2HP04 / H3P04, pH 8.0, 0.2 M NaCl. b) on a cation exchanger The renatured Serite was adjusted to pH 4.0 by addition of HCl and dialyzed against 50 mM NaOAc / HCl, pH 4. 0 (Cross Flow). The dialysate was centrifuged (13000 rpm, 30 min, SS 34) and applied to a column of TSK-SP (cation exchanger with sulfopropyl side chains, Merck, Darmstadt, Germany, 15 ml volume) which had been equilibrated with 50 mM NaOAc / HCl, pH 4.0. After washing the column with equilibration buffer and with 50 mM NaOAc / HCl, pH 4.0, 0.1 M NaCl, it is eluted with 50 mM NaOAc / HCl, pH 4.0, 0.2 M NaCl.

The purity of the eluate was examined by means of SDS-PAGE and RP-HPLC.

Result: The Serite is linked to the TSK-SP column under the conditions used and can be eluted with 0.2 M NaCl. Analyzes on SDS-PAGE and RP-HPLC yielded a purity of > 95% Example 3 Comparison of the specific activity of SßrITE, recite and ITE of the seeds of Erythrina caffra Serite, recite and ITE isolated from the seeds of Erythrina caffra [(seeds) ITE] were dialyzed against 50 mM Na2HP04 / H3P04, pH 8.0, 0.2 M NaCl and adjusted to the protein concentration of 1.0 mg / ml. The protein concentration was determined by measurement of UV absorbance at 280 nm (e = 1.46 cm2 / mg).

Determination of ITE activity The inhibition of trypsin by ITE is measured using N-a-benzoyl-L-arginine-4-nitroanilide (BAPA) as a substrate. 40 μl of a trypsin solution (0.13 mg / ml 2 mM Hcl) is mixed with 60 μl of buffer solution (0.1 Tris / HCl, pH 8.0) and 100 μl of ITE solution in a quartz cuvette and incubated for 5 min at 30 ° C. After the addition of 800 μl of a BAPA solution (10 mg BAPA x HCl / 10 my buffer solution test) the increase in absorbance per minute is determined at 405 nm.

The ITE activity is determined according to the following formula: U / ml = L l - Amuegtra / Atrip3inaj. Ctripaina. 0 328. P It shows 1 increase in absorbance / min of inhibited sample Atripsin: increase in absorbance / min of uninhibited trypsin Ctr? Psir?: Concentration of trypsin in the test mixture P: predilution of the ITE solution Protein specific activity (U / mg) ITE (seeds) 0.88 Serite 1.5 rec.ITE 1.07 Result: the specific activity of Serite is 50% higher than the specific activity of ITE isolated from E. caffra seeds by classical processes.

Example 4 170 mg of purified Serite or ITE (seeds) or recombinant ITE (produced analogously to example 1 and 2) were dialyzed against 0.05 M H3B03 / NaOH, pH 8.0, 0.5 M NaCl (coupling buffer) and mixed with 7.5 g of CNBr -Sepharose® (absorbed overnight in 500 ml 1 mM HCl, subsequently filtered by suction and suspended in coupling buffer). The suspension was incubated for 90 min at room temperature, filtered by suction and stirred overnight with 400 ml 0.1 M Tris / HCl, pH 8.0. The SerlTE-Sepharose® was drained and equilibrated with 0.7 M arginine / H3P04, pH 7.5.

Example 5 Purification of a recombinant plasmid activator rPA rPA: recombinant tPA derivative comprises kringle 2 and protease domains (produced according to EP-A 0 382 174, (US Patent 5,223,256) (12)). 54 mg of rPA recombinant plasmid activator (protein concentration determined by means of absorbance at 280 nm, extinction coefficient 1.69 cm / mg) was applied to ITE-Sepharose balanced with 0.7 M arginine / H3P04, pH 7.5. After washing with equilibrium buffer solution and with 0.3 M arginine / H3P04, pH 7.0 (five column volumes in each case) was eluted with 0.3 M arginine / H3P04, pH 4.5. The content of the plasminogen activator in the eluate was in each case determined with S 2288 as the substrate, cf. example 6 Example 6 Comparison of the binding capacity of SerlTE-Sepharose and ITE (seeds) -Sepharosa for r-PA ITE (seeds) and Serite were coupled to CNBr-Sepharose ff according to the instructions of the Sepharose producer (Pharmacia, Freiburg). The final columns were equilibrated with 0.7 mol / 1 with Arg / H3P04, pH 7.5, loaded with 2MU r-PA gel / ml and then washed with 5 CV 0.7 mol / 1 with Arg / H3P04, pH 7.5, 0.5 M NaCl and 5 CV 0.3 mol / 1 Arg / H3P04, pH 7.0, they were eluted with 0.3 mol / 1 Arg / H3P04, pH 4.5. The binding capacity was determined as in the rPA eluate (gel MU / ml). Each gel was loaded five times and eluted. The gels were regenerated under standard conditions between the individual stages.

Run-off capacity Ser-ITE-Seph MU / ml IET-Seph. 1 1.04 1.28 2 0.95 1.35 3 1.08 1.53 4 1.01 1.48 5 0.98 1.49 The data summarized in the table show that Ser-ITE-Sepharose produced by Ser-ITE coupling to CNBr-Sepharose has a binding capacity 1.5 times higher for r-PA than seed-ITE-Sepharose formed by seed-ITE coupling CNBr-Sepharose.

Activity determination: (Kohnert et al. (1992) (29)). 200 μl of buffer solution (0.1 Tris / HCl, pH 7.5, 0.15% Twen® 80) and 200 μl of rPA solution diluted with buffer solution at a concentration of 1 -12 μg / ml are incubated for 5 minutes at 37 ° C. The test is started by adding 200 μl S2288 (6 mmol / 1 (HD-Ile-Pro-Arg-P-nitroanide dihydrochloride, Kabi Vitrum, Sweden)) which had also been incubated at 37 ° C. The amidolytic activity is calculated from the increase in absorbance at 405 nm in the first 2.5 minutes with an extinction coefficient for p-nitroaniline of 9750 1 / mol / cm.

Reference list 1) Aman et. to the.; Gene 40 (1985) 1833 2) Beattie und Fowler, Nature 352 (1991) 548-549 3) Boehringer Mannheim GmbH, Katalog Nr. 1081365 4) Brinkmann et al .; Gene 85 (1989) 109-114 5) Brosius et al. J. Mol biol. 148 (1981) 107-127 6) Chang et al .; Nature 198 (1977) 1056 7) Dalborge, H. et al .; FEBS letters 266 (1990) 1 -3 8) Davies et al .; Ann. Rev. Microbiol. 32 (1978) 469 9) DE-A 44 24 171 10) EP-A 0 219 874 11) EP-A 0 267 851 12) EP-A 0 382 174 (Patent US 5,233,256) 13) EP-B 0 093 619 14) EP-B 0 112 122 15) EP-B 0 218 479 16) EP-B 0 241 022 17) Ghrayed et al .; EMBO J. 3 (1984) 2437 18) Goeddel et al .; Nuc. Acids Res. 8 (1980) 4057 19) Hames, B.D .; higgins, S.G .; Nucleic Acid Hybridization - A Practical approach (1985) 449 - 458 ) Harris, T.J.R .; Prötein engineerring 1 (1987) 449-458 21) Haymerle, H. et al .; Nucí Acid Res. 14 (1986) 8615 -8624 22) Heussen, C.; J. Biol. Chem. 259 (1984) 11635-11638 23) Heussen, C; Haemostasis 11 (1982) P47 (Supplement) 24) Hóltke und Kessler; "The DIG system user guide for filter hybridization" (1990), Boehringer Mannheim GmbH, Germany. 25) Joubert, F.J .; Thrombosis and Haemostasis 57 (3) (1987) 356-360 26) Joubert, F.J .; Int. J. Biochem. 14 (1982) 187-193 27) Joubert, F-J .; Phytochemistry 21 (1982) 1213-1217 28) Kingsman, S.M. et. to the.; Tibetch 5 (1987) 53-57 29) Kohnert, U. et. to the.; Protein Engineerring 5 (1992) 93-100 30) Lehle, K. et al .; J. Mol. Biol. 239 (1994) 276-284 331) Miller et al .; Bio / Technology 7 (1989) 698) 32) Nagai et al .; Nature 309 (1984) 810 33) Oka et al .; Proc. Nati Acad. Sci. USA 82 (1985) 7212 34) Onesti, S. et. to the.; J. mol. Recogn. 5 (1992) 105-114 ) Palva et al .; Proc. Nati Acad Sci. USA 79 (1982) 5582 36) Porath, J. & Olin, B .; biochemistry 22_ (1983), 1621-1630 37) Powell et al .; Appl. Environ.Microbiol .54 (1988) 655 38) Sambrook et al .; Molecular Cloning: A laboratory manual (1989) Cold Spring Harbor Laboratory Press, New York, USA 39) Sambrook et al .; "Expression of cloned genes in E.coli" in Molecular Cloning: A laboratory manual (1989) Cold Spring Harbor Laboratory Press, New York, USA 40) Sambrook, J. et al; Section IX, "A hybridization of radiolabelled probes to immobilized nucleic acid", in Molecular Cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press, New York, USA, 974-962 41) Shimatake et al .; Nature 292 (1981) 128 42) Shine et al .; Nature (1975) 25434; 43) Stratagene, US, Catalog No. 211201 44) Studier et al .; J. Mol. Biol. 189 (1986) 113 45) Teixeira et. to the.; Biochimica et Biophysica Acta 1217 (1994) 16-22 46) Teixeira et al .; Biochemica et Biophysica Acta 1217 (1994) 23 - 28 47) US Patent 4,3336,336 48). US Patent 4,551,433 49) US Patent 4,689,406 50) US Patent 4, 747,056 51) US Patent 4,902,623 52) US Patent 4,933,434 53) US Patent 5,223,256 54) WO 90/09437 SEQUENCE LIST (1. GENERAL INFORMATION (I) APPLICANT: (A) NAME: BOEHRINGER MANNHEIM GMBH (B) STREET: Sandhofer Str. 116 (C) CITY: Mannheim (E) COUNTRY: Germany (F) POSTAL CODE: D-68305 (G) PHONE: 08856 / 60-3446 (H) TEL / FAX: 08856 / 60-3451 (ii) TITLE OF THE INVENTION: New inhibitor of the Erythrina caffra type and its use to purify serine proteases (iii) SEQUENCE NUMBER: 10 (iv) LEGIBLE FORM OF COMPUTER (A) MEDIA TYPE: Floppy disk (B) COMPUTER: IBM PC Compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Free patent # 1.0, version # 1.30 B (EPO) (vi) DATA PREVIOUS TO THE APPLICATION (A) NUMBER OF APPLICATION: DE 195 12 937.7 (B) DATE OF APPLICATION: APRIL 06, 1995 (2) INFORMATION FOR SEC ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 516 base pairs (B) TYPE: nucleic acid (C) HEBRA: double (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..516 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1 TCA TTA TTA GAT GGT AAC GGC GAA GTC GTC CAG AAC GGC GGT ACC TAT Ser Leu Leu Asp Gly Asn Gly Glu Val Val CHn Asn Gly Gly Thr Tyr 1 5 10 15 TAT CTG CTG CCG CAG GTC TGG GCG CAG GGC GGC GGC CTG CAG CTG GCG Tyr Leu Leu Pro Gln Val Tro Wing CHn Gly Gly Gly Val Gln Leu Wing 20 25 30 AAA ACC GGC GAA GAA ACC TGC CCG CTG ACC GTG GTG CAG AGC CCG AAC Lys Thr Gly Glu Glu Thr Cys Pro Leu Thr Val Val Gln Ser Pro Asn 40 145 GAA CTG AGC GAT GGC AAA CCG ATT CGT ATT GAA AGC CGT CGT CGT AGC Glu Leu Ser Asp Gly Lys Pro lie Arg lie Glu Ser Arg Leu Arg Ser 50 55 60 CGC TTT ATT CCG GAT GAT GAT AAA GTG CGT ATT GGC TTT GCG TAT GCG Wing phe He Pro Asp Asp Asp Lys Val Arg lie Gly Phe Wing Tyr Wing 65 70 75 80 CCG AAA TGC GCG CCG AGC CCG TGG TGG ACC GTG GTG GAA GAT GAA CAG Pro Lys Cys Pro Pro Wing Pro Trp Trp Val Val Val Gl Asp Glu Gln 85 90 95 GAA GGC CTG AGC GTG AAA CTG AGC GAA GAT GAA AGC ACC CAG TTT GAT Glu Gly Leu Ser Val Lys Leu Ser Glu Asp Glu Ser Thr Gln phe Asp 100 105 110 TAT CCG TTT AAA TTT GAA CAG GTG AGC GAT CAG CTG CAT AGC TAT 'AAA Tyr Pro Phe lys Phe Glu Gln Val Ser Asp Gln Leu His Ser Tyr "Lys 1 15 120 125 CTG CTG TAT TGC GAA GGC AAA CAT GAA AAA TGC GCG AGC ATT GGC ATT Leu Leu Tyr Cys Glu Gly Lys His Glu Lys Cys Wing Ser lie Gly He 130 135 140 AAC CGT GAT CAG AAA GGC TAT CGT CTG GTG GTG ACC GAA GAT TAT Asn Arg Asp Gln Lys Gly Tyr Arg Arg Leu Val Val Thr Glu Asp Tyr 145 150 155 160 CCG CTG ACC GTG GTG CTG AAA AAA GAT GAA AGC AGC Pro Leu Thr Val Val Leu Lys Lys Asp Glu Ser Ser 165 170 (2) INFORMATION FOR SEC ID NO: 2: (i) SEQUENCE CHARACTERISTICS. (A) LENGTH: 172 amino acids (B) TYPE: amino acids (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2: Being Leu Leu Asp Gly Asn Gly Glu Val Val Gln Asn Gly Gly Thr Tyr 1 5 10 15 Tyr Leu Leu Pro Gln Val Trp Wing Glp Gly Gly Val Gln leu Wing 20 25 30 Lys Thr Gly Glu Glu Thr Cys Pro Leu Thr Val Val Gln Ser Pro Asn 40 45 Glu Leu Being Asp Gly Lys Pro He Arg He Glu Being Arg Leu Arg Being 50 55 60 Wing Phe He Pro Asp Asp Asp Lys Val Arg From Gly Phe Wing Tyr Wing 65 70 75 80 Pro Lys Cys Pro Pro Wing Pro Trp Trp Thr Val Val Glu Asp Glu Gln 85 90 95 Glu Gly Leu Ser Val Lys Leu Ser Glu Asp Glu Ser Thr Gln Phe Asp 100 105 1 10 Tyr Pro Phe Lys Phe Glu Gln Val Ser Asp Gln Leu His Ser Tyr Lys 1 15 120 125 Leu Leu Tyr Cys Glu Gly Lys His Glu Lys Cys Ala Ser De Gly He 130 135 140 Asn Arg Asp Gln Lys Gly Tyr Arg Arg Leu Val Val Thr Glu Asp Tyr 145 150 155 160 Pro leu Thr Val Val Leu Lys Lys Asp Glu Ser SEr 165 170 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (C) HEBRA: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 Val Leu Leu Asp 1 (2) INFORMATION FOR SEC ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (C) HEBRA: simple (D) CONFIGURATION: linear (iii) TYPE OF MOLECULE: peptide (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 Ser Leu leu Asp i (2) INFORMATION FOR SEQ ID NO: 5 (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "Initiator" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: AAAGGATCCC TCGAGAAATC ATAAAAA 27 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "Initiator" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: CATAAGAATT CTGTTTCCTC TTTAATGAAT TCTG 34 (2) INFORMATION FOR SEQ ID NO: 7: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "Initiator" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: CAGAATTCTT ATGTCATTAT TAGA 24 (2) INFORMATION FOR SEQ ID NO: 8 (I) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "Initiator" (xi) CHARACTERISTICS OF THE SEQUENCE: SEQ ID NO: 8: AGAAGCTTTT ATCAGCTG 18 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 541 base pairs (B) TYPE: nucleic acid (C) HEBRA: double (D) CONFIGURATION: linear (ii) TYPE OF MOLECULE: cDNA (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 11.529 (ix) CHARACTERISTICS: (A) NAME / KEY: mat-peptide (B) LOCATION: 11 (xi) LOCATION OF THE SEQUENCE: SEQ ID NO: 9: CAG AATTCTT ATG TCA TTA TTA GAT GGT AAC GGC GAA G GTTGG G GTTGG C CAAGG AAC Met Ser Leu Leu Asp Gly Asn Gly Glu Val Val Gln 1 5 10 GGC GGT ACC TAT TAT CTG CTG CCG CAG GTG TGG GCG CAG GGC GGC GGC 97 Gly Gly Thr Tyr Tyr Leu Leu Pro Gln Val Trp Wing Gln Gly Gly Gly 20 25 GTC CAG CTG GCG AAA ACC GGC GAA GAA ACC TGC CCG CTG AC GTG GTG 145 C Vsl Glp Leu Ala Lys Thr Gly Glu Glu Thr Cys Pro Leu Thr Val Val 35 40 45 CAG AGC CCG AAC GAA CTG AGC GAT GGC AAA CCG ATT CGT ATT GAA AGC 193 Gln Ser Pro Asn Glu Leu Ser Asp Gly Lys Pro He Arg He Glu Ser 50 55 60 TTT GCG TAT GCG CCG AAA TGC GCG CCG AGC CCG TGG TGG AC GTG GTG 289 C Phe Wing Tyr Wing Pro Lys Cys Wing Pro Pro Pro Trp Trp Thr Val Val 80 85 90 GAA GAT GAA CAG GAA GGC CTG AGC GTG AAA CTG AGC GAA GA GAA AGC 337 t Glu Asp Glu Glp Glu Gly Leu Ser Val Lys Leu Ser Glu Asp Glu Ser 95 100 105 ACC CAG TTT GAT TAT CCG TTT AAA TTT GAA CAG GTG AGC GA CAG CTG 385 T Thr Gln Phe Asp Tyr Pro Phe Lys Phe Glu Gln Val Ser Asp Gln Leu 1 10 1 15 120 125 CAT AGC TAT AAA CTG CYG TAT TGC GAA GGC AAA CAT GAA AA TGC CGC 433 A His Ser Tyr Lys Leu Leu Tyr Cys Glu Gly Lys His Glu Lys Cys Ala 130 135 140 AGC ATT GGC ATT AAC CGT GAT CAG AAA GGC TAT CGT CGT CGT GTG GTG 481 Being Of Gly He Asn Arg Asp Gln Lys Gly Tyr Arg Arg Leu Val Val 145 150 155 ACC GAA GAT TAT CCG CTG ACC GTG GTG CTG AAA AAA GAT GA AGC AGC 529 A Thr Glu Asp Tyr Pro Leu Thr Val Val Leu Lys Lys Asp Glu Ser Ser 160 165 170 TGATAAAAGC TT 5 [2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS (A) LENGTH: 173 amino acids (B) TYPE: amino acids (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) LOCATION OF SEQUENCE: SEQ ID NO: 10 Met Ser Leu Leu Asp Gly Asn Gly Glu Val Val Gln Asn Gly Gly Thr 1 5 10 15 Tyr Tyr Leu Leu Pro Gln Val Trp Wing CHn Gly Gly Gly Val Gln Leu 20 25 30 Ala Lys Thr Gly Glu Glu Thr Cys Pro Leu Thr Val Val Gln Ser Pro 35 40 45 Asn Glu Leu Be Asp Gly Lys Pro Arg De Glu Be Arg Leu Arg 50 55 60 Being Wing Phe Of Pro Asp Asp Asp Lys Val Arg Of Gly Phe Wing Tye 70 75 80 Wing Pro Lys Cys Wing Pro Pro Pro Trp Trp Thr Val Val Glu Asp Glu 85 90 95 Gln Glu Gly Leu Ser Val Lys Leu Ser Glu Asp Glu Ser Thr Gln Phe 100 105 1 10 Asp Tyr Pro Phe Lys Phe Glu CHn Val Ser Asp Gln Leu His Ser Tyr 1 15 120 125 Lys Leu Leu Tyr Cys Glu Gly Lys His Glu Lys Cys Ala Ser He Gly 130 135 140 From Asn Arg Asp Gln Lys Gly Tyr Arg Arg Leu Val Val Thr Glu Asp 145 150 155 180 Tyr Pro Leu Thr Val Val Leu Lys Lys Asp Glu Be Ser

Claims (17)

Claims
1. A process for the purification of a serine protease from a protein mixture by binding the serine protease to an immobilized polypeptide having an activity of a DE-3 inhibitor of Erythrina caffra, removing the unbound fractions from the protein mixture, releasing the serine protease from the inhibitor, separating the immobilized inhibitor from the soluble serine protease and isolating the serine protease, characterized in that a polypeptide is used as the polypeptide which has an amino acid sequence that is functionally analogous to SEQ ID NO: 2, has two bisulfide bridges, has a partial region that is more than 85% homologous to amino acid region 30-139 of this sequence and begins at the N-terminus with SEQ ID NO: 4 or with extended SEQ ID NO: 4 at the N-terminus by methionine.
2. A process as claimed in claim 1, characterized in that the polypeptide which starts at the N-terminus with SEQ ID NO: 4 is used.
3. A process as claimed in claim 1 or 2, characterized in that the polypeptide is encoded a) by a nucleic acid according to SEQ ID NO: 1, b) by a nucleic acid that hybridizes under stringent conditions with a DNA sequence showing a SEQ ID NO: 1 and begins at the N-terminus with a nucleic acid sequence encoded for SEQ ID NO: 4, c) by a nucleic acid which hybridizes under stringent conditions with one of the sequences mentioned in a) or b) without the degeneracy of the genetic code.
4. A process as claimed in claims 1 to 3, characterized in that the polypeptide is a product of the prokaryotic or eukaryotic expression of an exogenous nucleic acid.
5. A process as claimed in claims 1 to 4, characterized in that the polypeptide is used which is purified chromatographically by means of an anion exchanger, a cation exchanger or nickel chelate.
6. A process as claimed in claims 1 to 5, characterized in that the serine protease is a plasmigen activator.
7. A process as claimed in claims 1 to 6, characterized in that the polypeptide is immobilized on a matrix.
8. A process as claimed in claims 4 to 7, characterized in that the exogenous nucleic acid contains a SEQ ID NO: 1, a sequence which codes for the same polypeptide within the scope of the degeneracy of the genetic code, and / or a sequence complementary
9. A process for the production of a polypeptide which has an activity of a DE-3 inhibitor of Erythrina caffra and which reversibly and selectively binds serine proteases of a protein mixture by culture of prokaryotic and eukaryotic host cells which are transformed or transfected with a nucleic acid encoding said polypeptide in a manner that allows the host cells to express said polypeptide under suitable nutrient conditions and isolating said polypeptide, characterized in that the polypeptide has an amino acid sequence which is functionally analogous to SEQ. ID NO: 2, has a partial region that is more than 85% homologous to amino acid region 30 - 139 of this sequence, has two bisulfide bridges and begins at the N-terminus with SEQ ID NO: 4 or with SEQ ID NO : 4 extended by the N-terminus by methionine.
10. A process as claimed in claim 9, characterized in that the polypeptide begins at the N-terminus with SEQ ID NO: 4.
11. A process as claimed in claims 9 or 10, characterized in that the polypeptide is encoded a) by a nucleic acid according to SEQ ID NO: 1, b) by a nucleic acid which hybridizes under stringent conditions with a DNA sequence shown in SEQ ID NO: 1 and begins at the N-terminus with a nucleic acid sequence which codes for SEQ ID NO: 4, c) by a nucleic acid which hybridizes under stringent conditions with one of the sequences mentioned in a) or b) without the degeneracy of the genetic code.
12. 12. A process as claimed in claims 9 to 11, characterized in that the nucleic acid contains a sequence SEQ ID NO: 1, a complementary nucleic acid or a nucleic acid encoding the same polypeptide within the scope of the degeneracy of the genetic code.
13. 13. A process as claimed in claims 9 to 12, characterized in that the host cells are E. coli cells.
14. 14. A nucleic acid according to the sequence SEQ ID NO: 1, which codes for a polypeptide with DE-3 inhibitor activity of Erythrina caffra.
15. 15. A biologically functional plasmid or a viral DNA vector which contains a nucleic acid as claimed in claim 14.
16. 16. A prokaryotic or eukaryotic host cell which is stably transformed and transfected with a DNA vector as claimed in claim 15.
17. 17. A polypeptide which has an activity of a DE-3 inhibitor of Erythrina caffra and which reversibly and selectively binds serine proteases of a protein mixture which is obtained by culturing prokaryotic and eukaryotic host cells which are transformed or transfected with a nucleic acid encoding said polypeptide in a manner that allows the host cells to express said polypeptide under suitable nutrient conditions and isolating said polypeptide, characterized in that the polypeptide has an amino acid sequence which is functionally analogous to SEQ ID NO. : 2, has a partial region that is more than 85% homologous to amino acid region 30-139 of this sequence, has two bisulfide bridges and begins at the N-terminus with SEQ ID NO: 4 or with SEQ ID NO: 4 extended at the N-terminus by methionine. A polypeptide as claimed in claim 17, characterized in that it starts at the N-terminus with SEQ ID NO: 4. A polypeptide as claimed in claims 17 to 18, characterized in that the polypeptide is encoded a) by a nucleic acid according to SEQ ID NO: 1, b) by a nucleic acid which hybridizes under stringent conditions with a DNA sequence showing a SEQ ID NO: 1 and starts at the N-terminus with a nucleic acid sequence which codes for SEQ ID NO: 4, c) by a nucleic acid which hybridizes under stringent conditions with one of the sequences mentioned in a) or b) without the degeneracy of the genetic code. A polypeptide as claimed in claims 17 to 19, characterized in that it has a binding capacity for tissue plasminogen activators of 1.25 MU / ml and more.