MXPA06004664A - Nucleoside compounds for treating viral infections - Google Patents

Abstract

Disclosed are compounds, compositions and methods for treating viral infections caused by a flaviviridae family virus, such as hepatitis C virus.

Description

NUCLEOSID COMPOUNDS FOR THE TREATMENT OF VIRAL INFECTIONS FIELD OF THE INVENTION The invention relates to methods for preparing particular compounds for the treatment of viral infections in mammals caused, at least in part, by a virus of the family of flaviviridae viruses. This invention also addresses the novel intermediates used in these methods.

BACKGROUND OF THE INVENTION The family Flaviviridae virus is composed of three genera: pestivirus, flavivirus and hepacivirus (hepatitis C virus). Of these genera, flaviviruses and hepaciviruses represent important pathogens in man and are prevalent worldwide. There are 38 flaviviruses associated with human diseases, including dengue fever virus, yellow fever virus and Japanese encephalitis virus. Flaviviruses cause a variety of acute febrile conditions and encephalitic and hemorrhagic diseases. Hepaciviruses infect approximately 2 to 3% of the world population and cause persistent infections that lead to chronic liver disease, cirrhosis, hepatocellular carcinoma and hepatic deficiency. Human pestiviruses have not been extensively characterized as pestiviruses in animals. However, serological studies indicate considerable exposure to pestiviruses in humans. Pestivirus infections in man have been implicated in several diseases, among which include: congenital brain injury, infantile gastroenteritis and chronic diarrhea in patients positive for human immunodeficiency virus (HIV) .1-6 Currently , there are no antiviral pharmaceutical drugs to prevent, or treat infections by pestivirus or flavivirus. For hepaciviruses, that is, hepatitis C virus (HCV) infections, alpha interferon (IFN) is currently the only drug approved in the United States. HCV is the main causative agent of hepatitis that 'is not A, nor B, after transfusions and sporadic. HCV infection is insidious in a high proportion of chronically infected (and infectious) carriers who may not experience clinical symptoms for many years. Currently, the only acceptable treatment for chronic HCV is interferon (IFN-alpha) and this requires at least six (6) months of treatment and / or ribavirin that can inhibit viral replication in infected cells and also improve liver function in some people. . IFN-alpha belongs to a family of small proteins that occur in nature with characteristic biological effects such as, for example, antiviral, immunoregulatory and antitumor activities that are produced and secreted by most of the nucleated cells in animals in response to diverse diseases, in particular viral infections. IFN-alpha is an important regulator of growth and differentiation that affect cell communication and immune control. The treatment of HCV with interferon, however, has a limited long-term efficacy with a response rate of approximately 25%. . In addition, treatment of HCV with interferon has been frequently associated with adverse side effects such as, for example, fatigue, fever, chills, headache, myalgias, arthralgias, mild alopecia, psychiatric effects and associated disorders, autoimmune phenomena and associated disorders and dysfunction of the thyroid. Ribavirin (1-β-D-ribofuranosyl-lH-1,2,4-triazole-3-carboxamide), an inhibitor of inosine 5'-monophosphate dehydrogenase (IMPDH), enhances the efficacy of IFN-alpha in the treatment of HCV. Despite the introduction of ribavirin, more than 50% of patients do not eliminate the virus with the current standard therapy of alpha interferon (IFN) and ribavirin. For now, the standard therapy of chronic hepatitis C has been changed to the combination of PEG-IFN plus ribavirin. However, several patients still have significant side effects, mainly related to ribavirin. Ribavirin causes significant hemolysis in 10-20% of patients treated at currently recommended doses, and the drug is both teratogenic and embryotoxic. Other procedures are being carried out to combat the virus. They include, for example, the application of antisense oligonucleotides or ribozymes to inhibit the replication of HCV. In addition, low molecular weight compounds that directly inhibit HCV proteins and interfere with viral replication are considered attractive strategies for controlling HCV infection. Serine protease NS3 / 4A, ribonucleic acid helicase (RNA), and RNA-dependent RNA polymerase are considered potential targets for new drugs.7,8 Devos, et al.9 describes the pyrimidine nucleoside derivatives and pyrimidine and its use as inhibitors of HCV RNA replication. Sommadossi, et al.10 describes nucleosides 1 '. 2 'or 3' modified and their use for the treatment of a host infected with 'HCV. Carroll, et al.11.11, describes nucleosides as inhibitors of viral RNA polymerase RNA-dependent. Recently, Roberts, et al.13'14 exposed that certain compounds of 7- (2'-substituted-β-D-ribofuranosyl) -4-amino-5- (optionally substituted etin-1-yl) -pyrrolo [2, 3-d] pyrimidine possess a potent activity against HCV. These references are incorporated herein by reference in their entirety.

SUMMARY OF THE INVENTION This invention is directed to novel compounds that are useful in the. treatment, of viral infections in mammals caused at least in part by a virus of the flaviviridae virus family. Specifically, this invention is directed to the compounds of Formula I, wherein Y is selected from the group consisting of a bond, -CH2- or -0-; each of W, W1 and W2 is independently selected from the group consisting of hydrogen and a pharmaceutically acceptable prodrug; and T is selected from the group consisting of a) -C = C-R, wherein R is selected from the group consisting of i) tri (Ci-C4) alkylsilyl, -CiONO1! 2, alkoxyalkyl, heteroaryl, heteroaryl? substituted, phenyl, and phenyl substituted with 1 to 3 substituents selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl, carboxylester, cyano, cycloalkyl, substituted cycloalkyl, cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl, substituted heteroaryl, hydrazino, hydroxyl, nitro, thiol, and S (0) mR3; wherein R1 and R2 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic with the proviso that only one of R1 and R2 either amino or substituted amino, and further wherein R1 and R2, together with the pendant nitrogen atom thereof, form a substituted heterocyclic or heterocyclic; R3 is selected from the group consisting of alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic; and m. is an integer equal to 0, 1 or 2; ii) -C (0) OR14, wherein R14 is hydrogen, alkyl or substituted alkyl; b) -CH = CH-Q2 in • where Q2 is selected from hydrogen or cis-alkoxy; c) -C (0) H; d) -CH = NNHR15, wherein R15 is H or alkyl; e) '-CH = N (OR15), wherein R15 is as defined above; f) -CH (OR16) 2, wherein R16 is (C3-C6) alkyl; and g) -B (OR15) 2, wherein R15 is as defined above; and pharmaceutically acceptable salts or partial salts thereof. In a preferred embodiment, T is -C = CR and R is selected from the group consisting of tri (C_-C) alkylsilyl, -C (0) NR1R2, alkoxyalkyl, heteroaryl, substituted heteroaryl, phenyl and phenyl substituted with 1 to 3 substituents selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl, carboxylester, cyano, cycloalkyl substituted cycloalkyl, cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl, substituted heteroaryl, hydrazino, hydroxyl, nitro, thiol, and -S (0) mR3; wherein R1 and R2 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic with the proviso that only one of R1 and R2 either amino or substituted amino, and further wherein R1 and R2, together with the pendant nitrogen atom thereof, form a substituted heterocyclic or heterocyclic; R3 is selected from the group consisting of alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl / heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic; and m is an integer equal to 0, 1 or 2; or a pharmaceutically acceptable salt thereof. More preferably, R is selected from the group consisting of phenyl, -C (0) NH2, -Si (CH3) 3, pyrid-2-yl, 4-methoxyphenyl, and -CH (OCH2CH3) 2. In another preferred embodiment , T is -G = CR and R is -C (0) OH. In another preferred embodiment T is -C = C-R, R is - (C (O) OR14, and R14 is alkyl In another preferred embodiment T is -CH = CH-Q2, where Q2 is selected from hydrogen or cis-methoxy In another preferred embodiment T is -C (= 0) H. In another preferred embodiment T is -CH = NNHR15 wherein R15 is independently selected from the group consisting of hydrogen and alkyl In another preferred embodiment T is -CH = N (0R15) wherein R15 is independently selected from the group In another preferred embodiment T is -CH (OR16) 2 wherein R is independently (C3-C6) alkyl In another preferred embodiment T is -B (OR15) 2, wherein R15 is independently selected of the group consisting of hydrogen and alkyl In another preferred embodiment each of W1 and 2 is independently hydrogen or a pharmaceutically acceptable prodrug selected from the group consisting of acyl, oxyacyl, phosphonate, phosphate esters, phosphate, phosphonamidate, phosphorodiamidate, cyclic phosphorus, cyclic phosphoramidate, fos cyclic forodiamidate, phosphoramidate diester, and -C (0) CHR30NH2 wherein R30 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, heteroaryl and substituted hetefoaryl. Preferably, R30 is a side chain of an amino acid and more preferably is derived from an L-amino acid. Preferably, W is H, or W1 is H, or W2 is H. Most preferably, W and W1 are H, or W and W2 are H, or W1 and W2 are H. Even more preferred W, W1 and W2 H. In yet another preferred embodiment W1 and 2 are hydrogen and is hydrogen or a pharmaceutically acceptable prodrug selected from the group consisting of acyl, oxyacyl, phosphonate, phosphate esters, phosphate, phosphonamidate, phosphorodiamidate, phosphoramidate monoester, cyclic phosphoramidate, cyclic phosphorodiamidate. , phosphoramidate diester, and -C (O) CHR30NH2. In a particularly preferred embodiment, W1 and W2 are hydrogen and W is represented by the formula: wherein R30 is as defined above, R8 is hydrogen or alkyl and R10 is selected from the group consisting of alkyl, substituted alkyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic. In a preferred embodiment R30 is derived from an L-amino acid. In another particularly preferred embodiment, W and W2 are hydrogen and W1 is represented by the formula: R30 wherein R30 is as defined above. As in the above, R30 is preferably derived from an L-amino acid.

Table I • • 33-,, The compounds of this invention are either active as antiviral agents or are useful as intermediates in the preparation of antiviral agents as described herein. This invention is also directed to pharmaceutical compositions comprising a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound as described herein or mixtures of one or more of these compounds. This invention is still further directed to methods for the treatment of a viral infection caused at least in part by a virus of the family of flaviviridae viruses, such as for example HCV, in mammals, the methods comprising administering to a mammal , who has been diagnosed with viral infection or who is at risk of developing the viral infection, a pharmaceutical composition comprising a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound as described herein or mixtures of one or more of these compounds. In yet another embodiment of the invention, methods of treatment or to prevent viral infections in mammals are provided wherein the compounds of this invention are administered in combination with the administration of a therapeutically effective amount of one or more agents active against HCV. Agents active against HCV include ribavirin, levovirin, viramidine, limosine alpha-1, an inhibitor of serine protease NS3, and an inhibitor of inosine monophosphate dehydrogenase, interferon-alpha, pegylated interferon-alpha, alone or in combination with • ribavirin or levovirin. Preferably, the additional agent active against HCV is interferon-alpha or pegylated interferon-alpha alone or in combination with ribavirin or levovirin.

DETAILED DESCRIPTION OF THE INVENTION The invention is directed to compounds, compositions and methods for the treatment of flaviviridae viruses, such as, for example, infections by the hepatitis C virus. However, before describing this invention in detail, first the following terms will be defined: Definitions As used herein, the term "alkyl" refers to alkyl groups having from 1 to 6 carbon atoms, preferably from 1 to 3, and more preferably from 1 to 2 carbon atoms. carbon. This term is exemplified by groups such as, for example, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl, n-pentyl and the like. "Substituted alkyl" refers to an alkyl group having from 1 to 3, and preferably from 1 to 2, substituents selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, oxyacyl, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, * • substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic. "Alkoxy" refers to the group "alkyl-O-" which includes, by way of example, methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, t-butoxy, sec-butoxy, r_-pentoxy and similar. "Substituted alkoxy" refers to the group "substituted alkyl-0". "Alkoxyalkyl" refers to alkylene (alkoxy) n-alkylene (substituted alkoxy) n groups in which alkylene is a straight or branched chain alkylene group of 1 to 3 carbon atoms, alkoxy and substituted alkoxy is as defined in the present and n is an integer from 1 to 2. "Acyl" refers to the alkyl-C (O) -, alkyl-C (O) -substituted alkyl, alkenyl-C (O) -, alkenyl-C ( O) - 3'6 '• substituted, alkynyl-C (O) -, C (O) -substituted alkynyl, cycloalkyl-C (O) -, cycloalkyl-C (O) -substituted, aryl-C (O) -, aryl-C- ( ) -substituted, heteroaryl-C (0) -, heteroaryl-C (0) substituted, heterocyclic-C (0) -, and heterocyclic C (0) -substituted. "Acylamino" refers to the group -C (0) NR4R4 wherein each R4 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, cycloalkyl substituted, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and wherein each R 4 is attached to, together with the nitrogen atom, form a heterocyclic or substituted heterocyclic ring. "Acyloxy" refers to the groups alkyl-C (0) 0-, alkyl-C (0) 0-substituted, alkenyl-C (0) 0-, alkenyl-C (0) -substituted, alkynyl-C ( 0) 0-, C (O) O-substituted alkynyl, aryl-C (0) 0-, aryl-C (0) O-substituted, cycloalkyl-C (0) 0-, cycloalkyl-C (0) O -substituted, heteroaryl-C (0) 0-, heteroaryl-C (0) O-substituted, heterocyclic-C (O) 0-, and heterocyclic-C (0) O-substituted. "Oxyacil" refers to the groups alkyl-0C (0) -, alkyl-OC (O) -substituted, alkenyl-OC (0) -, alkenyl-OC- (0) -substituted, alkynyl-OC (0) - , alkynyl-OC- (O) -substituted, aryl-OC (0) -, aryl-OC- (0) -substituted, cycloalkyl-OG (O) -, cycloalkyl-OC- (0) -substituted, heteroaryl-OC (0) -, heteroaryl-OC- (O) -substituted, heterocyclic-OC (O) -, and heterocyclic-OC (O) -substituted. "Alkenyl" refers to an alkenyl group preferably having from 2 to 6 carbon atoms and more preferably from 2 to 4 carbon atoms and having at least 1 and preferably 1-2 unsaturation sites with alkenyl. These groups are exemplified by vinyl (ethen-1-yl), allyl, but-3-en-1-yl, and the like. "Substituted alkenyl" refers to alkenyl groups having 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic provided that any hydroxyl substitution is not bound to a vinyl carbon atom (unsaturated). Preferred substituted alkenyl groups are selected to include: 2, 2-difluoroethe-1-yl, 2-methoxyethe-1-yl, and the like.

It should be understood that the term "substituted alkenyl", includes -, the isomers both E. { cis) as Z . { trans) as appropriate. The isomers can be pure isomeric compounds or mixtures of the E and Z components. "Alkynyl" refers to an unsaturated hydrocarbon having at least 1 unsaturation site with alkynyl and having 2 to 6 carbon atoms and more preferably 2 to 4 carbon atoms. Preferred alkynyl groups are selected from the group consisting of: etin-1-yl, propin-1-yl, propin-2-yl, l-methylprop-2-yn-l-yl, butin-1-yl, butin-2 -ilo, butin-3-ilo, and the like. "Substituted alkynyl" refers to alkynyl groups having 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic. Preferred substituted alkynyl groups are selected, inter alia, from: 2-fluoroethin-1-yl, 3, 3, 3-trifluoropropin-1-yl, 3-aminopropin-1-yl, 3-hydroxypropin-1-yl; similar. "Amino" refers to the group -NH2. "Substituted amino" refers to the group -NR 'R "wherein R' and R" are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and wherein R 'and R "are attached, together with the bonding nitrogen thereto to form a substituted heterocyclic or heterocyclic group with the proviso that R 'and R "are not both hydrogen. When R 'is hydrogen and R "is alkyl, the substituted amino group is sometimes referred to herein as" alkylamino. "When R' and R" are alkyl, the substituted amino group is sometimes referred to herein as dialkylamino. "Amidino" refers to the group -C (= NR1: L) NR ^ R11 wherein each R11 is independently selected from hydrogen or alkyl. "Aminoacyl" refers to the groups -NR5C (O) alkyl, -NR5C (O) substituted alkyl, -NR5C (O) cycloalkyl, -NR5C (O) substituted cycloalkyl, -NR5C (O) alkenyl, -NR5C (O) substituted alkenyl, -NR5C (O) alkynyl, -NR5C (O) substituted alkynyl, -NR5C (0) aryl, -NR5C (O) substituted aryl, -NR5C (O) heteroaryl, -NR5C (O) substituted heteroaryl, -NR5C (O) heterocyclic, and substituted -NR5C (O) heterocyclic wherein R5 is hydrogen or alkyl. "Aryl" or "Ar" refers to a monovalent aromatic carbocyclic group of 6 to 14 carbon atoms having an individual ring (eg, phenyl) or multiple fused rings (eg, naphthyl or anthryl), these fused rings they may or may not be aromatic (for example, 2-benzoxazolinone, 2H-1,4-benzoxazin-3 (4H) -one-7-yl, and the like) with the proviso that the point of attachment is in an aromatic carbon. Preferred aryls include phenyl and naphthyl. "Substituted aryl", including "substituted phenyl" refers to aryl groups or phenyl groups which are substituted with 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of hydroxyl, acyl, acylamino, acyloxy, alkyl , substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, carboxyl, carboxylesters, cyano, thiol, thioalkyl , substituted thioalkyl, thioaryl, substituted thioaryl, thioheteroaryl, substituted thioheteroaryl, thiocycloalkyl; substituted thiocycloalkyl, thioheterocyclic, substituted thioheterocyclic, cycloalkyl, substituted cycloalkyl, halo, nitro, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic, heteroaryloxy, substituted heteroaryloxy, heterocyclyloxy, and substituted heterocyclyloxy. "Aryloxy" refers to the group aryl-O- which includes, by way of example, phenoxy, naphthoxy and the like. "Substituted aryloxy" refers to aryl-O-substituted groups. "Carboxyl" refers to -COOH or salts thereof. "Carboxylesters" refers to the groups -C (0) 0-alkyl, -C (O) O-substituted alkyl, -C (O) O-aryl, and C (0) -or substituted aryl wherein alkyl, substituted alkyl , aryl and substituted aryl are as defined herein. "Cycloalkyl" refers to cyclic alkyl groups of 3 to 10 carbon atoms having individual or multiple cyclic rings including, by way of example, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like.

"Substituted cycloalkyl" refers to a cycloalkyl having from 1 to 5 substituents selected from the group - consisting of oxo (= 0), thioxo (= S), alkyl, substituted alkyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, ary, substituted aryl, aryloxy, substituted aryloxy; cyano, -r, halogen, hydroxyl, nitro, carboxyl, carboxyl esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic. "Cycloalkoxy" refers to -0-cycloalkyl groups. "Substituted cycloalkoxy" refers to cycloalkyl-O-substituted groups. "Formyl" refers to the group -C (0) H. "Guanidino" refers to the group -NR1C (= NR12) NR12R12 wherein each R12 is independently hydrogen or 'alkyl.' "Halo" or "halogen" refers to fluorine, chlorine, bromine and iodine and is preferably fluorine or chlorine. "Heteroaryl" refers to an aromatic group of 1 to 10 • carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur within the ring wherein the nitrogen and / or sulfur is optionally oxidized [(N- »0), .i. < ^ • -, • -S (0) -, or -S02-]. These heteroaryl groups may have a single ring (eg, pyridyl or furyl) or multiple fused rings (eg, indolizinyl or benzothienyl) wherein the fused rings may or may not be aromatic and / or contain a heteroatom with the proviso that the 'point of union is through an atom of the aromatic ring. The heteroarylsPreferred include pyridyl, pyrrolyl, indolyl, thiophenyl and furyl. "Substituted heteroaryl" refers to heteroaryl groups which are substituted with 1 to 3 substituents selected from the group of substituents defined for substituted aryl. "Heteroaryloxy" refers to the group -0-heteroaryl and "substituted heteroaryloxy" refers to the heteroaryl-O-substituted group. "Heterocycle" 'or "heterocyclic" or "heterocycloalkyl" refers to a saturated or unsaturated (but not heteroaryl) group having an individual ring or multiple fused rings, from 1 to 10 carbon atoms and from 1 to 4 heteroatoms selected from a group consisting of nitrogen, oxygen and sulfur within the ring, wherein the nitrogen and / or sulfur atoms may optionally be oxidized [(N- >); 0), -S (O) - or -S02-] and furthermore wherein, in the fused ring systems, one or more of the rings may be cycloalkyl, aryl or heteroaryl with the proviso that the point of attachment is through the heterocyclic ring. "Substituted heterocycle" or "substituted heterocycle" refers to heterocycle groups that are substituted with 1 to 3 of the same substituents as defined for substituted cycloalkyl. Examples of heterocycles and heteroaryls include, without limitation, azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, diphenyleneimine, carboline, phenanthridine, dibenzopyridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, i idazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1, 2, 3, 4-tetrahydroisoquinoline , 4, 5, 6, 7-tetrahydrobenzo [b] thiophene, thiazole, thiazolidine, thiophene, benzo [b] thiophene, morpholinyl, thiomorpholinyl (also referred to as thiamorpholinyl), piperidinyl, tetrahydropyrol, tetrahydrofuranyl, and the like. "Heterocyclyloxy" refers to the group -0-heterocyclic and "substituted heterocyclyloxy" refers to the heterocyclic-O-substituted group.

"Hydrazinose" refers to the group -NR13NR13R13 wherein each R13 is selected - independently of the group consisting of hydrogen or alkyl. "Phosphate" refers to the groups -0P (0) (0H) 2 (monophosphate or phospho), -OP (0) (OH) OP (0) (OH) 2 (diphosphate or diphospho) and -0P (0) (OH) OP (O) (OH) OP (O) (0H) 2 (triphosphate or triphosphate) or salts thereof including the partial salts thereof. It should be understood, of course, that the initial oxygen of the mono-, di- and tri-phosphate (phospho, diphospho and triphospho) includes the oxygen atom in the 5- position of sugar ribose. "Phosphate esters" refers to the mono-, di- and tri-phosphate groups described above, wherein one or more of the hydroxyl groups is replaced by an alkoxy group. "Phosphonate" refers to the groups -0P (0) (R6) (OH), or -OP (0.) (R6) (OR6) or the salts thereof including the partial salts thereof, wherein each R6 is independently selected from hydrogen, alkyl, substituted alkyl, carboxylic acid, and carboxylester. It should be understood, of course, that the initial oxygen of the phosphonate includes the oxygen atom at the 5 'position of the sugar ribose. "Phosphorodiamidate" 'refers to the group: wherein each R7 can be the same or different and each is hydrogen, alkyl, substituted alkyl, cycloalkyl, or substituted cycloalkyl. A preferred phosphorodiamidate is the following group: "Monoester phosphoramidate" refers to the following group, wherein R30 is as defined above, R8 is hydrogen or alkyl. In a preferred embodiment R30 is derived from an L-amino acid: "Phosphoramidate diester" refers to the following group, wherein R 30 is as defined above, R 8 is hydrogen or alkyl and R 10 is selected from the group consisting of alkyl, substituted alkyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted, heterocyclic and substituted heterocyclic heteroaryl. In a preferred embodiment R30 is derived from an L-amino acid.

"Cyclic phosphoramidate" refers to the following group, wherein n is 1 to 3, most preferably n is 1 to 2.

"Cyclic phosphodiamidate" refers to the following group, wherein n is from 1 to 3, most preferably n is from 1 to 2.

"Phosphonamidate" refers to the following group, wherein R14 is hydrogen, alkyl, substituted alkyl, cycloalkyl, or substituted cycloalkyl.

"Tiol" refers to the group-SH. "Thioalkyl" or "alkylthioether" or "thioalkoxy" refers to the group -S-alkyl. "Substituted thioalkyl" or "substituted alkylthioether" or "substituted thioalkoxy" refers to the S-substituted alkyl group. "Thiocycloalkyl" refers to the -S-cycloalkyl groups and "substituted thiocycloalkyl" refers to the S-substituted cycloalkyl group. "Thioaryl" refers to the group -S-aryl and "substituted thioaryl" refers to the aryl-S-substituted group. "Thioheteroaryl" refers to the group -S-heteroaryl and "substituted thioheteroaryl" refers to the -S-substituted heteroaryl group. "Thioheterocyclic" refers to the group -S-heterocyclic and "substituted thioheterocyclic" refers to the -S-substituted heterocyclic group. The term "amino acid side chain" refers to the substituent R30 of the α-amino acids of the formula NH2CH (R30) COOH wherein R30 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl and substituted aryl. Preferably, the side chain of the α-amino acids is the side chain of one of the twenty L-amino acids that occur in nature. The term "pharmaceutically acceptable prodrugs" refers to the modifications recognized in the art for one or more functional groups, the functional groups are metabolized in vivo to provide a compound of this invention or an active etabolite thereof. These functional groups are well known in the art and include acyl groups for hydroxyl and / or amino substitution, mono-di- and tri-phosphate esters, wherein one or more of the pendant hydroxyl groups have been converted to an alkoxy , a substituted alkoxy, an aryloxy group or a substituted aryloxy, and the like. The term "pharmaceutically acceptable salt" refers to pharmaceutically acceptable salts of a compound, these salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetra-alkylammonium, and the like; and wherein the molecule contains a basic functional group, the salts of the organic or inorganic acids, such as for example, hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like. The term "pharmaceutically acceptable partial salts" refers to compounds having a substituent capable of having more than one group for the formation of a salt but less than the maximum amount of these groups actually to form a salt. For example, a diphosphate group can form a plurality of salts and, if only partially ionized, the resulting group is sometimes referred to herein as a "partial salt". It should be understood that in all the substituted groups defined above, the polymers that arrive by defining the substituents with additional substituents for themselves (eg, substituted aryl having a substituted aryl group as a substituent which itself is replaced with a group substituted aryl, 'etc.) is not intended to be included in this. In these cases, the maximum number of these substituents is three. That is to say, that each of the above definitions is restricted by a limitation, for example, the substituted aryl groups are limited to substituted-aryl- (substituted aryl) -substituted aryl. Similarly, it should be understood that the above definitions are not intended to include substitution patterns that are not allowed (for example, methyl substituted with 5 fluorine groups or an alpha hydroxyl group for ethylenic or acetylenic unsaturation). These impermissible substitution patterns are well known to those skilled in the art.

General Synthetic Methods The compounds of this invention can be prepared from readily available starting materials using the following general methods and procedures. It will be appreciated that when preferred process conditions are provided (i.e., reaction temperatures, times, molar ratios of reagents, solvents, pressures, etc.), other process conditions may also be used unless otherwise stated. way. The optimum reaction conditions may vary with the particular reagents or solvents used, although these conditions can be determined by one skilled in the art by routine optimization procedures. Additionally, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from experiencing undesired reactions. The ... . , suitable protecting groups for various functional groups, as well as, suitable conditions for protecting and deprotecting particular functional groups, are well known in the art. For example, many protecting groups are described in T. W. Greene and G. M. Wuts, Protecting Groups in Organic Synthesis, Third Edition, Wiley, New York, 1999, and the references cited therein. In addition, the compounds of this invention contain one or more chiral centers. Accordingly, if desired, these compounds can be prepared or isolated as pure stereoisomers, that is, as enantiomers or diastomers, or as mixtures enriched with stereoisomers. All of these stereoisomers (and enriched mixtures) are included within the scope of this invention, unless otherwise indicated. Pure stereoisomers (or enriched mixtures) can be prepared using, for example, optically active starting materials or stereoselective reagents well known in the art. Alternatively, the racemic mixtures of these t compounds can be separated using, for example, chiral column chromatography, agents for chiral resolution and the like. The starting materials for the following reactions in general are known compounds or can be prepared by known methods or obvious modifications thereof. For example, many of the starting materials are available from commercial suppliers such as, for example, Aldrich Chemical Co. (Milwaukee, Wisconsin, USA), Bache (Torrance, California, USA), Emka-Chemce or Sigma (St. Louis, Missouri, USA). Others may be prepared by procedures, or obvious modifications thereof, described in standard reference texts such as, for example, Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1-15 (John Wiley and Sons, 1991), Rodd's Chemistry of Carbon Compounds, Volumes 1-5 and Supplemental (Elsevier Science Publishers, 1989), Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991), March's Advanced Organic Chemistry, (John Wiley and Sons, 4th Edition), and Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989). Specifically, the compounds of this invention can be prepared by various methods known in the art. organic chemistry in general and in particular by a synthesis of nucleoside and nucleotide analogues. General summaries of the preparation of the nucleoside and nucleotide analogues include: 1) Michelson A.M. "The Chemistry of Nucleosides and Nucleotides," Academic Press, New York, 1963; 2) Goodman > . . . L. "Basic Principles in Nucleic Acid Chemistry," Academic Press, New York, 1974, vol. 1, Ch. 2; and 3) "Synthetic Procedures in Nucleic Acid Chemistry, "Eds. Zorbach W. & Tipson R., Wiley, New York, 1973, vol. 1 & 2. The synthesis of the compounds of this invention generally follow a synthetic path either convergent or linear 'as described below. The available strategies for the synthesis of the compounds of this invention include, for example: General Synthesis of 2'-C-Branched 2'-Branched Ribonucleoside Nucleosides of Formula I: where T, Y, W, W1, and W2 are as defined above, they can be prepared by one of the following general methods.

Convergent procedure: Glucosylation of the nucleobase with suitably modified sugar The key starting material of this process is a sugar suitably substituted with 2'-0H and 2'-H with the appropriate leaving group, for example, an acyl group or a chloro group , bromine, fluorine or iodine at position 1. Sugar can be purchased or can be prepared by any known means including standard epimerization, substitution, oxidation and / or reduction techniques. For example, commercially available 1, 3, 5-tri-O-benzoyl-a-D-ribofuranose (Pfanstiel, Laboratories Inc.) can be used. The substituted sugar can then be oxidized with the suitable oxidizing agent in a compatible solvent at a suitable temperature to provide the 2'-modified sugar. Possible oxidizing agents are, for example, periodic reagent Dess-Martin Ac20 + DCC in DMSO, Swem oxidation (DMSO, oxalyl chloride, triethylamine), Jones reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (oxide of dipyridine Cr (VI), Corey reagent (pyridinium chlorochromate), pyridinium bichromate, acid dichromate, potassium permanganate, Mn02, ruthenium tetraoxide, catalysts for phase transfer such as, for example, chromic acid or permanganate supported on a polymer, Cl2-pyridine, H202-ammonium molybdate, NaBr02- ', • • • • • CAN, NaOCl en- HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf reagent -Verley (aluminum t-butoxide with another ketone) and N-bromosuccinimide. The coupling of an organometallic carbon nucleophile, such as, for example, a reactant • Grignard, an orlithium, dialkyl copper of lithium, or SiMe 4 in TBAF with the ketone with the appropriate non-protic solvent at a suitable temperature, provides the 2'-methyl sugar. "For example, CH3MgBr / TiCl or CH3MgBr / CeCl3 can be used as described in Wolfe et al., 1997. J Org. Chem ^ .62: -1754-1759 Methylated sugar can optionally be protected with a protecting group Suitable, preferably, with a group of acyl, substituted alkyl or silyl, by methods well known to those skilled in the art, as shown by Greene et al., Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition. 1991. The optionally protected sugar can then be coupled to the purine base by methods well known to those skilled in the art, as shown by Tbwnsend Chemistry of Nucleosides and Nucleotides, Plerium 'Press, 1994.' For example, an acylated sugar can be collected with a silylated base with a Lewis acid, such as, for example, tin tetrachloride, titanium tetrachloride or trimethylsilyl triflate in the appropriate solvent at a suitable temperature. Alternatively, a halo-sugar can be coupled to a silylated base in the presence of trimethylsilyl triflate. In addition to the above, the 2'-C-substituted sugars used in the synthetic methods described herein are well known in the art and are described, for example, by Sommadossi, et al.10 and by Carroll, et al.11 , All are incorporated herein by reference in their entirety. The following Scheme 1 describes the alternative synthesis of a protected sugar that is useful for coupling to the bases described herein.

Scheme 1 Where Ph is phenyl and X is a suitable leaving group such as, for example, halo.

The formation of sugar a from Scheme 1, above, is carried out as described by Mandal, S.B., et al. , Sinth. Commun. , 1993, 9, page 1239, starting from commercial D-ribose. The protection of hydroxyl groups to form sugar b is described in Witty, D.R., et al. , Bet. Lett. , 1990, 31, page 4787. The sugars c and d are prepared using the method of Ning, J. et al. , Carbohydr. Res. , 2001,330, page 165, and the methods described herein. The sugar e is prepared by using a modification of the Grignard reaction with CH3MgBr or another suitable organometallic as described herein (without the need for titanium / cerium). Finally, the halogenated sugar (X = halo) used in the subsequent coupling reaction is prepared using the same protection method as used to prepare sugar b above. Halogenation is described in Seela, U.S. Patent No. 6,211,158. Subsequently, any of the described nucleosides can be protected by methods well known to those skilled in the art, as shown by Greene et al. Protective Grolls in Organic Synthesis, Jon Wiley and Sons, Second Edition, 1991. An alternative procedure for making the protected sugars useful for coupling with heterocyclic bases is detailed in the following Scheme 2, Scheme 2 In Scheme 2, methylation of the hydroxyl group of compound 1 proceeds via a conventional methodology to provide compound 2 Hydroxyl groups 2, 3 and 5 of compound 2 are each protected with 2,4-dichlorobenzyl groups to provide compound 3 The selective deprotection of the 2- (2 ', 4'-dichlorobenzyl group) on the compound 3 proceeds via contact with tin chloride in a suitable solvent such as, for example, methylene chloride, chloroform and the like at reduced temperatures, for example, ~ 0 up ° C, until the end of the reaction, for example, 24-72 hours. Oxidation of the 2-hydroxyl group proceeds as described herein to provide compound 7. Methylation also proceeds as described herein to provide compound 8.

Linear procedure: modification of a preformed nucleoside The key starting material for this process is a nucleoside suitably substituted with a 2'-OH and 2'-H. The nucleoside can be purchased or can be prepared by any known means including standard coupling techniques. The nucleoside can optionally be protected with suitable protecting groups, preferably with acyl, substituted alkyl or silyl groups, by methods well known to those skilled in the art, as shown by Greene et al. Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991. The suitably protected nucleoside can then be oxidized with the suitable oxidizing agent in a compatible solvent at a suitable temperature to provide the 2'-modified sugar. Possible oxidizing agents are, for example, periodic reagent Dess-Martin Ac20 + DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride, triethylamine), Jones reagent (a mixture of chromic acid and sulfuric acid), reagent Collins (dipyridine Cr (VI) oxide, Corey's reagent (pyridinium chlorochromate), pyridinium bichromate, acid bichromate, potassium permanganate, tetroxide Mn02 ruthenium, phase transfer catalysts such as, for example, chromic acid or permanganate supported on a polymer, Cl2-pyridine, H202-ammonium molybdate, NaBr02-CAN, NaOCL in HOAc, copper chromite, copper oxide, nickel Raney, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum t-butoxide with another ketone), and N-bromosuccinimide. Coupling an organometallic carbon nucleophile, such as, for example, a Grignard reagent, an organolithium, lithium dialkyl copper or CH3SiMe3 in TBAF with the ketone with the appropriate non-protic solvent at a suitable temperature, provides the substituted alkyl nucleoside. Isolation of the appropriate isomer is conducted as necessary. Subsequently, the nucleoside can be deprotected by methods well known to those skilled in the art, as shown by Greene et al. Protective Groups in Organic Synthesis, John Wiley and Sons, Second Edition, 1991. In one embodiment of the invention, i is preferred. '. ". *.'; • * H.1.: • ',:' - '•> • •., •' •> • r •;;,, • the D-enantiomers. L-enantiomers are also contemplated as useful herein The L-enantiomers corresponding to the compounds of the invention can be prepared following the same general methods above, starting with the corresponding L-sugar or the nucleoside as the starting material. A particular embodiment is desired - the branched 2'-C-ribonucleoside The compounds of this invention can be prepared by various methods known in the art of organic chemistry in general and in particular the synthesis of nucleoside analogs and Nucleotides The starting materials for the syntheses are either readily available from commercial sources or are known or can be prepared by techniques known in the art.The general summaries of the preparation of nucleoside and nucleotide analogs are included. yen in the following: Michelson A.M. "The Chemistry of Xucleosides and Nucleotides," Academic Press, New York, 1963. Goodman L. "Basic Principles in Nucleic Acid Chemistry," Academic Press, New York, 1974, vol. 1, Ch. 2. "Synthetic Procedures ín Nucleic Acid Chemistry, "Eds. Zorbach W. &Tipson R., Wiley, New York, 1973, vol 1 &2. . .. . 63 The derivatives of? [2, 3-d] 5-substituted acetylenyl-pyrrolo nucleoside of the present invention can be synthesized using the methods depicted in Scheme 3 below. A convergent procedure for the preparation of the pyrrolo [2, 3-d] pyrimidinyl nucleosides is shown in Scheme 3 below. First, the commercially available 4-chloropyrrolo [2,3-d] irimidine 11 is halogen at position 5 (compound 12) using well-known methods, for example, the halogenation method described in A. Gangjee et al. , J. Med. Chem. (2003) 46, 591. The intermediate compound 12 can be isolated and purified using standard techniques such as, for example, chromatography, precipitation, crystallization, filtration, and the like. Alternatively, compound 12 can be isolated and used in the next step without further purification. 5- (substituted alkynyl) -4-chloropyrrolo [2,3-d] pyrimidine 13 is prepared using Sonigashira conditions as described in A. Gangjee et al. , (J. Med. Chem. (2003) 46,591) to provide compound 13. Intermediate compound 13 can be isolated and purified using standard techniques such as, for example, chromatography, precipitation, crystallization, filtration, and the like. Alternatively, compound 13 can be isolated and used in the next step without further purification. The compound 13 is coupled to the protected 2-methyl substituted sugar 8 (the synthesis thereof was described above and also by Carroll, et al., 11'12) using conditions well known in the art. For example, lO-mer.-3, 5-bis-0- (2,4-dichlorophenylmethyl) -2'-C-methyl-β-ribofuranoside 8 is dissolved in a dry inert solvent, such as for example , dichloromethane, chloroform, carbon tetrachloride and the like, and then the solution is cooled to about 0 ° C. After this, an excess of HBr or other suitable reagent is added dropwise in acetic acid. This reaction is typically run at about 0 ° C for about 1 hour or at room temperature for about 2.5 'hours or until it is practically complete as determined by conventional techniques such as for example, tic. The resulting brominated sugar mixture is isolated and purified using standard techniques such as, for example, chromatography, precipitation, crystallization, filtration, and the like. Alternatively, this intermediate can be isolated and used in the next step without further purification. The resulting brominated sugar mixture is co-evaporated, preferably with dry toluene, dissolved in a suitable inert diluent, such as, for example, dry acetonitrile, and stirred with the sodium salt of compound 13. at room temperature during night. The sodium salt of compound 13 is prepared in an inert atmosphere by suspending compound 13 in a dry inert solvent such as, for example, acetonitrile and the like, with NaH dispersed in > Oil: • - The reaction - runs for 2 to approximately 24 hours at a temperature between approximately 0 to 40 ° C. Finally, compound 15 is isolated and purified using standard techniques such as by. . example, - chromatography, precipitation, crystallization, filtration, and the like. Alternatively, this intermediate can be isolated and used in the next step without further purification. Deprotection of compound 15 using standard methods provides compound 16 which in some cases is converted to the 4-amino derivative (compound 17) using methods well known in the art. For example, compound 16 is added to liquid ammonia at about -80 ° C and heated to about 80 ° C for about 24 and 48 hours. Compound 17 is isolated and purified using standard techniques such as, for example, chromatography, precipitation, crystallization, filtration, and the like. 6. 6 Scheme 3 17 1S where R is as defined herein and DCB is 2,4-dichlorobenzyl In an alternative procedure, the compounds of 1- [5- (substituted alkynyl) -4-aminopyrrolo [2, 3-d] pyrimidine] -2'-C-methyl-β-D-ribofuranoside can be prepare using the method illustrated in Scheme 4 below. Compound 12, prepared as described above is coupled to protected sugar 8, using the techniques described for the preparation of compound 15 in Scheme 3 above to provide compound 19. Deprotection of compound 19, using standard methods, provides the compound 20. From compound 20, the compounds l- [5- (substituted alkynyl) -4-amino-pyrrolo [2,3-d] pyrimidine] -2'-C-methyl-β-D-ribofuranoside can be prepare by first converting the 4-chloro group to an amino group, using the technique described for the preparation of compound 17 from compound 16 in Scheme 3 above to provide compound 21, followed by coupling using Sonigashira conditions as described in A. Gangjee et al. , (J. Med. Chem. (2003) 46, 591) to form the substituted alkynyl derivative, of compound 17. In some cases, the compounds 1- [5- (substituted alkynyl) -4-amino-pyrrolo [2 , 3-d] pyrimidine] -2'-C-methyl-β-D-ribofuranoside can be prepared from compound 20 by first converting the 5-iodo group to the 5-substituted alkynyl derivative (compound 16), followed by the conversion of the 4-chloro group to the amine (compound 17). The methods for each of these transformations were detailed above.

Scheme 4 17 wherein R and DCB are as described above.

The preparation of the compounds wherein W, W1 or W2 is other than hydrogen, using the compounds prepared in Schemes 3 and 4 above as the starting materials, can be carried out using the methods described in the following summaries of the preparation of Drugs: 1) Cooperwood, JS et al. , "Nucleoside and Nucleotide prodrugs," in Ed (s) Chu, C.K. Recent Advances in Nucleosides (2002), 92-147. 2) 'Zemlicka, J. et al. , Biochimica et Biophysica Acta (2002), 158 (2-3), 276-286. 3) Wagner, C. et al. , Medicinal Research Reviews (2002), 20 (6), 417-451. 4) Meier, C. et al. , Synlett (1998), (3), 233-242. • '' For example, the conversion of the 5'-hydroxyl group of the compounds 1- [5- (substituted alkynyl) -4-amino-pyrrolo [2,3-d] pyrimidine] -2 '-C-methyl-β -D-ribofuranoside to a phosphorus, diphosphine or triphosphate analog can be prepared using the methods described in DW Hutchinson, (Ed. Leroy B. Townsend) "The Synthesis, Reaction and Properties of • Nucleoside Mono-, Di-, Tri- , and tertaphosphate and Nucleosides with Changes in the Phosphoryl Residue, "Chemistry of Nucleosides and Nucleotides, Plenurn Press, (1991) 2. The preparation of the amino acid esters in the ribofuranoside can be carried out as shown in the following Scheme 5: SCHEME 5 The desired Boc-protected amino acid and N, N'-carbonyldiimidazole are dissolved in an inert solvent such as, for example, THF. The reaction mixture is maintained between about 20 and 40 ° C for about 0.5 to 24 hours. A solution containing a slight excess of the desired nucleoside in an inert solvent such as, for example, DMF, is added to the Boc-protected amino acid mixture and heated between about 40 to 80 C for about 2 to about 24 hours. A mixture of structural isomers is isolated and separated using conventional techniques such as, for example, evaporation, precipitation, filtration, crystallization, chromatography and the like.

The desired ester is then acidified using, for example, 1: 1 v / v TFA / DCM solution for about 0.1 to 1 hour between about 20 and 40 ° C and evaporated. The residue is dissolved in water and maintained at about 0 to 30 ° C for about 2 to about 24 hours. The mixture can be separated and the desired product isolated by HPLC in RP using standard techniques and conditions. While the previous scheme demonstrates the production of deazapurine pro-drugs, this process can be used in any desired nucleoside compound. Also, the amino acid can be protected with any protective group suitable for the reaction conditions. These protecting groups are well known in the art.

SCHEME 6 3 £ > alkyl - J íPf where T is as defined above.

Compound 1 is dissolved in a dry solvent, such as, for example, pyridine, and a silylhalide, such as for example, tert-butylchlorodiphenylsilane, is added to form a protecting group at the 5'-position on the sugar. Any protecting group that can be directed to the 5 'position and orthogonally removed from the desired final 3' ester can be used. This reaction is carried out for about 4 to 24 hours at a temperature between about 10 and 40 ° C. The desired acyl chloride is added to the protected nucleoside, compound 30, and it is added to the protected nucleoside. > '! - i. it agitates for about 4 and up to about 24 hours to form the compound 31. Which can be isolated and purified using standard techniques such as for example, isolation, crystallization, extraction, filtration, chromatography and the like. Compound 32 is prepared by removing the protecting group at the 5 'position. This can be carried out by reacting the compound 30 with a 1M solution of tetrabutylammonium fluoride in THF. The final product is isolated and purified using standard techniques such as, for example, isolation, crystallization, extraction, filtration, chromatography and the like. While the above scheme demonstrates the production of deazapurine pro-drugs, this process can be used in any desired nucleoside compound.

USEFUL, TEST AND ADMINISTRATION Utility The present invention provides novel compounds that possess antiviral activity, including hepatitis C virus. The compounds of this invention inhibit viral replication by inhibiting the enzymes involved in replication, including RNA-dependent RNA polymerase. AR. The. they can also inhibit other enzymes used in the activity or proliferation of viruses in the flaviviridae family, such as, for example, HCV. The compounds of the present invention can also be used as pro-drug nucleosides. As such, they are placed in cells and can be phospholipated intracellularly1 by triphosphate kinases and then they are the polymerase inhibitors (NS5b) and / or act as chain terminators. The compounds of this invention can be used alone or in combination with other compounds for the treatment of viruses.

Administration and Pharmaceutical Composition In general, the compounds of this invention will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents serving similar utilities. The actual amount of the compound of this invention, ie, the active ingredient, will depend on many factors such as for example, the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and method of administration, and other factors. The drug can be administered more than once a day, preferably once or twice a day. The therapeutically effective amounts of the compounds of Formula I may vary from about 0.05 to 50 mg per kilogram of body weight of the container per day; preferably about 0.01-25 mg / kg / day, more preferably about 0.5 to 10 mg / kg / day.- Thus, for administration to a 70 kg person, the dosage may vary more preferably from about 35-70 mg per day. In general, the compounds of this invention will be administered as pharmaceutical compositions by any of the following routes: oral, systemic (e.g., transdermal, intranasal or suppository), or parenteral (e.g., intramuscular, intravenous, or subcutaneous) administration . The preferred form of administration is oral using a convenient daily dosage regimen that can be adjusted according to the degree of the condition. The compositions can have the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other suitable compositions. Another preferred way to administer the compounds of this invention is inhalation. This is an effective method for delivering a therapeutic agent directly to the respiratory tract (see U.S. Patent No. ,607,915). The choice of formulation depends on various factors such as, for example, the mode of administration of the drug and bioavailability of the drug substance. l 'For delivery via inhalation, the compound can be formulated as a liquid solution, suspensions, aerosol propellants or dry powder and can be loaded into a suitable applicator for administration. There are several types of devices for pharmaceutical inhalation-nebulizer inhalers, metered-dose inhalers (MDI) and dry-powder inhalers (DPIs). The nebulizer devices produce a high velocity air stream that causes the therapeutic agents (which are formulated in a liquid form) to be sprayed as a vapor that enters the patient's respiratory tract. MDIs are typically a formulation packed with a compressed gas. At the time of actuation, the device discharges a measured quantity of the therapeutic agent by the compressed gas, thus producing a reliable method for administering a fair amount of the agent. The DPI delivers the therapeutic agents in the form of a free-flowing powder that can be dispersed in the patient's inspiratory airstream during respiration by the device. In order to achieve a free flowing powder, the therapeutic agent is formulated with an excipient such as, for example, lactose. A measured quantity of the therapeutic agent is stored in a capsule form and is supplied with each actuation. Recently, pharmaceutical formulations have been developed for drugs that show efficient bioavailability based on the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing the particle size. "For example, U.S. Patent No. 4,107,288 describes a pharmaceutical formulation having particles ranging in size from 10 to 1,000 nm in which the active material is supported on a crosslinked matrix of macromolecules. No. 5,145,684 discloses the production of a pharmaceutical formulation in which the drug substance is sprayed to nanoparticles (average particle size 400 'nm) in the presence of a surface modifier and then dispersed in a liquid medium to provide a pharmaceutical formulation exhibiting remarkably high bioavailability The compositions generally comprise a compound of Formula I in combination with at least one pharmaceutically acceptable excipient Acceptable excipients are non-toxic, are auxiliary to the administration , and do not adversely affect the therapeutic benefit of the compound of Formula I. This excipient p It can be any solid, liquid, semi-solid or, in the case of an aerosol composition, a gaseous excipient which is generally available to one of skill in the art. Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, • gypsum, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dehydrated skim milk and the like. Liquid and semi-solid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, - including those of petroleum, animal, vegetable or synthetic origin, for example, peanut oil, soybean oil, mineral oil, sesame oil , ' etc. Preferred liquid carriers, in particular for injectable solutions, include water, saline, aqueous dextrose and glycols. The compressed gases can be used to disperse a compound of this invention in the form of an aerosol. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18th ed., 1990). The amount of the compound in a formulation can vary within the full range, employed by those skilled in the art. Typically, the formulation will contain, on a weight percent basis (% by weight), of about 0.01-99.99% by weight of a compound of Formula I based on the total formulation, with the remainder being one or more pharmaceutical excipients adequate. Preferably, the compound is present "at a level of about 1-80% by weight Representative pharmaceutical formulations containing a compound of Formula I will be described below.Additionally, the present invention is directed to a pharmaceutical composition which comprises a therapeutically effective amount of a compound of the present invention in combination with a therapeutically effective amount of another agent active against the virus with RNA-dependent RNA and, in particular, against HCV. enunciative, ribavirin, levovirin, viramidine, ugly thymosin alpha-1, inhibitor of serine protease NS3 of HCV, interferon-a, pegylated interferon-a (peginterferon-a), a combination of interferon-a and ribavirin, a combination of peginterferon-a and ribavirin, a combination of interferon- a and levovirin, and a combination of peginterferon-a and levovirin. Interferon-a includes, but is not limited to, recombinant interferon-a2a (such as, for example, -Roferon interferon available from Hoffman-LaRoche, Nutley, NJ), interferon-a2b (such as, for example, Intron-A interferon available from Schering Corp., Kenilworth, New Jersey, USA), a generalized interferon, and a purified interferon-α product. For an analysis of ribavirin and its activity against HCV, see J.O. Saunders and S.A. Raybuck, "Inosine Monophosphate Dehydrogenase: Consideration of Structure, Kinetics and Therapeutic Potential," Ann. Rep. Med. Chem. , 35: 201-210 (2000).

EXAMPLES The following examples, as well as, throughout the application, the following abbreviations have the following meanings. If they are not defined, the terms have their meanings in general accepted.

AcOH or HOAc = acetic acid Ac20 = acetic anhydride Ar = arylhydrogen atm = atmosphere Boc = t-butoxycarbonyl bs = broad singlet CAN = serum ammonium nitrate cm = centimeter d = doublet with = concentration DCM = dichloromethane dd = doublet of doublets DMF = dimethylformamide dt = triplet double DBU = 1,8-diazabicyclo [5.4.0] undec-7-ene DCB = 2, 4-dichlorobenzyl DCC = dicyclohexylcarbodiimide DMEM = minimum eagle medium in Delbecco's DMSO = dimethylsulfoxide DTT = dithiothreitol EDTA = ethylenediaminetetraacetic acid eq. or eq = equivalents g = gram h or hr = hour HCV = hepatitis C virus HPLC = high efficiency liquid phase chromatography IPTG = ß-D-1-isopropyl thiogalactopyranoside Iü = international units kb = kilobase kg = kilogram KOAc = potassium acetate L = liters m = multiplet M = molar Me = methyl MeOH = methanol min = minute mg = milligram mL = milliliter mm = millimeters mM = millimolar mmol = millimol MS = mass spectrum ng = nanograms N = normal nm = nanometers nM = nanomolar NMR = nuclear magnetic resonance NTA = nitrile triacetic acid NTP = nucleotide triphosphate HPLC in RP = reverse phase high efficiency liquid chromatography q = quartet s = singlet lt = triplet TBAF = tetratubilamonium fluoride TEA = triethylamine TFA = trifluoroacetic acid THF = tetrahydrofuran tic or TLC = thin layer chromatography T = melting temperature UTP = uridine triphosphate μL = microliters μg = micrograms μM = micromolar v / v = volume at volume w / w = weight to weight Wt% = weight percent In addition, all reaction and melting temperatures are presented in degrees Celsius unless otherwise reported. In the following, examples, as well as, wherever throughout this application, the claimed compounds employ the following numbering system: Example 1 Preparation of the intermediate l-0-methyl-2-methyl-3, 5-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranose Step 1: Preparation of l-O-methyl-2, 3, 5-tris-O- (2,4-dichlorobenzyl) -β-D-ribofuranose The title compound was synthesized using the method described in Marín, P .; Helv. Chim. Acta, 1995, 78, 486 starting with commercially available D-ribose.

Step 2: Preparation of l-0-methyl-3, 5-bis-0- (2,4-dichlorobenzyl) -β-D-ribofuranose To a solution of the product from Step 1 (171.60 g, 0.2676 mol) in 1.8 L of methylene chloride which was cooled to 0 ° C, a tin chloride solution (31.522 mL, 0.2676 mol) in 134 mL of methylene chloride was added dropwise while it was "stirring. the solution at about 3 ° C for about 27 hours, another 5,031 mL of tin chloride (SnCl) (0.04282 mol) were added and the solution was kept at about 3 ° C overnight after a reaction time. total of about 43 hours, the reaction was quenched by carefully adding the solution to 1.9 L of saturated NaHCO3 solution.The tin salts were removed via filtration through Celite after which the organic phase was isolated, dried with MgSO4 and evaporated in vacuo The yield of dark yellow oil, without retinal was 173.6 g The crude oil was used directly in the next step without further purification.

Step 3: Preparation of l-0-methyl-2-oxo-3,5-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranose To an ice cooled solution of Dess-Martin periodinane ( 106.75 g, 0.2517 mol) in 740 mL of anhydrous methylene chloride, under rgon, was added a solution of the product from Step 2 above in 662 mL of anhydrous methylene chloride for 0.5 hour. The reaction mixture was stirred at 0 ° C for 0.5 hours and then at room temperature for 6 days. The mixture was diluted with 1.26 L of anhydrous diethyl ether and then poured into an ice-cooled mixture of Na2S303-5H20 (241.2 g, 1.5258 mol) in 4.7 L of saturated aqueous sodium bicarbonate. The layers were separated, and the organic layer was washed with 1.3 L of saturated aqueous sodium bicarbonate, 1.7 L of water and 1.3 Brine, dried with MgSO 4, filtered and evaporated to provide the desired compound. The 'compound (72.38 g, 0.1507 mol) was used without further purification in the next step.

Step 4: Preparation of the title compound A solution of MeMgBr in 500 mL of anhydrous diethyl ether maintained at -55 ° C was added dropwise to a solution of the product from step 3 above (72.38 g, 0.1507 mol) also in 502 mL of anhydrous diethyl ether. The reaction mixture was allowed to warm to -30 ° C and mechanically stirred for 4 hours at about -30 ° C to -15 ° C, then it was emptied into 2 L of ice cold water. After vigorous stirring at room temperature for 0.5 hour, the mixture was filtered through a pad of Celite (14 x 5 cm) which was washed thoroughly with diethyl ether. The organic layer was dried with MgSO, filtered and concentrated in vacuo. The residue was dissolved in hexanes (-1 mL per raw gram), applied to a column on silica gel (1.5 L silica gel in hexane) and eluted with hexanes and 4: 1 hexanes: ethyl acetate (v. / v) to provide 53.58 g (0.1080 mol) of the final purified product. The morphology of the title compound was that of a viscous, yellowish oil; MS: m / z 514. 06 (M + NH 4 +).

Example 2 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (trimethylsilyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine Step 1: 4-Chloro-5-iodo-7H-pyrrolo [23-d] pyrimidine: 4-chloro-7H-pyrrolo [2, 3-. ,.,, 88. , d) pyrimidine 10.75g (70 mmol) and N-iodosuccinimide (16.8g, 75 mmol) in 400 mL of dry DMF and left at room temperature in the dark overnight. The solvent was evaporated. The yellow residue was suspended in hot 10% Na2SO3 solution, filtered, washed twice with hot water and crystallized from ethanol to provide 14.6 g (74.6%) of the title compound as off-white crystals. The mother liquor was evaporated to 1/3 volume and crystallized again from ethanol to provide 2.47 g (12.3%) of the title product. The total yield closed at 100%; Tm 212-214 ° C (dec); UV? Max: 307, 266, 230, 227 nm (methanol); MS: 277.93 (M-H), 313 (M + Cl); 1 H-NMR (DMSO-d 6): 12.94 (s, 1 H, NH), 8.58 (s, 1 H, H- • 2), 7.94 (s, 1 H, H-8). ' Step 2: 7- (2 '-methyl-3', 5 '-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranosyl) -4-chloro-5-iodo-pyrrolo [2, 3 d] pyrimidine: The base, obtained as described above (11.2 g, 40 mmol) was suspended in 500 mL of CH 3 CN, NaH (1.6 g, 40 mmol 60% in oil) was added and the reaction mixture was stirred at room temperature until dissolved in NaH (approximately 2 hours). L-O-methyl-2-methyl-3,5-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranose (10 g, 20 mmol) was dissolved in 500 mL of DCM and cooled to of 4 ° C in a bath of ice water. HBr (g) was bubbled through the solution for about 30 min. The reaction was monitored by TLC and run until the disappearance of the starting sugar (ether / hexane 1: 9 v / v). At the end of the reaction, the solvent was evaporated at a temperature no higher than 20 ° C and kept for 20 min in deep vacuum to eliminate traces of HBr. The sodium salt solution of the base was filtered and the filtrate was added to the sugar component. The reaction was maintained overnight at room temperature, neutralized with 0.1 N H2SO4 and evaporated. The residue was distributed between 700 mL of ethyl acetate and 700 mL of water. The organic fraction was washed with water (150 mL), brine (150 L), dried over Na 2 SO and evaporated to provide a semi-crystalline mixture. Toluene (500 ml) was added to form a light tan precipitate of an unreacted heterocyclic base 2.5 g (25%). The filtrate was concentrated to a volume of 50 mL and loaded onto the glass filter with silica gel (10 x 10 cm). The filter was washed with 10% ethyl acetate in toluene collecting 500 mL fractions. The fraction 2-4 contained the title compound; fractions 6-7 contained the heterocyclic base. Fraction 2-4 were evaporated, ether was added to the colorless oil and the mixture was sonicated for 5 min. A whitish precipitate formed, yield 7.4 g (50%), the mother liquor was evaporated and the procedure described was repeated to provide 0.7 g more of the nucleoside of the title. The total yield is 8.1 g (54.4%); Tm: 67-70 ° C; 1H-NR (DMS0-d6): d 8.66 (s, 1H), 8.07 (s, 1H), 7.62- 7.34 (m, 6H), 6.22 (s, ÍH), 5.64 (s, ÍH), 4.78-4.55 (m, 4H), 4.20 (s, 2H), 3.97-3.93 and 3.78-3.75 (dd, ÍH), 0.92 (s, 3H); 'MS: 743.99 (M + H'); Base recovered (total): 4g as - whitish crystals; Tm 228-230 ° C.

Step 3: 7- (2 '-methyl-β-D-ribofuranosyl) -4-chloro-5-iodo-pyrro [2,3-d] pyrimidine: To the solution of the compound from the previous step (8 g, 10.7 mmol ) in DCM (200 mL) at -78 ° C was added boron trichloride (1M in DCM, 88 mL, 88 mmol) dropwise. The mixture was stirred at -78 ° C for 2 5 hours and additionally overnight at -20 ° C. The reaction was quenched by the addition of MeOH / DCM (90 mL, 1: 1) and the resulting mixture was stirred at -20 ° C for 30 min, then neutralized by aqueous ammonia at the same temperature. The solid was filtered and washed with methanol / DCM (250 mL, 1: 1). The filtrates were combined with 50 mL of silica gel and evaporated to dryness. The dried silica was loaded onto the glass filter with silica gel (10 x 10 cm). The filter was washed with ethyl acetate collecting fractions '' of '500' mL. -Fraction 2-4 contained the title compound. The solvent was evaporated and the residue was crystallized from acetone / hexane to provide 3.3 g (72%) of the title nucleoside; ^? - NMR ('DMSO-de): d 8.84 (s, 1H), 8.20' (s, ÍH), 6.21 (s, 1H), 4.00-3.-60 (m, sugar), 0. 84 ( s, 3H); MS: 426.26 (M + H); Tm: 182-185 ° C. . • • Step 4: 7- (2 '-methyl-β-D-ribofuranosyl) -4-amino-5-iodo-pyrrolo [2,3-d] pyrimidine: The nucleoside (1.5 g, 3.5 mmol) prepared above was treated with liquid ammonia at 85 ° C for 24 hours in the metal pressure reactor. After evaporation of the ammonia, the residue was dissolved in methanol and co-evaporated with silica gel (approximately 20 mL). The silica gel carrying the product was placed on the column (5 x 10 cm) with silica gel in acetone collecting fractions of 50 mL. Fractions 2-8 contained the title compound. The acetone was evaporated and the residue was crystallized from methanol / acetonitrile to provide 1.2 g (84%) of the title nucleoside; Tm 220-222 ° C (dec); XH-NMR (DMSO-d6): d 8.20 (s, 1H), 7.80 (s, ÍH), 6.80-6.50 (bs, 'ÍH),' • 6.O9 (s, ÍH), 5.19 (t, ÍH) , sugar), 5.13-5.11 (m, 2H, sugar), 4.00-3.70 (m, 3H, sugar), 3.60-3.20 (m, 1H, sugar), 0.84 (s, 3H); MS 407.32 (M + H).

Step 5 7- (2 '-methyl-β-D-ribofuranosyl-4-amino-5- (trimethylsilanylethyn-1-yl) -pyrrolo [2,3-d] pyrimidine: The aminonucleoside synthesized in the previous step (1.7 g , 4.2 mmol) was dissolved in the mixture of 12 mL of dry DMF and 28 mL of dry THF.Triethylamine (3.6 mmol, 0.5 mL), Cul (1 mmol, 80 mg) was added and the flask was filled with argon. added titanium ester (triphenylphosphine) palladium (0) (0.04 mmol, 46 mg) followed by (trimethylsilyl) acetylene and the mixture was stirred under argon for 20 hours. The solvent was evaporated and the residue in acetone was filtered through silica gel (5 x 10 cm). The acetone was evaporated, the residue was dissolved in acetonitrile and then filtered again through the silica gel column of the same size; an elution with pure acetonitrile occurred. The acetonitrile was concentrated to a small volume, approximately 10 volumes of ether were added and the solution was sonicated for 5 min. White crystals of the title compound were formed, yield 0.8 g (71%); Tm 188-191 ° C (decomposition); XH-NMR (DMSO-de): d 8.17 (s, 1H), 7.92 (s, 1H), 7.20-6.80 (t, 1.2H), 5.83 (s, ÍH), 3.75-3.20 (m, sugar), 0.45 (s, 3H), 0 (s, 9H).

Example 3 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-2-yl) etin-1-yl] -pyrrolo [2, 3 d] pyrimidine To a solution of the compound from Step 4, the Example 2 in DMF (.05 M) was added 1.0 equivalent of TEA, 0.4 eq of Cul, 6.0 equivalent of 2-ethynyl-pyridine. This mixture was degassed with argon and 10 mol% of P (Ph3) 4Pd was added and the reaction was stirred for 24 h at 25-80 ° C. The reaction mixture was then concentrated in vacuo, extracted in DMF and purified by RP HPLC on a PHenominex column (250 x 20mm) using a gradient of acetonitrile in water of 0 to 80% for 30 min at 10 mL / min.

Example 4 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxamidoetin-1-yl) -pyrrolo [2,3-d] pyrimidine GÜO} NTI, To a solution of. The product of Example 8 (20 mg, 0.053 mmol) was added 1.0 mL of concentrated ammonia solution (30% aqueous solution) and stirred at room temperature for 1 hour. The resulting precipitate was filtered and dried via co-evaporation with ethanol to give 15 mg (80%) of the title compound; XH-NMR (DMSO-d6): d 8.26 (bs, 1H), 8.16 (s, ÍH), 8.14 (s, 1H), 7.56 (bs, ÍH), 7.2-6.4 (bs, 2H), 6.11 (s) , ÍH), 5.26-5.14 (m, 3H), 3.9-3.6 (m, 4H, sugar), 0.69 (s, 3H); MS 348.10 (M + H).

Example 5 Preparation of 7- (2'-C-methyl'-β-D-ribofuranosyl) -4-amino-5- [3, 3-diethoxypropar-1-yl] -pyrrolo [2, 3-d] pyrimidine To a solution of the compound from Step 4, Example 2 (100 mg, 0.246 mmol) in 6.5 mL of THF-DMF (3: 1 v / v) was added Cul (18.2 mg, 0.096 mmol), TEA (32 μL, 0.23). mmol), propiolaldehyde diethylacetal (0.05 mL, 0.36 mmol). The mixture was degassed with argon and P (Ph3) Pd (28mg, 0.024 mmol) was added and the reaction was stirred at room temperature for 3.5 hours. A second charge of propiolaldehyde diethylacetal (0.05 mL) was added and the reaction was allowed to stir at room temperature overnight. The reaction was then concentrated in vacuo and purified on silica gel (on plates on gel with 100% CH2C12, eluted with 15% MeOH-CH2Cl2) to give 60 mg (60%) of the title compound; 1H-NMR (CD3OD): d 8.11 (s, 1H), 7.90 (s, ÍH), 6.22 (s, 1H), 4.2-3.6 (m, 4H, sugar), 3.8-3.6 (m, 4H), 1.26 (t, 6H), 0.84 (s, 3H); MS 407.22 (M + H).

Example 6 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (4-methoxyphenyl) etin-1-yl] -pyrrolo [2,3-dipyrimidine] To a solution of the compound from Step 4, Example 2 in DMF was added 1.0 equivalent of TEA, 0.4 eq of Cul, 6.0 equivalent of l-ethynyl-4-methoxy-benzene. This mixture was degassed with argon and 10 mol% of P (Ph3) 4Pd was added and the reaction was stirred for 24 hours between 25-80 ° C. The reaction mixture was then concentrated in vacuo, extracted in DMF and purified by RP HPLC on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water of 0 to 80% for 30 min at 10 mL / min.

Example 7 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine) Product solution from Step 4, Example 2 (50.0 mg, 0.1231 mmol) in 5 mL of dimethymamide. The solution was degassed by bubbling with argon while being sonicated for 5 min. To this solution was added triethylamine (16.0 μL, 0.1145 mmol), copper iodide (9.4 mg, 0.0492 mmol), and titanium ester (triphenylphosphine) palladium (0) (14.2 mg, 0. 0 123 mmol). Then, phenylacetyl no (81.1 μL, 0.7386 mmol) was added, the mixture was stirred under argon for 4 hours, when the reaction was complete, the mixture was concentrated in vacuo, the crude of the reaction was dissolved in 1 mL of dimethymamide, diluted 50 mL with deionized water and then washed through a pad of celite The solution was again concentrated to dryness, then redissolved in 1.0 mL of dimethymamide and 3.5 mL of water.The title compound was purified by HPLC; 1H-NMR (CD3OD): 8.14 (s, "lH), 7.91 (s, ÍH), 7 54-7.51 (m, 2H), 7.40-7.36 (m, 3H), 6.25 (s, ÍH), 4.16 -3.85 (m, 4H), 0.87 (s, 3H). MS: 381.14 (m / z).

Example 8 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxylethyl-1-yl) -pyrrolo [2,3-d] pyrimidine To a solution of the product from Step 4, Example 2 (450.0 mg, 1.108 mmol) in '28.8 mL of THF-DMF' (2: 1 v / v) was added Cul (0.082 g, 0.432 mmol), TEA (144 μL). 1.035 mmol), titanium (triphenylphosphine) palladium (0) ester (0.126 g, 0.108 mmol) and the solution was degassed with argon. Ethyl propiolate (100 μL, 1011 mmol) was added and the reaction was heated to 55 ° C. Approximately 100 μL of additional ethyl propiolate was added every hour for six hours until no starting material of Example 2, Step 4 was added. was present by TLC The reaction mixture was concentrated in vacuo, extracted in DMF and purified by HPLC on RP through a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water of 0 to 60% for 30 min at 10 mL / min to provide 115 mg (28%) of the title compound; 1H-NMR (CD3OD): 8.24 (s, ÍH), 8.17 (s, ÍH), 6.24 (s, 1H), 4.28 (q, 2 PI) 4.13-3: 87 (m, 4H, sugar), 1.34 (t, 3H), 0.86 (s, 3H), MS 377.11 (M + H).

Example 9 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxyletin-1-yl) -pyrrolo [2,3-d] pyrimidine To the product of Example 8 (20.0 mg, 0.053 mmol) was added 500 μL of IN NaOH and stirred at room temperature for 3Q min. The reaction was then diluted with water and purified by HPLC on RP on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water 0 to 60% for 30 min at 10 mL / min to provide 7.0 mg (38% ) of the title compound; XH-NMR (CD30D): 8.10 (s, ÍH), 7.96 (s, ÍH), 6.22 (s, ÍH), 4.12-3.82 (m, 4H, sugar), 0.84 (s, 3H); MS: 349.10 (M + H).

Example 10 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxyethe-l-yl) -pyrrolo [2,3-d] pyrimidine Step 1: Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine: 7- (2 '- was synthesized C-methyl-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine according to the procedure described by Shin-ichi Watanabe and Tohru Ueda e Nucleosides and Nucleotides (1983) 2 (2), 113-125.

In the synthesis of the title compound, however, the 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-pyrrolo [2,3-d] pyrimidine (See Carroll, et al., 11'12) was replaced in place of tubercidin; HX-NMR (CD3OD): 0.9 (s, 3H, 2'-CH3), 3'.8-4.2 (m, 4H, sugar), 6.3 (s, 1H, l'-H), 8.2 and 8.6 (s) , ÍH, -Ar), 9.7 (s, ÍH, -aldehyde-H); MS: 309.13 (M + H).

Step 2: Preparation of the title compound: The product of Step 1 above (0.050 g, 0.162 mmol) was dissolved in 2 mL of DMSO and added dropwise to the preformed yield of (methoxymethyl) -triphenylphosphonium chloride and stirred at room temperature. The yield was formed by dissog (0.555 g, 1.62 mmol) (methoxymethyl) triphenylphosphonium chloride in 10 mL of DMSO and adding 0.81 mL of 2 M methylsulfinyl carbanion solution (1.62 mmol) and stirring at room temperature. for 15 min. After stirring at room temperature for 4 hours, a second charge (1.62 mmol) of chloride yield was added to the reaction. (methoxymethyl) triphenylphosphonium and the reaction was allowed to stir at room temperature overnight. The reaction was quenched with water and diluted with methylene chloride.

The layers separated and the. Organic layer was extracted with water twice. The aqueous layers were combined and concentrated in vacuo and purified by RP HPLC on a Fenominew column (250 x 20 mm) using a gradient of acetonitrile in water of 0 to 30% for 30 min at 10 mL / min to provide 20 mg of trans-enol ether and 10 mg of cis-isomer (56%) yield; (cis-isomer) Ha-NMR (CD30D): 0.82 (s, 3H, 2'-CH3), 3.8 (s, 3H, -0CH3) 3.8-4.2 (m, 4H, sugar), 5.56 (d, 1H) , 6.23 (s, 1H, l'-H), 6.25 (d, ÍH), 7.8 and 8.0 (s, 1H, - Ar).

Example 11 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (eten-1-yl) -pyrrolo [2,3-d] pyrimidine The title compound of Example 2 (0.040 g, 0. 0132 mmol) was dissolved in methanol and NH0H was added and the mixture was left at room temperature for 1 hour. The solvent was evaporated, the residue was dissolved in methanol and co-evaporated with silica gel. The dried silica was loaded onto the glass filter with silica gel and the desilylated compound was eluted with acetone. The solvent was evaporated and the residue was crystallized from methanol / acetonitrile to provide 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (etin-1-yl) -pyrrolo [ 2, 3-d] pyrimidine. TM 209-219 ° C (decomposition); MS 305.13 (M + H); XH-NMR (DMSO-d6): 8.10 (s, 1H, H-2), 7.94 (s, ÍH, H-8), 6.08 (s, ÍH, Hl), 5.32-5.13 (m, 3H, sugar) , 3.96-3.62 (m, 4H, sugar), 0.68 (s, 3H, methyl). The acetylene product prepared above was dissolved in 3 mL of THF and 22 mg of Lindlar catalyst was added. The solution was stirred at room temperature under 1 atm of hydrogen (via a balloon) for 7 days. The balloon was recharged with hydrogen at the start of each day. After 7 days, the reaction was filtered through celite to remove the catalyst, concentrated in vacuo, and purified by reverse phase HPLC on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water of 0. at 30% for 30 min at 10 mL / min to provide 30 mg (75% yield) of the title compound; HX-NMR (CD3OD): 0.835 (s, 3H, 2'-CH3), 3.8-4.2 (m, 4H, sugar), 5.2 (dd, ÍH), 5.5 (dd, 1H), 6.23 (s, ÍH, 1'- H), 6.9 ((dd, ÍH), 7.73 and 8.06 (s, 1H, -Ar); MS: 307.15 (M + H).

Example 12 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (formyl,) -pyrrolo [2,3-d] pyrimidine Step 1: 4-Chloro-5-iodo-7H-pyrrolo [2,3-d] pyrimidine: 4-chloro-7H-pyrrolo [2,3-d] pyrimidine 10.75 g (70 mmol) and N-iodosuccinimide were dissolved (16.8 g, 75 mmol) in 400 mL of dry DMF and left at room temperature in the dark overnight. The solvent was evaporated. The yellow residue was suspended in hot 10% Na2SO3 solution, filtered, washed twice with hot water and crystallized from ethanol to provide 14.6 g (74.6%) of the title compound as off-white crystals. The mother liquor was evaporated to 1/3 volume and crystallized again from ethanol to provide 2.47 g (12.3%) of the title product; The total yield closed at 100%; Tm: 212-214 (decomposition); UV? Max: 307, 266, 230, 227 nm (methanol); MS: 277. 93 (M-H), 313 (M + Cl); XH-NMR (DMSO-de): d 12. 94 { s, ÍH), 8. 58 (s, ÍH), 7. 94 (s, ÍH).

Step 2: 7- (2 '-methyl-3', 5 '-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranosyl) -4-chloro-5-iodo-pyrrolo [2, 3 d] pyrimidine: The base, obtained as described above (11.2 g, 40 mmol) was suspended in 500 mL of CH3CN, NaH (1.6 g, 40 mmol 60% in oil) was added and the reaction mixture was stirred. at room temperature until dissolved in NaH (approximately 2 hours). L-0-methyl-2-methyl-3,5-bis-O- (2,4-dichlorobenzyl) -β-D-ribofuranose (10 g, 20 mmol) was dissolved in 500 mL of DCM and cooled to 4 mL. ° C in a bath of ice water. HBr gas was bubbled through a DCM solution for about 30 min. The reaction was controlled by TLC by the disappearance of the starting sugar (ether / hexane 1: 9 v / v).

At the time the reaction was completed, the solvent was evaporated at a temperature no higher than 20 ° C and kept for 20 min in deep vacuum to eliminate the traces HBr. The sodium salt solution of the base was filtered rapidly and the filtrate was added to the sugar component. The reaction was maintained overnight at room temperature, neutralized with 0.1 N H2SO4 and evaporated. The residue was distributed between 700 L of ethyl acetate and 700 mL of water. The organic fraction was washed with water (150 mL), brine (150 mL), dried over Na 2 SO and evaporated to give a semi-crystalline mixture. Toluene (500 mL) was added to form a light tan precipitate of an unreacted het.erocyclic base 2.5 g (25%). The filtrate was concentrated to the volume of 50 mL and loaded onto a glass filter with silica gel. (10 x 10 cm). The filter was washed with 10% ethyl acetate in toluene collecting 500 mL fractions. Fraction 2-4 contained the title compound; fractions 6-7 contained the heterocyclic base. Fractions 2-4 were evaporated, ether was added to the colorless oil and the mixture was sonicated for 5 min. A whitish precipitate formed, yield 7.4 g (50%). The mother liquor was evaporated and the described procedure was. - repeated to provide approximately 0.7 additional g of the title nucleoside. The total yield was 8.1 g (54.4%); Tm: 67-70 ° C; 1 H-NMR (DMSO-de): d 8.66 (s, 1H), 8.07 (s, ÍH), 7.62- 7.34 (m, 6H), 6.22 (s, ÍH), 5.64 (s, 1H), 4.78-4.55 (m, 4H), 4.20 (s, 2H), 3.97-3.93 and 3.78-3.75 (dd, 1H), 0.92 (s, 3H); -MS: 743.99 (M + H); 'Recovered base (total): 4 g as whitish crystals; Tm: 228-230 ° C.

Step 3: 7- (2 '-methyl-β-D ribofuranosyl) -4-chloro-5-iodo-pyrrolo [2, 3, d] pyrimidine: To the solution of the compound from the previous step (8 g, 10.7 mmol ) in DCM (200 L) at -78 ° C was added boron trichloride (1 M in DCM, 88 L, 88 mmol) dropwise. The mixture was stirred at -78 ° C for 2.5 hours and additionally overnight at -20 ° C. The reaction was quenched by the addition of methanol / DCM (90 mL, 1: 1) and the resulting mixture was stirred at -20 ° C for 30 min, then neutralized by aqueous ammonia at the same temperature. The solid was filtered and washed with methanol / DCM (250 mL, 1: 1). The filtrates were combined with 50 mL of silica gel and evaporated to dryness. Dry silica was loaded onto the glass filter with silica gel (10 x 10 cm). The filter was washed with ethyl acetate collecting fractions of 500 mL. Fraction 2-4 contained the title compound. The solvent was evaporated and the residue was crystallized from acetone / hexane to provide 3.3 g (72%) of the title nucleoside; XH-NMR (DMSO-d6): d 8.84 '(s, 1H), 8.20 (s, ÍH), 6.21 (s, ÍH), 4.00-3.60 (m, sugar), 0.84 (s, 3H); MS: 426.26 (M + H); Tm: 182-185 ° C.

Step 4: 7- (2 '-methyl-β-D-ribofuranosyl) -4-amino-5-iodo-pyrrolo [2, 3-d] pyrimidine: The nucleoside (1.5 g, 3.5 mmol) prepared above was treated with liquid ammonia at 8'5 ° C for 24 hours in the pressurized metal reactor. After evaporation of the ammonia, the residue was dissolved in methanol and co-evaporated with silica gel (approximately 20 mL). The silica gel carrying the product was placed on the column (5 x 10 cm) with silica gel in acetone collecting fractions of 50 mL. Fractions 2-8 contained the title compound. The acetone was evaporated and the residue was crystallized from methanol / acetonitrile to provide 1.2 g (84%) of the title nucleoside; Tm 220-222 ° C- (decomposition); XH-NMR (DMSO-de): d 8.20 (s, ÍH), 7.80 (s, ÍH), 6.80-6.50 (bs, ÍH), 6.09 (s, 1H), 5.19 (t, 1H), 5.13-5.11 (m, 2H), 4.00-3.70 (m, 3H), 3.60-3.20 (m, ÍH), 0.84 (s, 3H); MS 407.32 (M + H).

Step 5: Preparation of the title compound: A solution of the prepared compound was prepared o9 in Step 4 above (50.0 mg, 0.1231 mmol) in 5 mL of dry tetrahydrofuran, which was then purged with air by slow bubbling with carbon monoxide. To this solution was added,. titanium ester (triphenylphosphine) palladium (O) (2.8 mg, 0.0025 mmol). The reaction was stirred for 10 minutes, and then heated to 50 ° C. Then, tributyltin hydride in THF (35.9 μL, 0.1354 mmol) was added slowly during 2.5 hours during this time CO gas was continuously being bubbled. Upon completion, the mixture was concentrated in vacuo. The crude reaction was dissolved in 1 mL of dimethylformamide, diluted to 50 mL with deionized water, and then washed through a pad of celite. The solution was again concentrated to dryness, then it was redissolved in 1.0 mL of dimethylformamide and 3.5 mL of water. The title compound was purified by HPLC; XH-NMR (DMSO-de): d 9.64 (s, ÍH), 8.60 (s, 1H), 8.18 (s, 1H), 7.62 (m, 2H), 6.14 (s, ÍH), 5.28-5.19 (, 3H), 3.9-4-3.71 (m, 4H), 0.75 (s, 3H); MS: 309.11 (m / z).

Example 13 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine To a solution of the title compound (0.1 g, 0.325 mmol) of Example 12 in 10 mL of 50% ethanol was added hydroxylamine hydrochloride (0.073 g, 1.05 mmol) and KOAc (0.103 g, 1.05 mmol) and heated to 60 ° C for 2.5 hours. The crude mixture was concentrated, diluted with water and purified by reverse phase HPLC on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water of 0 to 30% for 30 min at 10 mL / min to provide 10 mg of the title compound; XH-NMR (CD30D): d 0.86 (s, 3H), 3.8-4.2 (m, 4H), 6.21 (s, 1H), • 7.78, 8.06, 8.08 (s, ÍH). MS: 324.15 (M + H). - Example 14 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine To a solution of the compound of Step 4, Example 2 (60 mg, 0.148 mmol) in 1 mL of DMSO was added KOAc (44 mg, 0.449 mmol), bis (neopentylglucoloto) diboro (40 mg, 0.177 mmol). The mixture was degassed with argon and P (Ph3) 2PdCl2 (3.1 mg.004 mmol) was added and the reaction was heated at 80 ° C for 4 hours. The mixture was diluted with water and purified by HPLC in RP on a Fenominex column (250 x 20 mm)? using a gradient of acetonitrile in water (with 0 to 50% for 30 min at 10 mL / min to provide 16 mg (33%) of the title compound; XH-NMR (D20): d 8.12 (s, ÍH), 7.75 (s, 1H), 6.12 (s, ÍH), 4.2-3.8 (m, 4H), 0.70 (s, 3H), MS 325. 13 (M + H).

Example 15 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine To a solution of the compound from Step 5, Example 13 in anhydrous isopropanol, activated molecular sieves were placed and the solution was acidified with HCl. The solution was heated between 50-80 ° C until the starting material had been consumed. The resulting diacetal was purified by HPLC on RP on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water (0 to 50% for 30 min at 10 mL / min.

A 'Example 16 Preparation of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine To a solution of the compound from Step 5, Example 12 (20 mg, 0.05 mmol) in DMF was added hydrazine (2 μL, 0.060 mmol) and the reaction was stirred at 50 ° C for 2.5 hours. The crude reaction was purified directly on HPLC in RP on a Fenominex column (250 x 20 mm) using a gradient of acetonitrile in water (with 0 to 50% for 30 min at 10 mL / min to provide 12 mg (75%) of the compound title: 1H-NMR (CD3OD): d 8.03 (s, ÍH), 7.85 (s, 1H), 7.68 (s, ÍH), 6.21 l (s, ÍH), 4.115-3.8 (m, 4H, sugar ), 0.85 (s, 3H); MS: 323.14 (M + H).

. '•' '•' IÍ4 '• _ ... ".'"! Example 17 Synthesis of 5 '-triphosphate' of 7- (2'-methyl-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2, 3-d] pyrimidine 5 '-triphosphate 7- (2'-methyl-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine (0.1 mmol) it was co-evaporated 3 times with dry DMF, dissolved in 2 mL of PO (OMe) 3, cooled to 5 ° C and P0C13 (35 μL) and a proton sponge (64 mg) were added. The mixture was stirred at -5 ° C for 3 h. then tetrabutylammonium pyrophosphate (2 mmol, 4 mL of a 0.5M solution of DMF) was added and the mixture was held for 2 h more at the same temperature. The reaction was quenched with (Et3N) HC03 buffer (pH 7.5) followed by water. The solvents were evaporated, the residue was dissolved in methanol (3 mL) and precipitated with ether (30 mL). The solid residue was purified by ion exchange HPLC on a Vydac column (250 x 10 mm) from 0 to 100% B. Buffer A is NaH2P0 / Na2HP04 25 mm, pH 3, Buffer B is NaH2P0 / Na2HP04 310 mm, pH 3. The last peak was collected, concentrated to the volume of 5 mL and re-purified on HPLC in RP on a Fenominex column (250 x 20 mm) in a gradient from 0 to 100% of buffer B in the shock absorber A. The buffer is aqueous solution 0.5 M of triethylammonium acetate, buffer B is a solution of acetonitrile 0.5 M of triethylammonium acetate. The fractions containing the title compound were combined, evaporated, co-evaporated 3 times with water and lyophilized from water.

Example 18 'Synthesis of 5' -phosphate of 7- (2'-methyl-β-D-ribofuranosyl) -4-amino-5 (2-phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine 7- (2'-methyl-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine (0.1 mmol) was coevaporated 3 times with DMF dried, dissolved in 2 mL of PO (OMe), cooled to 5 ° C and P0C13 (35 gel) and a proton sponge (64 mg) were added. The mixture was stirred at 5 ° C for 3 h. The reaction was quenched with buffer (Et3N) HC? 3 buffer (pH 7.5) followed by water. The solvents were evaporated, the residue was dissolved in methanol (3 mL) and precipitated with ether (30 mL). The solid residue was purified by ion exchange HPLC on a Vydac column (250 x 10 mm) from 0 to 100% B. Buffer A is NaH2P04 / Na2HP0 25 mm, pH 3, buffer B is NaH_P04 / Na_HP0 310 mm, pH 3. The last peak was collected, concentrated to the volume of 5 mL and re-purified through HPLC in RP on a Fenominex column (250 x 20 mm) in a gradient of 0 to 100% of buffer B in the shock absorber A. The buffer A is a 0.5 M aqueous solution of triethylammonium acetate, the B-buffer is a solution in 0.5 M acetonitrile of triethylammonium acetate. The fractions containing the title compound were combined, evaporated, co-evaporated 3 times with water and lyophilized from water; MS: 384.12 (M-H); ^ -NMR: 7.97 & 7.67 (s, 1H each, base), 6.12 (s, ÍH, Hl), 4.10-3.85 (, 4H, sugar), 3.15 (s, 1H, ethynyl), 0.87 (s, 3H, methyl-2 '); 31P-NMR: 5.02 (s¿ 1P).

Biological Examples Example 1. Anti-hepatitis C activity Compounds can exhibit anti-hepatitis C activity by inhibiting HCV polymerase, inhibiting other enzymes needed by the replication cycle, or by other pathways. Several analyzes have already been published to assess these activities. A general method that assesses the total increase of HCV virus in crops is set forth in U.S. Patent No. 5,738,985 to Miles et al. In vitro analyzes have been reported in Ferrari et al. Jnl. of Vir. , 73: 1649-1654, 1999; Ishii et al. , Hepatology, 29: 1227- '• "• ßs- <'" •? Í7 -t '• - 1235, 1999; Lohmann et al., Nl of Bio. Chem. , 274: 10807-10815, 1999; , and Yamashita et al., Jpl. Bio. Chem., 273: 15479-15486, 1998. WO 97/12033, filed September 27, 1996, by Emory University, which lists C. Hagedorn and A. Reinoldus as inventors claiming the priority of the patent application. U.S. Provisional No. Serial No. 60 / 004,383, filed September 1995, describes an HCV polymerase assay that can be used to evaluate the activity of the compounds described herein. Another HCV polymerase analysis had been reported by Bartholomeusz, et al. , Hepatitis C Virus (HCV) RNA, polymerase assay using cloned HCV non-structural proteins; Antiviral Therapy 1996: 1 (Supp 4) 18-24. Selections that measure the reduction in kinase activity of HCV drugs are set forth in U.S. Patent No. 6,030,785, to Katze et al. , U.S. Patent No. 6,228,576, Delvecchio, "and U.S. Patent No. 5,759,795 to Jubin, et al. The selections that measure the protease inhibitory activity of the proposed HCV drugs are set forth in US Pat. U.S. Patent No. 5,861,267 to Su et al., U.S. Patent No. 5,739,002 to De Francesco et al., and U.S. Patent No. 5,597,691 to Houghton et al.

Example 2. Analysis with replicons A cell line, ET (Huh-lucubineo-ET) was used to select the compounds of the present invention for RNA polymerase dependent on HCV RNA. The ET cell line was stably transfected with RNA transcripts harboring an I389luc-ubi-neo / NS3-3 '/ ET; the replicon with the luciferase-ubiquitin-neomycin phosphotransferase fusion protein and EMCV-IRES leading to the NS3-5B polyprotein that contained the cell culture adaptation mutations (E1202G; T1280I; K1846T) (Krieger et al, 2001 and without publishing). ET cells were developed in DMEM, supplemented with 10% fetal calf serum, Glutamine 2 mm, Penicillin (100 IU / mL) / Streptomycin (100 μg / mL), non-essential amino acids Ix, and 250 μg / mL of G418 ("Geneticina"). They were available through Life Technologies (Bethesda, MD). Cells were plated at 0.5-1.0 x 104 cells / well in 96-well plates and incubated for 24 hrs before adding the nucleoside analogue. Then the compounds were added to the cells to reach a final concentration of 50 or 100 μM, whatever the desired concentration. For these determinations,, -.- • •,; 6 dilutions of each compound were used. The compounds were typically diluted 3 times to cover a 250-fold concentration variation. Luciferase activity will be measured 48-72 hours after adding a lysis buffer and substrate (catalog number Glo-lysis buffer E2661 and the Bright-Glo E2620 Pr-omega leuciferase system, Madison, WI). The cells will not be very confluent during the analysis. Percent inhibition of replication will be plotted against any control of the compound. Under the same conditions, the cytotoxicity of the compounds will be determined using a cell proliferation reagent, WST-1 (Roche, Germany). The IC50 and TC50 values were calculated by adjusting the% inhibition at each concentration 'of the following equation, where b is the Hill coefficient: % inhibition = 100% / [IC50 / [I]) b + l] Example 3. Cloning and expression of the recombinant HCV-NS5b The coding sequence of the NS5b protein was cloned by PCR from pFKI389luc / NS3-3 '/ ET as described by Lohmann, V., et al. , (1999) Science 285, 110-113 using the following primers: aggacatggatccgcggggtcgggcacgagacag (SEQ ID NO.1) aaggctggcatgcactcaatgtcctacacatggac (SEQ ID NO.2) The cloned fragment was losing 21 amino acid residues in the C terminus. The cloned fragment was inserted into an IPTG-inducible expression plasmid that provides an epitope tag (His) 6 at the carboxy terminus of the protein. The recombinant enzyme is expressed in XL-1 cells and after induction of expression, the protein is purified using affinity chromatography on a nickel-NTA column. The storage condition is 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 M DTT, 20% glycerol at -20 ° C.

Example 4. Analysis of the enzyme HCV-NS5b The activity of the polymerase was analyzed by measuring the incorporation of the radiolabelled UTP into an RNA product using a biotinylated heteropolymer template, which includes a portion of the HCV genome. Typically, the assay mixture (50 μL) contained 10 M Tris-HCl (pH 7. 5), 5 mM MgCl 2, 0.2 mM EDTA, 10 mM KCl, 1 unit / μL of RNAsin, 1 mM DTT, 10 μM each of NTP, including [3 H] -UTP, and 10 ng / μl of a heteropolymer template. The test compounds were initially dissolved in 100% DMSO and further diluted in an aqueous buffer containing 5% DMSO. Typically, the compounds were tested at concentrations between 1 NM and 100 μM. The reactions were started with the addition of an enzyme and allowed to continue at 37 ° C for 2 hours. The reactions were inactivated with 8 μL of 100 mM EDTA and the reaction mixtures (30 μi.) Were transferred to microtiter plates in the proximity of scintillation coated with streptavidin (FlashPlates) and incubated at 4 ° C overnight. The incorporation of radioactivity was determined by scintillation counting. The results for the replicon analysis or the enzymatic analysis used to test the compounds of this invention are shown in the following Table II.

Table II t t Formulation Examples The following are representative pharmaceutical formulations containing a compound of the present invention. Example 1: Tablet formulation The following ingredients were thoroughly mixed and pressurized into tablets with a single line.

Ingredient quantity per tablet, mg Compound of this invention 400 Corn starch 50 Croscarmellose sodium 25 Lactose 120 Magnesium stearate 5 Example 2: Capsule formulation The following ingredients were thoroughly mixed and loaded into a gelatin capsule with hard coating.

Ingredient quantity per capsule, mg Compound of this invention 200 Lactose, dry sprayed 148 Magnesium stearate 5 Example 3: Suspension formulation The following ingredients were mixed to form a suspension for oral administration. • Ingredient Amount Compound of this invention 1.0 g Fumaric acid 0.5 g Sodium chloride '2.0 g Methylparaben 0.15 g Propylparaben. 0.015 g Granulated sugar 25.0 g Sorbitol (70% solution) 13.0.0 g Veegum K (Vanderbilt Co.) 1.0 g Flavor 0.035 mL Dyes 0.5 mg Distilled water q.b. for 100 mL Example 4: Injectable Formulation The following ingredients were mixed to form an injectable formulation.

Ingredient • Amount Compound of this invention 400 Buffer solution with sodium acetate, 0.4 M 2.0 mL HCl (IN) or NaOHG (IN) c.b. for an adequate pH Water (distilled, sterile) q.b. for 20 mL Example 5: Formulation of Suppositories A suppository with a total weight of 2.5 g was prepared by mixing the compound of the invention with Witepsol® H-15 (triglycerides of saturated vegetable fatty acid, Riches-Nelson, Inc., New York), and had the following composition: Ingredient Amount Compound of this invention 500 mg Witepsol® H-15 the remainder References The following applications are cited in this application as indices: 1. Giangaspero, et al., Aren. Virol. Suppl., 7: 53-62 (1993); 2. Giangaspero, et al., Int. J. STD. AIDS, 4 (5): 300-302 (1993; '. • 3. Yolken, et al., Lancet, 1 (8637): 517-20 (1989); 4. Wilks, et al., Lancet, 1 ( 8629): 107 (1989); 5. Giangaspero, et al., Lancet, 2: 110 (1988); 6. Potts, et al., Lancet, 1 (8539): 972-973 (1987); , et l., "Hepatitis C: therapeutic perspectives." Foru (Genova), 11 (2) -.154-62 (2001), 8. Dyck, et al., Antivir, Chem. Chemother, 11 (2) : 79-96 (200Q); 9. Devos, et al., International Patent Application Publication No. WO 02/18404 A2, published March 7, 2002. 10. Sommadossi, et al., International Application Publication Patent No. WO 01/90121, published May 23, 2001. 11. Carroll, SS, et al., International Patent Application Publication No. WO 02057287, published July 25, 2002. 12. Carrollf SS , et al., International Patent Application Publication No. WO 02057425, published July 25, 2002; 13. Roberts, et al., United States Patent Application Serial No. 10 / 861.0 90, filed on June 4, 2004. 14. Roberts, et al. , U.S. Patent Application Serial No. 10 / 861,311, filed June 4, 2004. All of the above publications and applications are hereby incorporated by reference in their entirety to the same extent as if each publication or individual application was I would have indicated specifically and individually to be incorporated as a reference in its entirety.

Claims (19)

NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and, therefore, the content contained in the following UPLINICATIONS is claimed as property: 1. A compound of Formula I, characterized in that Y is selected from the group consisting of a bond, -CH2- or -0-; each of W, W1 and W2 is independently selected from the group consisting of hydrogen and a pharmaceutically acceptable prodrug; and T is selected from the group consisting of a) -CSC-R, wherein R is selected from the group consisting of i) tri (C_-C4) alkylsilyl, -C (0) N01R2, alkoxyalkyl, heteroaryl ,. • substituted heteroaryl, and phenyl substituted with 1 to 3 substituents selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl, carboxylester, cyano, cycloalkyl, substituted cycloalkyl, cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl, substituted heteroaryl, .hydrazino, hydroxyl, nitro, thiol, and S (0) mR3; wherein R1 and R2 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic with the proviso that only one of R1 and R2 is amino or substituted amino, and further wherein R1 and R2, together with the pendant nitrogen atom thereof, forms a substituted heterocyclic or heterocyclic; R3 is selected from the group consisting of alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic; and m is an integer equal to 0, 1 or 2; ii). -C (0) 0R14, wherein R14 is hydrogen, alkyl or substituted alkyl; b) -CH = CH-Q2 where Q2 is selected from hydrogen, or cis-alkoxy, c) -C (0) H, d) -CH = NNHR15, where R15 is H or alkyl, e) -CH = N (OR15), wherein R15 is as defined above, f) -CH (OR16) 2, wherein R16 is (C3-C6) alkyl, and g) -B (OR15,) 2, wherein R15 is as defined above, and pharmaceutically acceptable salts or partial salts thereof 2. The compound according to claim 1, characterized in that each of W, W1, and W2 is independently hydrogen or a pharmaceutically acceptable prodrug selected from the group consisting of acyl, oxyacyl, phosphonate, phosphate esters, phosphate, phosphonamidate, phosphorodiamidate, phosphoramidatomonoester, cyclic phosphoramidate, cyclic phosphorodiamidate, phosphoramidate diester, and -C (O) CHR30NH2 wherein R30 is selected from the group which consists of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl and a side chain of an amino acid 3. The compound according to claim 2, characterized in that W is H. 4. The compound according to claim 2, characterized in that W1 is H. 5. The compound according to claim 2, characterized in that W2 is H. The compound according to claim 2, characterized in that W and W1 are H. 7. The compound according to claim 2, characterized in that W and W2 are H. 8. The compound according to claim 2, characterized in that W1 and W2 are H. The compound according to claim 2, characterized in that W, W1 and W2 are H. 10. The compound according to claim 2, characterized in that Wx and W2 are hydrogen and W is represented by the formula: wherein R30 is as defined above,
1. R8 is hydrogen or alkyl and R10 is selected from the group consisting of alkyl, substituted alkyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic. 11. The compound according to claim 2, characterized in that W and W2 are hydrogen and W1 is represented by the formula: wherein R30 is as defined above. 12. The compound according to any of claims 1 to 11, characterized in that the T is -C = CR and R is selected from the group consisting of tri (C_-C4) alkylsilyl, -C (0) NR1R2, alkoxyalkyl, heteroaryl, substituted heteroaryl, phenyl and phenyl substituted with 1 to 3 substituents selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, aminoacyl, amidino, amino, substituted amino, carboxyl, carboxylester, cyano, cycloalkyl, substituted cycloalkyl, cycloalkoxy, substituted cycloalkoxy, guanidino, halo, heteroaryl, substituted heteroaryl, hydrazino, hydroxyl, nitro, thiol, and -S 0) mR 3; wherein R1 and R2 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, amino, substituted amino,
2. . , '"., To aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic with the proviso that only one of R1 and R2 is amino or substituted amino, and furthermore wherein R1 and R2, together with the pendant nitrogen thereof forms a heterocyclic or substituted heterocyclic, R3 is selected from the group consisting of alkyl, substituted alkyl, amino, substituted amino, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic, and m is a whole number equal to 0, 1 or 2, or a pharmaceutically acceptable salt thereof 13. The compound according to claim 12, characterized in that R is selected from the group consisting of -C (0) NH2, -Si (CH3) 3, pyrid-2-yl, 4-methoxyphenyl, and -CH (0CH2CH3) 2.-14. The compound according to any of claims 1 to 11, characterized in that the T is -C = CR and R is -C (0 ) 0H 15. The compound according to any of the claims s 1 to 11, characterized in that the T is -C = C-R, R is -C (0) OR14, and R14 is alkyl. 16. A compound according to claim 15, characterized in that "R14 is methyl, or ethyl. 17. The compound according to any one of claims 1 to 11, characterized in that the T is -CH = CH-Q2, wherein Q2 is selected from hydrogen or cis-methoxy. 18. The compound according to any of claims 1 to 11, characterized in that T is -C (= 0) H. 19. The compound according to any of claims 1 to 11, characterized in that T is -CH = NNHR15 wherein R15 is independently selected from the group consisting of hydrogen and alkyl. twenty-. The compound according to any of claims 1 to 11, characterized in that the T is -CH = N (OR15) wherein R15 is independently selected from the group consisting of hydrogen and alkyl. 21. The compound according to any of claims 1 to 11, characterized in that T is -CH (OR16) 2 wherein Rld is independently (C3-Ce) alkyl. 22. The compound according to any of claims 1 to 11, characterized in that T is -B (OR15) 2, wherein R15 is independently selected from the group consisting of hydrogen and alkyl. 23. A compound selected from the group consisting of: 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2'-trimethylsilyletin-1-yl) -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-2-yl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-4-yl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (4-methoxyphenyl) -etin-i-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxamidoetin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(3, 3-diethoxy) proparg-1-yl] -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(N, N-dimethyl-2-carboxamido) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(N-amino-2-carb'oxamido) etin-1-yl] -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (2'-trimethylsilylenetin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-2-yl) etin-1-yl] -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-4-yl) etin-1-yl] -pyrrolo [2,3 -d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofur'anosyl) -4-amino-5- (2- (4-methoxyphenyl) etin-1-yl) -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (2-carboxamidoetin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [(3, 3-diethoxy) proparg-1-yl] -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [2- (N, N-dimethylcarboxamido) etin-1-yl] -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5 '-phospho-β-D-ribofuranosyl) -4-amino-5- [2- (N-aminocarboxamido) etin-1-yl] -pyrrolo [2, 3-d] ] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2'-trimethylsilylethin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-2-yl) etin-1-yl] -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-4-yl) etin-1-yl] -pyrrolo [2, 3 -d] pyrimidine; '7- (2' -C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-methoxyphenyl) etin-1-yl) -pyrrolo [2, 3- d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2-carboxamidoetin-lyryl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [(3, 3-diethoxy) proparg-1-yl] -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [(N, N-dimethyl-2-carboxamido) etin-1-yl] -pyrrolo [2 , 3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [(N-amino-2-carboxamido) etin-1-yl] -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (2'-trimethylsilylethyl-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribpfuranosyl) -4-amino-5- [2- (pyrid-2-yl) etin-1-yl) -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-4-yl) etin-1-yl) -pyrrolo [2, 3 -d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-methoxyphenyl) etin-1-yl) -pyrrolo [2, 3-d ] pyrimidine; 7- (2 '-C -methyl-5' -triphospho-β-D-ribofuranosyl) -4-amino-5- (2-carboxamidoetin-1-yl) -pyrrolo [2, 3-d] irimidine; 7- (2'-C-methyl-5'-tri- phospho-β-D-ribofuranosyl) -4-amino-5- [(3, 3-diethoxy) proparg-1-yl] -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5'-triflufo-β-D-ribofuranosyl) -4-amino-5- [(N, N-dimethylcarboxylamido) etin-1-yl] -pyrrolo [2, 3-d ] pyrimidine; and 7- (2'-C-methyl-5'-triflufo-β-D-ribofuranosyl) -4-amino-5- [(N-aminocarboxylamido) etin-1-yl] -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxytin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (2-carboxytin-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2-carboxytin-1-yl) -pyrrolo [2, 3-d] pyrimidine; and 7- (2'-C-methyl-5'-triflufo-β-D-ribofuranosyl) -4-amino-5- (2-carboxytin-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-β-D-riboiuranosyl) -4-amino-5- [(2-carboxyethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; • f • -, - > i- .. < i and 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(2-carboxymethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [(2-carboxyethyl) etin-1-yl] -pyrrolo [2,3-d] irimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- [(2-carboxymethyl) etin-1-yl] -pyrrolo [2,3-d] irimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [(2-carboxyethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- [(2-carboxymethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- [(2-ca-rboxiethyl) etin-1-yl] -pyrrolo [2, 3-d] ] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- [(2-carboxymethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine; • 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (4-fluorophenyl) ethyn-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (4-methylphenyl) ethyn-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-phospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-fluorophenyl) etin-1-yl) -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-methylphenyl) etin-1-yl) -pyrrolo [2,3-d] ] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-fluorophenyl) etin-1-yl) -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2- (4-methylphenyl) etin-1-yl) -pyrrolo [2, 3-d ] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofranosyl) -4-amino-5- (2- (4-fluorophenyl) etin-1-yl) -pyrrolo [2,3- d] pyrimidine; and 7- (2'-C-methyl-5 '-triphospho-β-D-riboiuranosyl) -4-amino-5- (2- (4-methylphenyl) etin-1-yl) -pyrrolo [2, 3 d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (eten-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxy-ethen-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-monophospho-β-D-ribofuranosyl) -4-amino-5- (ethyl-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-monophospho-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxy-ethen-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (eten-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxy-ethen-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (ethyl-1-yl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxy-ethen-1-yl) -pyrrolo [2, 3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine; 7- (2 '-methyl-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5'-phospho-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-diphospho-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine; 7- (2'-C-methyl-5 '-triphospho-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine; and pharmaceutically acceptable salts or partial salts thereof. 24. 7- (2 '' - C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (trimethylsilyl) -etin-1-yl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 25. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(2-pyrid-2-yl) etin-1-yl] -pyrrolo [2, 3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 26. 7- (2 '-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (pyrid-4-yl) etin-1-yl] -pyrrolo [2, 3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 27. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [2- (4-methoxyphenyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 28 '. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxamido etin-1-yl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt of it. 29. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [3, 3-diethoxyproparg-yl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 30. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(N, N-dimethyl-2-carboxylamido) etin-1-yl] -pyrrolo [2, 3 d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 31. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(N-amino-2-carboxylamido) etin-1-yl] -pyrrolo [2, 3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 32. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-carboxytin-1-yl) -pyrrolo [2,3-d] pyrimidine or. a pharmaceutically acceptable salt or a partial salt thereof. 33. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(ethyl 2-carboxyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof.
3. 3. 4'. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- [(2-carboxymethyl) etin-1-yl] -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt of it. 35. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-phenyletin-1-yl) -pyrrolo [2,3-d] irimidine or a pharmaceutically acceptable salt or a partial salt of it. 36. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (4-fluorophenyl) etin-1-yl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 37. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2- (4-methylphenyl) ethyn-1-yl) -pyrrolo [2,3-d] irimidine or a pharmaceutically acceptable salt or a partial salt thereof. 38. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (eten-1-yl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a salt partial of it. 39. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (2-cis-methoxy-ethen-1-yl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 40. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (formyl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof . 41. 7- (2'-methyl-β-D-ribofuranosyl) -4-amino-5- (hydrazono) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof. 42. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (oxycarbaldehyde) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof . 43. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (diisopropoxymethyl) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt thereof . 4
4. 4. 7- (2'-C-methyl-β-D-ribofuranosyl) -4-amino-5- (boronic acid) -pyrrolo [2,3-d] pyrimidine or a pharmaceutically acceptable salt or a partial salt of the same 4
5. 5. A pharmaceutical composition comprising a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound according to any of claims 1 to 11 or 23, to 44 or a mixture of two or more of these compounds. 4
6. 6. A method for the treatment of a viral infection in a mammal caused at least in part by a virus of. the Faviviridae virus family, characterized in that the method comprises administering to a mammal, which has been diagnosed with this viral infection or is at risk of developing this viral infection, a pharmaceutical composition according to the •, r - .. - • .- .., '. ,:.-.-,. - - '•,'. ' claim 4
7. 7. The method according to claim 46, characterized in that the virus is the hepatitis C virus. 4
8. 8. The method according to claim 47, in combination with the administration of a therapeutically effective amount of '»- one or more active agents against HCV. 4
9. 9. The method according to claim 48, characterized in that the active agent is ribavirin, levovirin, viramidine, thymosin alfa-1, an inhibitor of serine protease-NS3, an inhibitor of inosine monophosphate dehydrogenase, interferon-alpha, pegylated interferon-alpha , alone or in combination with ribavirin or levovirin. 50. The method according to claim 49, characterized in that the active agent against HCV is interferon-alpha or pegylated interferon-alpha alone or in combination with ribavirin or levovirin.