MXPA06007351A - Methods for inducing differentiation of undifferentiated mammalian cells into osteoblasts - Google Patents

Abstract

The present invention provides methods for inducing differentiation of undifferentiated mammalian cells into osteoblasts, and methods for identifying a compound that induces differentiation of undifferentiated mammalian cells into osteoblasts. In addition, the present invention provides polynucleotides and vectors, and the use thereof as a medicament for the treatment of a disease involving a systemic or local decrease in mean bone density. Moreover, the present invention provides methods for in vitro production of bone tissue, osteoblast cells and methods for diagnosing a pathological condition involving a systemic or local decrease in mean bone density or a susceptibility to the condition.

Description

METHODS FOR INDUCING THE DIFFERENTIATION OF NON-DIFFERENTIATED MAMMALI CELLS IN OSTEOBLASTS Description of the Invention The present invention relates to methods for inducing the differentiation of undifferentiated mammalian cells into osteoblasts. The invention further relates to methods for identifying one or more compounds that induce differentiation, as well as compounds per se to induce differentiation. Bones contain two distinct lineages of cells, bone-forming cells (eg, osteoblasts) and bone-resorbing cells (eg, osteoclasts). It is a dynamic tissue that is being continuously destroyed (reabsorbed) and formed by an intricate interplay between these osteoblasts and osteoclasts. For osteoblasts, a cascade of transcription factors and growth factors involved in the progress of progenitor cells to functional osteoclasts is well establd. In contrast, little is known about the lineage of osteoblasts. Osteoblasts originate from differential mesenchymal progenitor cells (MPCs). During differentiation in osteoblasts, the activity of alkaline phosphatase of the bones (BAP) becomes up regulated. The Ref.173647 Bone formation in vivo occurs through two distinct routes during embryonic development: endochondrial or intramembranous ossification (Figure 1). As shown in this figure, the mesenchymal progenitor or stem cells represent the starting points for both forms of. bone formation During intramembranous ossification, flat bones such as those of the skull or clavicles are formed directly from the condensations of mesenchymal cells. During the formation of long bones, such as the bones of the extremities, mesenchymal condensations lead first to an intermediate cartilage compound that is invaded during further development by endothelial cells, osteoclasts and mesenchymal cells that will differentiate into osteoblasts and osteocytes (from Nakashima and de Crombrugghe, 2003). Several diseases are already known which are caused by an alteration of the balance finely tuned between bone resorption and bone formation. These skeletal diseases represent a large number of patients: hypercalcemia of malignancy, Paget's disease, inflammatory diseases of the bones similar to rheumatoid arthritis and periodontal disease, focal osteogenesis that occurs during metastasis of the skeleton, Crouzon syndrome, rickets, opsismodisplasia, disease of Toulouse-Lautrec / picnodisostosis, osteogenesis imperfecta, but the most important individual bone disease is osteoporosis. Osteoporosis affects 1 to 5 women out of a total of 50 and 1 to 20 out of 50 men. Several treatments are available to the patient. These are often based on the net increase in bone resorption, ie: - hormone replacement therapy (HRT) - selective estrogen receptor modulators (SERMs) - biophosphonates - calcitonin. Although these treatments reduce bone resorption, they do not cancel the fracture because the lost bone is not filled sufficiently. The fracture will only be stopped when bone formation is sufficiently increased. Therefore, there is a great interest in identifying osteogenic routes that lead by themselves to therapeutic intervention with bone anabolism as an effect. Commonly, only one anabolic bone therapy has reached the market of osteoporosis: the parathyroid hormone (PTH) 1-34. PTH plays bone anabolic effects when administered intermittently. The treatment is very problematic because this biopharmaceutical substance needs to be injected daily for the patient. In addition, tumor formation was observed when animals were treated with high dosages. Also, the treatment is very expensive. Another class of bone anabolics, bone morphogenetic proteins (BMPS), have been approved but only for convenient markets. There are disadvantages to its use as therapeutic agents to improve bone healing. The receptors for bone morphogenetic proteins have been identified in many tissues, and BMPs by themselves are expressed in a wide variety of tissues in specific temporal and spatial configurations. This suggests that BMPs can have effects on many different tissues of bones, potentially limiting their usefulness as therapeutic agents when administered systematically. Accordingly, there is a need for novel anabolics that overcome one or more of the disadvantages of the anabolics mentioned above. It is an object of the present invention to provide a method for inducing the differentiation of undifferentiated mammalian cells into osteoblasts. This object is achieved by providing a method for inducing the differentiation of non-differentiated mammalian cells into osteoblasts, comprising contacting the undifferentiated cells with an inhibitor of any of the polypeptides listed in Table 4, and / or fragments and / or polypeptide derivatives. It is to be understood that according to the present invention, the term "inhibitor of a polypeptide" refers to any type of molecule that inhibits, for example, down-modulates the biological activity of the polypeptide by inhibiting the expression and / or translation of the polypeptide, or by inhibition of the polypeptide per se. The undifferentiated cells are the pluripotent cells that are in an initial stage of specialization, that is to say, that still do not have their final function and can be induced to form almost any type of given cell. In particular, these are cells that have not yet been differentiated for example into osteoblasts or osteoclasts. Such cells are for example, blood cells and cells present in the bone marrow, as well as cells derived from adipose tissue. In addition, cells that can still be differentiated in mesenchymal precursor cells are contemplated in the present invention, such as, for example, totipotent stem cells such as embryonic stem cells. Differentiation of osteoblasts can be measured by measuring the level of enzymes that are induced during the differentiation process, such as alkaline phosphatase (BAP), type 1 collagen, osteocalcin and osteopontin. The activity of alkaline phosphatase can be measured by adding a solution (Sigma) of methylumbelliferyl heptaphosphate (MUP) to the cells. The fluorescence generated during the segmentation of the MUP substrate by the activity of AP is measured on a fluorescence plate reader (Fluostar, BMG). In a preferred embodiment of the present invention, the inhibitor is an inhibitor of expression or translation that inhibits the expression or translation of a polyribonucleotide encoding the polypeptide. In another preferred embodiment, the inhibitor is a nucleic acid that expresses the inhibitor of expression or translation that inhibits the expression or translation of a polyribonucleotide encoding the polypeptide. Preferably, the nucleic acid is included within a vector. More preferably, the vector is an adenoviral, retroviral, adeno-associated viral, lentiviral vector or a sendaiviral vector. Nucleic acids expressing the inhibitor, for example antisense RNA, ribozyme, antisense oligodeoxynucleotide (ODN), and / or siRNA, such as vectors and viral vectors, have the advantage that they produce the inhibitors continuously. Vectors include plasmids and viruses. In the vector, the nucleic acid sequence can be placed under the control of a promoter appropriate, such as CMV, HSV, TK, SV40, or the elongation factor among others. Prolonged production of the inhibitor will cause a longer inhibitory effect and fewer transfections will be necessary. In a particular preferred embodiment, the inhibitor is selected from the group consisting of an antisense RNA, a ribozyme which cleaves the polyribonucleotide, an antisense oligodeoxynucleotide (ODN), and a small interfering RNA (siRNA), which is sufficiently homologous with respect to to a portion of the polyribonucleotide such that siRNA is capable of inhibiting the polyribonucleotide that could otherwise cause the production of the polypeptide. Chemically modified variants of the inhibitors are also part of the present invention, and refer to inhibitors that are modified to improve their stability. The inhibitors can thus contain a variety of modifications that confer resistance to nucleolytic degradation such as, for example, modified internucleoside linkages, modified nucleic acid bases and / or modified sugars and the like. The antisense oligonucleotides of the invention can also be modified by chemically linking the oligonucleotide to one or more portions or conjugates to improve the activity, cellular distribution, or cellular uptake of the antisense oligonucleotide. Such portions or conjugates include but are not limited to lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids, polyamines, polyethylene glycol (PEG), or palmityl portions. Other forms of chemical modification, including but not limited to modifications of 2 '-O-methyl-, methyl-phosphonate-, phosphothioate, inverted-end (3'-3'- bond), are also possible. One type of expression inhibiting agent is a nucleic acid that is antisense to a nucleic acid that comprises any of the genes listed in Table 4. For example, an antisense nucleic acid (eg, DNA) can be introduced into cells in vitro, or administered to a subject in vivo, as genetic therapy to inhibit the cellular expression of nucleic acids comprising any of the genes listed in Table 4. The antisense nucleic acid is proposed to mean a nucleic acid that it has a nucleotide sequence that interacts through the formation of base pairs with a specific complementary nucleic acid sequence, involved in the expression of the target such that the expression of the gene is reduced. Preferably, the specific, complementary nucleic acid sequence involved in the expression of the gene is a genomic DNA molecule or a mRNA molecule that encodes the gene. This DNA molecule genomic can comprise regulatory regions of the gene, or the coding sequence for the mature gene. The antisense nucleic acids preferably comprise a sequence containing from about 17 to about 100 nucleotides and more preferably, the antisense nucleic acids comprise from about 18 to about 30 nucleotides. The antisense nucleic acids of the invention are preferably fragments of nucleic acid capable of specifically hybridizing with all or part of a nucleic acid encoded by any of the genes listed in Table 4 or the corresponding messenger RNA, or they may be sequences of DNA whose expression in the cell produces the RNA complementary to all or part of the mRNA comprising the nucleic acid sequences encoded by any of the genes listed in Table 4. The antisense nucleic acids can be prepared by the expression of the whole or part of a sequence selected from the group of nucleic acid sequences encoded by any of the genes listed in Table 4, in the opposite orientation. Preferably, the antisense nucleic acid is prepared by the expression of a selected sequence consisting of SEQ ID NO: 1-226 and SEQ ID NO: 247-333, in the opposite orientation. Preferably, the antisense sequence is at least approximately 17 nucleotides in length. The term "complementary to a nucleotide sequence in the context of antisense nucleic acids and methods" therefore means sufficient complementarity to such a sequence to allow hybridization to that sequence in a cell, i.e., under physiological conditions. Another type of expression inhibitor according to the invention is a nucleic acid that is capable of catalyzing the cleavage of RNA molecules. The term "ribozymes" as used herein refers to catalytic RNA molecules capable of cleaving to other RNA molecules in phosphodiester bonds in a sequence-specific manner. The hydrolysis of the target sequence to be segmented is initiated by the formation of a catalytically active complex consisting of ribozyme and substrate RNA. All ribozymes capable of cleaving the phosphodiester bonds in the trans position, i.e. intermolecularly, are suitable for the purposes of the invention. Still another type of inhibition of expression is RNA interference (RNAi). RNAi is the post-transcriptional process of gene silencing mediated by double-stranded RNA (dsRNA) that is homologous in sequence to the silenced RNA and is observed in animals and plants.

According to a particular preferred embodiment of the invention, the inhibitor is a siRNA, comprising a first nucleotide sequence of 17-23 nucleotides homologous to a nucleotide sequence selected from any of the target genes listed in Table 4, and a second nucleotide sequence of 17-23 nucleotides complementary to the first nucleotide sequence. Preferably, the inhibitor is a siRNA, comprising a first nucleotide sequence of 17-23 nucleotides selected from the nucleotide sequences identified by SEQ. ID No: 1-220 and 247-333 in Tables 4 and 5, and a second nucleotide sequence of 17-23 nucleotides complementary to the first nucleotide sequence. In another preferred embodiment, the siRNA further comprises a third nucleotide sequence that connects the first and second nucleotide sequence, and that is capable of forming a stem-spire structure within the siRNA. Such a self-complementary, single-stranded siRNA polynucleotide, according to the present invention, comprises at least one first guiding sequence, and a second guiding sequence, which complements the first guiding sequence, and a third sequence capable of forming a structure stem-spiral within the second sequence, which is covalently linked to the distal-end of the first sequence and the proximal end of the second sequence. All nucleotides in the first and second sequences can be grouped in base pairs, or alternatively there can be disuniformities between the first and second sequences. The nucleotide sequences are preferably between about 17 and 23 nts in length. Preferably the first or second sequences are a sequence of oligonucleotides between about 17 and 23 nt in length selected from the polynucleotide sequences of any of the genes listed in Table 4. Such siRNA polynucleotides with a ring are self-complementary and can form hairpins stable The forks are more stable than the ordinary dsARN. In addition, they are more easily produced from the vectors. More preferably, the first or second nucleotide sequence comprises a nucleotide sequence consisting of SEQ ID NO: 1-220 and SEQ ID NO: 247-333. The nucleotide sequences of SEQ ID NO: 1-220 and SEQ ID NO: 247-333 are selected according to the siRNA design rules that provide an improved reduction of target sequences compared to nucleotide sequences that do not comply with these siRNA design rules (see, WO 2004/094636). Preferably, the third nucleotide sequence it is 4-30 nucleotides in length, more preferably 5-15 nucleotides in length, and still more preferably 8 nucleotides in length. In an even more preferred embodiment, the third nucleotide sequence is UUGCUAUA (SEQ ID NO: 334). The present invention further relates to a method for identifying a compound that induces differentiation of mammal cells undifferentiated into osteoblasts, comprising: (a) contacting one or more compounds with a polypeptide listed in Table 4, encoded by any of the genes listed in Table 4, and / or the fragments and / or derivatives of said polypeptide; (b) determining the agglutination affinity of the compound with respect to the polypeptide; (c) contacting a population of undifferentiated mammalian cells with the compound exhibiting an agglutination affinity of at least 10 micromolar; and (d) identifying the compound that induces the differentiation of undifferentiated mammalian cells. The polypeptides or polynucleotides of the present invention, used in the methods described above, can be free in solution, fixed to a solid support, carried on a cell surface, or localized intracellularly.

To effect the methods it is feasible to immobilize either the polypeptide of the present invention or the compound to facilitate the separation of the complexes from the non-complex forms of the polypeptide, as well as for the automatic accommodation of the assay. The interaction (e.g., agglutination) of the polypeptide of the present invention with a compound can be carried out in any suitable vessel to contain the reagents. Examples of such containers include microtiter plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the polypeptide to be bound to a matrix. For example, the polypeptide of the present invention can be labeled with "HIS", and subsequently adsorbed onto the Ni-NTA microtiter plates, or the fusions of ProtA with the polypeptides of the present invention can be adsorbed with respect to IgG, which are then combined with cell lysates (eg, labeled with (35) s) and the candidate compound, and the mixture incubated under favorable conditions for complex formation (for example, to the physiological conditions for salt and pH). After incubation, the plates are washed to remove any unbound label, and the matrix is immobilized. The amount of radioactivity can be determined directly, or in the supernatant after the dissociation of the complexes. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of agglutination of the protein to the protein of the present invention quantified from the gel, using standard electrophoretic techniques. Other techniques to immobilize the protein on the matrices can also be used in the compound identification method. For example, either the polypeptide of the present invention or the compound can be immobilized using the conjugation of biotin and streptavidin. The biotinylated protein molecules of the present invention can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (eg, a biotinylation kit, Pierce Chemicals, Rockford, 111.), and immobilized in 96-well plate cavities coated with streptavidin (Pierce Chemical). Alternatively, antibodies reactive with the polypeptides of the present invention but which do not interfere with the agglutination of the polypeptide to the compound can be derived to the cavities of the plate, and the polypeptide of the present invention can be trapped in the cavities by conjugation. of antibodies. As described above, the preparations of a labeled candidate compound are incubated in the cavities of the plate presenting the polypeptide of the present invention, and the amount of the complex trapped in the cavity can be quantified. The agglutination affinity of the compound with the polypeptide or polynucleotide can be measured by methods known in the art, such as using surface plasma resonance biosensors (Biacore), by saturation agglutination analysis with a labeled compound (e.g. of Scatchard and Lindmo), by means of displacement reactions, by differential UV spectrophotometer, fluorescence polarization assay, plate reader system with fluorometric imaging (FLIPR®), fluorescence resonance energy transfer, and bioluminescence resonance energy transfer. The agglutination affinity of the compounds can also be expressed in a dissociation constant (Kd) or as IC50 or EC50. The IC50 represents the concentration of a compound that is required for 50% inhibition of the agglutination of another ligand to the polypeptide. The EC50 represents the concentration required to obtain 50% of the maximum effect in vitro. The dissociation constant, Kd, is a measure of how well a ligand binds to the polypeptide, it is equivalent to the concentration of the ligand required to saturate exactly half of the agglutination sites on the polypeptide. Compounds with high affinity agglutination have low Kd, IC50 and EC50 values, that is, in the range of 100 nM to 1 pM; A moderate to low affinity agglutination refers to high Kd, IC50 and EC50 values, that is, in the micromolar range. For purposes of high throughput, libraries of compounds such as peptide libraries (eg, LOPAP ™, Sigma Aldrich), lipid libraries (BioMol), libraries of synthetic compounds (eg, LOPAC ™, Sigma Aldrich) or library libraries can be used. natural compounds (Specs, TimTec). The invention also relates to a method for identifying a compound or mixture of compounds that induces differentiation of mammal cells undifferentiated into osteoblasts, comprising: (a) culturing a population of undifferentiated mammalian cells expressing a listed polypeptide in Table 4, encoded by a gene listed in Table 4, and / or fragments and / or polypeptide derivatives; (b) exposing the population of cells to a compound or mixture of compounds; and (c) selecting the compound or mixture of compounds that induces differentiation of undifferentiated cells in osteoblasts. The compound or mixture of compounds that are identified according to this method can be applied thus to induce the differentiation of undifferentiated mammalian cells into osteoblasts. Preferably the compounds identified in these methods of the invention are low molecular weight compounds. Low molecular weight compounds, ie, with a molecular weight of 500 daltons or less, are likely to have good absorption and permeation in biological systems and are consequently more likely to be successful drug candidates than compounds with a molecular weight above 500 daltons (Lipinsky et al, 2001). According to another preferred embodiment, the compounds with peptides. Peptides can be excellent drug candidates and there are multiple examples of commercially valuable peptides such as fertility hormones and platelet aggregation inhibitors. According to another preferred embodiment, the compounds are natural compounds. Natural compounds are compounds that have been extracted from natural sources, for example plants. Using natural compounds in the selections has the advantage that more diverse molecules are selected. Natural compounds have a huge variety of different molecules. Synthetic compounds do not exhibit such a variety of different molecules. Other compounds can be selected from carbohydrates, and glycosylated polypeptides. In addition, the present invention relates to a polynucleotide comprising a sequence of 17-23 nucleotides, homologous to a nucleotide sequence selected from any of the target genes listed in Table 4, and variants and / or inverse complements thereof. Preferably, the polynucleotides have a nucleotide sequence selected from the nucleotide sequences identified by SEQ ID No: -220 and 247-333 in Tables 4 and 5, or the polynucleotides have a reverse complement of a nucleotide sequence selected from the nucleotide sequences identified by SEQ ID NO: 1-220 and 247-333 in Tables 4 and 5. The polynucleotides of the invention have been shown to increase the differentiation of osteoblasts. The invention also relates to these polynucleotides for use as a medicament. In addition, the invention relates to the use of polynucleotides in the manufacture of a medicament for the treatment of a disease that involves a systemic or local reduction in average bone density. As shown for the first time in this patent application, polypeptides comprising an amino acid sequence selected from the group listed in Table 4 are involved in the differentiation of mammals not differentiated into osteoblasts, "in yet another preferred embodiment of the present invention, compounds that are known to inhibit or inhibit the activity of any of the polypeptides comprising an amino acid sequence selected from the group listed in Table 4, can also to be used now to induce the differentiation of mammalian cells not differentiated into osteoblasts.Therefore, the present invention also relates to the use of compounds known in the art to inhibit the activity of any of the polypeptides comprising a sequence of amino acids selected from the group listed in Table 4, as a medicament In addition, the present invention also relates to the use of compounds known in the art to inhibit the activity of any of the polypeptides comprising a selected amino acid sequence. of the group listed in Table 4, as a medication for the treatment of a disease that involves a systematic or local reduction in average bone density. The invention further relates to a vector comprising any of the polynucleotides described above. In addition, the invention relates to vectors for use as a medicament. In a preferred embodiment, the vector is an adenoviral, retroviral, adeno-associated viral, lentiviral vector or sendaiviral. Preferably, the vector encodes an siRNA comprising a nucleotide sequence selected from the groups consisting of SEQ ID NO: 1-220 and SEQ ID NO: 247-333. The invention further relates to the use of vectors for the manufacture of a medicament for the treatment of a disease that involves a systemic or local reduction in average bone density. In a preferred embodiment of the present invention, the disease is selected from the group consisting of osteoporosis, hypercalcemia of malignancy, multiple myelomatosis, hyperparathyroidism and hyperthyroidism. Recombinant viruses are commonly used for gene transfer. To date, the three most commonly used viruses for gene transfer are adenoviruses, retroviruses and adeno-associated viruses. More recently, lentiviruses, a subgroup of retroviruses, and sendaviruses are being used. Adenoviruses are capable of transducing cells that are both dividing and non-dividing and can be produced at high viral concentrations. Retroviruses can • infect cells that divide only and integrate their genome into the chromosome of the host animal. The integration achieves long-term gene expression. The lentiviruses, a subfamily of retroviruses, share all of the standard properties of retroviruses but also have the ability to transduce cells that do not divide. Adeno-associated virus (AAV) is a small, non-pathogenic, single-stranded DNA virus. It requires co-infection with a helper virus (adenovirus or herpes virus) to suffer a productive infection. In the absence of the helper virus, the wild-type AAV is specifically integrated into the site, in the genome of the host animal. Similar to the retrovirus, the integration facilitates the expression of the longest gene. AAV can infect cells that divide as well as those that do not divide. The virus sendai in an element of the paramixoviridae, and is a virus of RNA of a single thread that is able to transfect the cells as much that they are divided as those that are not divided. His method of introduction to cells involves the sialic acid and cholesterol that are common for many cell types. The expression and replication of the viral sendai gene are located in the cytoplasm, in contrast to most of the viruses that need to enter the nucleus. In addition, the present invention relates to a method for the in vitro production of bone tissue, comprising: (a) applying undifferentiated mammalian cells on a substrate to form a cellular substrate; (b) introducing any of the polynucleotides described above, or a vector comprising the polynucleotide, for a sufficient period of time to differentiate undifferentiated cells into osteoblasts, whereby a continuous bone matrix is produced. Preferably, the continuous bone matrix comprises a thickness of at least 0.5 μ on the surface of the substrate. The invention thus provides a method for producing a substrate with a matrix that has grown on it, which can be used for the provision of implants carrying a load, including prostheses for the joints, such as artificial hip joints, joints of the knee and joints of the fingers, maxillofacial implants, such as dental implants. It can also be used for special surgical devices, such as spacers, or bone fillers, and for use in the augmentation, obliteration or reconstitution of damaged or lost bone and bone defects. The bone formations can be optimized by the variation in mineralization, by both inductive and conductive processes. A combination of the provision of an implant carrying a load (preferably coated with a matrix as described above) with a bone filler comprising a matrix as described is an advantageous method according to the present invention.

The method of the invention is also very suitable in relation to revision surgery, that is, when the previous surgical devices have to be replaced. Suitable non-differentiated cells are cells from the bone marrow, including hematopoietic cells and in particular stromal cells. Bone marrow cells, and especially stromal cells were found to be very effective in the bone production process when taken from their original environment. The undifferentiated cells can be applied directly on the substrate or they can be multiplied advantageously in the absence of the substrate before being applied on the substrate. In this latter mode, the cells are still largely undifferentiated after multiplication and, for the purpose of the invention, they are still referred to as undifferentiated. Subsequently, the cells are allowed to differentiate. Differentiation can be induced or enhanced by the presence of suitable inducers, such as glucocorticoids, and dexamethasone. Particularly suitable differentiation inducers are the expression inhibiting agents of the present invention. The use of undifferentiated cells provides several advantages. First, its lower differentiation implies a higher proliferation rate and allows that the eventual functionality is better directed and controlled. In addition, the culture of these cells not only produces the required bone matrix containing the organic and inorganic components, but also leads to the presence in the culture medium and the matrix of several factors that are essential for tissue growth. and for the adaptation of the existing living tissue. Also, the culture medium can be a source of active factors such as growth factors, which are to be used in relation to the implant process. Furthermore, such undifferentiated cells are often available in large quantities and more conveniently than, for example, mature bone cells, and exhibit lower morbidity during recovery. In addition, undifferentiated cells can be obtained from the patient for whom the implant is proposed. The bone that results from these cells is autologous to the patient and therefore will not induce an immune response. Matrices as thick as 100 μ can be produced as a result of the use of undifferentiated cells. The substrate on which the undifferentiated cells can be applied and cultured can be a metal, such as titanium, a cobalt / chromium alloy or stainless steel, a bioactive surface such as a calcium phosphate, polymeric surfaces such as polyethylene and the like. Although less preferred, a siliceous material such as glassware can also be used as a substrate. Still more preferred are metals, such as titanium, and calcium phosphates, even though calcium phosphate is not an indispensable component of the substrate. The substrate can be porous or non-porous. The cells can be applied at a rate for example, of 103-106 per cm 2, in particular 104-2 x 10 5 cells per cm 2. The culture medium to be used in the method according to the invention can be a commonly known culture medium such as MEM (minimal essential medium). Advantageously, the medium can be a conditioned medium. In this context, a conditioned medium is understood to be a medium in which similar cells have been previously incubated, causing the medium to contain factors such as polypeptides secreted by cells that are important for cell growth and cell differentiation. The cells are cultured for a period of time sufficient to produce a layer of the matrix, for example, a layer of the matrix having a thickness of at least 0.5 μM, in particular from 1 to 100 μm, more in particular of 10- 50 μm. The cells can be contacted with the culture medium for example for 2-15 weeks, and in particular 4-10 weeks.

The production of the matrix, when applied on a substrate, leads to a continuous or almost continuous coating covering the substrate at least 50%, in particular at least 80% of its surface area. In another embodiment, the present invention provides osteoblast cells that can be obtained by the methods of the present invention. Another embodiment of the present invention involves the use of osteoblast cells that can be obtained by the methods of the present invention for the in vitro production of bone tissue. The present invention further relates to a method for diagnosing a pathological condition that involves a systemic or local reduction in average bone density or a susceptibility to a subject's condition, comprising: (a) determining the level of expression of a polynucleotide encoded by any of the target genes listed in Table 4, in a biological sample derived from the subject; and (b) comparing the level of expression with the level of expression of the polynucleotides in a sample derived from a healthy subject; wherein an increase in the amount of the polynucleotide in the subject sample compared to the Sample of the healthy subject is indicative of the presence of the pathological condition. In addition, the present invention relates to a method for diagnosing a pathological condition that involves a systemic or local reduction in average bone density "or a susceptibility to the condition in a subject, comprising: (a) determining the amount of a polypeptide encoded by the genes listed in Table 4 in a biological sample derived from the subject, and (b) comparing the amount with the amount of the polypeptide in a biological sample derived from a healthy subject, wherein an increase in the amount of the polypeptide in the subject compared to the healthy subject is indicative of the presence of the pathological condition.Preferably, the pathological condition is selected from the group consisting of osteoporosis, hypercalcemia of malignancy, multiple myelomatosis, hyperparathyroidism, and hyperthyroidism.In accordance with the present invention, the finished "Derivatives of a polypeptide" refers to those proteins, proteinaceous molecules, protein fractions, peptides, and oligopeptides that comprise a segment of residues of contiguous amino acids of the polypeptide and that they retain the biological activity of the protein, for example, polypeptides having amino acid mutations compared to the amino acid sequence in a naturally occurring form of the polypeptide. A derivative may further comprise amino acid residues that are naturally present, altered, glycosylated, acylated or not present naturally, additionally, compared to the amino acid sequences in a naturally occurring form of the polypeptide. It may also contain one or more different amino acid substituents compared to the amino acid sequence in a naturally occurring form of the polypeptide, for example one reporter molecule and another ligand, covalently or non-covalently linked to the amino acid sequence. The term "fragment of a polypeptide" refers to peptides, oligopeptides, polypeptides, proteins and enzymes that comprise a segment of contiguous amino acid residues, and that exhibit a substantially similar, but not necessarily identical, functional activity as the entire sequence. The term "polynucleotide" refers to nucleic acids, such as double-stranded, or single-stranded DNA and to RNA (messenger), and to all types of oligonucleotides. It also includes nucleic acids with modified supports such as nucleic acid-peptide (PNA), polysiloxane, and 2 '-O- (2-methoxy) ethylphosphorothioate. The term "derivatives of a polynucleotide" refers to DNA molecules, RNA molecules, and oligonucleotides that comprise a nucleic acid segment or residues of the polynucleotide, for example polynucleotides that can have nucleic acid mutations when compared to the sequence of nucleic acids in a manner that is naturally present in the polynucleotide. A derivative may further comprise nucleic acids with modified supports such as PNA, polysiloxane, and 2'-O- (2-methoxy) ethyl phosphorothioate, nucleic acid residues that are not naturally present, or one or more acid substituents. nucleic acids, such as methyl-, thio-, sulfate, benzoyl-, phenyl-, amino-, propyl-, chloro-, and methanocarbanucleosides, or a reporter molecule to facilitate its detection. The term "fragment of a polynucleotide" refers to oligonucleotides that comprise a segment of contiguous nucleic acid residues that exhibit substantially similar, but not necessarily identical, activity as the entire sequence. The term "homologous sequence", whether of a nucleic acid sequence or of an amino acid sequence, is limited to a sequence that is identical or substantially identical to the original sequence and that has the same biological property as the original sequence. The term is understood to include mutants and variants that are naturally present in the original sequence. The original sequence is either provided in tables 4-6, or is indicated by the access numbers of GenBank in this table. In general, a homologous sequence is at least 95% identical with respect to the original sequence. In addition, up to two disuniformities are allowed for the siRNA sequence of 17-21 bp, provided that the homologous sequence leads to a similar down-regulation of the corresponding gene as the original sequence. Figure 1 shows intramembranous and endochondrial ossification. Figure 2 shows the principle of the osteoblast differentiation assay. Figure 3 shows the distribution of the control plate of the genetically modified organism carrying one or more genes that have become less active in the AP assay. Figure 4 shows the distribution of the control plate of 384 cavities. Figure 5 shows the operation of the control plate of the genetically modified organism carrying one or more genes that have become less active in the AP assay.

Figure 6 shows a graphical representation by points of the input data for the SilenceSelect selection plate. Figures 7A and 7B show the target expression profile in MPCs (fig.7A) and the genetically modified organism plate bearing one or more genes that have become less active from gene expression by Ad-siRNA (fig.7B). Figure 8 shows the profiling of the target expression in primary human OBs. Figure 9 shows the analysis of up-regulation of BAP-mRNA against PLAP- or IAP-mRNA. Figure 10 shows the results of the mineralization test. Figure 11 shows the scheme obtained by the transfer by means of a pipette used for the selection of Ad-shRNAs at 3 MO s .. Examples Example 1. Development of a high-throughput screening method for the detection of endogenous alkaline phosphatase Principle of the assay The mesenchymal progenitor cells (MPCs) were determined to differentiate into osteoblasts in the presence of appropriate factors (e.g. BMP2). An essay for selecting such factors was developed by verifying the activity of the alkaline phosphatase (AP) enzyme, an initial marker in the osteoblast differentiation program. The MPCs were seeded in 384-well plates and simultaneously co-infected one day later with the adenoviruses encoding the human coxsackievirus and the adenovirus receptor (hCAR, Ad-hCAR) and the individual siRNA adenoviruses (Ad-siRNA ) from the SilenceSelect ™ collection. Co-infection with Ad-C15-hCAR / AdC20-hCAR increases the infection efficiency of AdCO1-siRNA. The activity of cellular AP was determined 13 days after the start of the infection (13 dpi). Figure 2 illustrates the start of the test. Trial development MPCs were isolated from the bone marrow of healthy volunteers, obtained after informed consent (Cambrex / Bio hittaker, Verviers, Belgium). In a series of experiments, carried out in plates of 384 cavities, several parameters were optimized: the seeding density of the cells, the mutiplicities of infection (MOI) of the control viruses (Ad-BMP2 or Ad-eGFP), MOI of Ad-hCAR, duration of infection, toxicity, efficiency of infection (using Ad-eGFP) and the day of reading. Using Ad-BMP2 (on BMP2 expression) as a positive control for the development of the assay, the following protocol led to a higher dynamic range for the assay with the lowest standard deviation on the background signal: the MPCs were seeded on day 0 to 500 cells per well of a plate of 384 cavities and were co-infected the next day using a mixture of Ad-hCAR (5 μl of a solution of Ad-hCAR: total mixture MOI = 155.7) and 1 μl of the control virus Ad (Ad-BMP2 or Ad-eGFP corresponds to a theoretical MOI of 5000). On day 5, the medium containing the virus was removed and replaced by fresh medium that does not contain the virus. The ascending regulation of the alkaline phosphatase was read at 3 dpi: 15 μl of the 4-methylumbelliferyl phosphate (MUP, Sigma) was added to each cavity, the plates were incubated for 15 minutes at 37 ° C and checked for activity of AP using a fluorescence plate reader (Fluostar BMG). After trial optimization, a small pilot selection was run (103 different Ad-siRNA viruses) with the use of robots (96/384 Tecan Freedom 200 scatterer equipped with TeM096, TeM0384 and RoMa, Tecan AG, Switzerland) . Favorable data from this selection were collected and retested in the same trial. The two Ad-siRNAs that had a stronger evaluation (H9 = H24--010; H10 = H24-011) were used to generate a control plate (control plate of the modified organism genetically carrying one or more genes that have become less active (KD)) containing Ad-siRNAs. The control plate, a 96-well plate containing 3 negative control viruses (Ni, N2, N3) and 3 positive control viruses (Pl, P2, P3), is shown in Figure 3. This control plate " of the genetically modified organism carrying one or more genes that have become less active "contains Ad-H9 (H24-010) and Ad-HlO (H24-011) as positive controls; Ad-eGFP (virus of the organism in which a gene has been invalidated and replaced by another gene) as control of the infection; and Ad-eGFP-siRNA, Ad-M6PR-siRN? and Ad-Luc-siRNA. (All 3 are prefabricated viruses) as negative controls. The control viruses were transferred by means of a pipette from 96-well KD control plates to the 384-well plates using robots. The final distribution of the 384-well plate is shown in Figure 4. Figure 5 shows the results of the automatic selection procedure using the KD control plate. The average and standard deviations of the negative controls of Kd (N1-N3) were used to calculate a cut for the successful analysis, which was set at the average for Ni, N2, N3 ("all negative") plus 3 times the standard deviation for "all negative". The positive controls (Pl and P2), qualified with more 95% of infected cavities. The negative control viruses qualified in less than 5% of the cavities. Example 2. Selection of the adenovirus of 7980 Ad-siRNA in the osteogenesis assay El. Optimized protocol for the selection of the SilenceSelect library is as follows: on day 0, the MPC cells are seeded in 384 black-cavity plates with a light background (Costar or Nunc) in 60 μl of the medium at a density of 500 cells per cavity. One day later, 1 μl of the Ad-siRNA virus from the SilenceSelect ™ collection, stored in 384 well plates (estimated concentration of 2.5 x 109 viral particles per ml) and 5 μl of the Ad-hCAR solution (MOI total = 155), distributed in 96-well V-bottom plates, is transferred with the help of a 96/384 channel distributor (Tecan Freedo 200 equipped with TeMO 96, TeM0384 and RoMa, Tecan AG, Switzerland) of the cavities from a 96-well plate containing the Ad-hCAR solution to each of the cavities of the 384-cavity plates containing MPCs. The KD control plate was run under the same conditions as the aliquot plates of the SilenceSelect collection. All Ad-siRNA viruses were selected in duplicate, with each single element on a different MPC plate. The plates were then incubated at 37 ° C. Four days post- Infection, the medium containing the adenoviruses was replaced by a fresh medium free of the virus. Thirteen days post-infection, the reading of the AP activity was carried out. A typical result of a selection plate of 384 cavities is shown in Figure 6, in which the relative fluorescence units (RFU) are plotted for each of the data points of the plate 384 cavities on the Y axis; while the numbers on the x axis correspond to the positions on the 384 cavity plate. This duplicate selection was made twice, and all four data points were used to give a success signal (see example 3). Example 3. Identification of the target using the AP assay After making these 2 selections, the data obtained from the measurement of the AP activity were analyzed as follows: the background was calculated taking the average of the data points of all the plates except the control plate. A cutoff value to give a success signal was calculated by adding 3 times the standard deviation of all data points, excluding the control board. Each data point was analyzed by the evaluation above or below the cut. Only Ad-siRNAs that induce endogenous PA activity levels above the cut were of additional interest. Successful signals were prioritized agree - with your evaluation in a single or duplicate selection, in one or both of the selections. Data were collected for the 7980 Ad-siRNA virus constructs representing 4091 independent genes. A review of the constructions is given in Table 4. One of the successful signals identified has been shown to be a prior bone anabolic factor and therefore validates the assay ": H24-034: SRC Marzia et al. (2000) ) showed that bone formation was increased in mice that do not express the Src gene compared to wild-type mice.Mostly relevant for this work, osteoblasts isolated from Src null mice or osteoblasts isolated from mice of the wild type but transfected with the Src-antisense oligonucleotides, showed increased AP activity in vitro, 8 genes identified in the selection were targeted by 2 Ad-siRNAs.These genes are AVPR1B, FLJ22955, IL1F8, PPIA, USP38, C9, LOC254378 and BRS3 (see table 4) Example 4. Quality control of the target Ad-siRNAs The successful signals of Ad-siRNA, hereinafter referred to as "targets" were subjected to analogous analysis. isis additional to establish its therapeutic application as a Anabolic factor of the bones. A first stage involved a quality control on the selected Ad-siRNA for further analysis (this example). Other validation steps are the validation of targets at the mRNA level (example 5), the selection of targets in the osteogenesis assays such as the mineralization assay (example 6), and the development of additional Ad-siRNAs that locate target the identified genes (example 9). The objectives that are still of interest after these validation tests are considered for the discovery of the drug: trials were developed that allow the discovery and optimization of the compounds that mimic the anabolic actions of the bones of the target Ad-siRNAs (example 7). ). In addition, the anti-resorption activities of the identified Ad-siRNAs are validated in the osteoclast assays (example 8). Quality control of target Ad-siRNAs: Target Ad-siRNAs were propagated using PerC6 cells (Crucell, Leiden, The Netherlands) at a 96-well plate level, followed by reselection of these viruses in several MOIs in the primary assay (see example 1) and by the sequencing of the siRNAs encoded by target Ad-siRNA viruses. The PerC6 / E2A cells were seeded in the 96-well plates at a density of 40,000 cells per cavity in 180 μl of PerC6 / E2A medium. The cells were then incubated overnight at 39 ° C in an incubator moistened at 10% C02. One day later, the cells were infected with 1 μl of unrefined cell lysate from the storage materials of SilenceSelect containing the target Ad-siRNAs. The cells were further incubated at 34 ° C, 10% C02 until the cytopathic effect appeared (as revealed by the swelling and rounding of the cells, typically 7 days post-infection). The supernatant was collected and the crude lysate of the virus was treated with proteinase K: 12 μl of the unrefined lysate were added to 4 μl of the lysis buffer (lx Expand High Fidelity buffer) with MgCl 2 (Roche Molecular Biochemicals, Cat. No 1332465) supplemented with 1 mg / ml proteinase K (Roche Molecular Biochemicals, Cat No. 745 723) and 0.45% Tween-20 (Roche Molecular Biochemicals, Cat No.1335465) in sterile PCR tubes. These were incubated at 55 ° C for 2 hours followed by the 15 minute inactivation step at 95 ° C. For the PCR reaction, 1 μl of the lysate was added to a PCR master mix composed of 5 μl of lOx of the Expand High Fidelity buffer with MgCl2, 0.5 μl of the dNTP mixture (10 mM for each dNTP), 1 μl of the "forward primer" (storage material of 10 iriM, sequence: 5 'CCG TTT ACG TGG AGA CTC GCC, SEQ ID No: 245), 1 μl of the "reverse primer" (10 mM storage material, sequence: 5 'CCC CCA CCT TAT ATA TAT TCT TTC C, SEQ ID No: 246), 0.2 μl of the polymerase of Expand High Fidelity DNA (3.5 U / μl, Roche Molecular Biochemicals), and 41.3 μl of H20). The PCR was carried out in a PE Biosystems GeneAmp 9700 PCR system as follows: the PCR mixture (50 μl in total) was incubated at 95 ° C for 5 minutes; each of the subsequent 35 cycles was run at 95 ° C for 15 minutes, 55 ° C for 30 seconds, 68 ° C for 4 minutes. A final incubation at 68 ° C was carried out for 7 minutes. 5 μl of the PCR mixture were mixed with 2 μl of the 6 x gel loading buffer, loaded onto a 0.8% agarose gel containing 0.5 μg / μl of ethidium bromide to resolve the amplification products. The size of the amplified fragments was estimated from a standard DNA ladder loaded on the same gel. The expected size was -500 bp. For the sequencing analysis, the siRNA constructs expressed by the target adenoviruses were amplified by PCR using primers complementary to the vector sequences flanking the SapI site of the pIPsp? Dapt6-U6 plasmid. The sequence of the PCR fragments was determined and compared to the expected sequence.

Multiple MOI reselection Propagated target Ad-siRNAs were reselected at several MOIs in the AP assay (see example 1). The Ad-siRNAs have to be evaluated in duplicate in at least one MOI to pass this stage of quality control. All the signs of success in table 4 have satisfied this stage of quality control and therefore: a) showed the correct length of the fragment of PCR b) showed the correct sequence of the PCR fragment c) induced AP activity in duplicate in at least 1 MOI. Example 5. mRNA validation experiments for the identified targets An initial validation of the target Ad-siRNAs was carried out on the RNA isolated from the infected MPCs. First, the expression of the targets was analyzed in several isolates of the primary human MPCs and the osteoblasts (hOBs). Second, the genetically modified organism carrying one or more genes that have become less active from the expression of the target gene by the Ad-siRNA was verified at the mRNA level. In Third, the upregulation of AP mRNA from endogenous bone versus that of AP mRNA from the placenta or the intestine was analyzed. Analysis of the expression of MPC and osteoblasts for the profiling of the identified targets The expression levels of the target genes were determined in 4 different isolates of MPCs and 2 different isolates of hOBs. The MPCs and hOBs (obtained from Cambrex / Biowhittaker, Verviers, Belgium) were seeded at 3000 resp., 5000 cells / cm2 in T180 containers, and cultured until they reached 80% confluence. The cells were washed with ice-cold PBS and collected by adding 1050 μl of the SV RNA lysis buffer to a T180 vessel. Total RNA was prepared using the total RNA isolation system of SV (Promega, Cat # Z3100). The total RNA concentration was measured with the Ribogreen RNA quantification kit (Molecular Probes, Leiden, The Netherlands, Cat No. R-11490). The cDNA synthesis was performed using 40 mg of the total RNA per reaction using the master mix of the TaqMan Universal PCR, No AmpErase UNG, kit (Applied Biosystems, Warrington, UK, part number 4324018). For each RT reaction, a less-RT reaction was carried out (negative control: no enzyme included in the reaction). The real time reverse transcriptase reaction (rtRT) -PCR was performed with the gene-specific primers on the samples of both cDNA and minus-RT, using the SYBR Green PCR master mix (Applied Biosystems, Warrington, UK, part number 4309155). For normalization of expression levels, an RT-PCR reaction was performed on human β-actin using the human β-actin kit (Applied Biosystemas, Warrington, UK, part number 4310881E). The following program was run on a real-time PCR apparatus (ABI PRISM 7000 sequence detection system): 10 minutes at 25 ° C, 30 minutes at 48 ° C, 5 minutes at 95 ° C. In Figures 7A and 8, the relative expression levels for 10 genes are shown, respectively for the MPC and hOB isolates. For the data in Figure 7A, the total RNA was extracted from 4 different MPC isolates and used to analyze the expression levels of the target genes identified through the target Ad-siRNAs. The sets of compatible primers of RtRT-PCR were developed for 10 genes and compared with the expression levels of β-actin. The data are expressed as -log (difference to ß-actin) (Y axis). For the data presented -in Figure 8, the total RNA was extracted from 2 different isolates of hOB.

Analysis of the genetically modified organism carrying one or more genes that have become less active from the expression of the target gene by the Ad-siRNA was verified at the mRNA level To determine whether the Ad-siR? Target A's lead to genetically modified organism that carries one or more genes that have become less active from the expression of the corresponding gene, the AR? Total was collected from the MPCs infected with Ad-siR? A and the expression of the gene was analyzed using the gene-specific primers. The MPCs were seeded in 25,000 cells per cavity of a 24-well plate. After 24 hours, the cells were infected with the successful viruses for the genetically modified organism carrying one or more genes that have become less active or the negative control viruses Ad-gPPARg and Ad-GL2.2 that stop the expression of PPAR? respectively (all four known splice variants) and luciferase, both of which are not related to osteogenesis. For Ad-siR? As, the cells were co-infected with the unrefined lysates of Ad-hCAR and Ad-siR? A (MOI Ad-hCAR: 750; 40, 10, 3.3 μl of the virus with an average concentration of 2.5 x 10E9 virus particles / ml). At 5 dpi the medium was refreshed and at 14 dpi cell lysates were prepared. The cells were processed for the AR? M analysis as described in previous section. The mRNA levels for a specific gene were normalized for the β-actin levels and compared with the levels measured for the Ad-siRNAs of negative control. An example of this kind of analysis is provided in Figure 7B. The data were normalized for the expression levels of β-actin and compared with the expression of the endogenous gene for MPCs infected with the negative control viruses (Y axis: percentage expression of the gene of the endogenous gene, 100%. Endogenous mRNA present in the negative control sample). Analysis of upregulation of AP mRNA from endogenous bone versus that of AP mRNA from the placenta or intestine BAP is the physiologically relevant AP, involved in bone formation. To determine whether the measured AP activities were due to upregulation of the expression of BAP or another product of the AP gene, the mRNA levels for all AP genes were analyzed for the infected MPCs. The mRNA levels were determined as described in the previous sections. The difference is in the primer set used (see table 2): one set detects the expression of BAP mRNA ALPL (human liver / bone / kidney alkaline phosphatase). Another set detects the expression of the other 3 AP genes (ALPI (intestinal human alkaline phosphatase), ALPP (fosfasata human placental alkaline (PLAP)), and ALPPL2 (human alkaline phosphatase resembling the placenta)). ALPI, ALPP and ALPPL2 are highly similar at the level of nucleotides and therefore can be amplified using a pair of primers. The primer pairs were validated first on the RNA isolated from the MPCs infected with Ad-eGFP and Ad-BMP2. Figure 9 illustrates the strong up-regulation of BAP mRNA by Ad-BMP2 and the absence of up-regulation of the expression of any of the other AP genes. The MPCs were infected in the 24-well plate format using the Ad-eGFP (negative control) or the osteogenic Ad-BMP2. The cells were collected and the RNA was prepared and subjected to rtRT-PCR using sets of primers that amplify the BAP mRNA or the mRNA of the other 3 AP genes (PLAP / IAP). Ad-BMP2 strongly up-regulates BAP mRNA levels but not the mRNA levels of the other 3 AP genes. Both sets of primers were then used to measure mRNA levels for all AP genes in the RNA isolated from the MPCs infected with Ad-siRNA. Example 6. Mineralization The process of osteogenesis consists of several successive events. During the initial phases of osteogenesis, bone alkaline phosphatase (BAP) becomes regulated ascending. However, it is equally important to observe the specific events that occur in the later stages of osteogenesis such as mineralization. Establishment of the trial The process of osteogenesis consists of several successive events. During the initial stages of osteogenesis, bone alkaline phosphatase (BPA) becomes up-regulated. Subsequently, during differentiation, the cells deposit (hydroxy) apatite (precipitated Ca2 + -phosphate) on an extracellular matrix consisting mostly of type I collagen to form the mineralized bone. In the bone mineralization assay (BM assay), the primary human MSCs are differentiated in vitro in mineralization osteoblasts using BMP2 (recombinant or supplied by adenoviral transduction) as an osteogenic agent. The mineralization is then visualized by staining the MSCs with Alizarin red, a dye with a high affinity towards calcium (see Figure 10). Selection and granting of signs of success. The following optimized protocol is used for the selection of the targets of Ad-siRNA and Ad-cDNA identified as targets in the primary assay: 100,000 MPCs are sown in each cavity of a plate of 6 cavities in 2 ml of MSC medium, containing 10% FCS. The following day, after incubation at 37 ° C, 10% C02 in a humidified incubator, cells are co-infected with AdC15-hCAR (final MOI of 750) and Ad-siRNA, Ad-cDNA or viruses control at a final MOI of 1250, 2500 and 5000. The cells are incubated at 37 ° C, 10% C02 in a humidified incubator for about six additional days. The virus is removed and replaced by 2 ml of fresh MSC medium, 10% FCS. During the next 22 days, the medium is refreshed 3 times in 2 weeks. From time to time, the medium is refreshed in half or completely. At 28 days after the start of the experiment, the conditioned medium is removed, the cells are fixed using 10% paraformaldehyde and the monolayers are stained with 1 ml of Alizarin red at ~ 1% (Sigma, fr A5533) in MilliQ water. (pH adjusted to 4.2). The Ad-eGFP, to evaluate the efficiency of the infection, the Ad-BMP2 as a strong osteogenic inducer and the Ad-H4-2 as a weak osteogenic factor, are included in each experiment as the negative and positive controls, respectively. Each experiment where Ad-H4-2 does not induce mineralization is completely repeated. The Ad-shRNAs that induce mineralization are presented in Table 6.

Example 7. Discovery of the drug against the identified targets The compounds are selected for agglutination to the polypeptides of the present invention. The affinity of the compounds to the polypeptides is determined in a displacement experiment. Such displacement experiments are well known in the art, and can be considered as a common technique among others to identify the compounds that bind to the polypeptides. In summary, the polypeptides of the present invention are incubated with a labeled ligand (radiolabelled, fluorescently labeled or with antibodies, or any other detectable label) that is known to bind to the polypeptide and is further incubated with a non-proprietary compound. labeled. The displacement of the tagged ligand from the polypeptide is determined by measuring the amount of the tagged ligand that is still associated with the polypeptide. The amount of the labeled ligand associated with the peptide is an indication of the affinity for the unlabelled compound. The amount of the labeled ligand associated with the polypeptide is plotted against the concentration of the unlabeled compound to calculate the IC50 values.

This value reflects the affinity of agglutination of the unlabeled compound with respect to its target, ie, the polypeptides of the present invention. The compounds are considered strong binders, when they have an IC50 in the nanomolar and even picomolar range. Compounds that have an IC50 of at least 10 micromoles or even better in the nmol to pmol range, are applied either in the bone alkaline phosphatase assay (BAP) and / or in the tests to determine their effect on induction of osteoblast markers and the function of osteoblasts. Compounds with a lower IC50 are generally considered to be of less interest. The polypeptides of the present invention can be prepared in various ways depending on whether the assay will be run on the cells, cell fractions or biochemically on purified proteins. Such preparations are well known in the art, as are the different tests. Example 8. Osteoblast assays: validation of the anti-resorption activity of the identified targets During the course of life, the skeleton is in a constant state of remodeling. The focal areas of the bones are resorbed by the osteoclasts and then replaced by a bone matrix newly formed by the osteoblasts. The development of osteoporosis is characterized by severe bone loss due to deregulation of the balance between the activity of osteoclasts and osteoblasts, leading to an increased bone resorption mediated by osteoclasts. Osteoclasts emanate from cells of the monocyte / macrophage lineage. In vivo, the differentiation of osteoclast precursor cells into osteoclasts is controlled by the two central factors expressed by stromal cells (MPCs): the activator of the NFkB ligand receptor (RANKL) and the osteoprotegerin (OPG). RANKL is a membrane bound to the ligand expressed on the surface of MPCs that stimulates the differentiation of osteoclasts. OPG is a soluble decoy receptor for RANKL that inhibits the differentiation of osteoclasts by the clearance of active RANKL. The balance between the expression of RANKL and OPG by MPCs determines the level of differentiation of osteoclasts. As MPCs control the differentiation of osteoclasts, it is important to know the effect of the target Ad-siRNAs identified on the activity or differentiation of osteoclasts. Target Ad-siRNAs that reduce the differentiation / activity of osteoclasts are very valuable, because they are expected to increase bone apposition by two mechanisms: the increase in osteoblast differentiation / activity and reduction in the activity of osteoclasts. As illustrated by several precedents (Thirunavukkarasu et al., (2002,) J Biol Chem 275: 25163-72; Yamada et al., (2003) Blood 101: 2227-34) such pleiotropic effect of osteogenic factors can be expected . Osteoclast differentiation assay The effect of osteogenic factors on osteoclastogenesis is evaluated by means of two types of assay. In a first trial setting, a co-culture of MPCs with the primary human mononuclear cells is effected. The effect of infection of the MPC monolayer with a genetically modified organism virus carrying one or more genes that have become less active on its ability to support osteoclastogenesis is evaluated. The desired effect is as follows: the genetically modified organism carrying one or more genes that have become less active from the expression of the target gene of Ad-siRNA in the MPCs must inhibit osteoclast differentiation promoted by a physiological trigger such as , a mixture of 10 nM of 1, 25 (OH) 2vitD3 and 50 nM M-CSF. The monocytes used can be derived from the bone marrow or peripheral blood. In the present example, a differentiation experiment based on the derived mononuclear cells of peripheral blood (PBMCs) is described. The MPCs (obtained from Cambrex / BioWhittaker, Verviers, Belgium) are seeded in 96-well plates (1000 cells per well) in an a-MEM medium (GIBCO-Life Technologies) supplemented with 10% FBS, and one day Later, these are infected with a target Ad-siRNA. At least three days later, 100 000 PBMCs per cavity are added as well as M-CSF (R & D systems, final concentration 50 ng / ml). Half the volume of the medium is refreshed twice a week by the medium + 50 ng / ml of M-CSF and 10 nM 1.25 (OH) 2vitD3. The reading is made 14 days after the addition of PBMCs to co-culture. The spontaneous differentiation of osteoclasts promoted by the physiologically relevant mixture of triggering agents can be evaluated by multiple readings. The microscopic evaluation of the number of "TRAP positive" multinucleated cells per cavity is a generally accepted measure for the level of osteoclast differentiation. "TRAP positive" means that the cells possess a tartrate-resistant acid phosphatase (TRAP) activity. To evaluate this, the coculture is subjected to in situ TRAP staining carried out according to the acid phosphatase detection kit (SIGMA, 386-A). The positive cells acquire a purple color during the treatment. As an alternative reading, a specific marker for mature osteocytes is measured for example, TRACPdb (acid phosphatase resistant to tartrate type 5b), the calcitonin receptor (CTR) or cathepsin K (CTSK). The measurement of the amounts of the osteoclast-derived tartrate-resistant acid phosphatase protein (TRACPdb) in the co-culture supernatant is carried out by a commercially available ELISA assay (BoneTRAP assay, Sba Sciences, Turku, Finland). CTR or CTSK are detected by immunocytochemistry, during the application of the following general protocol. The medium is removed and the co-culture is fixed (4% paraformaldehyde, 0.1% TritonX-100, 4 ° C, 30 minutes), wash and blocking buffer (PBS + 1% BSA + 0.1% Tween 20) It is added for an incubation of at least 4 hours. The blocking buffer is removed and the primary antibody directed against CathepsinK (for example Oncogene, IM55L) or the calcitonin receptor (for example Serotec AHP635), dissolved at the desired concentration in a suitable buffer (for example Tris.HCl 0.05 M, pH 7.4, 1% BSA), is added to the cavities. The incubation is carried out overnight, at 4 ° C. The mixture is removed, the cells are washed (PBS + 0.1% tween 20) and secondary antibodies, suitable HRP conjugates, diluted in the same buffer as the primary antibody, are added. After an incubation of at least 4 hours, a washing step was carried out (PBS + 0.1% tween 20) and luminol (a substrate for HRP that produces a signal luminescent: BM Chemiluminescense ELISA Substrate [POD] (luminol), Roche Diagnostics, Cat No. 1582950) is added. After a 5-minute incubation, the reading is carried out with a luminometer (Lu inoskan Ascent, Labsystem). The 2 assays described (the evaluation of the number of multinuclear cells and the immuno-pyramide for the detection of specific markers of osteoclasts) allow to evaluate the differentiation of mononuclear cells towards osteoclasts, but they do not give information about the activity of resorption of the osteoclast bones formed. The activity of the osteoclasts is measured in the gap formation test. For this purpose, the co-culture and infection of the cells are performed as described for the assays described above unlike a bone-like substrate is present in the lower part of the cavity in which the co-culture is effected . This bone-like substrate can be a slice of dentine (eg Kamiya Biomedical Company, Seattle (Cat No KT018)) or equivalent (calcium carbonate coating, OAAs ™, Gentaur; Biocat ™ Osteologic ™, BD Bioscience) which is commercially available. The co-culture is carried out for at least 14 days on the bone-like substrate. The cells are then removed by treatment with sodium hypochlorite and the area resorbed by osteoclasts (the resorption gap) can be evaluated microscopically. This can be facilitated by treating the surface of the dentin slice with toluidine blue. In a second trial setting, the effect of infection of osteoclast precursor cells (PBMCs or BMMCs) with a successful virus on its ability to differentiate into an osteoclast is measured in a monoculture assay. For this purpose, monocytes (PBMCs or BMMCs) are seeded in a 384-well plate in a medium of aMEM supplemented with 10% serum and 25 ng / ml recombinant M-CSF (R & D Systems). One day after sowing, the cells are infected with target Ad-siRNAs. Four days after infection, the recombinant RANKL is added to the cavities (25 ng / ml, R &D Systems). The medium is refreshed twice a week. Fourteen days after the addition of RANKL, the differentiation of monocytes to osteoclasts is measured using one of the readings described for the establishment of the initial assay. This assay allows the identification of factors that are indispensable for the response of osteoclast precursor cells to M-CSF or RANKL. Isolation of PBMCs PBMCs are obtained from peripheral blood (obtained from patients after informed consent) submitted to the following protocol. Blood is aseptically poured into 50 ml Falcon tubes and centrifuged at 3000 g for 10 minutes at 25 ° C. The cushioned coating is then collected and diluted 1: 1 with PBS. The diluted buffered coating is poured on top of 20 ml of Lymphoprep (Sigma) contained in a 50 ml Falcon tube. During centrifugation (35 minutes at 400 g at 25 ° C), a white layer of mononuclear cells on top of the Lymphoprep is collected and washed twice with PBS (centrifugation at 200 g, 10 minutes, 25 ° C) and rediluted in 7 ml of PBS. This solution is transferred by means of a pipette onto a 7 ml layer of hyperosmolar Percoll gradient contained in a 15 ml Falcon tube and centrifuged 35 minutes at 400 g at 25 ° C. The hyperosmolar Percoll gradient is prepared as follows: 1 volume of 1.5 M NaCl and 9 volumes of Percoll (Pharmacia, d = 1,130 g / ml) are mixed. This mixture is added 1: 1 to a PBS / citrate buffer (1.49 mM NaH2P04, 9.15 mM Na2HP04, 139.97 mM NaCl, NaCl citrate (dihydrate) 13, pH 7.2). After centrifugation, the monocytes form a discrete ring on top of the gradient. The monocytes are collected and washed in the culture medium. The cells are then ready to be used in the trials. Example 9. 7 Analysis of the effect of the genetically modified organism carrying one or more genes that have become less active "out of target" The siRNAs exert the genetic modification of one or more more genes that have become less active from gene expression by means of a recently discovered and partially understood mechanism. It is generally acceptable that the specific annealing of the sequence from siRNA to mRNA is responsible for the genetic modification of one or more genes that have become less active "on the target" specific to the gene. However, it still can not be excluded because the limited disuniformity between the siRNA and another mRNA can induce "out-of-target" down-regulation of gene expression. To exclude that genetic modification of one or more genes that have become less active from (a) AR m (s) "outside the target" were responsible for the observed osteogenic effect, the additional siRNAs / shRNAs were designed for 38 targets that induced mineralization (example 6) using strict design criteria. The additional Ad-shRNAs were then tested in the BAP assay. To solve the question of possible "out-of-target" effects, additional siRNA sequences were designed that perfectly align with the target mRNA by the original siRNA. The preferred siRNA sequences do not align with other mRNAs. However, in some cases only the siRNAs could be designed that showed some overlap to other mRNAs. For siRNAs that are aligned to a minimum number of mRNAs "outside the target "(maximum of 2 base pairs of non-identity verified for each 19mer position), the following rules were applied: the mRNAs" outside the target "assumptions must be different from the mRNAs" outside the target "assumptions identified for the original siRNA and the supposed "out-of-target" mRNAs must be different from the "out-of-target" mRNA assumptions identified for all target, original siRNAs.The only exception to these rules made during the course of these experiments were the siRNAs designed for PPIA: For each of the 38 target genes selected, 7 additional siRNAs were designed and processed to derive the recombinant adenoviruses.All siRNAs were sequenced during cloning, to verify their identity and exclude errors due to oligonucleotide synthesis. -shRNAs were successfully generated and tested in the BAP assay in 3 MOIs in 2 independent experiments, and n Parallel with 38 original Ad-shRNAs. The recombinant adenoviruses encoding the engineered shRNAs (Ad-shRNAs) were produced, titrated, aliquoted into 96-well plates and stored at -80 ° C. These plates were processed in the primary BAP assay as follows: The MPC cells were seeded with an apparatus Multidrop 384 (Labsystems) in plates of 384 black cavities with a light background (Costar or Nunc) in 60 μl of MSC medium containing 10% fetal bovine serum (Progentix, The Netherlands), at a density of 500 cells per well. One day later, a 96-well plate containing the Ad-shRNAs added as aliquots and others containing positive and negative control viruses (control plate of the genetically modified organism carrying one or more genes that have become less active) were thawed and the aliquots of the viruses transferred to the MPC plate using a 96-channel distributor (Tecan Freedom 200 equipped with a TeM096 and a plate manipulator RoMa, Tecan AG_, S lza _) _._ For the control plate, the virus storage material in the amount of 1 μl (average concentration of 2 X 109 viral particles per ml) was transferred to the selection plates of 384 cavities. On the control plate (see Figure 3), the negative control viruses (Ni, N2, N3) and positive (Pl, P2) are distributed diagonally on the plate. NI, N2, N3: Ad-siRNAs which targets eGFP, mannose-6-phosphate receptor and luciferase mRNA, respectively. Pl and P2: Ad-siRNAs that target the PRKCN (H24-010) and MPP6 (H24-011) mRNAs. P3: Ad-eGFP: the overexpression of eGFP allows verification of infection efficiency. The Ad-shRNAs were selected in 3 Mutiplicities of infection (MOIs): 12,000, 4,000 and 1,333. The Ad-shRNAs were added as aliquots in the internal cavities of a 96-well plate at a concentration of 1.5 x 109/4 μl and the 1/3 and 1/9 dilutions were derived from this plate (Figure 11). The 3 resulting plates were used to infect the plates of 3 x 384 cavities seeded with MSCs, in positions Al and B2 of each quadrant using robots. The viruses on the control plate were transferred by means of a pipette to positions A2 and Bl. Then, 5 μl of the adenovirus expressing the adenovirus receptor and the human coxsackie virus (hCAR) (AdCl5-hCAR / AdC20-hCAR), were transferred to these cavities (final MOI of 155) from a plate with V-bottom of 96 cavities with the help of the 96-channel distributor. The plates were then incubated at 37 ° C. 10% C02 in a humidified incubator for four days. Four days post-infection, the medium containing the adenoviruses was replaced by 60 μl of fresh MCS medium containing 10% free FCS of the virus. After about nine additional days of incubation, the medium was removed, 15 μl of a solution of 4-methyl-lumbeliferil phosphate (Sigma, # M3168) were added to each well and the fluorescence of the 4-methyl-umbelliferone released by the activity of the Alkaline phosphatase was measured after 15 minutes of incubation at 37 ° C using a fluorimeter (excitation: 360 nm, emission: 440 nm, FluoStar, BMG). All viruses of Ad-shRNAs were selected in duplicate at 3 MOIs in two independent selections. The thresholds were calculated for this signaling of success using either all the negative controls present in a selection round ("global" analysis) or using the negative controls present on a selection plate ("local" analysis). The threshold was set at a BAP signal higher than the average plus 3 times the standard deviation of the negative controls. The two individual data points for each virus in the batch were analyzed independently. Success signals were selected if one of the Ad-shRNAs scored at least one MOI in duplicate in at least one of the 2 selections above the threshold (see Table 3). A "global" analysis of the data identified 32 sites that target 61 siRNAs and a "local analysis" identified 35 sites that target 84 siRNAs. The identity of the 38 selected genes is presented in Table 1 along with the final number of siRNAs that scored in the BAP assay. In this table, the numbers indicate all the siRNAs that qualified in the BAP assay, including the 38 original siRNAs. Based on the "global" "local" analyzes respectively, an average of 2.61 and 3.21 constructions was finally identified for each of the 38 validated objectives. All 38 original Ad-shRNAs qualified in the BAP assay based on both "Global" and "Local" analyzes. In conclusion, the additional Ad-shRNAs that target 38 selected targets were designed and constructed. The negative controls present on the control plates were used per plate ("Local" analysis) or per plate lot ("Global" analysis) to determine the cut to give a signal of success. The "Global" analysis led to 61 viruses that qualified as positive in the BAP trial, confirming 32 of the 38 validated targets. The "Local" analysis led to 84 viruses that qualified as positive in the BAP assay, confirming 35 of the 38 validated targets. All 38 original Ad-shRNA viruses qualified in the BAP assay when either a "Global" or a "Local" analysis was used. The objectives LOC160662, PPIA and SLC39A4 They were identi fi ed only in the. "Local" analysis. Table 1: Sets of primers used: Primers specific for the gene were developed for the genes denoted in the left column. Its orientation (For = same sense, Rev = antisense) is indicated in the second column. The sequence of the primers is provided in the third column. Table 2. Primers used for the identification of PLAP and other phosphatases Ncpfoe Sequence SBC ID NO »roo-osF (PLAP) TTCCAG? CCA.TTSaC TGAGT 241 JI > 0-05bÍB R < PLAP / ALPI / AI? PPI? 2) ACTCCCACTGACTTTCCTGCT 242 IDO-21F (BAP) CATQC GAGTGACACAGACAACAAG 243 JD0-21R (BAP) 0? GGTAQTTGTTGTGA < 3CATAGTCC! A 244 Table 3: Identification of siRNAs for the validated targets selected in the BAP assay.

Table 4. Review of isolated constructs of gnically modified organisms carrying one or more genes that have become less active and corresponding target gene sequences fifteen OS 00 twenty fifteen twenty fifteen - . 15 -o or twenty -J twenty fifteen twenty a twenty j fifteen twenty j twenty fifteen twenty j twenty 1 oo twenty fifteen twenty THE oo O oo twenty oo twenty 00 twenty 15 00 twenty oo twenty oo twenty 00 fifteen twenty 00 00 25 00 twenty o twenty Table 5. Review of additional constructions of genetically modified organisms that carry one or more genes that have become less active and correspond to target gene sequences * SEC ID NO: Sequence Symbol of the Access of the Name constructions Target KD Target gene. GßnpanJt receptor 18 CGÜ.TUQC? GAATCA.TTT? C GFÁ36 NH_001S07 bound to protein G 247 receptor 38 CQOGO? GATOtCACTTC GFJV3S MM_001507 bound to protein G 341 receptor 38 CTCTCAQTACTTTAACATC OPK3B SH_001S07 bound protein G 349 HM_1990S4 - serine / threonine kinase 2 from CA1AACAJUU »JCATCaCCC MKNK2 - HOta BM_017573 -S1C33C interaction with MAP kinase 350 • JA TSATAGCC? TCCAG CBSXXOX - CKI9I tm_oaao48 - sxß i casein kinase 1, granzyme 351 K gamma 1 (serine protease, granzyme 3;? T? CCAGGCCATTTATGac GZMK HM_003104 tryptase 11) 353 hypothetical protein TGT? OACTA sTaA CAC FLJ14S06 KM_033859 FU 14906 353 matrix metalloproteinase HM_006983 - 23A - matrix CAACCTCACCT? CA8ATC MMP23A - W4F23B NM_004ßE9 metalloproteinase 23B 354 matrix metalloproteinase BM_006BB3 - 23A - maíriz TC ACCCOA CAACCACAC MMM 3 a - MME33S NM_0046S9 metalloproteinase 23B 355 cccrroaAocavACTATOcc XM_174813 LOC254378 35C CAACTCAOACAACTaCATC IAC354378 JCM_174ßlI LOC254378 257 similar to lipase dependent oncofetal bile salt TCATTGTAAOaCTtTTQaCC IKJC13B539 »t_O70951 isoform ase Gt3ACCAA OQ 3AtlATJUlAC XXX KH_002031 kinase related to fyn 359? OCTTATCC? JGCT XATOC 7KX MK_Ooa031 kinase related to fyn 360 kinase 1 similar to unc-51 (c. cracAT AACAAOAAaAAc mja. MM_00356S chemokine elegans aci (CC portion) CCJV1 SM_O01395 chemokine receptor 1 loop (CC portion) cccprciaaAToaACTJvc ca 1IH_001395 receptor 1 3S3 olfactory receptor, MH_013353 - family 1, subfamily A, CAATTATOAßTC ACOO C OR1A2 KH_01456S member 2 264 olfactory receptor, - family 1, subfamily A, AAOSAT8GCATQTATTTC OR2A2 KM_013353 member 2 3S5 olfactory receptor, - family 1, subfamily A, TOTCTCCTATßTTCAQOTC OE1A3 »M_013353 - member 2 266 - specific for sentrin SUMO HK_015C70 - protease 3 3Í7 GATOÍ? CATQTA OaAaAC SENP3? m_oas« 7? - specify sentrina / SUMO 268 protease 3 specific sentrine / SUMO AT CCTTCM? COXATOSC SENP3 NH 015670 protease 3 taste receptor, type 1, QCTCCIGSAQAACATßl? C TAS1R3 XM_371210 member 3 protein kinase one hundred amino acids KM_016151 STE20 derived from the prostate Acs? ccrcAaAcaTTCTC T? OI KM, 00 * 783 271 similar to kinase PSK protein kinase of one hundred amino acids Mt_0161Sl STE20 derived from prostate MGCOGKCCX? QtaACITC TAOl MM_004783 273 similar to kinase PSK family 16 carrier of solute (transporters acid csrcTAt? STA siGTrc SLCißja HH_004207 monocarboxylic), chain 3 short chain regulated by androgen GTQTGT? C? CA? CTGT? C ARSDR1 XM_01602C dehydrogenase / reductase 1 short chain regulated by androgen GOCACAGTCCAATCTeAAC ABSDRi HH_016036 dehydrogenase / reductase 1 RAS, dexamethasone C8CAAOTXCTACTCCATCC RASD1 HH_01Í0B4 induced 1 RAS, dexamethasone GGTSZTC? GTCFG? CAAC RASD1 HH_0160ß4 induced one RAS, dexamethasone OTOTTC 3TCGGACAACC RASD1 HM_016084 371 induced 1 open reading frame 121 ACT GAACGCTCTCCACAC caoorfi? i NH_0I4331 chromosome 20 open reading frame 121 GTCTTCAATAAcrraAAGC caoaxtuí HM_024331 chromosome 20 HMT1 hnRNP like methyltransferase 3 CCACAACAAQCACGTQITC? RMT1L3 NM_01S854 (S cerevisiae) receptor-associated kinase 2 ATCAATCGAAAGATICTTC XKJUC2 HM_001570 8X181 interleukin 1 receptor-associated kinase 2 CACACOT GACAATTCCAOC XKAK2 NM.001S70 Interleukin 1 receptor kinase 2 receptor-associated kinase 2 OCAOASGTQCAGATTTGTC XKMCS HM_001S70 Interleukin 1 glutamate receptor, κBKlac notrópico, N-methyl D-TCAGCArrCCTACQATJAC GWtl8? HM_00083? . aspartate 2A glutamate receptor, ionotropic, N-methyl D- CCGO AGAACQATAACCTC QRXH3? HH_000833 Z «6 aspartate 2A glutamate receptor, ionotropic, N-methyl D-CCAGAACTCTQA? OTTTAC QRSV3A NM_000B33 aspartate 2A glutamate receptor, ionotropic, N-methyl D-GCATGOCñAGAAADTTAAC GRIW2A NM_000833 aspartate 2A glutamate receptor, ionotropic, N-methyl D -AOC? TGTTATG CTTATOC GRIM3A KH 000833 aspartate A T? TTOT T raCCATAOC OATCGTTAACCACCCTOAC 8CM »CCßTGßSAßT? TAC OICCRrCOM? TCAAGAAC ZGC ?? OCICTTACCCMSC CH? ATCCCTTCGTCTAOC CGTGsrci? Cscs TCi? E C? TTATCAC ATGCTCGOC TCTCTCTTCCTATCAATCC CCXAADJT? TCTOGAAQAC GTACCTGTAOCCATCTAAC CCTAGTGAKGAA GATGOC ACACOACTATAASTCTAAC ACATTGCAATGGACAACAC OOAAT? TCCTGAU'lUT OC raccAO? OoaArsAACTAC ATGGA? GACTGCTQQAATC Q? OCGCTTCAA? Ca? GATC ACOTCTOCCTJU3ATTCTTC ACOCATCrrGGCAAAOASC ATTCCAGOaTTTATG GTC CAACASTOCATCTCTT? TC ET-3 CAECATCACCTCCTGAAC CCM CMCSCTCTCAATCCCrTC GHU50 CAT03ACTATATAGCABßC CSL CCAAG? GTCTAT CAA? OC OR1A? CCACTAAXOTCAACA &TCC GPR23 CC? CTCGTCAßATOXTTQC LOC254378 CCCTG CA TOATQQAOAC XEi CCOAGCCATATACTTGACC C20or £ 121 CCTAßAGCTQATTßAGTTC V0SSS2 - MH3 CCTOQACACCAASTCTTßC SASD1 CGCTCT TAACATßAATOC TAO COIGOA ATOaACIACQAC TA91R3 CTCQZAATßAGACI? TAAC ARSUR1 CITCAA? TC CAQOpTC GPRS4 QAAßCACa? STTGQAQGTC ULK1 s? Q Tß? AGß? GAcsprc FU22955 ? XH_49762l XMJ371409 NM_203431 ii Ciaei 0 -XM_496546 0C388817 - PFXAXM_170597 - KBTBD9 -XM_0S717 £ OC2S6374 -HH_021130 L0C13 05S -XM_372741 LOC3S0SJS6 -XH_372715 OC391062 - SM_203430 LOC343384 - XM_291S44 - peptidyl isomerase OA LOC401859 ?? TSßTTATAAOGßTTC XM.377444 A 321 carrier family 39 of solute IM .0177Í7 - (zinc transporter), GCIACTQC ATAGATC 8 C39 4 HH_130ß49 member 4 329 endothelial tumor marker TCOSOTTCIATIG? TCGC TT45 UM_032777 precursor 5 330 mitogen-activated protein TCQCC TCCTATTCCTTC HAP3K9 KM 033141 kinase kinase kinase 9 331 family 16 carrier of the solute (transporters of TGTACSTGTTCATCCTßGC SLC16A3 BM 004207 carboxylic acid), member 3 332 olfactory receptor, family 1, subfamily A tataACATtATGCCtttoc ORIA? HM 012353 member 2 333 Table 6. Signals of success of the mineralization 924-001 CAAC? TGTACCTQQ6CAGC GPR38 NK_001507 receptor 38 bound to G protein «24-004 CATGCTGTTTGAGAGCATC MHK2 - HHX2 HM 017572 S 236 serine / threonine kinase 2 interaction with MAP kinase 324-006 GACGGTGTTAATGATAGCC CSOTOtGl -NM_022048 SK647 casein kinase 1, gamma 1 CKlg 324-007 CTTCGGOACTCCTQAOTTC H? A247087 -AJ2470B7 - - SK536 myosin light chain kinase caMLCK 124-009 ACßCAAAQTGGCCAGGAOC IPT NM_017646 tRNA isopentenyltransferase 1 324-013 CAACCTGCTGGTGCTOSTC OPN3 NK_014322 opsin 3 (encephalopsin, panopsin) 324-014 CTCTCTTAOATCTGGAACC QZHC HM_002104 granzyme K (serine protease, gramzyme 3, tryptase II) 324-015 AOCASGA? ßGCGßACAT? C AF073344 -AF073344 - protease 3 specific for ubiquitin - USP3 HM_006537 protease 3 specific for ubiquitin 324-01B CAGSTAOTTOQTTCTQA? 0.3A1 NM_000129 coagulation factor XIII, polypeptide Al 324-019 CTGCSCCßAACAAATGTAC PSMB3 HM .00279S proteasome (prosoma, macropain) subunit, beta type, 3 324 - 020 TGTGOCßACTTsTGCACAC CUX NM_006660 protease homologue X caseinolitica Cl x (E coli) 324-021 TCTCTCAQTGTAGAATGCC P T14906 NM_033859 hypothetical protein FLJ14906 324-024 sTOTACTss ACAAGGACC MMP23A -HH_0046S9-matrix metalloproteinase 23 A - matrix KM? 23B NK.006983 metalloproteinase 23B 324-026 TCTCTCATCAATACTGSTC APBX HM_001641 -nuclease APEX (enzyme repair) NH_080648 Multifunctional DNA) NM_080649 324-029 CTATGCCATCACCTTCTGC L0 25437B XH_174813 324 - 030 TGTQCCGAAGGATCTAAQC LOC137491 SH_070459 LOC254378 similar to a disintegrin domain 25 324-031 CCBGOACATAACTAAATCC and metalloprotease (testase 2) LOC13B529 XM_070951 similar to the oncofetal isoform of lipase HM_001737 dependent on bile salt 324-032AGCAGOCTATaßGATCAAC C9 complement component 9 324-033 CCACAAOGTTßCAGCAT? CX? B NM_00S10B homolog of xyululinase (M. influenzae) | 324-035SGQCTCAGCCAQGASATTC CABC1 - ADCK3 NH.020247 SK609 chaperone, activity of ABC1 of the bel similar complex (S. pombe) 324-036 CñGGTAOACATGGCGGCAC nuc NM_002031 kinase related to fyn 324-038GCACGATTTGGAGSTCQCC ÜI? L HM_003S65 kinase 1 similar to unc-51 (C. elegans) 324-04 OSACICICAGTTCAGCATC PIK3C2B H_002646 phosphoinositide-3-kinase, class 2, beta '324-049 polypeptide OXACCTGCAGSßCTCAGC AVPR1B MH.000707 Arginine vasopressin 1B receptor GT4CGCGGCaGrißTTC CCRl HH_001295 chemokine receptor 1 (CC portion) 324-062 TTCQOACACCCACAAATGC KRH NH .006583 rhodopsin homolog derived from retinal pigment epithelium ] 324-064 OT aiCC OTTCXOACGTC OR1A2 NH_012353 olfactory receptor, family 1, subfamily A, member 2 324-071CACCTQOTT CTCAATOCO XIAA1 53 HH_025090 protein K1AA1453 324-073ASCACCTCOCTGACATTCC SBNP3 NM_01S670 protease 3 specific for sentrin / SUMO 324-078GOTTCTGG GGAGAAGGAC TGM3L XK_066Í81 similar to transglutaminase 3 324-079 GTOTATGAAGTGOTCCACC LOC160662 XM 090422 similar to carrier family 21 of Soluto - (organic anion transporter), member 8 H34-084 CAG GCCAAßAAGßAGCCC AV2 NM_018162 neuron navigator 2 H24-092ATaCAGGTCCATATGTGAC TRPM6 NM.0 7662 potential cation channel of the transient receptor, subfamily M, member 6 324-093 CCTTTCTCTGAACACGOAC ATR H_oo i84 ataxia and telangiectasia and related Rad3 324-095 CAGGTTC CCTCAAACGGC 0C126788 XM_060177 similar to TPA: receptor bound to protein G 324-097ACATCCTGCTGTCAGAGCC TAO - F6K mt_0047B3 - protein of one thousand amino acids HM_oi6i5i kinase - kinase PSK similar to STE20 derived from the prostate 324-099 GTTCTCCAGTGCCATTGGC SLC1SA3 M_004207 family 16 of the solute carrier (monocarboxylic acid transporters), member 3 324-104AGTGCGCAirCTTCaGCCTC FG? 14 KM_00411S fibroblast growth factor 324-106GCCCTGATGTCCACTTCC HR1 SN.014434 FMN oxidoreductase and FAD-dependent NADPH 324-107 CATAßGGAAGGACACTTaC H.1F8 NM_01443ß Interleukin 1 family, member 8 (eta) 324-108 CCTGOATOTGAGAGAGAGC IL1F8 HM_014438 interleukin 1 family, member 8 (eta) 324-109AACTTGTACTATGA? TGCC RABSF2 NM_014737 Ras association domain (RalGDS / AF-6) family 2 324-110GTAT CTGTACACCCXGGC ARSDB1 NM_016026 dehydrogenase / reductase 1 short chain regulated by androgen 324-111TTCTCGCAATGGCCAATQC peptidylprolyl isomerase like PPII NM_0160S9 (cyclophilin) 1 RAs, dexamethasone-induced 1 324-113 324-113 GAAGAACAGCAGCCTQGAC RASD1 NM_016084 TCAßOCGGACTTGACAGC DCXR HM_016286 H24-H7 TCTCTCCACACAAACCGK: dicarbonyl / L-xylulose reductase £ C20or 131 H_024331 open reading frame 121 chromosome 20 324-119 GCSAATTCCACCAGCATC SLC26AB HH_05296i 324-120 TGTCCAGGACCTATTGAGC UGT1A1 HH_000463 family 26 of the solute carrier, member 8 family 1 of UDP glycosyliltransferase, H24-128 TGTßCGAßACCTCGATTTC HRHT1I3 HH_019854 Polypeptide Al similar to HMT1 hnRNP methyltransferase 3 324-130 AGCATGAAAGAAACCCTGC (S. cerevisiae) KKSG00000169O KSISG00000169066 • - short chain peroxisomal alcohol 66 - hu NRBR HM_021004 dehydrogenase 324-131 OAAGATCACCATTOCGGAC PPI? -HM_021130 -Similar to peptidylprolyl isomerase A 0C127711 -JSMJ) 6062S - (cyclophilin A) - similar to OC128430 -XM_066074 -peptidyl-prolyl cis-trans isomerase A LOC138130 -JM_07077! - (PPIase) (Rotamase) (Cyclophilin A) LOC165317 -JM_092514 - Cyclosporin A agglutination protein) LOC2S7332 XM_173314 (SP18) 324-133 TGCAGGCAAGCAßACQGTC OXCT2 NM_022120 3-oxoacid CoA transferase 2 324-136 CTTATTßTTCACATTasCC LOC170327 2W_932S5 similar to glyceraldehyde 3-phosphate dehydrogenase 324-138 TCAGQTOTCCCATTCCAGC ISAX2 NM_001570 - SK180 kinase 2 associated interleukin-1 receptor 24-141 GAGTCCAGCCTTCATOCCC HOMCVPIir -J02906, -cytochrome P450, subfamily IIF, C? P2P1 MM_000774 polypeptide 1 24-142 GTCCAGCTGAAOAAGMCC QRI 2A XM 000833 receptor of glutamate, isotropic, N- methyl D-aspartate 2A 324-143 TTOSOCAC? GAaSTCTTßC FU32955 NM 034819 hypothetical protein F 22955 S34-145 CCTGCTCTTGAGC? ATAAC TBH5 MM_033777 334-146 TGTCCAQACCACATGGAGC L0C12653B XH 065153 precursor of endothelial marker 5 of the tumot similar to cytochrome P450, subfamily IVF, polypeptide 2; leukotriene B4 omega-hydroxylase; leukotriene-B4 S24-148 GA? TGTGGCCAAGAAGTAC CI1IC6 XM .093804 20-monooxygenase intracellular channel 4 of chloride 324-149 CCTCATTATCACCATGCTC L0C167417 X_09447i 324-150 CTGQTTATTGGCGG3TKK! IOC165345 XM 103864 LOC167417 similar to 25-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial precursor (25-OHD-l alpha-hydroxylase) (25-hydroxyvitamin D3 I-alpha-hydroxylase) (VD3 IAA hydroxylase) (P450C1 alfe) (P450VD1- alpha) 324-154 GTTCAAGAAGCTGCGCCAC OPK1M -HM_000513 OPH1I ?? KM 030061 • opsina 1 (conical pigments), sensitive to medium waves (color blind, deutan) - opsin 1 (conical pigments), sensitive to long waves (color blind, protan) 24-156 GCAGTTCCAAGCTTGCATC OPK1SW NM_001708 - opsin 1 (conical pigments), sensitive to short waves (color blind, tritans) 24-157 OTACCTGCGCCACTTCTTC CCR3 MM_001837 24-159 GTCCTOCTACATCAATGCC GPB33 NM_005396 chemokine receptor 3 (portion C-C) 324-160 GAAGAAGCSACTGGGAGCC GPR64 NM_005756 receptor 23 bound to protein G 34-169 CaACCTOTTCATCCTTAAC GA R2 NM_003857 receptor 64 bound to protein G B34-173 GTTCTCTCAGCACGTTCOC EGr NM 002632 receptor 2 galanin factor of placental growth, protein related factor from 324-180 ATGCAGGTCAGGTTOTTTC SLC4A10 HH_022058 vascular endothelial growth family 4 of the solute carrier, similar to the bicarbonate transporter 334-185? CCGTGGAAGGCCTATCGC C? P34 NH_000783 sodium, member 10 cytochrome P450, subfamily XXIV 324-188 TCGGCAGGGCCAGCATTTC HST1 MH_020998 vitamin D 24 - hydroxylase) macrophage stimulant 1 (similar to 324-190 TCAG7? GGTTGTGCAGGAC Apg4B HK.013335 hepatocyte growth factor) 324-191 CA »CTTGCATGAC?» CGßC APP NM 000484 protein KIAA0943 beta amyloid precursor protein (A4) (protease nexin-II, disease of 334-193 ACCAGTGCTAAATGTCAGC DU8PS NM.004419 Alzheimer) 324-194 CTCTGTATCCCATTCCCTC HAP3K9 XM_037337 phosphatase 5 double-specificity 'protein kinase kinase kinase 9 324-200 OTAGCACTCTOCGACATGC S C39A4 HM_017767 activated by mitogen NH_130B49 -family 39 of the carrier of solute 3 -202 GW? TTCG CC? CC? TGQC NMMT KM_006169 (zinc carrier), member 4 324-205? GCATGACAGGAAACCTaC UGCGL2 BH 030121 nicotinamide N-methyltransferase similar to glucosyltransferase 2 324-307 CCTTGTXGGCCAATGATTC 0C166161 JW .093702 similar to acrylacetamide deacetylase (esterase) 324-211 CAAGTTCTCCTQCAASTTC ATP4B HH .000705 ATPase, H + / K + exchange, beta 324-318 polypeptide CAACATCCCAACTGTGSTC GSR HM 000637 glutathione reductase B24-319 TATCCTGACCTTCCTGCGC KCMG1 KM_002237 channel with gates for voltage, potassium, subfamily G, member 1 D4-334 TATTCGTGCGGAGGAAGAC S9K071 SX521 324-225 ATOGGCTTCAACAßCCACC AVPR1B SH_O0O707 arginine vasopressin IB receptor REFERENCES Lipinsky, CA, et al. (2001). Adv Drug Deliv Rev 46: 3-26 Nakashima K, by Crombrugghe B. (2003). Trends Genet. 19 (8): 458-66. Marzia M, et al. (2000). J Cell Biol. 151: 311 Thirunavukkarasu et al., (2000) J Biol Chem 275: 25163-72 Yamada et al., (2003) Blood 101: 2227-34. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (25)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property.

1. The method for inducing the differentiation of undifferentiated mammalian cells into osteoblasts, characterized in that it comprises contacting the undifferentiated cells with an inhibitor of any of the polypeptides listed in Table 4, and / or the fragments and / or the derivatives of the polypeptide.

2. The method according to claim 1, characterized in that the molecule is an inhibitor of expression or translation that inhibits the expression or translation of a polyribonucleotide encoding the polypeptide.

3. The method according to claim 1, characterized in that the inhibitor is a nucleic acid that expresses an inhibitor of expression or translation that inhibits the expression or translation of a polyribonucleotide encoding the polypeptide.

4. The method according to claim 3, characterized in that the nucleic acid is included within a vector.

5. The method according to claim 4, characterized in that the vector is an adenoviral vector, retroviral, viral adeno-associated, lentiviral or a sendaiviral vector.

6. The method according to any of claims 1-5, characterized in that the inhibitor is selected from the group consisting of an antisense RNA, a ribozyme. which cleaves the polyribonucleotide, an antisense oligogodeoxynucleotide (ODN), and a small cell interference RNA (siRNA) that is sufficiently homologous with a portion of the polyribonucleotide such that. the siRNA is capable of inhibiting the polyribonucleotide that could otherwise cause the production of the polypeptide.

The method according to claim 6, characterized in that the inhibitor is a siRNA, comprising a first nucleotide sequence of 17-23 nucleotides, homologous to a nucleotide sequence selected from any of the target genes listed in Table 4 , and a second nucleotide sequence of 17-23 nucleotides complementary to the first nucleotide sequence.

The method according to claim 6, characterized in that the inhibitor is a siRNA, comprising a first nucleotide sequence of 17-23 nucleotides selected from the nucleotide sequence identified by SEQ ID No: 1-220 and 247-333 in tables 4 and 5, and a second nucleotide sequence of 17-23 nucleotides complementary to the first nucleotide sequence.

9. The method according to claim 7 or 8, characterized in that the siRNA further comprises a third nucleotide sequence that connects the first and second nucleotide sequences, and is capable of forming a stem-spire structure within the siRNA.

The method according to claim 9, characterized in that the third nucleotide sequence consists of the nucleotide sequence defined by SEQ ID NO: 334.

11. A method for identifying a compound that induces the differentiation of mammalian cells. not differentiated in osteoblasts, characterized in that it comprises: (a) contacting one or more compounds with a polypeptide listed in table 4, encoded by any of the genes listed in table 4, and / or the fragments and / or derivatives of the polypeptide; (b) determining the agglutination affinity of the compound to the polypeptide; (c) contacting a population of undifferentiated mammalian cells with the compound exhibiting an agglutination affinity of at least 10 micromolar; Y (d) identifying the compound that induces the differentiation of undifferentiated mammalian cells.

12. A method for identifying a compound or mixture of compounds that induces differentiation of undifferentiated mammalian cells in osteoblasts, characterized in that it comprises: (a) culturing a population of undifferentiated mammalian cells expressing a polypeptide listed on the Table 4, encoded by a gene listed in Table 4, and / or fragments and / or polypeptide derivatives; (b) exposing the population of cells to a compound or mixture of compounds; and (c) selecting the compound or mixture of compounds that induces the differentiation of undifferentiated cells into osteoblasts.

The method according to claims 11 or 12, characterized in that the compounds are selected from the group consisting of low molecular weight compounds, peptides, lipids, natural compounds, and antibodies.

14. A polynucleotide, characterized in that it comprises a sequence of 17-23 nucleotides, homologous to a nucleotide sequence selected from any of the target genes listed in Table 4, and variants and / or inverse complements thereof.

15. The polynucleotide according to claim 14, characterized in that it has a nucleotide sequence selected from the nucleotide sequence identified by SEQ ID No: 1-220 and 247-333 in Tables 4 and 5.

16. A polynucleotide in accordance with claim 14, characterized in that it has a reverse complement of a nucleotide sequence selected from the nucleotide sequences identified by SEQ ID No: 1-220 and 247-333 in Tables 4 and 5.

17. The polynucleotide according to claims 14, 15 or 16 characterized in that it is used as a medicine.

18. The use of a polynucleotide according to claims 14, 15 or 16 in the manufacture of a medicament for the treatment of a disease that involves a systemic or local reduction in average bone density.

19. A vector, characterized in that it comprises a polynucleotide according to any of claims 14-17.

20. The vector according to claim 19, characterized in that it is used as a medicine.

21. The vector according to claim 19 or 20, characterized in that the vector is an adenoviral, retroviral, adeno-associated viral, lentiviral vector or a sendaiviral vector.

22. The use of a vector according to claims 19, 20 or 21, for the manufacture of a medicament for the treatment of a disease that involves a systematic or local reduction in average bone density.

23. A method for the in vitro production of bone tissue, characterized in that it comprises: (a) applying undifferentiated mammalian cells on a substrate to form a cellular substrate; (b) introducing a polynucleotide according to claims 14-17, or a vector comprising the polynucleotide, for a period of time sufficient to differentiate undifferentiated cells into osteoblasts, whereby a continuous bone matrix is produced.

24. A method for diagnosing a pathological condition that involves a systematic or local reduction in average bone density or a susceptibility to the condition in a subject, characterized in that it comprises: (a) determining the level of expression of a polynucleotide encoded by any one of the target genes listed in Table 4, in a biological sample derived from the subject; and (b) compare the level of expression with the level of expression of the polynucleotides in a sample derived from a healthy subject; wherein an increase in the amount of the polynucleotide in the sample of the subject compared to the sample of the healthy subject is indicative of the presence of the pathological condition.

25. A method for diagnosing a pathological condition that involves a systematic or local reduction in average bone density or a susceptibility to the condition in a subject, characterized in that it comprises: (a) determining the amount of a polypeptide encoded by the genes listed in Table 4 in a biological sample derived from the subject; and (b) comparing the amount with the amount of the polypeptide in a biological sample derived from a healthy subject; wherein an increase in the amount of the polypeptide in the subject compared to the healthy subject is indicative of the presence of the pathological condition.