MXPA06011595A - Nucleoside derivatives for treating hepatitis c virus infection - Google Patents

Abstract

Disclosed are adenosine derivatives, compositions and methods for treating viral infections caused by a flaviviridae family virus, such as hepatitis C virus.

Description

DERIVATIVES OF NUCLEOSIDES FOR TREATING INFECTIONS FOR HEPATITIS VIRUSES FIELD OF THE INVENTION The invention relates to the field of the pharmaceutical industry, in particular to compounds, compositions and methods for the treatment of viral infections in mammals mediated, at least in part, by a virus belonging to the Flaviviridae virus family. This invention also relates to compounds, compositions and methods for treating hepatitis C virus infections. BACKGROUND OF THE INVENTION The hepatitis C virus (HCV) virus causes an infection that damages the liver, which can trigger cirrhosis, liver failure or liver cancer, and eventually death. HCV is a coated virus that contains a positive chain single-stranded RNA genome of approximately 9.4 kb, and has a virion with a size of 30-60 nm.1 HCV is the main causative agent of non-A hepatitis , not B post-transfusion and sporadic. HCV infection affects a large proportion of chronically infected (and infectious) carriers who probably do not experience clinical symptoms for many years.

HCV is difficult to treat, and it is estimated that there are 500 million people infected with it in the world. There is no effective immunization available at present, and hepatitis C can only be controlled by other preventive measures, such as improvements in hygiene and sanitary conditions, and by interrupting the route of transmission. At present, the only acceptable treatment for chronic hepatitis C is interferon (IFN-alpha), which requires at least six (6) months of treatment, and / or ribavirin, which can inhibit viral replication in infected cells and It also improves liver function in some people. IFN-alpha belongs to a family of small natural proteins with characteristic biological effects, such as antiviral, immunoregulatory and antitumor activities, which are produced and secreted by most cells with animal nuclei in response to various diseases, in particular viral infections. IFN-alpha is an important regulator of growth and differentiation that affect cell communication and immune control. However, the treatment of HCV with interferon has a limited long-term efficacy with a response rate of approximately 25%. In addition, the treatment of HCV with interferon has been frequently associated with adverse effects such as fatigue, fever, tremors, headache, myalgias, arthralgias, mild alopecia, psychiatric effects and associated disorders, autoimmune phenomena and associated disorders and dysfunction of the thyroid gland. Ribavirin (l-ß-D-ribofuranosyl-lH-l, 2,4-triazole-3-carboxamide), an inhibitor of inosine 5'-monophosphate dehydrogenase (IMPDH), improves the efficacy of IFN-alpha in the treatment of the HCV. Despite the introduction of ribavirin, more than 50% of patients do not eliminate the virus with the current standard interferon-alpha therapy (IFN) and ribavirin. Currently, the standard therapy of chronic hepatitis C has been changed by the combination of PEG-IFN plus ribavirin. However, many patients still have significant side effects, primarily related to ribavirin. Ribavirin causes significant hemolysis in 10-20% of patients treated with the currently recommended doses and the drug is both teratogenic and embryotoxic. Other approaches to fighting the virus have been considered. Such approaches include, for example, the application of antisense oligonucleotides or ribozymes to inhibit HCV replication. Even more, the low weight compounds Molecules that directly inhibit HCV proteins and interfere with viral replication are considered attractive strategies to control HCV infection. The NS3 / 4A serine protease, the ribonucleic acid (RNA) helicase, the RNA-dependent RNA polymerase are considered potential targets to elaborate new drugs.2'3 Devos, et al.4 describe derivatives of the purine and pyrimidine nucleosides and their use as inhibitors of the replication of HCV RNA. Sommadossi, et al, 5 describe modified nucleosides at the 1 ', 2' or 3 'position and their use in the treatment of a host infected with HCV. Due to the level of the global HCV epidemic, there is a significant need for new effective drugs for the treatment of HCV. The present invention provides nucleoside derivatives for treating HCV infections. SUMMARY OF THE INVENTION This invention relates to new compounds that are useful for treating HCV in mammals.

Specifically, in one aspect, the compounds of this invention are represented by Formula I below: i, wherein:, 1 and W2 are independently selected from the group consisting of hydrogen and an acceptable prodrug for pharmaceutical use; R is selected from the group consisting of hydrogen or (C1-C3) alkyl; R1 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl and substituted alkynyl; And it is a link, -CH2- or -0-; Y 'is selected from the group consisting of hydrogen, halo, hydroxyl, thioalkyl, amino and substituted amino; Z is selected from the group consisting of acyl, cyano, carboxyl, carboxylic ester, -C (O) NR20R21, halo, - B (OH) 2, -C (= NR 2) R 3, nitro, alkenyl, substituted alkenyl, acetylenyl and substituted acetylenyl of formula -C = C-R 4; wherein R2 is selected from the group consisting of hydrogen, -OH, -OR5 amino, substituted amino, and (Cx-C2) alkyl, wherein R5 is selected from the group consisting of alkyl and substituted alkyl; R3 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, amino and substituted amino; R 4 is selected from the group consisting of hydrogen, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, -Si (R 8) 3, carboxyl, carboxylic esters and -C (0) NR 6 R 7, wherein R 6 and R 7 are independently hydrogen, alkyl, or R6 and R7, together with the nitrogen atom to which they are attached, are combined to form a heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl group; each R8 is independently (Cx-C4) alkyl or phenyl; and R20 and R21 are independently hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle and substituted heterocycle, or R20 and R21, together with the nitrogen atom to which they are attached, form a heterocyclic or heterocyclic group replaced; or salts thereof acceptable for pharmaceutical use.

In a preferred embodiment, it is preferably selected from the group consisting of hydrogen, monophosphate, diphosphate and triphosphate, and 1? 2 are independently hydrogen or acyl. Preferred acyl groups include acetyl and trimethylacetyl, and acyl groups derived from amino acids. In another aspect, the compounds of this invention are represented by Formula II below: pu II, where R, and Z are as previously defined; or salts thereof acceptable for pharmaceutical use. In a preferred embodiment, it is preferably selected from the group consisting of hydrogen, monophosphate, diphosphate and triphosphate. In the compounds of formula I and II above, Z is preferably selected from the group consisting of acyl, nitro, halo, cyano, -C (= NR2) R3, acetylenyl and substituted acetylenyl of formula -C = C-R4, where R2, R3 and R4 are as previously defined. Even more preferably, Z is selected from formyl, nitro, bromo, iodo and -C = C-R4, where R4 is selected from H, phenyl and -Si (CH3) 3. In one embodiment, when Z is a substituted alkenyl or alkenyl group, these groups are preferably in cis orientation, if the substituent has a cis / trans ratio. Compounds included in the scope of this invention include, for example, those detailed (including salts thereof acceptable for pharmaceutical use) in Table I below: Table I 15 20 This invention is also directed to pharmaceutical compositions comprising a diluent acceptable for pharmaceutical use and an effective amount for therapeutic use of one of the compounds of the present invention or mixtures of one or more of said compounds. This invention is further directed to methods for the treatment of a viral infection mediated, at least in part, by a virus belonging to the Flaviviridae virus family, such as HCV, in mammals where said methods comprise administration to a mammal, diagnosed with said viral infection or at risk of developing said viral infection, a pharmaceutical composition comprising a diluent acceptable for pharmaceutical use and an effective amount for therapeutic use of one of the compounds of the present invention or mixtures of one or more of said compounds. DETAILED DESCRIPTION OF THE INVENTION The invention is directed to compounds, compositions and methods for the treatment of viruses of the Flaviviridae family, such as infections by the hepatitis C virus. However, before describing this invention in greater detail, The following terms will be defined first: Definitions Unless the terms are limited in accordance with their use in other sections of this documentation, the following terms have the meanings indicated below: An "alkyl" refers to alkyl groups that possess between 1 and 5 carbon atoms and more preferably between 1 and 3 carbon atoms. The alkyl group may contain linear or branched carbon chains. Examples of this term include groups such as methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl, n-pentyl and the like. The term C? -C2 alkyl denotes an alkyl group having one or two carbon atoms. A "substituted alkyl" refers to an alkyl group having between 1 and 3, and preferably between 1 and 2, substituents selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl , substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocycles and substituted heterocycles. An "alkoxy" refers to the group "alkyl-O-" which includes, by way of example, methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, t-butoxy, sec-butoxy, n-pentoxy and similar. A "substituted alkoxy" refers to the group "alkyl-O-substituted". An "acyl" refers to groups HC (O) -, alkyl-C (O) -, alkyl-C (O) -substituted, alkenyl-C (O) -substituted, alkenyl-C (O) -substituted, alkynyl -C (O) -, C (O) -substituted alkynyl, C (O) - cycloalkyl, (C) -substituted cycloalkyl, aryl-C (O) -, aryl-C (O) -substituted, heteroaryl-C (O) -, substituted heteroaryl-C (O), C (O) - heterocycles and-C (O) -substituted heterocycles, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl , substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle and substituted heterocycle are as defined herein. An "acylamino" refers to the group -C (?) NR10R10, wherein each R10 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, cycloalkyl substituted, heteroaryl, substituted heteroaryl, heterocycles, substituted heterocycles and wherein each R10 is joined to form together with the nitrogen atom a heterocyclic or substituted heterocyclic ring, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle and substituted heterocycle are as defined herein. An "acyloxy" refers to alkyl-C (0) 0-, alkyl-C (O) O-substituted, alkenyl-C (O) O-, alkenyl-C (O) O-substituted, alkynyl-C groups (O) O-, C (O) O- substituted alkynyl, aryl-C (0) 0-, aryl-C (0) 0- substituted, cycloalkyl-C (0) 0-, cycloalkyl-C (0) 0- substituted, heteroaryl-C (0) 0-, heteroaryl-C (O) 0- substituted, heterocycles-C (0) 0- and C (0) 0- substituted heterocycles, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle and substituted heterocycle are as defined in this documentation. An "alkenyl" refers to an alkenyl group having between 2 and 6 carbon atoms and preferably between 2 and 4 carbon atoms and having at least 1 and preferably 1-2 sites of alkenyl unsaturation. Examples of such groups are vinyl (ethen-1-yl), allyl, but-3-en-l-yl and the like. A "substituted alkenyl" refers to alkenyl groups having between 1 and 3 substituents, and preferably between 1 and 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl , substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocycles and substituted heterocycles with the proviso that none Hydroxyl substitution is attached to a carbon atom (unsaturated) of a vinyl. "Alkynyl" denotes an alkynyl group preferably having between 2 and 6 carbon atoms, and more preferably 2 or 3 carbon atoms, and having at least 1, and preferably 1-2 sites of alkynyl unsaturation. A preferred alkynyl is a C2 that is sometimes known in the present documentation as acetylenyl: -C = CH. A "substituted alkynyl" refers to alkynyl groups having between 1 and 3 substituents, and preferably between 1 and 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl , substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocycles and substituted heterocycles. A preferred substituted alkynyl is a substituted acetylenyl which may be represented by the formula: -C = CR 4, where R 4 is as defined herein. An "amino" refers to the NH2 group.

A "substituted amino" refers to the group NR'R ", where R 'and R" are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl , substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocycles, substituted heterocycles and where R and R "are attached, together with the nitrogen to which they are attached, to form a substituted heterocyclic or heterocyclic group provided that both R 'and R" are not hydrogen . When R 'is hydrogen and R "is alkyl, the substituted amino group is often referred to as alkylamino in the present documentation When R' and R" are alkyl, the substituted amino group is often referred to as dialkylamino in the present documentation. "Aminoacyl" refers to the groups -NRX1C (O) alkyl, -NRX1C (O) substituted alkyl, NRa? C (O) cycloalkyl, -NRX1C (O) substituted cycloalkyl, NR ?: LC (O) alkenyl, -NR1XC (O) substituted alkenyl, NRX1C (O) alkynyl, -NRX1C (O) substituted alkynyl, NR21C (0) aryl, -NR1: LC (0) substituted aryl, NR1XC (O) heteroaryl, -NR1: LC (O) heteroaryl substituted, NR1XC (O) heterocyclic, and -NR1: LC (O) substituted heterocyclic, wherein RX1 is hydrogen or alkyl, and where alkyl, alkyl substituted, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle and substituted heterocycle are as defined herein. The terms "aryl" or "Ar" refer to a monovalent aromatic carbocyclic group of 6 to 14 carbon atoms possessing a single ring (e.g., phenyl) or multiple fused rings (e.g., naphthyl or anthryl), wherein said Condensed rings may, or may not, be aromatic (for example, 2-benzoxazolinone, 2H-1,4-benzoxazin-3 (4H) -one-7-yl and the like) provided that the point of attachment is at a carbon atom aromatic. Preferred aryls include phenyl and naphthyl. A "substituted aryl" refers to aryl groups including phenyl groups (sometimes referred to as "substituted phenyl" herein) substituted with 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of hydroxy, acyl, acylamino, acyloxy, alkyl, substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, carboxyl, carboxylic esters, cyano, thiol, thioalkyl, substituted thioalkyl, thioaryl, substituted thioaryl, thioheteroaryl, substituted thioheteroaryl, thiocycloalkyl, substituted thiocycloalkyl, thioheterocyclics, substituted thioheterocycles, cycloalkyl, substituted cycloalkyl, halo, nitro, heteroaryl, substituted heteroaryl, heterocycles, substituted heterocycles, heteroaryloxy, substituted heteroaryloxy, heterocyclyloxy and substituted heterocyclyloxy. An "aryloxy" refers to the group aryl-0- which includes, by way of example, phenoxy, naphthoxy and the like. A "substituted aryloxy" refers to aryl-O-substituted groups. A "carboxyl" refers to -COOH or salts thereof. "Carboxylic esters" refer to groups -C (O) O-alkyl, -C (0) O-substituted alkyl, -C (0) O-aryl and -C (O) O-substituted aryl, wherein the groups alkyl, substituted alkyl, aryl and substituted aryl are as previously defined herein. A "cycloalkyl" refers to cyclic alkyl groups of 3 to 10 carbon atoms, which are single or multiple cyclic rings, one or more of which may be aromatic or heteroaromatic as long as the point of attachment is through a cycloalkyl ring atom. Such groups include, by way of example, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like. A "substituted cycloalkyl" refers to a cycloalkyl group having between 1 and 5 substituents selected from the group consisting of oxo (= 0), thioxo (= S), alkyl, substituted alkyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocycles and substituted heterocycles. A "cycloalkoxy" refers to -0-cycloalkyl groups. A "substituted cycloalkoxy" refers to cycloalkyl -O-substituted groups. The terms "halo" or "halogen" refer to fluorine, chlorine, bromine and iodine, and preferably it is fluorine or chlorine. A "heteroaryl" refers to an aromatic group of 1 to 10 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen, sulfur, -S (0) -, and -S (0) 2 in the ring. Said heteroaryl groups may be single-ring (for example, pyridyl or furyl) or multiple fused rings (for example, indolizinyl or benzothienyl), where the fused rings may or may not be aromatic and / or contain a heteroatom, always that the point of union is through an atom of the aromatic heteroaryl group. Preferred heteroaryls include pyridyl, pyrrolyl, thienyl, indolyl, thiophenyl, and furyl. A "substituted heteroaryl" refers to heteroaryl groups that are substituted with 1 to 3 substituents selected from the same group of substituents defined for substituted aryl. A "heteroaryloxy" refers to the group -O-heteroaryl and a "substituted heteroaryloxy" refers to the -O-substituted heteroaryl group. The terms "heterocycle" or "heterocycle" or "heterocycloalkyl" refer to a saturated or unsaturated group (but not heteroaryl) having a single ring or multiple fused rings, between 1 and 10 carbon atoms and between 1 and 4 selected heteroatoms of the group consisting of nitrogen, oxygen, sulfur, such as -S (O) - and -S (O) 2-] within the ring, where, in the fused rings, one or more of the rings may be cycloalkyl, aryl or heteroaryl provided that the point of attachment is through the heterocyclic ring. The terms "substituted heterocycles" or "substituted heterocycloalkyl" refer to heterocycle groups that are substituted with 1 to 3 of the same substituents as defined for substituted cycloalkyl. Examples of heterocycles and heteroaryls include, by way of example, azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindol, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine. , quinoxaline, quinazoline, cinoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, imidazolinoline, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline , 4,5,6,7-tetrahydrobenzo [b] thiophene, thiazole, thiazolidine, thiophene, benzo [b] thiophene, morpholinyl, thiomorpholinyl (also known as thiomorpholinyl), piperidinyl, pyrrolidine, tetrahydrofuranyl and the like.

A "heterocyclyloxy" refers to an -O-heterocyclic group and a "substituted heterocyclyloxy" group reference to the -O-substituted heterocyclic group. A "phosphate" refers to the groups -P (0) (OH) 2 (monophosphate), -P (0) (OH) OP (O) (0H.). 3 (diphosphate) and P (0) (OH ) OP (O) (OH) OP (O) (OH) 2 (triphosphate) or salts thereof, including partial salts thereof The term "phosphonate" refers to groups -P (0) (R12) ( OH) or -P (0) (R12) (OR13) or salts thereof, including partial salts thereof, wherein each R12 is independently selected from hydrogen, alkyl, substituted alkyl, carboxylic acid and carboxyl ester and R13 is alkyl or substituted alkyl. "Sulfonate ester" refers to the groups: -S02OR14 where R14 is selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic or substituted heterocyclic. A "thiol" refers to the group -SH. A "thioalkyl" or "alkylthioether" or "thioalkoxy" refers to the group -S-alkyl. A "substituted thioalkyl" or "substituted alkylthioether" or "substituted thioalkoxy" refers to the group -S-substituted alkyl. The term "thiocycloalkyl" refers to groups -S-cycloalkyl and "substituted thiocycloalkyl" refers to substituted -S-cycloalkyl groups. A "thioaryl" refers to the group -S-aryl and "substituted thioaryl" refers to the group -S-substituted aryl. A "thioheteroaryl" refers to the group -S-heteroaryl and "substituted thioheteroaryl" refers to a group -S-substituted heteroaryl. The "thioheterocycles" refer to -S-heterocyclic groups and the "substituted thioheterocyclic" groups refer to substituted -S-heterocyclic groups. The term "amino acid" refers to a-amino acids of the formula H2NCH (R15) COOH, where R15 is hydrogen, alkyl, substituted alkyl, aryl or substituted aryl. Preferably, the α-amino acid is one of the twenty natural L-amino acids. The term "carbohydrate" refers to oligosaccharides comprising between 2 and 20 units of saccharides. The particular saccharide units employed are not critical, and include, by way of example, all natural and synthetic derivatives of glucose, galactose, N-acetylglucosamine, N-acetylgalactosamine, fucose, sialic acid and the like.

In addition to being in its pyranose form, all the saccharide units described in this documentation are in their D form, except fucose, which is in its L form. The term "lipid" is a term with a known definition in the technique, for example, that of Lehninger, Biochemistry, 1970, on pages 189 et seq., which is incorporated herein in its entirety by way of reference. The term "peptide" refers to polymers of α-amino acids, which comprise between about 2 and about 20 amino acid units, preferably between about 2 and about 10, more preferably between about 2 and about 5. The term "stabilized phosphate prodrug" "denotes mono, di and tri-phosphate groups having one or more of the bound hydroxyl groups converted to an alkoxy, a substituted alkoxy group, an aryloxy or a substituted aryloxy group. The term "prodrugs acceptable for pharmaceutical use" refers to modifications recognized in the art of one or more functional groups, where said functional groups are metabolized in vivo. to provide a compound of this invention or an active metabolite thereof. Such functional groups are well known in the art, including acyl groups for hydroxyl and / or amino substitution, esters of mono-, di- and triphosphates where one or more of the pendant hydroxyl groups has been converted to an alkoxy group, substituted alkoxy, aryloxy or substituted aryloxy and the like. The term "pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts of a compound, wherein said salts are derived from various organic and inorganic counterions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium and the like; and when the molecule contains a basic functionality, the salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like. It is considered that in all the substituted groups that were previously defined, the polymers obtained by definition of the substituents with additional substituents belonging to the same group (for example, a substituted aryl containing a substituted aryl group as a substituent, which in turn is same substituted with a substituted aryl group, etc.) are not considered included in this documentation. In such cases, the maximum amount of said substituents is three. That is to say that each of the above definitions is restricted by a certain limitation, for example, the substituted aryl groups are limited to substituted-aryl- (substituted aryl) -substituted aryl. Similarly, it is considered that the above definitions do not intend to include the substitution patterns not allowed (for example, methyl substituted with 5 fluoro groups or an alpha hydroxyl group with respect to an ethenyl or acetylenic unsaturation). Such impermissible substitution patterns are well known to the specialists. General Methods of Synthesis The compounds of this invention can be prepared using readily available raw materials with the following general methods and procedures. It should be noted that when typical or preferred process conditions are indicated (ie, reaction temperatures, times, molar ratios of reagents, solvents, pressures, etc.), other process conditions may also be used unless otherwise indicated otherwise. The optimal reaction conditions may vary with the particular reagents or solvent used, but said conditions can be determined by the person skilled in the art by means of routine optimization procedures. In addition, the methods of this invention employ protecting groups which are necessary to prevent certain functional groups from suffering unwanted reactions. Suitable protecting groups for different functional groups as well as suitable protection and deprotection conditions of particular functional groups are well known in the art. For example, numerous protective groups are described in T. Greene and G. M. Wuts, Protecting Groups in Organic Synthesis, Third Edition, Wiley, New York, 1999, and references cited therein. Still further, the compounds of this invention will typically contain one or more chiral centers and said compounds may be prepared or isolated as pure stereoisomers, that is, as individual enantiomers or diastereomers, or as mixtures enriched in stereoisomers. All said stereoisomers (and enriched mixtures) are included in the scope of this invention, unless otherwise indicated. Pure stereoisomers (or enriched mixtures) can be prepared using, for example, optically selective or reagent raw materials or reagents assets well known in the art. Alternatively, racemic mixtures of said compounds can be separated using, for example, chromatography on chiral columns, chiral resolving agents and the like. Furthermore, some of the compounds defined in this documentation will include vinyl groups, which may exist in cis, trans, or a mixture of cis and trans forms. All combinations of these forms are within the scope of this invention. The raw materials of the following reactions are known compounds in general or can be prepared by known processes or obvious modifications thereof. For example, many of the raw materials can be obtained from commercial suppliers, such as Aldrich Chemical Co. (Milwaukee, Wisconsin, USA), Bachem (Torrance, California, USA), Emka-Chemce or Sigma (St. Louis, Missouri, USA). Other materials can be prepared by procedures, or obvious modifications thereof, which are described in standard reference texts, such as Reagents for Organic Synthesis by Fieser and Fieser, Volumes 1-15 (John Wiley &Sons, 1991), Chemistry of Carbon Rodd Compounds, Volumes 1-5 and Supplements (Elsevier Science Publishers, 1989), Organic Reactions, Volumes 1-40 (John Wiley & Sons, 1991), Advanced Organic Chemistry by March, (John Wiley &Sons, 4th Edition), and Comprehensive Organic Trans formations by Larock (VCH Publishers Inc., 1989). Specifically, the compounds of this invention can be prepared by various methods known in the art of organic chemistry in general and the synthesis of nucleoside and nucleotide analogs in particular. General reviews of the preparation of nucleoside and nucleotide analogs include 1) Michelson A.M. "The Chemistry of Nucleosides and Nucleotides", Academic Press, New York, 1963; 2) Goodman L. "Basic Principles in Nucleic Acid Chemistry", Academic Press, New York, 1974, vol. 1, Chap. 2 and 3) "Synthetic Procedures in Nucleic Acid Chemistry", Eds. Zorbach W. & Tipson R., Wiley, New York, 1973, vol. 1 & 2. The synthesis of the compounds of this invention generally follows a convergent or linear synthesis pathway as will be described below. The available strategies for the synthesis of compounds of the present invention include, for example: General synthesis of 2'-C-branched nucleosides The 2'-C-branched ribonucleosides of formula I: where R, W, W1, W2, Y, Y "and Z are as defined above, can be prepared by one of the following general methods: Convergent approach: Nucleosis glycosylation with appropriately modified sugar The key raw material of this process is a sugar appropriately substituted with 2'-OH and 2'-H with the appropriate leaving group, for example, an acyl group or a chloro, bromo, fluoro or iodo group. The sugar can be purchased or can be prepared by any known means including standard epimerization, substitution, oxidation and / or reduction techniques. For example, commercially available 1,3,5-tri-O-benzoyl-a-D-ribofuranose (Pfanstiel Laboratories, Inc.) can be used. Then, the substituted sugar can be oxidized with the appropriate oxidizing agent in a compatible solvent at an appropriate temperature to give the 2'-modified sugar. The possible oxidizing agents are, for example, Dess-Martin periodic reagent, Ac20 + DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride, triethylamine), Jones reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (Cr (VI) dipyridine oxide, Corey reagent (pyridinium chlorochromate), pyridinium dichromate, dicromic acid, potassium permanganate, Mn02, ruthenium tetraoxide, phase transfer catalysts such as for example chromic acid or permanganate supported on a polymer, Cl2-pyridine, H202-ammonium molybdate, NaBr02-CAN, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum ter-butoxide with other ketone) and N-bromosuccinimide The coupling of an organometallic nucleophilic carbon, such as a Grignard reagent, an organolithium, dialkyl copper or Rl-SiMe3 in TBAF with the ketone with the appropriate aprotic solvent for an appropriate temperature, yields 2 '-methyl sugar. For example, RlMgBr / TiCl 4 or RlMgBr / CeCl 3 can be used as described in Wolfe et al. 1997. J. Org. Chem. 62: 1754-1759 (where Rl is as defined in this documentation). The alkylated sugar can optionally be protected with an appropriate protective group, preferably with an acyl, substituted alkyl or silyl group, using methods that those skilled in the art know well, as set forth in Greene et al. Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991. Then, the protected sugar optionally can be coupled to the purine base using methods that those skilled in the art know well, as set forth in Townsend Chemistry of Nucleosides and Nucleotides, Plenum Press, 1994. For example, an acylated sugar can be coupled to a silylated base with a Lewis acid, such as for example tin tetrachloride, titanium tetrachloride or trimethylsilyl triflate in the appropriate solvent for an appropriate temperature. Alternatively, halo-sugar can be coupled to a silylated base in the presence of trimethylsilyl triflate. In addition to the above, the 2'-C-substituted sugars that are used in the synthesis methods described herein are well known in the art and are described, for example, in Sommadossi, et al. 5 and Carrol, et al .6 et al. both are incorporated here as a reference in their entirety. Scheme 1 below describes the alternative synthesis of a protected sugar that is useful for coupling to the bases described herein.

Scheme 1: Synthesis and alternative union of sugars Scheme 1 The formation of sugar a in Scheme 1, above, is achieved as described in Mandal, S. B., et al., Synth. Commun. , 1993, 9, page 1239, starting from commercial D-ribose. The protection of the hydroxyl groups to form sugar b is described in Witty, D.R., et al., Tet. Lett., 1990, 31, page 4787. The sugars c and d are prepared using the method of Ning, J. et al., Carbohydr. Res., 2001, 330, page 165, and the methods described herein. R1, in scheme 1, may be hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl. The groups R1 particularly preferred are methyl, trifluoromethyl, alkenyl and alkynyl. The sugar e is prepared using a modification of the Grignard reaction with RxMgBr or another suitable organometallic as described herein (without the need for titanium / cerium). Finally, the halogenated sugar used in the subsequent coupling reaction is prepared using the same protection method used to make sugar b above. Halogenation is described in Seela7. Immediately below, any of the described nucleosides can be deprotected using methods that those skilled in the art know well, as set forth in Greene et al. Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991. Scheme 2 below details an alternative approach for making protected sugars useful for coupling them to heterocyclic bases. The details of this synthesis can be found in Example 1.

Scheme 2 Linear Approach; Modification of a preformed nucleoside The key raw material for this process is a nucleoside appropriately substituted with 2'-0H and 2'-H. Said nucleoside can be purchased or can be prepared by any known means including standard coupling techniques. The nucleoside can optionally be protected with appropriate protecting groups, preferably with acyl, substituted alkyl or silyl groups, using methods that those skilled in the art know well, as set forth in Greene et al. Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991.

Then, the appropriately protected nucleosides can be oxidized with the appropriate oxidizing agent in a compatible solvent at an appropriate temperature to give the 2'-modified sugar. Possible oxidizing agents are, for example, Dess Martin periodic reagent, Ac20 + DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride, triethylamine), Jones reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (Cr (VI) dipyridine oxide, Corey reagent (pyridinium chlorochromate), pyridinium dichromate, dicromic acid, potassium permanganate, Mn02, ruthenium tetroxide, phase transfer catalysts such as for example chromic acid or permanganate supported on a polymer, Cl2-pyrridine, H202-ammonium molybdate, NaBr02-CAN, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum tert-butoxide with another ketone) and N-bromosuccinimide. The coupling of an organometallic nucleophilic carbon, such as a Grignard reagent, an organolithium, dialkyl copper or RxSiMe3 in TBAF with the ketone in the appropriate non-protic solvent for an appropriate temperature, yields the appropriate substituted nucleoside.

Immediately thereafter, the nucleoside can be deprotected using methods that those skilled in the art know well, as set forth in Greene et al. Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991. In one embodiment of the invention, L-enantiomers are preferred. However, it is contemplated here that the L-enantiomers are also useful. The L-enantiomers corresponding to the compounds of the invention can be prepared following the same general methods above, starting with the corresponding L-sugar or L-enantiomer nucleoside as raw material. In a particular embodiment, the 2'-C-branched ribonucleoside is desired. In another embodiment, the 3'-C-branched ribonucleoside is desirable. Scheme 3 below provides a method for preparing 7-nitro-7-deazapurines of the present invention.

The preparation of compound 115 from compound 102 (prepared as previously detailed in Scheme 2) and compound 101 has been described in another publication (see Carroll, et al., International Patent Application No. WO 02/057425).

Scheme 3 16 The hydroxyl groups of the 6-chloro-deazapurine derivative, compound 115, are protected with acetyl groups, by reaction with acetyl chloride and acetic acid, to form compound 115a. Compound 115a is converted to the 7-nitro derivative through a reaction in a solution of a 5% (v / v) acid (1: 1 mixture of a nitric and sulfuric acid solution) in DCM. The reaction develops between about 0 ° C and about room temperature for about 20 minutes, or until the reaction is complete. The compounds of hydroxylamine of this invention are prepared by reacting compound 116 with NH2OH. Methoxyamine derivatives can be prepared in a similar manner, using NH 2 OCH 3 instead of NH 2 OH. Scheme 4 below provides a method for preparing the 7-halo-7-deazapurine derivatives of the present invention. For example, the reaction of the compound 100 commercially available with NBS in acetonitrile, under conventional conditions, provides compound 101. Compound 104 is prepared by linking compound 101 with compound 103 (which is prepared as previously described in Scheme 3). This binding reaction develops in the presence of sodium hydride in an inert solvent, such as acetonitrile. The deprotection of compound 104 is carried out in a reaction with BC13 in DCM, between about -78 ° C and about -20 ° C for about 12 hours, which makes it possible to obtain compound 105. Finally, the reaction of compound 105 with trimethylsilyl- O-hydroxylamine in a solvent such as ethanol provides the 7-halo-7-deazapurine derivatives. This reaction develops at about 85 ° C for about 2 hours. These compounds are useful in the treatment of viral infections, such as HCV.

They are also useful as intermediates for preparing other compounds of the present invention. Scheme 4 108 The 7-formyl-7-deazapurines of the present invention can be prepared as indicated in Scheme 5 below. Compound 104 (prepared as previously described) is reacted with carbon monoxide, in the presence of catalytic amounts of tributyltin hydride and palladium tetraphenylphosphine, in an inert solvent, such as THF. This reaction develops for approximately 24 hours at approximately 50 ° C to provide compound 107. Deprotection of compound 107 as previously described provides compound 109. Reaction of compound 109 with trimethylsilyl-O-hydroxylamine, as previously described, provides the 6-hydroxylamine-7-formyl-7-deazapurines of the present invention. Alternatively, the reaction of compound 109 with NHOCH3 in ethanol at about 85 ° C for about 2 hours provides compound 20, the 6-methoxyamino-7-formyl-7-deazapurine derivatives of the present invention. In addition, the formyl group of compound 109 can be used as an intermediate in the synthesis of alkenyl and substituted alkenyl compounds, using conventional Wittig-Horne reaction conditions. Still further, the formula group can be oxidized to provide the corresponding carboxyl group, which optionally can be esterified according to conventional methods to provide a carboxylic ester, or can be amidated according to conventional methods to provide a carboxyl amide, for example, -C ( O) NR20R21, where R20 and R21 are as previously defined.

Scheme 5 104 107 109 110 twenty The preparation of the 7-cyano-7-deazapurine derivatives of the present invention is carried out as described in Scheme 6 below. Compound 104 can be treated with tributyltin cyanide and palladium tetraphenylphosphine in an inert solvent, such as THF. This reaction proceeds for about 15 hours at about 50 ° C to provide compound 111, which can be converted to hydroxylamine or ethoxyamine as previously described.

Scheme 6 104 108 111 17 The acetylenic compounds of the present invention can be prepared using the method detailed in Scheme 7 below. The details of each reaction step necessary to prepare the compounds where X is -NHOH in Example 2 below can be found. Specifically, the reaction of compound 100 with NIS, in a manner similar to that used with NBS in Scheme 4, provides the 7-iodo substituent in compound 118. Binding of this compound with trimethylsilylacetylene provides compound 119, which, in turn, it binds with sugar 102 under conventional conditions to obtain compound 120. Conventional elimination of the protecting groups in sugar provides compound 121, which is then converted to hydroxylamine or alkoxylamine, and desilylated to obtain compound 122. As described above, the conversion to hydroxylamine employs trimethylsilyl-O-hydroxylamine, and the conversion into the Alkoxyamine employs trialkylsilyl-O-methoxyamine in place of trimethylsilyl-O-hydroxylamine. Of course, it will be understood that the 7-iodo substituent itself is a compound of this invention, as well as an intermediate in the synthesis of other compounds. Similarly, the 7-acetylenyl substituent can be derivatized, for example, by hydrogenation, to provide the corresponding vinyl compound (not detailed). Scheme 7 The boronic substituents in the 7-position are prepared according to Scheme 8 below. These methods used to prepare compound 125 are similar to those described for the preparation of compound 106 in Scheme 4 above. As previously stated, it will be understood that the 7-iodo substituent itself is a compound of this invention, as well as an intermediary in the synthesis of other compounds. The conversion of compound 125 to the boronic acid derivative can be carried out using methods known in the art. For example, by reacting it with an excess of KOAc (approximately 3 eq.) In the presence of approximately 3 mol% of (Ph3) 2PdCl2 and approximately 1.2 eq. Bis (neopenty glycoate) diboro, in an inert solvent, such as DMSO (0.15 M). This reaction develops at about 65 ° C until it is complete. Scheme 8 UTILITY, EVALUATION AND ADMINISTRATION Utility The present invention provides novel compounds that possess antiviral activity, including activity against the hepatitis C virus. The compounds of this invention inhibit the replication of HCV by inhibition of the enzymes involved in replication, including RNA RNA-dependent polymerase. They can also inhibit other enzymes used in the activity or proliferation of HCV. The compounds of the present invention can also be used as prodrug products. As such they are captured by the cells and can be phosphorylated intracellularly by kinases in the triphosphate and then act as polymerase inhibitors (NS5b) and / or act as chain terminators. The compounds of this invention can be used alone or in combination with other compounds to treat viruses. Administration and pharmaceutical compositions In general, the compounds of this invention will be administered in an amount effective for therapeutic use by any of the accepted modes of administration for agents serving similar utilities. The actual amount of the compound of this invention, ie, the active ingredient, will depend on numerous factors, such as the severity of the disease to be treated, the age and relative state of health of the subject, the potency of the compound used, the route and manner of administration, and other factors. The drug can be administered more than once a day, preferably once or twice a day. The amounts effective for therapeutic use of the compounds of the present invention may vary in a range between about 0.05 and 50 mg per kilogram of body weight of the receptor per day; preferably about 0.01-25 mg / kg / day, more preferably between about 0.5 and 10 mg / kg / day. Accordingly, for administration to a 70 kg person, the dosage range would be more preferably about 35-70 mg per day. In general, the compounds of this invention will be administered as pharmaceutical compositions by any of the following routes: oral, systemic (e.g., transdermal, intranasal or suppository) or parenteral (e.g., intramuscular, intravenous or subcutaneous) administration. The preferred mode of administration is the oral route using a convenient daily dosage regimen that can be adjusted according to the degree of the disease. The compositions can take the form of tablets, pills, capsules, semi-solids, powders, sustained-release formulations, solutions, suspensions, elixirs, aerosols or any other suitable composition. Another preferred way of administering the compounds of this invention is inhalation. This is an effective method for administering a therapeutic agent directly in the respiratory tract, in particular for the treatment of diseases such as asthma, and similar or related respiratory tract disorders (see US Patent No. 5607915). The choice of formulation depends on various factors, such as the mode of administration of the drug and the bioavailability of the drug. For administration by inhalation, the compound can be formulated as a liquid solution, suspensions, aerosol propellants or dry powder, and then loaded into a suitable dispenser for administration. There are several types of pharmaceutical inhalation elements such as nebulizer-inhaler devices, metered-dose inhalers (MDI) and dry powder inhalers (DPI). The nebulizer devices produce a high velocity airflow that causes the therapeutic agents (formulated in a liquid form) to atomize like a mist that is transported to the inside of the patient's airway. The formulation for MDIs is typically packaged with a compressed gas. With the drive, the device discharges a measured quantity of the therapeutic agent by the compressed gas, which allows a reliable method of administration of a defined amount of agent. The DPIs administer the therapeutic agents in the form of a free-flowing powder that can be administered to the patient's inspiratory airflow during respiration with the device. In order to obtain a free flowing powder, the therapeutic agent is formulated with an excipient such as lactose. A measured amount of the therapeutic agent is stored in the form of a capsule and is administered with each actuation. Recently, special pharmaceutical formulations have been developed for drugs that have a poor bioavailability based on the principle that bioavailability can be increased by an increase in surface area, that is, by decreasing the particle size. For example, in U.S. Pat. No. 4,107,288 describes a pharmaceutical formulation containing particles in a size range between 10 and 1,000 nm in which the active material is on a support of a matrix of intertwined macromolecules. In U.S. Pat. No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug is sprayed into nanoparticles (average particle size of 400 nm) in the presence of a surface tension modifier and then dispersed in a liquid medium for get a formulation pharmaceutical that exhibits a remarkably high bioavailability. The compositions are generally composed of a compound of the present invention in combination with at least one excipient acceptable for pharmaceutical use. The acceptable excipients are non-toxic administration aids and do not adversely affect the therapeutic benefit of the compound of the present invention. Said excipient can be any solid, liquid, semisolid or, in the case of an aerosol composition, a gaseous excipient which is generally known to the person skilled in the art. Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silicon gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, skimmed milk powder and similar. Liquid and semi-solid excipients may selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, for example, peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, in particular for injectable solutions, include water, saline, aqueous dextrose and glycols. Compressed gases can be used to disperse the compound of this invention in the form of an aerosol. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and formulations therewith are described in Remington's Pharmaceutical Sciences, edited by E.W. Martin (Mack Publishing Company, 18th ed., 1990). The amount of compound in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt%) basis, approximately 0.01-99.99% by weight of a compound of the present invention based on the total formulation, taking up volume with one or more suitable pharmaceutical excipients. Preferably, the level of compound present comprises about 1-80% by weight. Pharmaceutical formulations Representative samples containing a compound of the present invention will be described below. Dosages and ranges of the compounds The amount of the composition administered in the therapy will depend on a number of factors, including, without limitation, the desired final concentration of compound, the pharmacokinetic and pharmacodynamic properties of the compound, the size of the patient, the physiological profile of the patient, and the like. The active compound is effective over a wide range of dosages, and is generally administered in an effective amount for therapeutic use. However, it will be understood that the compound amount administered will in fact be determined by a physician, in light of the relevant circumstances, including the condition to be treated, the route of administration selected, the compound administered, the age, the weight and the response. of the individual patient, the severity of the patient's symptoms, and the like. The determination of the dosages is within the empirical knowledge of those trained in the technique; even so, it can be appreciated that estimates of the final dosages can be made by approximating the concentration of compound necessary to achieve a proteasomic, anti-proliferative inhibition activity, anti-cancer or anti-inflammatory, such as the activities previously described. Additional refinements of this dose estimate can be made on the basis of activity in one or more preclinical models, such as the animal models presented in Example 16 of this documentation. Extrapolation to a specified range for mammals, or more particularly, a range for humans, is within the knowledge of the manager. Typically, the amount of a single administration of a composition of the present invention may be between about 0.1 and about 1000 mg per kg of body weight, or between 0.5 and about 10000 mg per day. Any of these doses can be further subdivided into separate administrations, and multiple dosages can be provided to any individual patient. In some embodiments, compositions are administered in a single formulation dosage, and in other embodiments, compositions are administered in multiple dosages of a single formulation within a specified period of time. In some embodiments, the time period is between about 3 hours and about 6 hours. In other embodiments, the period of time is between approximately 6 hours and 12 hours. In other emments, the time period is between about 12 hours and 24 hours. In still other emments, the time period is between about 24 hours and 48 hours. The administration of separate formulations can be simultaneous or in stages, over a specific period of time, in order to administer all the ingredients within the specific time period. EXAMPLES In the following examples, as well as throughout the application, the following abbreviations have the meaning indicated below. If they are not defined, the terms have the meaning that is accepted in general. AcOH or HOAc = Acetic acid AC20 = Acetic anhydride atm = Atmosphere CAN = Ceric ammonium nitrate cm = Centimeter d = Double dd = Doublet of doublets dec = Decomposition DCB = 2,4-dichlorobenzyl DCC = N, N-dicyclohexyl caramide DCM = dichloromethane DMAP = dimethylaminopyridine DMEM = Dulbecco's Modified Eagle Minimal Medium DMF = Dimethylformamide DMSO Dimethylsulfoxide DTT Dithiothreitol EDTA = Ethylenediaminetetraacetic acid eq. or equiv. = equivalents g = gram h = hour HCV Hepatitis C virus HPLC High pressure liquid chromatography IPTG isopropyl-b-D-thiogalactopyranoside IU International units kb kilobase kg kilogram L liters m multiplet M molar mg milligrams mi or mi milliliter mM = millimolar mmol = millimol MS = Mass spectrum ng = nanograms nm = nanometers nM = nanomolar NBS = N-bromosuccinimide NIS = N-iodosuccinimide NMR = nuclear magnetic resonance NTA = Nitriltriacetic acid NTP = Nucleotide triphosphate RP HPLC = High liquid chromatography reverse phase pressure s = singlet TBAF = tetrabutylammonium fluoride TFA = trifluoroacetic acid THF = tetrahydrofuran m = melting temperature μL = microliters v / v = volume in volumem + t% = weight percentage μg = micrograms μM = micromolar In addition, all reaction temperatures are in Celcius degrees, unless otherwise indicated, and all percentages are molar percentages, again unless otherwise indicated. Example 1 Preparation of the intermediate l-0-methyl-2-methyl-3,5-bis-0- (2,4-dichlorobenzD-β-D-ribosfuranose Step 1: Preparation of l-O-methyl-2, 3, 5-tris-O- (2,4-dichlorobenzyl) -g-D-ribofuranose The title compound is synthesized using the methods described in Martin, P.; Helv. Chim. Acta, 1995, 78, 486, starting with commercially available D-ribose. Step 2: "Preparation of l-methyl-3, 5-bis-O- (2,4-dichlorobenzyl) -ff-D-ribofuranose To a solution of the product from Step 1 (171.60 g, 0.2676 mol) In 1.8 L of CH2C12 cooled to 0 ° C, a tin chloride solution (31.522 mL, 0.2676 mol) in 134 mL of CH2C12 was added dropwise with stirring. the solution at 3 ° C for 27 hours, another 5.031 ml of SnCl4 (0.04282 mol) was added and the solution was kept at 3 ° C overnight. After 43 hours, the reaction was set up by carefully adding the solution to 1.9 1 of a saturated solution of NaHCO3. The tin salts were removed by filtration through celite, after which the organic phase was isolated, dried with MgSO 4 and evaporated in vacuo. The dark yellow crude oil yield was 173.6 g, which contains 2,4-dibenzoyl chloride. The crude oil was used directly in the next step, without further purification. Step 3: Preparation of l-0-methyl-2-oxo-3,5-bis-O- (2,4-dichlorobenzyl) -ff-D-ribofuranose To an ice cooled suspension of Dess-Martin periodinane (106 , 75 g, 0.2517 mol) in 740 ml of anhydrous CH2C12 under argon, a solution of the product from Step 2 above was added in 662 ml of anhydrous CH2C12, dropwise for 0.5 hours. The reaction mixture was stirred at 0 ° C for 0.5 hours and then at room temperature for 6 days. The mixture was diluted with 1.26 1 of anhydrous Et20 and poured into an ice-cooled mixture of Na2S2035H20 (241.2 g, 1.5258 mol) in 4.7 l of saturated aqueous NaHCO3. The layers were separated and the organic layer was washed with 1.3 1 of saturated aqueous NaHCO 3, 1.7 1 of water and 1.3 1 of solution saline saline, dried with MgSO 4, filtered and evaporated to obtain the desired compound. This compound (72.38 g, 0.1507 mol) was used without further purification in the next step. Step 4: Preparation of the title compound A solution of MeMgBr in 500 ml of aqueous Et20 at 55 ° C was added dropwise to a solution of the product from Step 3 above (72.38 g, 0.1507 mol), also in 502 my anhydrous Et20. The reaction mixture was allowed to warm to -30 ° C and stirred mechanically for 4 hours between -30 ° C and -15 ° C, then poured into 2 1 of ice-cooled water. After stirring vigorously at room temperature for 0.5 hours, the mixture was filtered through a plug of Celite. (14 x 5 cm), which was exhaustively washed with Et20. The organic layer was dried with MgSO 4, filtered and concentrated in vacuo. The residue was dissolved in hexanes (approximately 1 ml per crude gram), applied to a column of silica gel (1.5 1 silica gel in hexanes) and eluted with hexanes and [4: 1 hexanes: acetate ethyl, v / v] to obtain 53.58 g (0.1080 mol) of the final purified product. The morphology of the title compound was that of a viscous yellowish oil. MS: m / z 514.06 (M + NH4 +).

Example 2 Preparation of l- (6-Hydroxylamino-7-ethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose Step 1: Synthesis of 6-chloro-7-iodo-7-deazapurine: 6-Chloro-7-deazapurine 10.75 g (70 mmol) and N-iodosuccinimide (16.8 g, 75 mmol) was dissolved in 400 ml of dry DMF, and left at room temperature in the dark overnight. The solvent was evaporated. The dark residue was distributed between 500 ml of ethyl acetate and 150 ml of 10% Na 2 SO 3. The organic fraction was washed with 10% Na 2 SO 3 (2 x 100 mL), saline (150 mL), dried over Na 2 SO 4 and evaporated. The yellow residue was crystallized from ethanol to obtain 16.2 g (83%) of the title compound as off-white crystals. The mother liquor was evaporated, dissolved in toluene and purified by flash chromatography on silica gel (7 4 cm). The column was washed with toluene until the eluent was colorless, then the title compound was eluted with 5% ethyl acetate in toluene to obtain another 3.5 g of the title product. The total yield is 98%. Tm 212-214 (dec) UV? Max: 307, 266, 230, 227 nm (methanol) MS: 277.93 (M-H), 313 (M + Cl) XH-NMR (DMS0-d6): d 12.94 (s, 1H, NH), 8.58 (s, 1H, H-2), 7.94 (S, 1H, H-8) Step 2: Synthesis of 6-chloro-7-trimethylsilanylethynyl-7-deazapurine •• The heterocycle obtained in Step 1 above (16 g, 64.25 mmol) was dried by co-evaporation with dry DMF (2 x 50 mL) and dissolved in a mixture of DMF / THF (800 ml, 1: 3 v / v). Triethylamine (8.33 ml, 0.93 equiv.), Cul (4.9 g, 0.4 equiv.) And (trimethylsilyl) acetylene (54.5 ml, 6 equiv.) Was added. The flask was filled with Ag, then (Ph3) Pd (7.4 g, 0.1 equiv.) Was added and the mixture was left overnight at room temperature. The solvent was evaporated; the dark residue was distributed between 1000 ml of ethyl acetate and 300 ml of water. The organic fraction was washed with saline (2 x 150 ml), dried over Na 2 SO 4 and concentrated to a volume of 200 ml. Dry silica gel was added to the solution (approximately 400 ml) and the mixture was evaporated to dryness. The silica gel containing the reaction mixture was charged to the filter containing the silica gel in toluene (6 x 13 cm, approximately 1000 ml of silica gel). The filter was washed with toluene until the eluent became colorless; the compound was eluted with toluene / ethyl acetate (9: 1 v / v, 51). The solvent was evaporated and the composed of acetone / hexane. The title compound was obtained by recrystallization from methanol. The 9.8 g of the first harvest were obtained as brown crystals, the second crop consisted of 2.3 g, also of brown crystals. Total yield: 12.1 g (85%). Tm 217-220 (dec) UV? Max: 311, 245, 239, 231 nm (methanol) MS: 248, 07 (MH), XH-NMR (DMS0-d6): d 12, 92 (s, 1H, NH), 8, 60 (s, 1H, H-2), 8, 06 (s, 1H, H- 8) Step 3: Synthesis of 1- (6-chloro-7-trimethylsilanylethynyl-7-deazapurin-9-yl) -2-methyl-3, 5-di (-0-2, 4-dichlorobenzyl) -β-D -ribofuranose: The base, obtained as described in Step 2 above (9.8 g, 39 mmol), was suspended in 600 ml of CH3CN, NaH was added (1.6 g, 39 mmol, 60% in oil ) and the reaction mixture was stirred at room temperature to form a clear solution (approximately 1 hour). L-O-methyl-2-methyl-3,5-di (-0-2,4-dichlorobenzyl) -β-D-ribofuranose (10 g, 20 mmol) was dissolved in 500 ml of DCM and cooled to 4 ml. ° C in an ice / water bath. HBr / AcOH (30 ml) was added dropwise, the reaction mixture was kept in the bath for an additional 1 hour, the solvents and co-evaporated with dry toluene (2 x 50 ml), always keeping the temperature below 25 ° C. The dark residue was dissolved in CH3CN (100 ml) and added to the Na salt solution of the base. The reaction was maintained overnight at room temperature. The solvent was evaporated and the dark residue was distributed between 1000 ml of ethyl acetate and 300 ml of a 5% citric acid solution. The organic fraction was washed with water (150 ml), saline (150 ml), dried over Na 2 SO 4 and concentrated to a volume of 200 ml. Dry silica gel was added to the solution (approximately 400 ml) and the mixture was evaporated to dryness. The silica gel containing the reaction mixture was loaded onto a column (5 x 20 cm) filled with hexane. The column was washed with 10% EtOAc in hexane to elute the first side product, 6-chloro-7-trimethylsilanylethynyl-9- (2,4-dichlorobenzyl) -7-deazapurine; then the title compound was eluted. Elution was continued with 20% EtOAc / hexane to recover the unreacted base as white crystals. The yield of the title compound was 10.9 g, 76% as a brown foam. %? L-NMR (DMSO-d6): d 8.75 (s, 1H, H-2), 8.20 (s, 1H, H-8), 7.63-7.38 (m, 6H, dichlorophenyl), 6.22 (s, 1H, H-1 '), 5.65 (s, 1H, H-3'), 4.80-4.45 (m, 4H, CH2-benzyl, 2'- OH, H-4 '), 4.21 (S, 2H, CH2-benzyl), 3.97 and 3.80 (dd, 1H, H-5 '), 0.92 (s, 3H, 2'-methyl), 0.23 (s) , 9H, Si (CH3) 3) Step 4: Synthesis of 1- (6-chloro-7-trimethylsilanylethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose: To the solution of the compound of the Preceding (5.4 g, 7.5 mmol) in DCM (200 mL) at -78 ° C, boron trichloride (1 M in DCM, 88 mL, 88 mmol) was added dropwise. The mixture was stirred at -78 ° C for 2.5 hours, and additionally for 3 h between -20 and -30 ° C. The reaction was set up by adding methanol / DCM (90 ml, 1: 1) and the reaction mixture was stirred at -20 ° C for 30 minutes, then neutralized with aqueous ammonium at the same temperature. The solid was filtered and filtered with methanol / DCM (250 ml, 1: 1). The combined filtrates were evaporated and the residue was purified by chromatography on silica gel, using chloroform and then chloroform / methanol, between 2% and 10% as a step gradient, for elution. The desired compound was obtained as a yellowish foam, with a yield of 2.2 g (75%). aH-NMR (DMSO-d6 d, 70 (s, 1H, H-2), 8.45 (s, 1H, H-8), 6.21 (s, 1H, H-1 '), 5.40 -5.20 (m, 3H, sugar), 4.00-3.60 (m, 4H, sugar), 0.84 (s, 3H, 2'-methyl), 0.23 (s, 9H, Si (CH3) 3) Step 5: Synthesis of 1- (6-hydroxylamino-7-ethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose: The 6-chloro nucleoside from Step 4 above was dissolved (300 mg , 1 mmol) in dry ethanol, trimethylsilyl-O-hydroxylamine (300 mg) was added and the reaction mixture was refluxed for 5 hours. The reaction was monitored by LC-MS. When no further nucleoside was detected, the mixture was cooled to room temperature, neutralized with HCl / dioxane and evaporated to dryness. The residue was purified by RP HPLC, between 0% and 100% B in 20 minutes. A: 0.05% TFA in water, B: 0.05% TFA in acetonitrile, flow rate: 10 ml / minute. The first peak was collected and evaporated to dryness. The residue was dissolved in methanol, 200 μl of HCl / dioxane was added and the solvents were evaporated. The residue was dissolved in 3 ml of methanol and precipitated with 35 ml of ether to obtain 150 mg (50%) of the title compound as an off-white powder. MS: 321.11 (M + H) XH-NMR (DMSO-d6): d 0.86 (s, 3H, CH 3); 5.99 (s, 1H, H-1 '); 7.88 and 7.92 (s, 1H, base).

Example 3 Preparation of 1- (6-hydroxylamino-7-ethenyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose 1- (6-hydroxylamino-7-ethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (Example 2) is dissolved in THF and placed under hydrogen (1 atm), in the presence of a Lindlar catalyst, until one mole of hydrogen is consumed to provide the title compound. BIOLOGICAL EXAMPLES Example 1. Anti-hepatitis C activity Compounds may exhibit anti-hepatitis C activity by inhibition of HCV polymerase, by inhibition of other necessary enzymes in the replication cycle or by other routes. Numerous trials have been published to evaluate these activities. A general method for evaluating the total increase of the HCV virus in culture is described in U.S. Pat. No. 5,738,985 to Miles et al. In vitro assays are described in Ferrari et al. Jnl. of Vir. , 73: 1649-1654, 1999; Ishii et al., Hepatology, 29: 1227-1235, 1999; Lohmann et al., Jnl de Bio. Chem., 274: 10807-10815, 1999; and Yamashita et al., Jnl. of Bio. Chem., 273: 15479-15486, 1998. In WO 97/12033, filed on September 27, 1996, by Emory University, with C. Hagedorn and A. Reinoldus as inventors, claiming the priority benefit for the US Provisional Patent Application No. 60 / 004,383, filed in September 1995, describes an assay with the HCV polymerase that can be used to evaluate the activity of the compounds described in this documentation. Another assay with the HCV polymerase was described by Bartholomeusz, et al., Hepatitis C Virus (HCV) RNA polymerase assay using cloned HCV non-structural proteins; Antiviral Therapy 1996: 1 (Suppl 4) 18-24. Tests that measure reductions in kinase activity by HCV drugs are described in U.S. Pat. No. 6,030,785, to Katze et al., In U.S. Pat. No. 6,228,576, Delvecchio, and in U.S. Pat. N °: 5,759,795 to Jubin et al. The tests that measure the protease inhibitory activity of the proposed HCV drugs are described in U.S. Pat. No. 5,861,267 to Su et al., In U.S. Pat. N °: ,739,002 of De Francesco et al., And in U.S. Pat. No. 5,597,691 to Houghton et al. Example 2. Replicon assay The cell line, ET (Huh-lucubineo-ET), is used to evaluate the compounds of the present invention with the RNA-dependent RNA polymerase of HCV. The ET cell line is stably transfected with RNA transcripts containing I389luc-ubi-neo / NS3-3 '/ ET; a replicon with the fusion protein of firefly luciferase-ubiquitin-neomycin phosphotransferase and EMCV-IRES directed by the polyprotein NS3-5B containing the adapter mutations for cell culture (E1202G; T1280I; K1846T) (Krieger et al, 2001; published) . ET cells are cultured in DMEM supplemented with 10% fetal bovine serum, 2 mM glutamine, penicillin (100 IU / ml) / streptomycin (100 μg / ml), non-essential L-amino acids lx and 250 μg / ml G418 ("Geneticin "). All can be purchased from Life Technologies (Bethesda, MD). The cells were plated at a rate of 0.5-1.0 x 10 4 cells / well in 96-well plates and incubated for 24 hours before the addition of the nucleoside analogues. The compounds were then added to the cells, each at a concentration of 5 and 50 μM. The luciferase activity will be measured 48-72 hours later by adding a lysis buffer and the substrate (Catalog No. Glo E2661 Lysis Buffer and Bright-Glo E2620 Luciferase System, Promega, Madison, Wl). The cells should not be too confluent during the test. Percent inhibition of replication will be plotted in relation to a control without compound. Under the same conditions, the cytotoxicity of the compounds will be determined using the cell proliferation reagent, WS T-1 (Roche, Germany). Compounds that exhibit antiviral activity, but without significant cytotoxicity, are selected for IC50 and TC50. Example 3. Cloning and expression of recombinant HCV-NS5b The cloning sequence of the NS5b protein was cloned by PCR from pFKI389luc / NS3-3 '/ ET described by Lohmann, V., et al. (1999) Science 285, 110-113 using the following primers: aggacatggatccgcggggtcgggcacgagacag (SEQ ID NO: 1) aaggctggcatgcactcaatgtcctacacatggac (SEQ ID NO: 2) The cloned fragment lacks 21 terminal C amino acid residues. The cloned fragment is inserted into the IPTG-inducible expression plasmid which provides a (His) 6 epitope tag at the carboxyl-terminal end of the protein. The recombinant enzyme is expressed in XL-1 cells and after induction of expression, the protein is purified using affinity chromatography on a nickel-NTA column. Storage conditions comprise 10 mM Tris-HCl pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 20% glycerol at -20 ° C. Example 4. Enzyme assay HCV-NS5b Polymerase activity is evaluated by measuring the incorporation of radiolabelled UTP into an RNA product; using a poly-A template (1000-10000 nucleotides) and an oligo-U12 primer > Alternatively, a portion of the HCV genome is used as a template and radiolabelled GTP is used. Typically, the assay mixture (50 μl) contains 10 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.2 mM EDTA, 10 mM KCl, 1 unit / μl of siRNA, 1 mM DTT, 10 μM of each NTP, alpha- [32 P] -GTP, 10 ng / μl of polyA template and 1 ng / μl of oligoU primer. The test compounds were dissolved in water containing between 0 and 1% DMSO. Typically, compounds are evaluated at concentrations between 1 nM and 100 μM. The reactions are started by adding enzyme, and they are allowed to continue at room temperature or 30 ° C, for 1 to 2 hours. The reactions are set with 20 μl of 10 mM EDTA, and the reaction mixtures (50 μl) are transferred to a DE81 filter disc to capture the radiolabelled RNA products. After washing with 0.5 mM Na2HP04 (3 times), water (1 time) and ethanol (1 time) to remove the NTP without incorporation, the discs are dried and the incorporation of radioactivity is determined by scintillation counting. EXAMPLES OF FORMULATION The following formulations are representative pharmaceutical formulations containing a compound of formulas IV or IV A Example 1: Formulation in tablets The following ingredients were thoroughly mixed and compressed into simple scored tablets. Ingredient Amount per tablet, mg Compound of this 400 invention Corn starch 50 Croscarmellose sodium 25 Lactose 120 Magnesium stearate 5 Example 2: Formulation in capsules The following ingredients were thoroughly mixed and loaded into hard gelatin capsules.

Ingredient Quantity per capsule, mg Compound of this invention 200 Lactose, spray-dried 148 Magnesium stearate 2 Example 3: Formulation of suspensions The following ingredients are mixed to form a suspension for oral administration.

Ingredient Amount Compound of this invention 1.0 g Fumaric acid 0.5 g Sodium chloride 2.0 g Methyl paraben 0.15 g Propyl paraben 0.05 g granulated sugar 25.0 g Sorbitol (70% solution) 13 , 00 g Vee K gum (Vanderbilt Co.) 1.0 g Flavor 0.035 ml Dyes 0.5 mg Distilled water cs until completing 100 mi Example 4: Injectable formulation The following ingredients are mixed to form an injectable formulation.

Ingredient Amount Compound of this invention 0.2 mg-20 mg Buffer solution of 2.0 ml sodium acetate, 0.4 M HCl (1 N) or NaOH (1 N) q.s. for an adequate pH Water (distilled, sterile) q.s. up to 20 mi Example 5: Formulation of suppositories A suppository of a total weight of 2.5 g is prepared by mixing the compound of the invention with Witepsol® H-15 (triglycerides of saturated vegetable fatty acids; Riches-Nelson, Inc., New York), and has the following composition: Ingredient Amount Compound of the invention 500 mg Witepsol® H-15 Balance From the foregoing description, those skilled in the art will be able to devise various modifications and changes for the described invention. All these modifications within the scope of the Attachments are included in this documentation.

REFERENCES The following publications are cited in this application with superscript numbers: 1. Chen, et al. , Med. Assoc, 95 (1): 6-12 (1996) 2. Cornberg, et al. , "Hepatitis C: therapeutic perspectives." Forum (Genova), ll (2): 154-62 (2001) 3. Dymock, et al., Antivir. Chem. Chemother. 11 (2): 79-96 (2000) 4. Devos, et al. , International Patent Application No. WO 02/18404 A2, published March 7, 2002 5. Sommadossi, et al. , International Patent Application No. WO 01/90121, published May 23, 2001 6. Carroll, et al. , International Patent Application No. WO 02/057425 7. Seela, F .; Steker, H., Liebigs Ann. Chem., P. 1576 (1983). 8. Li, N-.S .; Tang, X.-Q .; Piccirilli, J. A., Organic Letters, 3 (7) -.1025 (2001).

Claims (13)

1. NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and, therefore, the content of the following is claimed as property: CLAIMS: 1. A compound characterized in that it has the following formula I: wherein: W, W1 and W2 are independently selected from the group consisting of hydrogen and an acceptable prodrug for pharmaceutical use; R is selected from the group consisting of hydrogen or (C? -C3) alkyl; R1 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl and substituted alkynyl; And it is a link, -CH2- or -0-; Y1 is selected from the group consisting of hydrogen, halo, hydroxyl, thioalkyl, amino and substituted amino; Z is selected from the group consisting of formyl, -B (OH) 2, nitro, alkenyl, substituted alkenyl, acetylenyl and substituted acetylenyl of formula -C = C-R4; R 4 is selected from the group consisting of hydrogen, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, -Si (R 8) 3, carbsxyl, carboxylic esters and -C (0) NR 6 R 7, wherein R 6 and R 7 are independently hydrogen, alkyl, or R6 and R7, together with the nitrogen atom to which they are attached, are combined to form a heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl group; each R8 is independently (C? -C4) alkyl or phenyl; or salts thereof acceptable for pharmaceutical use.
2. 2. A compound characterized in that it has the following formula I: wherein: W, W1 and W2 are independently selected from the group consisting of hydrogen and an acceptable prodrug for pharmaceutical use; R is selected from the group consisting of hydrogen or (C? -C3) alkyl; R1 is selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl and substituted alkynyl; And it is a link, -CH2- or -0-; Y 'is selected from the group consisting of hydrogen, halo, hydroxyl, thioalkyl, amino and substituted amino; Z is selected from the group consisting of formyl, halo, -B (OH) 2, nitro, alkenyl, substituted alkenyl, acetylenyl and substituted acetylenyl of formula -C = C-R4; R4 is selected from the group consisting of hydrogen, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, -Si (R8) 3, carboxyl, carboxylic esters and -C (0) NR6R7, where Rd and R7 are independently hydrogen, alkyl, or R6 and R7, together with the nitrogen atom to which they are attached, are combined to form a heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl group; each R8 is independently (C? -C4) alkyl or phenyl; or salts thereof acceptable for pharmaceutical use.
3. 3. A compound according to claim 1 or 2, characterized in that W is selected from the group consisting of hydrogen, monophosphate, diphosphate and triphosphate.
4. 4. A compound according to claim 1 or 2, characterized in that W1 and W2 are independently hydrogen or acyl.
5. 5. A compound according to claim 4, characterized in that W1 and W2 is an acyl group selected from the group consisting of acetyl, trimethylacetyl and acyl groups derived from amino acids.
6. 6. A compound characterized in that it has formula II II wherein: W is selected from the group consisting of hydrogen and an acceptable prodrug for pharmaceutical use; R is selected from the group consisting of hydrogen or (C1-C3) alkyl; Z is selected from the group consisting of formyl, -B (OH) 2,, nitro, alkenyl, substituted alkenyl, acetylenyl and substituted acetylenyl of formula -C = C-R4; R4 is selected from the group consisting of hydrogen, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, -Si (R8) 3, carboxyl, carboxylic esters and -C (0) NR6R7, wherein R6 and R7 are independently hydrogen, alkyl, or R6 and R7, together with the nitrogen atom to which they are attached, are combined to form a heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl group; each R8 is independently (C1-C4) alkyl or phenyl; or salts thereof acceptable for pharmaceutical use.
7. 7. A compound according to claim 6, characterized in that W is selected from the group consisting of hydrogen, monophosphate, diphosphate and triphosphate.
8. A compound according to claim 1 or claim 6, characterized in that Z is selected from the group consisting of formyl, nitro, acetylenyl and substituted acetylenyl of formula -C = C-R4, where R2, R3 and R4 are as they were previously defined.
9. 9. A compound according to claim 8, characterized in that Z is selected from formyl, nitro, and -C = C-R4 and R4 is selected from H, phenyl, and -Si (CH3) 3.
10. 10. A compound characterized in that it is selected from the group consisting of: 1- (6-hydroxylamino-7-ethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (1); 1- (6-hydroxylamino-7- (2-phenyletin-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (2); 1- (6-hydroxylamino-7- (2- (pyridin-2-yl) -etin-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (3); 1- (6-hydroxylamino-7- (2- (4-fluorophenyl) ethyn-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (4); 1- (6-hydroxylamino-7- (2- (4-methylphenyl) ethyn-1-yl) -7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (5); 1- (6-hydroxylamino-7- (2-carboxylin-l-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (6); 1- (6-hydroxylamino-7- (2-ethylcarboxiletin-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (7); 1- (6-hydroxylamino-7- (2-carboxamidoetin-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (8); 1- (6-hydroxylamino-7- (2-trimethylsilylethin-1-yl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (9); 1- (6-hydroxylamino-7-ethenyl-7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (10); 1- (6-hydroxylamino-7-formyl-7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (11); 1- (6-hydroxylamino-7- (boronic acid) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (13); 1- (6-hydroxylamino-7- (2, 2-difluorovinyl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (14); 1- (6-hydroxylamino-7- (2-cis-methoxyvinyl) -7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (15); 1- (6-hydroxylamino-7-nitro-7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (16); 1- (6-methoxyamino-7-ethynyl-7-deazapurin-9-yl) -2-methyl-β-D-ribofuranose (18); 1- (6-methoxyamino-7-nitro-7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (19); 1- (6-methoxyamino-7-formyl-7-deaza-purin-9-yl) -2-methyl-β-D-ribofuranose (20); and salts thereof acceptable for pharmaceutical use.
11. 11. Pharmaceutical compositions characterized in that they comprise a diluent acceptable for pharmaceutical use and an effective amount for the therapeutic use of a compound according to any of claims 1, 6 and 10.
12. 12. A method for treating a viral infection mediated at least in part by a virus of the flaviviridae virus family in mammals, characterized in that it comprises administering to a mammal, which has been diagnosed with said viral infection or is at risk of developing said viral infection, a pharmaceutical composition comprising a diluent acceptable for pharmaceutical use and an effective amount for the therapeutic use of a compound of any of claims 1, 6 and 10.
13. 13. The method of claim 12, characterized in that said virus is HCV.