MXPA97007244A - Expression of genes in mamif cells - Google Patents

Abstract

Proteins such as human interferon-human or erythropoietin are prepared by culturing mammalian cells which harbor a nucleic acid sequence comprising: (i) a coding sequence which codes for the desired protein and which is operably linked to a promoter capable of direct the expression of the coding sequence in a mammalian cell in the presence of a heavy metal ion, and (ii) a first selectable marker sequence comprising a metallothionein gene and which is operably linked to a promoter capable of directing the expression of the metallothionein gene in a mammalian cell in the presence of a heavy metal ion, and optionally (iii) a second selectable marker sequence which comprises a neo gene and which is operably linked to a promoter capable of directing the expression of the gene neo in a mammalian cell

Description

EXPRESSION OF GENES IN C? T, TTT.AS DE MAMÍFERO DESCRIPTION OF THE DWINTION This invention relates to the expression of genes in mammalian cells, particularly genes responsible for proteins whose in vivo biological activity is altered by various factors including specific glycosylation. Examples of such genes are human interferon-ß (IFNβ), human erythropoietin (EPO), human chorionic gonadotropin, various cytokines and growth factors as well as specific viral antigens such as viral Dengue proteins whose structure may be relevant to the development of vaccines. Previously, the genes have been extensively expressed in mammalian cell lines, particularly Chinese mutant hamster ovary (CHO) cells, deficient in the dihydrofolate reductase (dhfr) gene as designed by the method of Urlab et al., PNAS USA 21, 4216-4220, 1980. Various expression systems have been used. Many vectors for the expression of genes in such cells are therefore available. Typically, the selection procedures used to isolate transformed cells with the REF: 25736 expression vectors are based on the use of methotrexate to select the transformants in which the genes for dhfr and the target gene are co-amplified. The gene for dJifr, which allows cells to resist methotrexate, is usually incorporated into the vector with the gene whose expression is desired. Then cell selection is performed under increasing concentrations of methotrexate. This leads to amplification in the number of genes for d? present in each cell of the population, to the extent that the cells with the highest number of copies resist higher concentrations of methotrexate. As the gene for dhfr r is amplified, the number of copies of the gene of interest increases concomitantly with the copy number of the dhfr gene. so that the increased expression of the gene of interest is obtained. Unfortunately, these amplified genes have been reported to be variably unstable in the absence of continuous selection (Schimke, J. Biol. Chem. 263, 5989-5992, 1988). This instability is inherent in the currently available expression systems of CHO dlafr- cells. For several years, several promoters have been used to activate the expression of objective genes such as the SV40 early promoter, the early CMV promoter and the SRa promoter. It is stated that the CMV and SRa promoters are the strongest (Wenger et al., Anal. Biochem. 221, 416-418, 1994). In one report, the promoter for interferon-β has also been used to activate the expression of the gene for interferon-β in mutant CHO cells di__f_c "(US-A-5376567) In this system, however, the CHO dhfr cells selected must to be superinduced by the method of Tan et al (Tan et al., PNAS USA £ 2, 464-471, 1970); Tan et al., US-A-3773924) to carry out a higher level of interferon-β production. In this system, a significant percentage of the superinduced interferon ß produced by CHO dhfr cells is not glycosylated.The gene for mouse metallothionein (mMTl) has also been used for the expression of the genes for interferon-β in CHO cells, BHK mouse and LTK "(Reiser et al 1987 Drug Res. 27, 4, 482-485). However, the expression of interferon-β with this promoter is not as good as with the SV40 early promoter in CHO cells. In addition, the expression of interferon-β from these cells mediated by the mMT1 promoter is inducible by heavy metals. However, heavy metals are extremely toxic to cells and therefore this system was abandoned. Instead, Reiser et al., Used the CHO dhfr expression system "together with the SV40 early promoter (Reiser et al., Drug Res. 37.4, 482-485 (1987) and EP-A-0529300) to produce interferon ß in CHO dhfr cells "derived by the method of Urlaub et al (1980). Now β-interferon has been expressed in wild-type CHO cells. The wild-type CHO cells are transfected with a vector comprising a gene for interferon-β under the control of a mouse sarcoma viral extender and a mouse metallothionein promoter.

(.MSV-mMTl), a neo gene under the control of the promoter capable of promoting the expression of the neo gene both in E. coli and in mammalian cells and the human metallothionein gene having its own promoter. Transfected cells capable of expressing interferon-β are selected by first exposing the cells to geneticin (antibiotic G418) and therefore • removing the cells lacking the neo gene and then exposing the surviving cells to increasing concentrations of a metal ion. heavy. The heavy metal ion increases the promoter MSV-mMTl for the gene for interferon-β, which increases the expression of interferon-β. The heavy metal ion induces the gene promoter for human metallothionein, which causes the expression of human metallothionein. The human metallothionein protects the cells against the toxic effect of the metal-heavy ion. The presence of a heavy metal ion ensures that there is a continuous selection of cells which have the transfectant vector, or at least the gene for interferon-β and the gene for human metallothionein and their respective promoters integrated into their genomes. Selected cells that have been successfully transfected express interferon-β. Expression is surprisingly improved when the cells are cultured in the presence of Zn2 +. Interferon-β has improved properties, in particular greater bioavailability, compared to previous β-interferons. These findings have general applicability. Accordingly, the present invention provides: a nucleic acid vector comprising: (i) a coding sequence which encodes a protein of interest and which is operably linked to a promoter capable of directing the expression of the coding sequence in a mammalian cell in the presence of a heavy metal ion; (ii) a first selectable marker sequence which comprises the gene for metallothionein and which is operably linked to a promoter capable of directing the expression of the gene for metallothionein in a mammalian cell in the presence of a heavy metal ion; and (iii) a second selectable marker sequence which comprises a neo gene and which is operably linked to a promoter capable of directing the expression of the neo gene in a mammalian cell; mammalian cells which harbor a nucleic acid sequence comprising: (i) a coding sequence which codes for a protein of interest and which is operably linked to a promoter capable of directing the expression of the coding sequence in a mammalian cell in the presence of a heavy metal ion; (ii) a first selectable marker sequence which comprises the gene for metallothionein and which is operably linked to a promoter capable of directing the expression of the gene for metallothionein in a mammalian cell in the presence of a heavy metal ion; and optionally (iii) a second selectable marker sequence which comprises a neo gene and which is operably linked to a promoter capable of directing the expression of the neo gene in a mammalian cell; a process for producing such cells, which process comprises: (a) transfecting mammalian cells with a vector of the invention; (b) exposing the transfected cells to geneticin to thereby eliminate cells lacking the neo, - and (c) gene exposing the cells surviving to step (a) at progressively increasing concentrations of a heavy metal ion to select in this way the heavy cells. - the use of a neo gene and the gene for metallothionein as selectable marker genes in a single vector; and a process for the preparation of a protein of interest, a process which comprises culturing mammalian cells of the invention under conditions that allow the expression of the desired protein and recovery of the desired protein expressed in this manner. By using both the neo gene and the metallothionein gene as selectable markers in a single vector, it is possible to select transformed mammalian cells, such as wild-type CHO cells, which have multiple copies of the expression vector stably integrated into their genomes. This selection system therefore facilitates the preparation and identification of stable transformed mammalian cells such as wild-type CHO cells and avoids the need for dhfr cells. "Transformed cells allow stable expression of genes such as the human interferon ß because they have multiple copies, typically at least 20-100 copies or more, of these genes integrated into their genomes, and the use of relatively high concentrations of CD2 + (greater than 200 μM) in selection procedures eliminate the unnoticed microbial contaminants such as mycoplasma that can be associated with the transfected cells during tissue culture procedures.Therefore, the present invention minimizes the possibility of microbial contamination of the transfected cells.In addition, a particular promoter / extender system , according to the invention surprisingly has a significantly higher level of expression compared to strong promoter systems that have been used in the past. This promoter / extender is the MSV-mMTl system which comprises the promoter of mouse metallothionein gene 1 (mMTl) flanked upstream with a mouse sarcoma virus (MSV) extender. A promoter of a gene for metallothionein, particularly the combined promoter / extender system MSV-mMTl, can be operably linked to a gene of interest such as the gene for human interferon-β or the gene for human erythropoietin. A vector comprising such an arrangement can provide a high level of expression of the gene product in wild-type CHO cells. Therefore, the inventors have identified a new and unexpectedly powerful expression system for use in mammalian cells, particularly in wild-type mammalian cells. Products, such as human interferon-ß and human erythropoietin, can be expressed with unexpected / novel biological properties such as increased bioavailability. Such properties may result in higher efficiency / additional utility for the product. Therefore, it is possible, according to the invention, to express genes such as the gene for interferon-β and others, in large quantities, in wild-type mammalian cells such as wild-type CHO cells and to perform this in a stable manner, without the need for continuous selection and dependence on CHO dhfr "-methotrexate selection system The invention can be applied to a large variety of mammalian cells, thus allowing the expression of appropriate target genes with a glycosylation pattern and a cell environment unique to the type of cell used.A vector according to the invention is an expression vector.It comprises three sequences that can be expressed in mammalian cells.Therefore, an expression vector comprises: (i) a coding sequence comprising a gene of interest whose expression is desired, for example the gene for human interferon-β; (ii) a first selectable marker sequence comprising a gene for metallothionein which confers resistance to heavy metal ions, such as cadmium, copper and zinc or mammalian cells expressing the gene of interest; and (iii) a second selectable marker sequence comprising a neo gene which confers resistance to the antibiotic kanamycin to bacterial and transformed cells expressing the gene, and resistance to geneticin (antibiotic G418) to mammalian cells expressing the gene.

Each of these three sequences will typically be associated with other elements that control its expression. In relation to each sequence, the following elements are generally present, usually in a 5 'to 3' array: a promoter for directing the expression of the sequence and optionally a promoter regulator, a translation start codon, the coding sequence / marker, a polyadenylation signal and a transcriptional terminator. In addition, the coding sequence and / or either or both of the marker sequences can optionally be operably linked to an extender that increases the expression obtained under the control of the promoter. Suitable extenders include the Rous Sarcoma Virus Extender (RSV) and the Mouse Sarcoma Virus Extender (MSV). In addition, a vector according to the invention will typically comprise one or more origins of replication, eg, a bacterial origin of replication, such as the pBR322 origin, which allows replication in bacterial cells. Alternatively or additionally, one or more eukaryotic origins of replication can be included in the vector so that replication is possible in, for example, yeast cells and / or mammalian cells. The vector also comprises one or more introns or other 3 'or 5' non-coding sequences with respect to the coding sequence or one or more of the marker sequences. Such non-coding sequences can be derived from any organism, or they can be synthetic in nature. Therefore, they can have any sequence. Such sequences may be included if they elongate or do not damage the correct expression of the coding sequence or the marker sequences. In the vectors of the invention, the coding sequence and the marker sequences are operably linked each to a promoter capable of directing its expression in a mammalian cell. Optionally, one or more of these promoters is capable of directing expression in other cells, for example, eukaryotic non-mammalian cells, such as yeast cells or insect cells and / or prokaryotic cells. "Operably linked" refers to a juxtaposition wherein the promoter and the coding / marker sequence are in a relationship that allows the coding / marker sequence to be expressed under the control of the promoter. Therefore, there may be elements such as the 5 'non-coding sequence between the promoter and the coding / marker sequence. Such sequences can be included in the recombinant construct or plasmid if they elongate or do not damage the correct control of the coding / marker sequence by the promoter.

Any promoter capable of enhancing expression in a mammalian cell in the presence of a heavy metal ion such as Cd2 +, Cu2 + and Zn2 + can be operably linked to the coding sequence. A suitable promoter is the promoter of the gene for metallothionein. The promoter of gene I for mouse metallothionein (mMTl) is preferred. Suitable promoter / extender combinations for the coding sequence include the mMT1 promoter flanked upstream with the MSV extender (MSV-mMTl) and the combination of the RSV extender and the mMTV promoter. Preferably it is MSV-mMtl. Similarly, any promoter capable of enhancing the expression of mammalian cells in the presence of a heavy metal ion such as Cd2 +, Cu2 + and Zn2 + can be operably linked to the gene for metallothionein such as the gene for human metallothionein. Preferably, the marker sequence gene is a gene for human metallothionein, such as gene IIA, for human metallothionein, which has its own promoter. The second selectable marker sequence is a neo gene. In nature there is more than one type of this gene: any specific neo gene can be used in a vector of the invention. A preferred neo gene is the neo gene of E. coli.

The promoter for the neo gene is capable of directing the expression of the gene in a mammalian cell. Suitable promoters are the cytomegalovirus (CMV) early promoter, the SV40 promoter, the mouse mammary tumor virus promoter, the a-P promoter of human elongation factor-1 (EF-la-P), the SRa promoter and the promoter of the gene for metallothionein, such as mMTl. The promoter may also be capable of expressing the neo gene in bacteria such as E. coli in which a vector of the invention can be constructed. Although the protection against antibiotics conferred by the neo gene is qualitative in the sense that once it is expressed in the neo gene it will confer resistance to antibiotics in a cell, the protection against heavy metals conferred by the gene for metallothionein is quantitative. The higher the level of expression of the gene for metallothionein in a cell, the greater the resistance of the cell to heavy metals. Therefore, cells that have a high copy number of metallothionein genes will be expected to have high resistance to heavy metals. Therefore, cells that include many copies of a vector of the invention have a higher resistance to heavy metals compared to cells comprising one or some copies. Accordingly, it is possible to select for transfected cells having a high number of copies of a vector of the invention (and therefore a high number of copies of the coding sequence for a gene such as human interferon-β) by progressively increasing the concentration of heavy metals to which it is exposed to the cells. Therefore, the cells have progressively higher numbers of copies of the vector, according to the invention, cells which are the ones that are selected. Therefore, the combination of selectable markers found in the vectors of the invention allows a two-step selection process for transfected cells of interest. First, the cells are exposed to geneticin (antibiotic G418) which eliminates cells lacking the neo gene and therefore lacks the vector of the invention in any way. The neo gene serves to no longer function after this stage. Second, selection is made with increasing concentrations of heavy metal ions, which select cells that have multiple copies of the vectors, especially cells that have multiple copies integrated into their genomes. In this selection process, cells that survive at high concentrations of heavy metal ions express metallothionein to a high degree, for example because they include a large number of vectors of the invention and / or because the vector or vectors that have been integrated into their genome are in a chromosomal position that allows or encourages strong expression. Any of the suitable heavy metal ions can be used. Therefore, any heavy metal ion that is toxic to the cells of the invention and for which it confers protection for the expressed metallothionein gene may be the one used. For example, zinc ions (Zn2 +), copper ions can be used (Cu2 +) or preferably cadmium ions (Ca2 +). The concentrations of a heavy metal ion is from 5 to 100, and actually up to 200, μM can be applied to carry out the selection. A concentration of 130 to 170 μM, preferably about 150 μM of Zn2 + is suitable. In order to carry out the selection using heavy metal ions, these ions can be provided as salts in combination with any suitable counter ion such as sulfate or chloride. Because the selected cells are resistant to the toxicity of heavy metals which, as it happens, are promoter inducers for the coding sequence, the expression of the protein of interest can be maximized by heavy metal ions such as 130 to 170 μM of Zn2 + which are inducers of the promoter. In addition to the neo and metallothionein genes, the vector may also contain one or more selectable marker genes, for example, a gene for ampicillin resistance, for the identification of bacterial transformants. In the vectors of the invention, the nucleic acid can be DNA or RNA, preferably DNA. Vectors can be expression vectors of any type. Of course, the vector must be compatible with the mammalian cell with which it is to be transfected. The vector can be in linear or circular form. For example, the vector can be a plasmid vector, typically a plasmid DNA. A preferred plasmid vector is pMMTC (Example 2, Figure 3). Those familiar with the art will be able to prepare suitable vectors starting with widely available vectors which will be modified by genetic engineering techniques such as those described by Sambrook et al (Molecular Cloning: A Laboratory Manual, 1989). In regard to plasmid vectors, a suitable initial vector is the plasmid pRSN (Low et al., (1991): JBC 266: 19710-19716), which is widely available. An initial suitable initial plasmid vector is pBR322.

The vectors of the invention may be capable of carrying out the integration of part or all of the nucleic acid sequence in the genome of a host cell or may remain free in the host cell. Integrative vectors are preferred. This is because they provide stable expression of the coding sequences such as those of the human interferon-β gene. The transfected mammalian cells can be BHK, COS, VERO, human fibroblastoids such as CIO, HeLa or human lymphoblastoid cells or cells of a human tumor cell line. Preferably, however, the cells are CHO cells, particularly wild-type CHO cells. Desirably, the transfected cells will have all or part of a vector of the invention integrated into their genomes. Such cells are preferred because they provide stable expression of the coding sequence contained in the vector. Preferably, one or more copies of the complete vector will be integrated, cells which will have multiple integrated copies of the vector, for example, from 20 to 100 copies or more, being particularly preferred because these cells provide a high stable level of expression of the coding sequence contained in the vector. However, the cells having less than the complete sections of vectors of the invention integrated into their genomes are also included within the invention insofar as they are functionally equivalent to the cells that have the complete vector integrated into their genomes, in the sense in which the integrated sections of the vector allow the cell to express the coding sequence and be selected by the use of heavy metals, as described above. Therefore, cells that show partial integration of the vector of the invention are included in the invention insofar as the integrated element or elements include the coding sequence operably linked to its associated promoter and the linked metallothionein marker sequence. operable way to its associated promoter. Cells can be transfected by any suitable method such as the methods described by Sambrook et al (Molecular cloning: A Laboratory Manual, 1989). For example, vectors comprising nucleic acid sequences according to the invention can be packaged in infectious viral particles such as retroviral particles. The vectors can also be introduced by electroporation calcium phosphate precipitation or by contact with naked nucleic acid vectors with the cells in solution. Preferred transfection methods include those described by Low et al- (JBC 266; 19710-19716; 1991). The invention also provides a process for producing proteins encoded by the coding sequence in a vector of the invention. Such a process comprises culturing cells transfected with a vector of the invention under conditions that allow the expression of the coding sequence and recover the protein produced in this way. Preferred proteins that can be produced in this manner include interferons, for example human interferons. Interferons β are preferred and human interferon β is most preferred. Other proteins are interleukins (such as interleukin 12), human chorionic gonadotropin, growth factors, human growth hormone and human erythropoietin, cell membrane component, viral proteins and other proteins of biomedical relevance. The selected cells can be cultured under any of the suitable conditions known in the art and these conditions can vary based on the type of cell and the type of protein that is produced. The promoter of the coding sequence can be a constitutive promoter such that the protein encoded by the coding sequence is expressed in the absence of a heavy metal ion. However, the cells can be cultured in the presence of a heavy metal ion, particularly in an amount which is non-toxic to the cells. Which can lead to a higher expression of the desired protein. The concentration of the heavy metal ion in the culture medium is typically between 100 and 200 μM. Therefore, the cells can be cultured in the presence of 100 to 200 μM of a heavy metal ion selected from Cd2 +, Cu2 + and Zn2 +, for example from 130 to 170 μM of a heavy metal ion. A useful concentration is about 150 μM, particularly when the heavy metal ion is Zn2 +. The use of Zn2 + has a beneficial effect on the yield for the production of interferon-ß and erythropoietin. Unexpectedly, it has been observed that the production of human interferon-β increases two to three times and that the production of human erythropoietin increases three to five times. The protein that is produced can be recovered by any suitable means known in the art and the method of recovery can vary based on the type of cells used, the culture conditions and the type of protein that is produced. Desirably, the protein produced will be purified after recovery. In this way, substantially pure protein can be obtained.

The present invention allows to provide novel β interferon. This interferon ß has a high degree of sialylation. Like interferon ß produced by primary diploid human fibroblasts, it is well glycosylated. However, it has a higher degree of bioavailability compared to natural interferon-ß or recombinant interferon-ß produced in E. coli (betaseron). The greater bioavailability of interferon-β can be characterized. When 1.5 x 106 international units (IU) of interferon are injected subcutaneously into the back of a rabbit of approximately 2 kg: (a) detectable = 128 IU / ml interferon in rabbit serum after 1 hour, and / or (b) is detectable > 64 U.I./ml of interferon in the serum of a rabbit after 5 hours. The maximum level of interferon is typically observed after 1 hour. According to (a), therefore, 128 to 256 U.I./ml, for example 140 to 190 U.I./ml of interferon may be detectable in rabbit serum after 1 hour. After 5 hours, according to (b), it may be detectable = 70 U.I./ml such as = 80 U.I./ml of the interferon in the rabbit serum. Typically, according to (b), an amount of interferon can be detected in the range of 64 to 128 U.I./ml, for example 80 to 110 U.I./ml.

Additionally or alternatively, interferon can be characterized by its specific activity. You can have a specific activity in the range from 4.8 x 108 to 6.4 x 108 U.I. per mg equivalent of bovine serum albumin protein. The specific activity can be from 5 x 108 to 6 x 10B, for example, from 5.2 x 10a to 5.8 x 108, for example from 5.3 x 108 to 5.5 x 108 U.I. per mg equivalent of bovine serum albumin protein. Reference can be made regarding the specific activity to a standard, in particular the standard Gb23-902-531 distributed by Nati. Inst. Allergy and Infectious Disease, NIH, USA. The specific activity is determined according to a modification of the method of Armstrong (1971), in which 0.2 μg / ml actinomycin D is included in the viral exposure and the C.P.E. virally induced Cell assays are in MRC-5 fibroblasts. Interferon β can also be characterized by one or more of the following properties: 1. Interferon β according to the present invention typically has an apparent molecular weight of 26,300, determined by electrophoresis with 15% sodium dodecylsulfate-polyacrylamide gel (SDS-PAGE).

When injected as an untreated intravenous bolus, in a rabbit, the measured life of the interferon typically ranges from 12 to 15 minutes, for example from about 13.5 minutes. The bolus is injected into the vein of the rabbit's ear and blood samples are drawn from the artery of the rabbit's ear. Rabbit serum is assayed to determine the viral activity of interferon according to the modification of the method of Armstrong (1971). The antiviral activity of interferon in a human hepatoblastoma cell line (HepG2) is at least equal to and typically, approximately 1.5 times the activity of native interferon-β from primary diploid human fibroblast cells. Interferon is also approximately 2.2 times more effective than Betaseron in protecting Hep2 cells against a viral exposure. The antiviral activity is again determined according to the modified method of Armstrong (1971). Actinomycin D is omitted in the antiviral determination in HepG2 cells.

The oligosaccharides associated with the interferon-β of the invention can also characterize interferon-β. Interferon β has oligosaccharides which can be characterized by one or more of the following characteristics: 1. Neutral (without acidic substituents): 5 to 15%, preferably about 10%. Acid: 95 to 85%, preferably about 90%. 2. The accumulated total desialylated oligosaccharide is heterogeneous with at least six different structural components present in the accumulated one. 3. The laser desorption mass spectrometry assisted by matrix-time of flight (MALDI-TOF) and the high-resolution gel permeation chromatography data are summarized as follows: The carbohydrate portion of the interferon-β of the invention consists of a bi-, tri-and tetraantenary complex of N-linked oligosaccharides. These oligosaccharides contain repeating units of lactosamines. Approximately 30 to 80%, for example 35 to 60% or 35 to 50% of the oligosaccharides are biantennary oligosaccharides. Approximately 15 to 65%, for example from 25 to 50% or 25 to 45% of the oligosaccharides with triantennary oligosaccharides. Approximately 5 to 55%, for example from 15 to 45% or 20 to 40% of the oligosaccharides with tetraantenary oligosaccharides. The interferon-β of the invention exhibits antiviral activity, cell growth regulating activity and an ability to regulate the production of 'intracellular enzymes and other substances' produced by the cells. Consequently, interferon-ß can be used to treat various viral and oncological diseases such as hepatitis B, hepatitis C, viral encephalitis, viral pneumonia, viral warts, AIDS / nasopharyngeal carcinoma, lung cancer, melanomas, CML renal cell carcinoma and brain tumors as well as diseases such as multiple sclerosis, hemangiomas and cervical intraepithelial neoplasia. Pharmaceutical compositions containing the interferon-β of the invention as an active ingredient will normally be formulated with a suitable pharmaceutically suitable carrier or diluent, based on the particular mode of administration used. For example, ^ parenteral formulations are usually injectable fluids that utilize pharmaceutically and physiologically acceptable fluids such as physiological saline, balanced salt solutions or the like, as a carrier. On the other hand, the oral formulations can be solid, for example tablets or capsules, or liquid solutions or suspensions. The interferon of the invention will usually be formulated as a unit dosage form containing from 104 to 109, most commonly from 106 to 107 U.I. per dose. Interferon can be administered to humans in various ways, for example orally, intravenously, intramuscularly, intraperitoneally, intranasally, intradermally and subcutaneously. The particular mode of administration and the dosage regimen will be selected by the attending physician when considering the particularities of the patient, disease and the disease state involved. For example, viral infections are usually treated by daily or twice-daily doses for a few days or a few weeks, while tumor or cancer treatment involves multiple daily doses for months or years. Interferon can be combined with other treatments and can be combined with or used in association with other chemotherapeutic or chemopreventive agents to provide therapy with viral infections, neoplasms or other conditions against which it is effective. For example, in the case of treatment for herpes virus keratitis, the. Interferon therapy has been supplemented by thermal cauterization, waste disposal and therapy with trifluorothymidine. The following examples illustrate the invention. In the accompanying drawings: Figure 1 shows the results of the immunoblot analysis carried out on CHO cells transfected with DPPIV con- sequences under the control of various promoters; Figures 2 to 4 are vector maps of plasmids pMMTN, pMMTC and pBPV, respectively; Figure 5 (a) shows the results of the analysis on SDS-PAGE (15%) of purified GS38-IFNβ. The molecular weight markers are from BioRad (California). The molecular weight of the markers is indicated in kda. The amount of GS38-IFNß in line 1, 2 and 3 is 0.8 x 106 U.I. 0. 2 x 106 U.I. and 1.1 x 106 U.I. respectively. The amount of bovine serum albumin in lines a, b, c, d, e and f is 5 μg, is 3.5 μg, 2.5 μg, 1.5 μg, 0.5 μg, 0.25 μg. Figure 5 (b) shows the results of a Western blot analysis of purified GS38-IFNβ. Purified IFNß produced by • fibroblasts • primary human diploids (lines 1 and 2) and GS38-IFNβ (lines 3 and 4) is subjected to SDS-PAGE (15%). The proteins are then placed at points on nitrocellulose membranes and probed with a monoclonal antibody against IFNß '(Accurate Chem. New York). The amounts of IFNß activity in the various lines are 0.1 x 105, 0.05 x 106, 0.14 x 106 and 0.56 x 106 U.I. in lines 1, 2, 3 and 4. The molecular weights, in kda, are indicated in the figure. Figure 6 is an anion exchange chromatogram of clap of the oligosaccharides associated with GS38-IFNβ; Figure 7 is an anion exchange chromatogram of clap of oligosaccharides associated with GS38-IFNß after treatment with neuroamidase; Figure 8 is a high resolution gel permeation chromatogram of the oligosaccharides associated with GS38-IFNβ; Figure 9 shows the molecular weight distribution - of the deacidified glycans released from GS38-IFNβ by MALDI-TOF mass spectrometry. Figure 10 (a) shows the serum levels of IFNß in rabbits after subcutaneous injection with 0.7 x 106 U.I. of IFNβ produced by GS38 () cells, primary human diploid fibroblasts (M) or by E. coli [betaseron] (*)]. The weight of the injected rabbits is approximately 1.5 kg. Figure 10 (b) shows the serum levels of IFNβ in rabbits after subcutaneous injection with 1.5 x 106 U.I. of IFNβ produced by GS38 (F) cells. Primary human diploid fibroblasts (I) or by E. coli [betaseron (*)]. The weight of the injected rabbits is approximately 2.0 kg. • Figure 11 shows the decrease in serum IFNß concentrations in rabbits (approximately 2 kg) injected intravenously with 0.7 x 106 U.I. of three different classes of IFNβ prepared from GS38 (F) cells, primary human diploid fibroblasts (I) or E. coli [betaseron (*)].

Figure 12 shows the effect of the dosage of GS38-IFNβ injected subcutaneously on the serum concentrations of circulating GS38 / IFNβ. The levels of IFNβ produced by GS38 in serum, in rabbits (2 kg) injected subcutaneously with [1.2 x 106 U.I. (), 2.5 x 106 U.I. (I) and 10.1 x 106 U.I. (*) of GS38 IFNß. Figure 13 relates to the expression of human erythropoietin of wild-type CHO cells transfected with the new vector which. it contains EPO instead of the gene pair IFNß. The cells of the indicated clones (lines 1 to 14) are seeded in 35 mm culture plates (diameter) . When confluence occurs, it is added 1 ml of culture medium to each of the containers and cultivated for 24 hours. The media is collected and 10 μl of each, together with a control of 50 ng of human erythropoietin (line 15) are separated by SDS-PAGE and analyzed by Western staining using the Amersham detection system.

ECL.

EXAMPLE 1 Identification of MSV-nMTl as a powerful prcmotor for wild-type CBP cells The strengths of 5 promoter / extender systems were compared. These were: promoter of gene 1 for mouse metallothionein fld upstream with mouse sarcoma virus extender (MSV-mMtl: described by Glanville et al. (1981) Nature 292, 267-269; MSV is described by Dhar et al (1980) PNAS 77, 3937-3941); - the cytomegalovirus early promoter (CMV); - RSV-SV40 (a fusion between the rous sarcoma virus extender [RSV] and the SV40 early promoter); RSV-extender / long terminal promoter of mouse mammary tumor virus (RSV-MMTV); and SR-a promoter (Yutaka Takebe et al (1988) Mol Cell. Biol. 8, 466-472). For this comparison, an EcoRI-Xhol cDNA encoding full-length dipeptidylpeptidase IV (DPPIV) (Hong and Doyl (1988) J. Biol. Chem. 263, was cloned, 16892-16898) in the respective expression vectors so that expression of DPPIV is under the control of MSV-mMTl, CMV, RSV-SV40, RSV-MMTV, or SR-a, respectively. For MSV-mMTl, the DPPIV fragment is inserted into the Xhol -Notl sites of the pMMTN vector (Figure 2); for CMV, the fragment is inserted into the EcoRI and Xhol sites of the pXJ41neo vector (Zheng and Pallen (1992), Nature, 359f 336-339); for RSV-SV40, see Low et al (1991) J. Biol. Chem. 266, 19710-19716); for RSV-MMTV, the fragment is inserted into the Nhol-Xhol sites of the vector pMAMneo (from Clontech: catalog number 6104-1; described by Lee et al (1981): Nature 294, 228 and by Sardet et al (1989) : J_Cell 56, 271); for SR-a, the fragment is inserted into the XhoI-BamHI sites of the pSRalfa / neo vector (Yutaka Takebe et al (1988) MCB £, 466-472; Nilsson et al, J. Cell Biol. 12Ü, 5-13, 1993). Each expression vector is transfected into CHO cells and stably transfected cells are harvested for each vector. The strength of each expression vector is then measured by the DPPIV protein concentrations using immunoblot analysis, with the amount of DPPIV detected providing an indication of the strength of each expression system. The immunoblot analysis to detect DPPIV in these transfected cells is performed as described by Hong et al (1989) ..,. (Biochemistry 2J., 8474-8479). Briefly, the cells are washed with saline buffered with Tris - (TBS) -. (Tris 20 >; ? r? M, < > pH 7.2, 150 mM NaCl), and then extracted with 1% Triton X-100 in TBS with 1 mM PMSF. The extracts are cleaned of cellular debris by centrifugation. The protein concentration of the extracts is determined using a BSA kit (Pierce Chemical Co.).

Approximately 100 μg of the proteins extracted from the respective transfected cells are separated by SDS-PAGE and then analyzed by immunoblotting as previously described (Hong et al (1989) Biochemistry 28, 8474-8479). The results shown in figure 1 show that the expression system MSV-mMTl (line 2) is much stronger than the rest, widely used.

EXAMPLE 2 Description of the pMMTC plasmid Based on the above, an expression vector - powerful pMMTC - is constructed using MSV ^ mMTlpa "to activate the expression of foreign-gen-jt-n or 'co-do &' selection markers (the neo gene). paira transfill cells and the IIA gene for human metallothionein, for cells that have integrated multiple copies of the vector into their genomes.) pMMTC (Figure 3) is an expression vector for mammalian cells.The gene to be expressed it is cloned in the Xhol and / or Notl sites so that the expression of the gene is activated by a Control region (MSV-mMTl) comprising the mouse sarcoma virus (MSV) extender and the promoter of gene 1 for metallothionein The SV40 splicing region and the polyadenylation site serve to finalize transcription and to ensure proper control in post-transcriptional events.The neo bacterial gene is flanked upstream with the origin of replication of SV40 and the early promoter. or SV40, and downstream by the splice region SV40 and the polyadenylation site. This neo expression unit confers to the cells of transfected mammalian geneticin resistance (G418) and also confers resistance to kanamycin ar._3a col * transformad-ais .. > .. - The origin of replication pBR322 (Ori) serves as the origin for the autonomous replication of plasmid DNA. in E. coli. The structural gene IIA for human metallothionein, which confers resistance to heavy metal ions such as Cd2 + in mammalian cells, is used to select mammalian transfectants that have multiple integrated copies of the plasmid.

Construction of the expression vector, «fe mam eo pMMTC Plasmid pRSN (Low et al., JBC 266; -19710-19716, 1991) is cut with the restriction enzyme BamHI and separated by agarose gel electrophoresis. -A DNA fragment of approximately 2685 bp is gel purified. This BamHI fragment contains the expression unit for the neo gene of E. coli in both mammalian and E. coli cells.

Plasmid pBPV (Pharmacia: product number 27-4390, see Figure 4 and below for a full description) is cut with the restriction enzyme BamHI and then treated with intestinal alkaline phosphatase of cattle (CIAP). After being separated by agarose gel electrophoresis, a gel is purified. fragment by BamHI of about 4570 bp. This fragment of 4570 bp contains the origin of replication pBR322 and E. coli, the gene for ampicillin resistance (Amp) and the expression cassette composed of mouse sarcoma virus extender and the promoter of gene I for mouse metallothionein followed by a multiple cloning site and the splice junction SV40 and the polyadenylation signal. This 4570 bp fragment is ligated to the previous 2685 bp fragment treated with? AmHI. The resulting plasmid is called pMMTN (Figure 2). A phMT plasmid (Karin et al (1982): Nature 299, 797-802) is cut with HindIII and its ends blunt with Klenow fragment of DNA polymerase I. A 3100 bp fragment containing gene II is gel purified. A for human metallothionein. Plasmid pMMTN is cut with Seal (which is within the ampicillin resistance gene), treated with CIAP, and then ligated with the 3100 bp fragment obtained from phMT.

The product of this ligation is transformed into E. coli. The selection is made by resistance to kanamycin (conferred by the neo gene) and sensitivity to Amp (due to the insertion of the 3100 bp fragment in the structural gene for Amp resistance). The final plasmid construct is confirmed by digestion with restriction enzyme and is referred to as pMMTC. pMMTC has a length of approximately 10350 bp.

GENEALOGY: pBVP (12516 bp) '(The nucleotide numbers refer to the numbering in the reference) • MSV extender (388 bp) Dhar. R. et al, Proc. Nati Acad Sci. USA 77, 3937 (1980). Nuc 529-142 • BamHI / BglII linker CCGGATCTG • 5 'end of the metallothionein promoter (295 bp) Nuc 1-295 • 3' end of the promoter for metallothionein (368 bp) Glanville, N. et al Nature 292 267 (1981 ). Nuc 300-68 • Multiple cloning site and additional nucleotides from the construction CTCGAGCCGCGGCCGCTTCGAGG • Small SV40 antigen binding (Patent Bulletin No. 612) and polyadenylation signals (Patent Bulletin No. 235) Buchman, A.R. et al DNA Tumor Viruses, Cold Spring Harbor Laboratory, pg 799 (1980), Nuc 4713-4102 and 2772-2538 • Genome BPV (7945 bp) Chen E.Y. et al Nature 299, 529 (1982). Nuc 4451-7945 and 1-4450 • pML2: a derivative of pBR322 with a suppression between the bases 1,095 and 2,485 (2,632) pb) (1) Balbas. P., et al Gene 50.3 (1986). (2) Sarvor. N. et al Proc. Nati Acad. Sci USA 79, 7147 (1982). Nuc 376-1095, 2485-4363 and 1-33 • Linker BglII / BamHI GAGATCCGG EXAMPLE 3 Insertion of the expression AEN for human interferon ß in pMMTC The coding sequence for interferon-β is recovered from human genomic DNA by PCR with two oligonucleotides. The 5 'oligonucleotide (GGGGTACCATGACCAACAAGTGTCTCCTC) is modified such that the sequence (CCACCATG) around the start ATG codon favors an efficient translational start (Kozak (1984): NAR 12,857-872). The sequence of the 3 'oligonucleotide is GGAATTCTTCAGTTTCGGAGGTAACCTGT. This modified expression sequence for interferon-β is inserted into the Xhol and Notl sites of pMMTC. The correct insertion and orientation is confirmed by restriction map determination, pCR or sequence determination. The resulting plasmid is called pMMTC / IFNβ.

EXAMPLE 4 constitutively cancentracionea elevated interferon ß human functional CHO cells are transfected with pMMTC / IFNβ as described (Low et al., J. Biol. Chem.2 £ &; 19710-19716, 1991). Cells are selected in G418 (800 μg / ml) for 7-10 days to allow the growth of stably transfected cells. The cells are then incubated in medium with 50-100 μM of Zn2 + ions for 24 to 48 hours to induce the expression of human metallothionein and then incubated in medium with gradually increasing concentrations of CD2 + (final concentration, 200 μM). The individual colonies are cloned and expanded. The culture medium of the cloned cells accumulates interferon β up to a concentration of 106 U.I./ml or more, and 106 U.I. or more than interferon ß is secreted by 106 cells in, at most, 24 hours.

EXAMPLE 5 Production of human interferon-β in HD cells - - - - - The Chinese wild-type hamster ovary CHO-K1 cell line (ATCC CCL-61) is propagated in Dulbecco minimal essential medium (DMEM) containing fetal bovine serum to 10%. The cells are grown at 37 ° C in an atmosphere with 5% carbon dioxide. These cells are transfected with the plasmid 'pMMTC / IFNß- to constitutively secrete high concentrations of functional human interferon-β. The cells are selected as described in Example 4. During selection with Cd2 +, the clones of transfected cells are They measure to determine the antiviral activity interferon-β to demonstrate that they constitutively secrete high concentrations of functional human interferon-β. The antiviral activity is measured according to the method of Armstrong (Armstrong, Applied Microbiology 21, 723, 1971) modified by the inclusion of 0.2 μg / ml actinomycin D in the viral exposure and reacting C.P.E. induced virally, directly. From these measurements, individual colonies are isolated and expanded. In fact, it was found that several lines produce 106 U.I./ml up to 107 U.I./ml of interferon ß when they are grown in round plastic bottles. One of these cell lines, GS38, - is kept in culture for more than 12 months to test its ability to maintain a consistently high level of interferon ß production. The GS38 cell line is maintained in plastic culture flasks (80 cm2) in DMEM containing 10% fetal bovine serum, 100 μg / ml penicillin, 100 μg / ml streptomycin, 2.5 μg / ml amphotericin and 150 μM zinc sulfate ("regular medium"). The sowing of a round bottle (1700 cm2) is done by adding a culture flask (80 cm2) of GS38 cells in a round bottle of 1700 cm2 and the cells are kept in 200 ml d &; regular medium. The medium of the round bottle is discarded on day 2 and day 4 and refilled with 200 ml of fresh regular medium each time. On day 6, the regular medium is discarded and the round bottle is added again with 300 ml of serum-free DMEM medium, which contains 2.5 mg / ml of human serum albumin which contains the list of additional ingredients mentioned. in Table 1 ("serum free medium"). TABLE 1 * EX-CYTE is a supplement or aqueous liquid of human serum sold by Bayer, Illinois, USA.

On day 7, the serum free medium is discarded and refilled with another 3Q0 ml of serum-free medium. On day 8, the serum free medium is again discarded and filled with another 300 ml of serum-free medium. On day 9, the serum free medium (300 ml) is collected and refilled with another 300 ml of serum-free medium. This collection procedure is repeated daily for another 14 days. From each round bottle, a total of approximately 4.2 liters of GS38 is produced, producing interferon-β (or GS38-IFNβ). From 2.4 x 106 to 3.6 x 106 U.I. of interferon ß obtained per ml of crude collection of GS38 cells. This is equivalent to 1.35 mg to 2 mg of GS38-IFNβ per day from a round bottle of GS38 cells from about 5 mg to 6.7 mg per liter of GS38-FNβ, from one liter of raw collection per day. Crude GS38-IFNβ, when purified to homogeneity, has a specific activity of 5.37 x 108 IU / mg of protein (bovine serum albumin), standardized for it standard Gb23-902-531 (a reference standard NIH distributed by Nati. Allergy and Infectious Diseases, NIH, USA). The collection of crude GS38-IFNβ is accumulated and subjected to purification by a purification combination by affinity chromatography. Polymerase ion chromatography (Tan et al, J. Biol. Chem. 254, 8067-8073V 19V9í 'Edy et Sl J .-Bio l Chem. <2S4, 5934-5935, '1977; Knight et al PNAS USA 22, 520-523, 1976). Pure GS38-IFNß is obtained with approximately 70-80% recovery. Pure GS38-IFNβ is analyzed and found to be homogeneous according to the following homogeneity criteria: A single molecular mass of apparent molecular weight of 26,300 is observed on SDS-PAGE (15%) (Figure 5a). This is similar to the molecular weight of natural interferon-β produced by primary human triploid foreskin fibroblasts after the superinduction procedure of Tan et al (1970 and 1973) (see Figure 5b). Note that the wide range of molecular weight markers obtained from BIO-RAD is slightly different from those used as previously reported by ourselves and others. The identity of these interferons β (interferon β produced by GS38-IFNβ and human fibroblasts) is verified by western blot analysis (Figure 5b) and belongs to a single average molecular mass of 26,300. - When subjected to chromatography on clap C18 column (Hewlett Packard 1090) the protein peak of the material directly corresponds to the antiviral activity of interferon. When subjected to amino acid sequence determination, the material has a sequence of interferon β. The amount of GS38-IFNβ produced by GS38 cells for 12 months is found to not change much. The cells produce from 2.35 to 3.6 x 106 U.I./ml of GS38-IFNβ during this period. Five biological activities of GS38-IFNß were tested. The human primary fibroblast β interferon mentioned in the following is produced from primary human mid-passage foreskin fibroblasts, according to the superinduction method of Tan et al (1970) with additional cell priming per 100 U.I. of interferon ß approximately 16 hours before superinduction. The resulting interferon-β is purified by affinity chromatography. The five activities which were tested are: 1. Antiviral activity of interferon β assayed in human MRC5 fibroblasts or in human hepatoblastoma cell line (HepG2) after the modified method of Armstrong (1971). Accordingly, the specific activity of GS38-IFNβ is 5.37 x 108 U.I./mg of prstein as tested in human MRC5 fibroblasts and used as a reference for the NIH interferon-ß standard. The antiviral activity of GS38-IFNβ in HepG2 cells is at least 1.5 times more effective than natural interferon-β from human fibroblast cells. GS38-IFNß is also approximately 2.2 times more effective than Betaseron (recombinant human interferon-ß produced in E. coli) to protect HepG2 cells against viral exposure of VSV. 2. The interferon β cell growth inhibition assay (Tan, Nature 260, 141-143, 1976) in human hepatoblastoma cells as described for primary human cells but which is applied to HepG2 cells was carried out. However, the assay is performed in 2 cm2 wells containing one ml of regular medium and an initial HepG2 cell count of 3 to 5 x 10 4 cells / well. Accordingly, GS38-IFNβ is effective as the native primary human diploid fibroblast interferon-ß to inhibit the growth of HepG2 cells measured by this assay in vi tro. 3. A pharmacokinetic study of interferon-ß injected subcutaneously in mice was performed. Purified ß interferon from GS38 or primary human fibroblasts, or E. coli betaseron, was reconstituted separately in 4 mg of human serum albumin in 1 ml of phosphate buffered saline (NaCl 0:15 M), pH 7.0, containing 20 mg of trehalose. They were injected subcutaneously, separately, 0.7 x 106 or 1.5 x 106 ICU. on the back of albino rabbits weighing approximately 1.5 kg and approximately 2 kg, respectively. The whole blood (500 μl) was extracted from the cones at 15 m'ih, * 30 min, 1 h, 2 h, 3 h, 4 h and -5 h. The blood serum extracted is then tested for interferon β antiviral activity according to the modified method of Armstrong (1971). The results are presented in Figure 10 (a) and (b) and show that GS38-IFNß has a higher bioavailability compared to interferon-β produced from primary human fibroblasts and betaseron.

It was found that the maximum level of GS38-IFNß (128 256 U.I./ml) was presented after 1 hour, and significant concentrations of GS38-IFNβ (64- 128 U.I./ml) were found for at least 5 hours in the serum of rabbits injected with 1.5 x 106 U.I. of GS38-IFNß. This is unexpected. It is generally known that subcutaneous or intramuscular injection of. Human interferon ß results in zero or very low levels of circulating human interferon serum. 4. A pharmacokinetic study of an untreated intravenous bolus injection of interferon-ß in rabbits was also performed. 1 ml of each class of interferon-ß (GS38-IFNβ, natural interferon produced from primary human fibroblasts and E. coli betaseron) containing approximately equal amounts of interferon-β (0.7 x 10 6 IU) is injected into the ear vein of rabbit. Blood is drawn (500 μl) at 5 min, 10 min, 15 min, 30 min and 90 min. Serum tests are performed to determine the antiviral activity of interferon β according to the modified method of Armstrong (1971). The result is shown in Figure 11, where the half-life (tα) of GS38-IFNβ is 13.6 min, compared to interferon β produced by primary human fibroblasts (t = 4.4 min) or betaseron (t = 3.8). According to the standard methodology, the total amount of interferon-ß injected is divided by the blood volume to estimate the initial concentration of interferon-β at time zero. The assumption is made that the blood volume constitutes 5% of the rabbit's body weight. The time for the 50% decrease of this initial concentration is VA. 5. The effect of the dosage was investigated by injecting increasing amounts of GS38-IFNβ. Rabbits of approximately 2 kg were injected subcutaneously with increasing amounts of GS38-IFNß, in particular with 1.2 x 106 U.I., 2.5 x 106 U.I. and 10.1 x 106 U.I. of GS38-IFNß. The results in Figure 12 show that the increasing doses of GS38-IFNβ injected subcutaneously proportionally increases the measurable level of GS38-IFNβ in the serum of the injected rabbits.

EXAMPLE 6 Analysis of olioosaccharides associated with GS38-IFMß GS38-IFNß is a glycoprotein. The oligosaccharides associated with GS38-IFNβ are released and recovered quantitatively. The glycans bonded to N and O are released by treatment with anhydrous hydrazine. In this procedure, the main structure of the protein is converted to amino acid hydrazone. The intact reducing glycans are separated, recovered and labeled fluorimetrically with 2-aminobenzamide. More specifically, a sample of GS38-IFNβ (1-2 mg) is subjected to vigorous sample preparation, which involves lyophilization (<50 milli Torr,> 24 hours), introduced to a GlycoPrep 1000 kit (Oxford Glyco Systems, GB) and the oligosaccharides are released and recovered using the "N + O" program. The sample is fluorescently labeled by reductive amination with 2-aminobenzamide. The sample is then applied to Whatman 3MM chromatographic paper and subjected to upward chromatography on paper using 1-butanol / ethanol / water (4: 1: 1) The marked sample that remains at the origin is subsequently eluted with water. This procedure leads to a quantitative (and non-selective) recovery of the total accumulation of oligosaccharides associated with the GS38-IFNβ sample as an oligosaccharide labeled with 2-aminobenzamide. The accumulated labeled oligosaccharides are activated and analyzed as follows: The labeled oligosaccharides are analyzed for their charge distribution by ion exchange chromatography by clap. Accordingly, an aliquot of the total accumulation of oligosaccharides labeled with 2-aminobenzamide is subjected to anion exchange chromatography by clap on a GlycoSep C column (Oxford GlycoSystems, GB) using acetonitrile and ammonium acetate as eluent. The labeled glycans eluted from the column are detected using the fluorometer a? Ex = 356 mm? em = 450 mm. The resulting chromatogram is shown in Figure 6. It can be seen * from Figure 6 that the, oligosaccharides associated with GS38-IFNß consist of both neutral and acid components. To determine the nature of the acid substituents, an aliquot of the total accumulation of fluorescently labeled oligosaccharides is incubated with neuramidase (derived from Arthrobacter ureafaciens). An aliquot is again subjected to chromatography with GlycoSep C. The resulting chromatogram is shown in Figure 7. No acid oligosaccharides are detectable after incubation with neuraminidase. Therefore, the oligosaccharides present an acidic substituent they only do so because they possess a sialic acid residue in the non-reducing terminal outer arm covalently bound. The relative molar content of neutral and acid oligosaccharides in the total accumulated is determined by integration of the chromatographic peaks (Figure 6). The results are as follows: Neutral 10% ± 0.8% (up to 1d.e.) Acid 90% ± 0.6% (up to 1d.e.) d.e. = standard deviation 2. Size distribution of the total accumulated and deaerated isosaccharides liberated from GS38-IFNβ An aliquot of the total accumulation of the oligosaccharides labeled with deacidified 2-aminobenzamide is subjected to high resolution gel permeation chromatography using RAAM 2000 (Oxford Glyco Systems, GB). The resulting gel permeation chromatogram is shown in Figure 8. As indicated in the explanation, the fluorescently labeled deacidified oligosaccharides are suspended in an aqueous solution of a dextran partial acid hydrolyzate, and are applied to a RAAM 2000 device. (eluent of water, maintained at 55 ° C, constant flow, 80 μl / min for 10.6 hours). Detection is performed by an in-line fluorescence flow detector (to detect the fluorescently labeled sample), and a line differential refractometer (to detect individual glucose oligomers). The numerical indices in Figure 8 represent the elution position of the non-fluorescent oligomers, co-applied for glucose in units of glucose (gu), simultaneously detected by refractive index. The hydrodynamic volume of the individual 2-aminobenzamide labeled oligosaccharides is measured in terms of glucose units, and calculated by cubic splicing interpolation between the two glucose oligomers immediately adjacent to the fluorescently labeled oligosaccharide. It is evident that at least 6 defined oligosaccharides are identifiable within the dextran calibration range and their effective hydrodynamic volumes are as follows: . .7 gu 14.5% 17. .6 gu 23.4% 14, .5 gu 29.8% 12. .2 gu 26.4% 11, .1 gu 2.1% 1, .0 gu 3.8% The annotation of the hydrodynamic volume is accurate to ± 0.1 gu for all volumes = 20 gu. The conjugation of the glycans with 2-aminobenzamide (2-AB) decreases the hydrodynamic volume of the glycans at a constant value. The hydrodynamic volume of the glycans labeled 2-AB (? F) is calculated from the hydrodynamic volume of the non-produced (?) Glycans using the following equation:? F = 1.2? -1.96 3. deacidified released from GS38-IFN? Since peaks are detected outside the dextran calibration range (Figure 8), and particularly in the void volume, it is necessary to obtain a molecular weight distribution in order to establish which carbohydrate species are present. An aliquot of the accumulated deacidified glycan is prepared in a 3,5-dihydroxybenzene matrix. A mass spectrum is obtained by ionization of laser assisted desorption in matrix-time of flight (MALDI-TOF) in positive ion mode (ie molecular sodium ion plus). The following ions can be assigned to carbohydrates (figure 9).

Na molecular ion 1929. 9 2292. 5 2660. 1 3019. 1 Four . EE = IMEN The GS38-IFNß glycoprotein presents oligosaccharides with the following structural characteristics: (i) neutral (non-acidic substituents): 10% ± 0.8% acid: 90% ± 0.6% (ii) The total accumulation of desialylated oligosaccharide is heterogeneous, with minus 6 different structural components present in the total accumulated, (iii) The MALDI-TOF mass spectrometry data and the RAAM 2000 data can be summarized as follows: Hex = Hexose, dHex = deoxyHexose, HexNAc = N-acetylhexosamine, 2AB = 2-aminobenzamide, Na = sodium ion.

NB The peak which elutes at 1.0 gu will be included in the matrix of the MALDI-TOF mass spectrum and therefore not detected.

Expression of human erythropoietin in CBO cells using pMMTC The cDNA that codes for human erythropoietin (EPO) is derived by PCR with pfu polymerase using human kidney mRNA that has been reverse transcribed. The nucleotide sequence of the primers for 5 'and 3' PCR are as follows: Initiator for 5 'PCR: 5' GTGGATCCGCCGCCACC / ATG / GGG / GTG / CAC / GAA / TGT / CCT / GCC / TG-3 ' (the sequence CCGCCGCCACC before the ATG start codon for Met is designed for optimal translation of the resulting mRNA); Y Primer for PCR 3 ': 5' -GATCTAGACAGTTCTTGTCAATGAGGTTGAAG-3 'The PCR product is gel purified, cut with restriction enzyme BamHI and Xbal, and then ligated into the pGEM-llZ plasmid that has been cut with BamHI and Xbal . After confirming the nucleotide sequence of the region encoding EPO, the plasmid pGEM-11Z DNA is recovered by cleavage with Xhol and Notl. The EPO cDNA is gel purified and inserted into the Xhol-Notl sites of pMMTC, resulting in a plasmid referred to as pMMTC / EPO. Wild type CHO cells (CHO-K1) are transfected with pMMTC / EPO and initially selected with G-418 for 7 days and then with gradually increasing concentrations of Cadmium (4, 8, 16, 32, 64 and 92 μM). Approximately a few thousand colonies are obtained after the initial selection with G418. When the cadmium concentration is 64 μM, approximately 100 colonies remain viable. Among these 100 colonies, 60 are individually isolated and expanded, and tests are carried out to determine the EPO levels in their culture media by Western staining, which has an impact on the identification of 8 colonies with high expression (referred to as E15 / 1 , E15 / 3, E15 / 8, E15 / 10, E15 / 13, E15 / 18, E15 / 26 and E15 / 30, respectively). The remaining colonies were additionally selected in 92 μM cadmium medium and several colonies remained viable after this selection, from which 6 colonies (designated C5, CIO, Cll, C12, C14, and C15, respectively) were individually isolated and tests were performed for EPO expression levels. The levels of EPO expression by the 8 colonies of high expression after selection with 64 μM cadmium from the 6 colonies after selection with 92 μM cadmium were further compared by Western blot analysis. Cells from the selected colonies are seeded in 35 mm (diameter) culture vessels. When confluence occurs, 1 ml of culture medium is added to each one of them and they are grown for 24 h. The media is then collected and 10 μl of each, together with a 50 ng EPO control (line 15) is separated by SDS PAGE and analyzed by Western blotting using the Amersham ECL detection system. The Western B stain is shown in Figure 13. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (35)

1. A nucleic acid vector, characterized in that it comprises: (i) a coding sequence which codes for a protein of interest and which is operably linked to a promoter capable of directing the expression of the coding sequence in mammalian cells in presence of a heavy metal ion; (ii) a first selectable marker sequence which comprises a gene for metallothionein and which is operably linked to a promoter capable of directing sufficient expression of the gene for metallothionein in mammalian cells in the presence of a heavy metal ion for confer resistance to the cells before the ion; and (iii) a second selectable marker sequence which comprises a neo gene and which is operably linked to a promoter capable of directing the expression of the neo gene in mammalian cells.

2. The vector according to claim 1, characterized in that the promoter for the coding sequence is the promoter of a gene for metallothionein.

3. The vector according to claim 2, characterized in that the promoter is the promoter of gene I for mouse metallothionein.

4. The vector according to any of the preceding claims, characterized in that the promoter for the coding sequence is also operably linked to an extender.

5. The vector according to claim 4, characterized in that the extender is the extender of the mouse sarcoma virus.

6. The vector according to any of the preceding claims, characterized in that the promoter for the first marker sequence is the promoter of a gene for metallothionein.

7. The vector according to any of the preceding claims, characterized in that the first marker sequence comprises a gene for human metallothionein.

8. The vector according to claim 7, characterized in that the promoter for the first marker sequence is the native promoter for the gene for human metallothionein.

9. The vector according to any of the preceding claims, characterized in that it is a DNA plasmid.

10. The vector according to any of the preceding claims, characterized in that the coding sequence codes for human interferon-β or for human erythropoietin.

11. Mammalian cells which harbor a nucleic acid vector, characterized in that it comprises: (i) a coding sequence which codes for a protein of interest and which is operably linked to a promoter capable of directing the expression of the coding sequence in mammalian cells in the presence of a heavy metal ion; (ii) a first selectable marker sequence which comprises a gene for metallothionein and which is operably linked to a promoter capable of directing sufficient expression of the gene for metallothionein in mammalian cells in the presence of a heavy metal ion for confer resistance to the cells before the ion; and (iii) a second selectable marker sequence which comprises a neo gene and which is operably linked to a promoter capable of directing the expression of the neo gene in mammalian cells.

12. The cells according to claim 11, characterized in that they are Chinese wild type hamster ovary cells.

13. The cells according to claim 11 or 12, characterized in that the promoter for the coding sequence is the promoter of a gene for metallothionein.

14. The cells according to claim 13, characterized in that the promoter is the promoter of gene I for mouse metallothionein.

15. The cells according to any of claims 11 to 14, characterized in that the promoter for the coding sequence is also operably linked to an extender.

16. The cells according to claim 15, characterized in that the extender is the extender of the mouse sarcoma virus.

17. The cells according to any of claims 11 to 16, characterized in that the promoter for the first marker sequence is the promoter of a gene for metallothionein.

18. The cells according to any of claims 11 to 17, characterized in that the first marker sequence comprises a gene for human metallothionein.

19. The cells according to claim 18, characterized in that the promoter for the first marker sequence is the native promoter for the gene for human metallothionein.

20. The cells according to any of claims 11 to 19, characterized in that the nucleic acid sequence is a DNA sequence.

21. The cells according to any of claims 11 to 20, characterized in that the coding sequence encodes human β-interferon or human erythropoietin.

22. The cells according to any of claims 11 to 21, characterized in that the vector is integrated into the genome of the cells.

23. A process for the preparation of cells, according to claim 11, which process is characterized in that it comprises: (a) transfecting mammalian cells according to a vector as defined according to any of claims 1 to 10; (b) exposing the transfected cells to geneticin to thereby eliminate cells lacking the neo gene; and (c) exposing the surviving cells to step (a) at progressively increasing concentrations of a heavy metal ion to thereby select the heavy cells.

24. The process according to claim 23, characterized in that the cells in step (c) are exposed to concentrations from 5 to 200 μM of a heavy metal ion selected from Cd2 +, Cu2 + and Zn2 +.

25. The use of a neo gene and a gene for metallothionein as selectable marker genes, in a single vector.

26. A process for the preparation of a protein of interest, a process which is characterized in that it comprises culturing mammalian cells as defined according to any of claims 11 to 22, in the presence of a heavy metal ion, and recovering the expressed protein in this way.

27. The process according to claim 26, characterized in that the cells are cultured in the presence of concentrations from 100 to 200 μM of a heavy metal ion selected from Cd2 +, Cu2 + and Zn2 +.

28. The process according to claim 27, characterized in that the cells are cultured in the presence of approximately 150 μM Zn2 +.

29. Human interferon ß, characterized because when 1.5 x 10s U.I. of interferon are injected subcutaneously into the back of a rabbit of approximately 2 kg: (a) it is detectable = 128 IU / ml of interferon in rabbit serum after 1 hour, and / or (b) it is detectable = 64 IU / ml of interferon in rabbit serum after 5 hours.

30. Human interferon-ß characterized in that it has a specific activity from 4.8 x 108 to 6.4 x 10"U.I. per mg equivalent to protein bovine serum albumin.

31. Human interferon-ß characterized in that it can be obtained by a process according to any of claims 26 to 28.

32. Human erythropoietin, characterized in that it can be obtained by a process according to any of claims 26 to 28.

33. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable carrier or diluent and, as an active ingredient, human interferon-β as defined according to any of claims 29 to 31.

34. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable carrier or diluent and, as an active ingredient, human erythropoietin, according to claim 32.

35. The composition according to claim 33 or 34, characterized in that it is suitable for oral or intranasal administration.