MXPA06003519A

MXPA06003519A - Clostridium botulinum c3 exotransferase compositions and methods for treating tumour spreading

Info

Publication number: MXPA06003519A
Application number: MXPA/A/2006/003519A
Authority: MX
Inventors: Mckerracher Lisa; Lasko Dana
Original assignee: Bioaxone Therapeutique Inc; Lasko Dana; Mckerracher Lisa
Priority date: 2003-09-29
Filing date: 2006-03-29
Publication date: 2007-04-20

Abstract

Pharmaceutical compositions, each consisting of a cell-permeable fusion protein conjugate of a polypeptidic cell-membrane transport moiety and a Clostridium botulinum C3 exotransferase unit, or a functional analog thereof, are provided. The compositions are useful to prevent or inhibit uncontrolled proliferation, spreading, and migration of a metastatic neoplastic cell of a cancer in a mammal. The compositions can each effect or arrest combination of two or more of tumor cell proliferation, migration, angiogenesis, and metalloproteinase secretion.

Description

COMPOSITIONS OF EXTRRANSFERASE OF CLOSTRIDIUM BOTULINUM C3 AND METHODS TO TREAT THE SPREAD OF THE TUMORS FIELD OF THE INVENTION The present invention relates to compositions and methods useful for the treatment of cancer and the prevention of tumor growth related to metastatic cancer. In particular, the present invention relates to compositions that have a cell-permeable fusion protein conjugate consisting of a transport portion of the membranes of polypeptide cells and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues. useful for preventing or inhibiting the uncontrolled proliferation and expansion or migration of a metastatic neoplastic cancer cell in a mammal. BACKGROUND OF THE INVENTION Cancer in a mammal can be characterized by the uncontrolled division of a population of malignant cells into tissue in a mammal. If the cell population is located in a tissue, this uncontrolled division of the malignant or cancerous cells can lead to the formation of a first malignant tumor in the tissue. If one or more cells or clustering of malignant cells migrate from the localized population site to lodge or take root and grow out of control in a second site or in additional tissue sites, site or sites may be close to the site of the first tumor or can be removed from the site of the first tumor, for example in another organ or tissue anatomically distant or different from the first tissue, then a second tumor or additional tumors may arise at the second site or at additional sites, respectively, as a result of division uncontrolled cell or migrating malignant cells. The migration of one or more malignant cells from the origin of the growth cells in the second site or the other sites may also occur, and thus produce malignant tumors at more than sites in the tissues of a mammal. Associated with the growth of these malignant tumors is often the characteristic of angiogenesis or process of vascularization of a tissue near the tumor in formation consisting of the development of new capillary blood vessels or in the growth of the vessels and the formation of tubular networks, This new vascularization provides several factors such as nutrients and growth factors that are necessary and allow the continuous growth of the tumor. A tumor is an abnormal mass of tissue that is the result of excessive division of cells that is uncontrolled and progressive, also called neoplasm. The tumors can be either benign (non-cancerous) or malignant. A variety of methods are currently used to treat cancer in a mammal such as man, including for example surgical procedures in which for example a tumor and generally contiguous or proximal non-tumoral tissues are removed from the tumor site in a tissue. After removing the tumor, residual or marginal tissue remains close to the site of tumor removal in the mammal.

If they are treated only with surgery, however many patients, particularly those with certain types of cancer, such as the cancer selected from the group consisting of breast, brain, colon, skin (melanoma), kidney (kidney) and liver cancer ( liver) will experience the recurrence of cancer in the form of formation and growth of less additional or secondary tumor, often in the residual margins remaining after the removal of the first tumor and sometimes in other tissues or organs and in remote locations or distant from the site of the first tumor. Therefore, in addition to surgery, many cancers are also treated with combination therapies such as those that include the administration of cytotoxic chemotherapeutic drugs (eg, cinchistine, viblastin, cisplatin)., methotrexate, 5-FU, etc.) and / or radiation therapy, One difficulty with this method, however, is that radiotherapeutic and chemotherapeutic agents can be toxic to normal tissues at the administered dose levels, and often create laterals that endanger the life of a patient. These cancer therapies can often have high failure / remission rates that result in the death of the patient. Some more recent therapeutic treatments take advantage of deregulation of cellular signals by means of altered or over-regulated gene products in cancer cells, such as the use of tamoxifen for breast cancer and Gleevec® (Novartis imatinib mesylate) for the chronic myeloid leukemia (also referred to as CML). An additional difficulty of the present methods is that local recurrence and control of local disease remains a major challenge in the treatment of malignancies. More than 600,000 patients per year (in the United States of America) have a localized malignancy (with no evidence of distant metastatic spread) at the time of presentation, accounting for approximately 64% of all patients diagnosed with a malignant tumor but not including non-melanoma skin cancer or carcinoma in situ. For most of these patients, the surgical removal of the disease represents the greatest opportunity for cure, and more than 400,000 patients will be cured after the initial treatment. Unfortunately, approximately 200,000 (or about one third of all patients with localized disease) will relapse after initial treatment. Of those who relapse the number of those who relapse due to local recurrence of the disease amounts to approximately 1 33,000 patients annually (or approximately 21% of those with localized disease). The number that will relapse due to distant metastases from the disease is approximately 68,000 patients annually (or approximately 11% of all those with localized disease). Approximately another 100,000 patients annually will die as a result of the inability to control the local growth of the disease. Brain tumors are a particularly deadly form of cancer. Approximately one third of all primary gliomas (gliomas represent approximately 1/3 of all brain tumors) are fatal, and the average survival for glioma patients is approximately 10 to 12 months. The five-year survival rate is approximately 9%. Gliomas are neuroectodermal tumors of neuroglial origin, and include astrocytoma derived from astrocytes, oligodendoglioma derived from oligodendocytes, and ependymoma derived from ependymal cells. A number of studies suggest that combination therapies are required to treat those aggressive tumors. The most common type of brain tumor arises from metastasis and there are approximately 1,00,000 to approximately 170,000 brain tumors per year in the United States. The average survival time is in the range of approximately 2.9 months to approximately 3.4 months. Metastatic brain tumors are mainly treated with radiosurgery or tumor removal. The best results have been reported when surgery is combined with radiation rather than radiation alone. The most common origins of metastatic tumors to the brain consist of breast cancer, bronchial cancer, gastrointestinal carcinoma, renal carcinoma and malignant melanoma. Metastatic brain tumors can be clinically explosive, especially after removing a primary tumor. Individuals suspected of having CNS cancer (which includes brain tumors and brain cancer as used here) can be identified by detecting clinical symptoms such as headache, nausea or vomiting, seizures, altered metal status, altered speech, visual abnormalities and / or paralysis. A method for inhibiting metastasis of primary CNS cancer in a mammal is also within the scope of the present invention.

Angiogenesis Many of the mechanisms that control angiogenesis in normal tissues are altered in the presence of a malignant tumor during tumor growth. The formation and metastasis of a tumor includes pathological angiogenesis. Like healthy tissues, a tumor requires the connection to blood vessels in order to receive nutrients and oxygen and eliminate cellular waste. Thus pathological angiogenesis is critical for the growth and expansion of tumors. Tumors in which angiogenesis is important include solid malignancies as well as benign tumors, for example such as acoustic neuroma, neurofibroma, trachoma and pyogenic granulomas. In metastasis, pathological angiogenesis is important in at least two aspects. The formation of blood vessels in tumors allows tumor cells to enter the bloodstream and circulate throughout the body. Angiogenesis supports the formation and growth of new tumors implanted by tumor cells that have been left in the primary site or first tumor as used herein. Angiogenesis is the complex process of blood vessel formation. The process includes both biochemical and cellular events, including (1) the activation of endothelial cells (EC) by an angiogenic stimulus; (2) degradation of the extracellular matrix, invasion of activated EC in the surrounding tissue and migration towards the source of the angiogenic stimulus; and (3) proliferation and differentiation of EC to form new blood vessels (Folkman et al., 1991, J. Biol. Chem. 267: 1 0931 -.10934). The control of angiogenesis is a highly regulated process that involves angiogenic stimulators and inhibitors. In healthy humans and animals, angiogenesis occurs under specific and restricted situations. For example, angiogenesis is normally observed in fetal and embryonic development, in the development and growth of normal tissues and organs, in wound healing and in the formation of corpus luteum, endometrium and placenta. Another embodiment of the present invention is the inhibition of angiogenesis by means of a cell-permeable fusion protein conjugate comprising a polypeptide cell membrane transport portion and a Clostridium botulinum C3 exotransferase unit, or a functional analogue , for example a fusion protein such as BA-05. Another embodiment of the present invention is the inhibition of angiogenesis by means of an effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate containing a polypeptide cell membrane transport portion and a cell Clostridium botulinum C3 exotransferase, or a functional analog, for example a fusion protein such as BA-05. Rho signaling and cancer Rho family proteins (also known as Ras homology) have been investigated in relation to cancer. Tas (and RhoB as a secondary objective) are the targets of metastasis by means of molecules that inhibit posttranslational modification. However, these therapeutic investigations focus on Ras and are limited to RhoB among members of the Rho family, although the current invention has the potential to affect RhoA signaling; RhoB and RhoC. RhoA; RhoB and RhoC are members of the Rho family specifically inhibited by the BA-05 fusion protein. In some studies, C3 exoenzyme has been used as a molecular probe for Rho involvement and significant changes have been found in the parameters of in vitro models considered important in cancer such as cell transformation. In those studies C3 was applied by means of methods ranging from a prolonged incubation in a tissue culture medium to the heterologous expression of the gene. It is an advantage of the present invention that the compositions and methods of the present invention such as BA-05 and administration of BA-05 offer a significant advantage over C3 due to the ability of the compositions of the present invention to penetrate into tumor cells to rapidly inactivate Rho at low doses. In another advantage, the present invention provides compositions consisting of a fusion protein of this invention such as BA-07, a fusion protein that has the ability to penetrate both tumor and endothelial cells that in the absence of fusion protein can form new blood vessels that promote tumor growth. Mutations in the regulatory proteins of the Rho family have been found in the clinical samples of malignant tumors. The examples include the DLC1 gene in hepatocellular carcinoma; p-1 90-A, in a genomic region that is altered in gliomas and astrocytomas; GRAF, which has lost from function mutations in leukemia; and LARG, found in some genetic fusions found in acute myeloid leukemia. The mutations of points by genetic engineering activate RhoaA and induce cell transformation in vitro. Genetic expression of the Rho family in human malignancies The small Rho of GTPase is a cellular target of BA-05, and is up-regulated in some cancers, such as malignant melanoma and breast cancer. In contrast to the small Ras of GTPase, Rho GTPases have not been identified as oncogenic by traditional methods, although evidence has accumulated that the deregulation of Rho gene expression in cancer. For example high levels of RhoA mRNA have been observed in tel tumor cell testicular germ, and higher Rhoc mRNA in inflammatory breast cancer and pancreatic adenocarcinoma. The Cancer Genome Anatomy (CGAP) project correlates gene expression with the site of the malignant tumor. There is data available on the levels of transcription in libraries made of malignant and normal cells (NCBl, 2002) Transcription levels are measured using "labels", this is 10 base oligonucleotides that uniquely define a gene. available on RhoA, RhoB and RhoC I show deregulation of RhoA and to a lesser extent in those measurements, RhoC in malignant tumors of the brain and breast.RaA labeling tags are most frequently found in libraries made of malignant tumors of the cerebellum and breast. The levels of expression were high in glioblastoma but not in astrocytoma.The result of astrocytoma corresponds to the reduction of RhoA protein levels in the tumor samples of astrocytes.The Rho C mRNA is overexpressed in the malignant tumors of the breast and to a lesser extent in some malignant tumors of the brain, and it can be downregulated in the adenocarcinoma of c However, the relative levels of Rho cDNA in these libraries may not be directly related to the action of Rho in the cell, which undergoes complex regulation including numerous different genetic products. Rho proteins in tumors and tumor cell lines The expression of Rho protein has been investigated in several tumor sites in humans. Higher levels of protein are found in colon, breast and lung tumors. Levels of RhoA and RhoB have been found in 5 μm sections of squamous cell carcinomas of the neck and head using polyclonal antibodies directed against these proteins, followed by visualization using a VectaStain (Vector Labs) and image analysis. The nearby "non-neoplastic" areas were used as controls. Although RhoA protein levels were elevated as the tumor progressed, RhoB levels were reduced in invasive tumors compared to carcinomas in situ and well-differentiated tumors. The activation states were not studied. Overexpression of RhoA and RhoB can occur in breast and lung adenocarcinomas compared to normal tissues, in which the expression of Rho proteins is reduced in astrocytic tumors and are inversely related to grade II to IV malignancy . Rho and Rho metastasis participates in the regulation of cell motility and migration. MM 1 rat hepatoma cells transfected with mutant Rho A constructs (Val14 or Val14l le41) results in constitutively activated Rho. In an in vitro invasion assay, the percentage of seeded cells capable of infiltrating an esothelial cell layer correlated with the expression level of transfected RhoA Rho14. When these cells transfected with RhoA were used in an in vivo assay in the peritoneal cavity, 6 of 10 implants resulted in tumor nodules compared to 2 to 8 false transfectants. That results indicate that active Rho is correlated with tumorigenicity. An extensive study of gene expression compares two systems of metastatic melanoma models, one human and one mouse, and the shared similarities in genetic expression were searched by means of the microarray concluded that the expression RhoC was altered by increasing the levels of metastasis (Clark et al., 2000). In addition, when gene expression was manipulated experimentally, overexpression of RhoC induced a human melanoma cell line to change from a low metastatic potential to a high metastatic potential. Although RhoA was not observed to be overexpressed, a dominant negative mutation (N1 9RhoA) decreased the metastatic potency. We identified a group of 70 genes whose expression correlates with the propensity for metastasis in human breast cancer (van 't Veer et al., 2002). Although no Rho genes were found, the value of a disease marker as an indicator of prognosis was not necessarily related to its value as a target for therapy. In the case of Rho family signals, there is a complex regulation of enzymatic activity and protein-protein interactions that is not evident from the only measurements of transcription levels. SUMMARY OF THE INVENTION The individual fusion proteins of this invention are sometimes referred to by designations such as BA-05, BA-07 and the like. This invention describes a method for preventing or inhibiting the uncontrolled proliferation and expansion or migration of metastatic neoplastic cells from a cancer in a mammal, which consists of administering to the mammal a therapeutically effective amount of a pharmaceutical composition comprising a protein conjugate. of cell-permeable fusion consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues. This invention describes a method of preventing or inhibiting uncontrolled proliferation and expansion or migration, within a range of resection of a host tissue near the site of removal of a cancer tumor in a mammal, from a metastatic neoplastic cell resident in the resection margin, which consists in administering a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, administration is performed directly on the surface of the resection margin or below the surface of the resection margin that remains in the mammal, that administration in a time interval prior to, or Subsequently to or prior to and subsequently to the extirpac ion or removal of the tumor. This invention describes a method for preventing the growth of a malignant cell tumor in a host tissue in a mammal of a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a fraction of transport of the polypeptide cell membrane and of a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, wherein the fusion protein simultaneously prevents or inhibits at least two of the following: migration of the malignant cells, proliferation of the malignant cells, angiogenesis or formation of tubular structure or growth of the capillary network near the malignant cell and secretion of an active metalloproteinase of the malignant cell. This invention describes a method for preventing growth within a resection range of a host tissue near a site of removal or removal of a first tumor from a cancer in a mammal, of a second tumor comprising a residual cancer tumor cell. , the method consists of administering a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit., or one of its functional analogues, the administration is carried out directly on the surface of the resection margin or below the surface of the resection margin that remains in the mammal, that administration in a time interval prior to, subsequent to or prior to and subsequently to the excision or removal of the first tumor, wherein the fusion protein simultaneously prevents or inhibits at least two of the following: migration of residual tumor cells, proliferation of residual tumor cells, angiogenesis or formation of tubular structure or growth of the capillary network near the residual tumor cell and secretion of an active metalloproteinase from the residual tumor cell. The invention further provides for the use of the pharmaceutical composition as defined above for carrying out the above method or for producing a medicament for carrying out the above method. In one aspect, the present invention consists of a method for inhibiting the metastasis of a systemic cancer in the CNS (central nervous system) of a mammal consisting of administering to a mammal a therapeutically effective amount of a pharmaceutical composition or a protein conjugate. of cell-permeable fusion consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, for example a fusion protein such as BA-05. In one aspect, a therapeutically effective amount of a pharmaceutical composition comprises a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit of Clostridium botulinum C3, or one of its Functional analogues, for example a fusion protein such as BA-05, may have an anti-angiogenic activity and is useful in the treatment of cancer. In one aspect, this invention describes a method for preventing or inhibiting the uncontrolled proliferation and expansion or migration of metastatic neoplastic cancer cells in a mammal, comprising administering to the mammal a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues. In a second aspect, this invention describes a method for preventing or inhibiting uncontrolled proliferation and expansion or migration within a resection range of a host tissue near the site of tumor removal from a cancer in a mammal, from a cell metastatic neoplastic that resides in the resection margin, comprising administration to the mammal of a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and of a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, administration is performed directly on the surface of the resection margin or below the surface of the resection margin remaining in the mammal, that administration in a range of time prior to, subsequent to or prior to and subs ectually to the removal or removal of the tumor. In a third aspect, this invention describes a method for preventing the growth of a malignant cell tumor in a host tissue in a mammal consisting of administering to the mammal a therapeutically effective amount of a pharmaceutical composition comprising a conjugate. of cell-permeable fusion protein consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, wherein the fusion protein simultaneously prevents or inhibits at least two of the following migration of malignant cells, malignant cell proliferation, angiogenesis or tubular structure formation or growth of the capillary network near the malignant cell and secretion of an active metalloproteinase of the malignant cell. In a fourth aspect this invention describes a method of preventing growth within a resection range of a host tissue near the site of removal or removal of a first cancer tumor in a mammal, of a second tumor comprising a tumor cell cancer residual, the method consists in administering a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, administration is directly on the surface of the resection margin or below the surface of the resection margin or in tissue close to the margin of resection that remains in the mammal and administration is performed in a time interval prior to, or subsequent to, or prior to subsequent to the removal or removal of the first tumor, wherein the fusion protein simultaneously prevents or inhibits at least two of the following malignant cell migration, proliferation of malignant cells, angiogenesis or tubular structure formation or growth of the capillary network near the residual tumor cell and secretion of an active metalloproteinase from the residual tumor cell. In a fifth aspect, this invention describes a use of a pharmaceutical composition comprising a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, in the manufacture of a medicine for the prevention or inhibition of uncontrolled proliferation and the expansion or migration of a metastatic neoplastic cancer cell in a mammal. In a sixth aspect, this invention describes a use of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, in the manufacture of a medicine for the prevention or inhibition of uncontrolled proliferation and expansion or migration within a resection margin of a host tissue near the site of tumor removal from a cancer in a mammal , of a metastatic neoplastic cell residing in the resection margin, suitable to be administered directly on the surface of the resection margin or below the margin of resection in the tissue close to the margin of resection that remains in the mammal, in a range of time prior to or subsequent to or prior to and subsequent to the removal or withdrawal of the tumor In a seventh aspect, this invention describes a use of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, in the manufacture of a medicine for preventing the growth of a tumor of a malignant cell in a host tissue in a mammal, wherein the fusion protein simultaneously prevents or inhibits at least two of the following migration of malignant cells, proliferation of malignant cells, angiogenesis or formation of tubular structure or growth of the capillary network near the malignant cell and secretion of an active metalloproteinase of the malignant cell. In an eighth aspect the invention describes a use of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit., or one of its functional analogs, in the manufacture of a medicine for the prevention of growth within a margin of recession of a host tissue near the site of removal or removal of a first tumor of cancer in a mammal, of a second tumor that contains a cancer residual tumor cell, when administered directly on the surface of the resection margin or below the surface of the resection margin or in the tissue proximal to the resection margin or in the tissue close to the resection margin it remains in the mammal at a time interval prior to, or subsequent to, or prior to and subsequent to the removal or removal of the first tumor, wherein the fusion protein simultaneously prevents or inhibits at least two of the following migration of the cells malignancies, proliferation of malignant cells, angiogenesis or formation of tubular structure or growth of the capillary network near the tumoral cell residu to and secretion of an active metalloproteinase from the residual tumor cell. In a ninth aspect, the invention describes another aspect of the above aspects, in which the conjugate of the fusion protein is BA-05. In a tenth aspect, this invention describes another aspect of the previous aspects, in which the cancer is selected from the group consisting of breast, brain, colon, skin, lung and liver cancer. In an eleventh aspect this invention describes another aspect of the above aspects, in which the cancer is a brain tumor selected from the group consisting of equal tumors, neuronal tumors, tumors of the pineal gland, tumors of the meninges, tumors of the nerve covers , lymphomas, deformative tumors, and metastatic tumors located in the brain and derived from tumors of the lung, breast, melanoma, lung, and gastrointestinal tract. In a twelfth aspect this invention describes another aspect of the previous aspects, in which the cancer is a brain tumor selected from the group consisting of anaplastic astrocytoma, gioblastoma multiforme, pilocytic astrocytoma, oligodendroglioma, ependymoma, myxopapillary ependymoma, subependymoma, papilloma of the choroid plexus , neuroblastoma, ganglioneuroblastoma, ganglioneuroma and medulloblastoma, pineoblastoma and pineocytoma, meningioma, meningeal hermangiopericytoma, meningeal sarcoma, schwannoma (neurolemone) and neurofibroma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, primary and secondary subtypes of Hodgkin's lymphoma, craniopharyngioma, epidermoid cysts , dermoid cysts and colloid cysts. In a thirteenth aspect, this invention describes another aspect of the previous aspects, wherein the therapeutically effective amount is from about 0.001 microgram per cell to about 50 microgram per cellulose. In a fourteenth aspect this invention describes another aspect of the previous aspects in which the therapeutically effective amount is about 0.0001 micrograms of fusion protein per cubic centimeter (cc) of tissue at about 100 micrograms per centimeter of tissue. In a fifteenth aspect this invention describes another aspect of the previous aspects in which the therapeutically effective amount is from about 1 microgram per milliliter to about 10 microgram per milliliter to about 40 microgram per milliliter. In a sixteenth aspect this invention describes another aspect of the previous aspects, wherein the administration is carried out by means of injection, by topical application or by means of an implant. In a seventeenth aspect, this invention describes another aspect of the previous aspects, wherein the administration is selected from the group consisting of intra-articular, intraocular, intranasal, intraneural, intradermal, intraosteal, sublingual, oral, topical, intravesical, intrathecal, intravenous, intraperitoneal, intracranial, intramuscular, subcutaneous, inhalation, atomization and inhalation, application directly on a tumor, application directly at the site of the disease, application directly on or within the remaining margins after tumor resection, enterally, enterally together with a gastroscopic procedure, and ECRP. In an eighteenth aspect, this invention describes another aspect of the previous aspects, wherein the polypeptide cell membrane transport portion contains a peptide containing from about 5 to 50 amino acids. In a nineteenth aspect this invention describes another aspect of the previous aspects, wherein the Clostridium botulinum C3 exotransferase unit comprises the amino acid sequence designated by the sequence of the fusion protein BA-07. In a twentieth aspect, this invention describes another aspect of the previous aspects, wherein the functional analog comprises a protein having activity in the range of 50% to 500% of that of the Clostridium botulinum C3 exotransferase unit. In a twenty-first aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier. In a twenty-second aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition contains a pharmaceutically acceptable carrier selected from the group consisting of poly (ethylene-co-vinyl) acetate, PVA, poly (ethylene-acetate) co-vinyl) partially hydrolyzed, poly (ethylene-co-vinyl acetate-co-vinyl alcohol), a crosslinked poly (ethylene-co-vinyl) acetate, a crosslinked partially hydrolyzed poly (ethylene-co-vinyl) acetate, a crosslinked poly (ethylene-co-vinyl acetate-co-vinyl alcohol), poly-D, L-lactic acid, poly-L-lactic acid, polyglycolic acid, PGA, copolymers of lactic acid and glycolic acid, polycaprolactone, polyvalerylactone, poly (anhydrides), copolymers of polycaprolactone with polyethylene glycol, copolymer of polylactic acid with polyethylene glycol, polyethylene glycol; and its combinations and mixtures. In a twenty-third aspect, this invention describes another aspect of the previous aspects, in which the pharmaceutical composition presents a pharmaceutically acceptable carrier consisting of an aqueous gelatin, an aqueous protein, a polymeric carrier, a crosslinking agent, and a combination of the same. In a twenty-fourth aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier consisting of a matrix. In a twenty-fifth aspect, this invention writes another aspect of the previous aspects, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier consisting of water, a pharmaceutically acceptable buffer salt, a pharmaceutically acceptable buffer, a pharmaceutically acceptable antioxidant, ascorbic acid , one or more pharmaceutically acceptable low molecular weight polypeptides, a peptide with from 2 to 10 amino acid residues, one or more pharmaceutically acceptable proteins, one or more pharmaceutically acceptable amino acids, an amino acid essential for human, one or more pharmaceutically acceptable carbohydrates , one or more pharmaceutically acceptable carbohydrate-derived materials, a non-reducing sugar, glucose, sucrose, sorbitol, trehalose, mannitol, maltodextrin, dextrin, cyclodextrin, a pharmaceutically acceptable chelating agent, EDTA, DTPA, a chelant agent e for a divalent metal ion, a chelating agent for a trivalent metal ion, glutathione, a non-specific pharmaceutically acceptable serum albumin, and combinations thereof. In a twenty-sixth aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition is sterile. In a twenty-seventh aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition is sterilizable. In a twenty-eighth aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition is sterilized. In a twenty-ninth aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition is in a bottle in a quantity of unit dose or in an amount which is an integral multiple of a unit dosage amount. In a thirtieth aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition is dry. In a thirty-first aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition comprises a dehydrated matrix. In a thirty-second aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition presents a pharmaceutically acceptable carrier. In a thirty-third aspect, this invention describes another aspect of the previous aspects, wherein the pharmaceutical composition consists of a fusion protein in a lyophilized matrix. Rho Antagonism and Apoptosis The mechanisms to control cell proliferation are deregulated in cancer. Elevated apoptosis in EL4 lymphoma cells Murina T occurs after Rho inactivation by recombinant exoenzyme C3. In NIH3t3 cells, treatment with the Rho kinase inhibitor Y-27632 significantly inhibits anchor-independent growth. In one embodiment, inactivation of Rho can prevent the proliferation of tumor cells, and the present invention is the reduction or arrest of cell proliferation, or induction of apoptosis by means of a cell-permeable fusion protein conjugate that it consists of a transport fraction of the polypeptide cell membrane and of a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, for example a fusion protein such as BA-07. In another modality, the present invention is the reduction or arrest of cell proliferation, or the induction of apoptosis by means of an effective amount of a pharmaceutical composition comprising a cell-permeable fusion protein conjugate consisting of a transport fraction. of the polypeptide cell membrane and a Clostridium botulinum C3 exotransferase unit, for example the fusion protein such as BA-07. Rho Antagonism and Cell Migration Metastatic cancer cells are highly migratory. Inactivation of Rho can prevent the migration of cells in certain cell types. Transferase C3 and kinase inhibitor RHo Y-27632 blocks cell invasion by HT29 human colon cancer cells. In a 3Y1 inducible fibroblast cell line with v-Crk, C3 and Y-27632 inhibited v-Crk, resulting in reduced cell motility. Decreased apoptosis in MEF cells RhoB - / -, in Rho B +/- or RhoB - / - treated with doxorubicin, radiation or taxol resulted in a lack of the RhoB protein. In another embodiment, Rho antagonism can reduce cell migration and metastasis and the present invention comprises the inhibition of cell migration by means of a cell-permeable fusion protein conjugate consisting of a membrane transport fraction. polypeptide cell and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, for example a fusion protein such as BA-07. Another embodiment of the present invention is the inhibition of cell migration by means of an effective amount of a pharmaceutical composition consisting of a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and of a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, for example a fusion protein such as BA-05. Rho Antagonism and Matrix Metalloproteinases (MMP) Invasive tumor cells have the property that they are able to degrade the extracellular matrix that surrounds them by secreting proteases that degrade the extracellular matrix. An important class of proteases that are secreted by tumor cells is that of matrix metalloproteinases (MMPs). These enzymes open the trajectories in the matrix through which cancer cells can invade and spread. Tumor cells can produce different types of MMP, and MMPs are often produced as pro-enzymes that open and release after activation. MMP1 breaks down the collagen matrix. MMP-2 can play an important role in the invasion of lung cancer cells. MMP-9 has also been implicated in the invasion of tumor cells. In another embodiment, the present invention comprises the inhibition of MMP expression, MMP processing and MMP secretion of a tumor cell, inhibition by a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, for example a fusion protein such as BA-07. In another embodiment, the present invention is the inhibition of MMP expression, MMP processing and MMP secretion of a tumor cell, inhibition by means of an effective amount of a pharmaceutical composition containing a fusion protein conjugate permeable to the cells consisting of a transport fraction of the polypeptide cell membrane and of an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, for example a fusion protein such as BA-05. BA-05 and BA-07 as antagonists of Rho BA-05 and BA-07 are genetically engineered forms of C4 exoenzyme. Exoenzyme C4 is a secreted protein derived from bacteriophages discovered in some strains of Clostridium botulinum that transfer a group of ribose ADP to an asparagine residue of the small regulatory GTPases, RhoA, RhoB and RhoC. C3 inactivates Rho because the ribosylation of ADP prevents Rho activation. The novel modifications that distinguish BA-05 and BA-07 include a C-terminal transport peptide that allows efficient entry into the cytoplasm, resulting in a more potent Rho antagonist. BA-05 and BA-07 differ in silent mutations in the non-enzymatic region. BA-07 allows expression in a commercial scale vector for the purification of the protein useful as a therapeutic drug. In one aspect of this invention, a fusion protein such as BA-07 can be considered a permeable switch to cells of the interactions between proteins important in signal transduction. The present invention provides variants of BA-05 and BA-07 such as a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction whose amino acid sequence can be modified or shortened or elongated or truncated to contain a variant of a Clostridium botulinum C3 exotransferase unit whose amino acid sequence can be varied, elongated, shortened or truncated in a variant, or one of its functional analogues, as anti-neoplastic and anti-metastatic compositions, as well as methods and devices that use those compositions for the treatment of cancer and other malignancies.

Within one aspect of the present invention, compositions and methods are provided for lateralizing the DNA sequence of BA-07 expressed in a plasmid to improve the ability to purify large amounts of BA-07 for the formulation in a safe pharmaceutically acceptable carrier for the therapeutic use. BA-05 and BA-07 are fusion proteins according to this invention. In this invention, BA-05 variants are included which retain a proline-rich transport sequence and sufficient for the C3 transferase unit to retain the enzymatic activity towards Rho of ADP ribosylate. According to the present invention there is provided a conjugate or a fusion protein containing a therapeutically active agent in which the active agent can be provided through a membrane of the cell wall, the conjugate or the fusion protein comprises subdomain ( s) or additional transport portion (s) to the active agent (s). More particularly, according to the present invention, a therapeutically active agent is provided as a conjugate or fusion protein, containing a polypeptide cell membrane transport portion and an exotransferase unit of Clostridium botulinum C3 as a therapeutically active unit, or as its analogue functional, in which the therapeutically active agent can inhibit tumor cell migration, promote the apothesis of tumor cells, inhibit angiogenesis, and inhibit the production of metalloproteinases associated with tumor growth. It is an advantage that the compositions and methods of the present invention provide a significant improvement over prior drugs designed to arrest tumor spread or metastasis because a single compound of the invention can act as combination therapy to stop many aspects different from the growth and expansion of the tumor. It is advantageous that a composition of the present invention, such as a composition consisting of BA-07, can prevent or retard or inhibit: the migration of the tumor cell, the proliferation of the tumor cell, the angiogenesis at the tumor site and the secretion of active metalloproteinases. It is an advantage of the present invention that pharmaceutically active compounds can penetrate a cancer cell without relying on a mechanism of transporting the membrane based on the receptor. It is an advantage of the present invention that the pharmaceutically active compounds can inactivate members of the GTPases of the Rho family. It is an advantage of the present invention that the pharmaceutically active compounds are Rho antagonists. The invention describes a method for preventing or inhibiting the uncontrolled proliferation and expansion or migration of a metastatic neoplastic cancer cell in a mammal consisting of administering to the mammal a therapeutically effective amount of a pharmaceutical composition containing a protein conjugate. of cell-permeable fusion consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues. The invention describes a method for preventing or inhibiting uncontrolled proliferation and expansion or migration within a resection range of a host tissue near the site of removal of a cancerous tumor in a mammal, from a metastatic neoplastic cell residing in the margin. of resection, which comprises administering to the mammal a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and a Clostridium exotransferase unit. botulinum C3, or one of its functional analogues, administration is performed directly on the surface of the recession margin or below the surface of the resection margin remaining in the mammal, the administration is carried out in a time interval previous or subsequent or previous to and subsequent to the removal or removal of the tumor. This invention describes a method of preventing the growth of a tumor of malignant cells in a host tissue in a mammal consisting of administering to the mammal a therapeutically effective amount of a pharmaceutical composition containing a fusion protein conjugate permeable to cells. which consists of a transport fraction of the polypeptide cell membrane and of an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, wherein the fusion protein simultaneously prevents or inhibits at least two of the following migration of the cells malignant, proliferation of malignant cells, angiogenesis or formation of tubular structure or growth of the capillary network near the malignant cell and secretion of an active metalloproteinase of the malignant cell. This invention describes a method for the prevention of growth within a recession range of a host tissue near the site of removal or removal of a first cancer tumor in a mammal, of a second tumor containing a residual tumor cell of the tumor. cancer, the method comprising administering a therapeutically effective amount of a pharmaceutical composition containing a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction of the polypeptide cell membrane and an exotransferase unit. of Cl.ostridium botuiinum C3, or one of its functional analogues, the administration being carried out directly on the surface of the resection margin or below the surface of the resection margin or in the tissue proximal to the resection margin or in the tissue close to the resection margin that remains in the mammal in a time interval pr evolved to, or subsequent to, or prior to and subsequent to the excision or removal of the first tumor, wherein the fusion protein simultaneously prevents or inhibits at least two of the following migration of malignant cells, proliferation of malignant cells, angiogenesis or formation of tubular structure or growth of the capillary network near the residual tumor cell and secretion of an active metalloproteinase from the residual tumor cell. In one aspect, the present invention consists of a method for inhibiting the metastasis of a systemic cancer in the CNS (central nervous system) of a mammal consisting of administering to a mammal a therapeutically effective amount of a pharmaceutical composition or a protein conjugate. of cell-permeable fusion consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, for example a fusion protein such as BA-07. In one aspect, a therapeutically effective amount of a pharmaceutical composition comprises a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its Functional analogs, for example a fusion protein such as BA-07, may have an anti-angiogenic activity and is useful in the treatment of cancer. According to the present invention the active agent region of a fusion protein useful in this invention consists of a C3 region of ADP ribosyl transferase, or a functional equivalent thereof. According to the present invention, the ribosyl transferase of ADP C3 can be selected from the group of a ribosyl transferase of ADP derived from Closteridum botulinum and a ribosyl transferase from recombinant ADP. Alternatively C3 can be derived from other sources such as C. limoseum or Staphylococcus aureus. C3 purified from these bacteria has an enzymatic activity such as C. botulinum C3 which is effective for Rho of ADP ribosylate and causes the inactivation of Rho.

In one aspect of the present invention a polypeptide cell membrane transport portion can contain a proline-rich transport domain. Examples of proline-rich transport domains or portions can be found in US Patent Application 0101879, which is incorporated by reference. As used herein the term "proline rich region" refers to any linear sequence of 10 amino acids linked together by amide bonds of peptides within a molecule consisting of peptide or protein, wherein at least 3 of 10 amino acids in the linear sequence are proline residues, each proline being covalently linked to a peptide amide bond on its nitrogen and to another peptide amide bond at its carboxylic site (carbonyl). A proline-rich region in any 10 amino acid sequence within a peptide may contain 2 or more proline residues and 8 or fewer amino acids without proline. For example, in one aspect, a proline-rich region in the peptide comprising a sequence of 10 amino acids within a peptide having 10 or more amino acids may contain 2 proline residues and 8 amino acid residues other than proline, distributed in any combination among the 10 amino acids. In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 3 proline residues and 7 amino acid residues other than proline, distributed in any combination between the 10 amino acids.

In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids can contain 4 proline residues and 6 amino acid residues other than proline, distributed in any combination between the 10 amino acids. In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 5 proline residues and 5 amino acid residues other than proline, distributed in any combination between the 10 amino acids. In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 6 proline residues and 4 amino acid residues other than proline, distributed in any combination among the 10 amino acids. In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 7 proline residues and 3 amino acid residues other than proline, distributed in any combination among the 10 amino acids. In another aspect, a proline-rich region in the peptide that contains a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 8 proline residues and 2 amino acid residues other than proline, distributed in any combination between the 10 amino acids.

In another aspect, a proline-rich region in the peptide containing a sequence of 10 amino acids within a peptide containing 10 or more amino acids may contain 9 proline residues and 1 amino acid residue other than proline, distributed in any combination between the 1 0 amino acids. In another aspect, a proline-rich region in the peptide that contains a sequence of 10 amino acids within a peptide containing 10 or more amino acids contains 10 proline residues. In another aspect, a "proline-rich region" refers to an amino acid sequence region of a protein containing more proline than that generally observed in natural proteins (e.g., proteins encoded by the human genome). A "proline-rich region" of a peptide in a composition of the present invention can function to improve the rate of transport of a fusion protein of this invention through a cell membrane. A non-proline region of a peptide or protein may contain a sequence of 10 amino acids covalently linked via peptide bonds, that region contains one or no proline residue. A peptide that enhances cell membrane transport of a composition of this invention may contain one or more of a proline-rich region, each of which may be an equal or different amino acid sequence and each of which is covalently linked each other by a peptide bond or by peptide bonds containing one or more non-proline amino acid sequences which may be the same or different when the amino acid sequence not rich in proline contains more than 10 amino acids. In another aspect of the invention, a polypeptide cell membrane transport portion suitable for use in compositions and methods containing the fusion protein of this invention can be prepared for example by means of methods modified and adapted for use in this invention such as describes Rojas (1998) 16: 370-375 which refers to a translocating membrane sequence; Vives (1997) 272: 16010-16017 related to the supply of Tat mediated protein; by Wender et al. 2000, PNAS 24: 13003-13008 which refers to polyarginine sequences; in Derossi (1996) 271: 181 88-18193 that is reverted to antennopedia; in Canadian patent document 2,301, 157 relating to conjugates containing the antennopedia homeodomain; and in U.S. Patents 5,652, 122, 5,670,617, 5,674,980, 5,747,641 and 5,804,604 which refers to amino acid-containing conjugates of the Tat protein of VI H (here the Tat protein of HiV is sometimes called Tat alone); the descriptions are incorporated as a reference. Several transport strategies mediated by the receptor have been used to test and improve the function of DP ribosilase. These strategies or methods include fusing the C2 and C3 sequences (Wilde et al (2001) 276; 9537-9542) and the use of receptor-mediated transport with the diphtheria toxin receptor (Aullo, et al., 81993) 12: 921 -31). Those strategies have not produced dramatically increased potency of C3 activity, contrary to the activity that has been found with BA-05. In addition, these strategies require receiver-mediated transport. This requires that the target cells must express a specific receptor and must express sufficient amounts of that receptor to significantly improve transport speeds. In the case of diphtheria toxin, not all cells express the appropriate receptor, limiting its potential use. In contrast to these strategies, a composition of this invention that contains a polypeptide transport moiety such as for example BA-05 is able to cross a plasma membrane of the cell by means of a mechanism independent of the receptor. In one aspect of this invention a preferred composition comprises a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, in a fusion protein conjugate. A specifically preferred composition is a fusion protein designated BA-05. Fusion protein compositions containing a proline-rich amino acid sequence added to the N-terminal region of an N-terminal region of a C3 exotransferase unit of Clostridium botulinum, or a functional analogue thereof, are sometimes referred to herein as analogues of BA-05. In another aspect of this invention a preferred composition comprises a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, in a fusion protein conjugate. Fusion protein compositions comprising a proline-rich amino acid sequence added to the N-terminal region of the C3 exotransferase unit of Clostridium botulinum, or a functional analogue thereof, are sometimes referred to herein as variants of BA-05. The BA-05 analogs and the BA-07 variants of the present invention each contain a polypeptide cell membrane transport portion and an exotransferase unit of Clostridium botulinum C3, or its functional analogue. Functional analogues of a Clostridium botulinum C3 exotransferase unit can comprise polypeptides such as biologically active fragments and BA-05 analogs with altered amino acid sequence, in which the activity of those fragments and the BA-05 analogs with altered amino acid sequence are derives from a mechanism of action essentially similar to that of BA-05. These fragments contain or include amino acid sequences that are truncated in one or more amino acids in relation to those of BA-05. These fragments contain or include amino acid sequences that have amino acids truncated ((or deleted) in relation to the amino acid sequence in BA-05, where the truncate can originate from the amino or N terminus., the carboxy terminal or C, or the interior of the protein sequence. The analogs and variants of BA-05 of the invention may comprise an insertion or substitution of one or more amino acids. The compositions of this invention containing fragments, analogs and variants useful in the invention have the biological property of BA-05 which is capable of inactivating a Rho GTPase and preferably capable of inactivating more than one Rho GTPase. In another aspect, the compositions and methods of this invention contain chimeric polypeptides that contain an amino acid sequence BA-05 or a truncated sequence, fused to and containing heterologous amino acid sequences. Those heterologous sequences include those which when formed in a chimera with BA-05 retains one or more biological or immunological properties of BA-05, more preferably the property of being able to inactivate Rho GTPase and even more preferably capable of inactivating more of a Rho GTPase. In another embodiment, this invention comprises a host cell transformed or transfected with nucleic acids encoding the BA-05 protein or the BA-07 chimeric protein. In one aspect any host cell which produces a protein consisting of a polypeptide having at least one of the biological properties of BA-05, more preferably the properties of being able to inactivate Rho GTPase and even more preferably capable of inactivate more than one Rho GTPase. Representative examples of the host cell types include cells of bacteria, yeast, plants, insects and mammals. In addition, the BA-05 protein or the BA-05 chimeric protein can be produced in transgenic animals. Transfected or transfected host cells and transgenic animals can be obtained using materials and methods that are routinely available to those skilled in the art of molecular and cellular biology. A host cell may contain a nucleic acid sequence containing a full-length gene encoding the BA-05 protein and also including a leader sequence and a C-terminal membrane anchor sequence. Alternatively, a host cell it may contain a nucleic acid sequence which lacks a leader sequence or which lacks both leader sequences or which lacks the anchor sequence of the C-terminal membrane, or which lacks combinations of those sequences. In addition, nucleic acid sequences encoding a polypeptide fragment, a variant polypeptide, or a polypeptide analog, each capable of retention of the biological activity of BA-05 may also reside in those host expression systems. A Rho antagonist that is a recombinant protein can be made according to the recombinant protein technology methods known in the art. A protein of the present invention can be prepared from the bacterial cell extract, or through the use of recombinant techniques BA-05 and related fusion proteins according to the invention can be produced by means of transformation (for example by means of transfection , transduction, infection) of a host cell with all or a part of the DNA fragment encoding BA-05 in in vehicle or suitable expression vector. Suitable expression vehicles include: plasmids, viral particles and phages. For insect cells, baculovirus expression vectors are suitable. The entire expression vector vehicle or a portion thereof can be integrated into the host cell genome by methods known in the art. In one aspect, the use of an inducible expression vector is preferred. Those skilled in the art of molecular biology will understand that any of a wide variety of expression systems can be used to provide the recombinant protein. The precise host cell used usually is not critical to the invention. For example, fusion protein BA-05 and fusion proteins including functional analogs and variant s and BA-05 fragments of this invention can be produced in a porcarion host (e.g. E. coli or B. subtitlis) or in a eukaryotic host (for example Saccharomyces or Pichia; mammalian cells, for example cells designated in the art as COS, NIH, 3T3, CHO, BHK, 293, or HeLa cells; or insect cells). To determine the relative and effective Rho antagonist activity of the compositions of this invention, a tissue culture bioassay system can be used. BA-05 in the concentration range of approximately 0.01 to 10 ug / ml is useful and is not toxic to cells. BA-05 is stable at 37 ° C for at least 24 hours. The stability of BA-05 was tested in a tissue culture with the following experiment. The BA-05 was diluted in tissue culture medium, left in an incubator at 37 ° C for 24 hours, then added to the bioassay system described here, using retinal ganglion cells as the test cell type. These cells could extend neurites on inhibitory substrates when treated with C3 stored for 24 hours at 37 ° C. A minimum stability of 24 hours is obtained. Another method to confirm that a compound is a Rho antagonist can use a radioactive assay to detect enzyme activity. Another method to detect the activity can use a fluorescent assay to detect enzymatic activity. For example, A-05 has at least two inherent enzymatic activities, glycohydrolase and ribosyl ADP transferase. These enzymatic activities can sequentially act on the mono-ADP-ribosylate and inactivate the GTP binding protein RhoA by trapping the ribosylated Rho with ADP in a complex with guanine nucleotide dissociation inhibitor-1 (GDI-). In a first reaction step, the glycohydrolase activity hydrolyzes the N-glycosidic linkage between nicotinamide and adenine dinucleotide phosphate ribose (ASP ribose) in the nicotinamide adenine dinucleotide molecule (NAD +). The second stage, catalyzed by the ribosyltransferase of ADP, results in the formation of ADP-ribose-RhoA. Enzyme assays can measure the glycohydrolase activity of a fusion protein of this invention such as BA-05 and BA-07aI following ADP ribose formation. In one aspect the present invention comprises a pharmaceutical composition useful for suppressing malignant transformation and metastasis, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier and a therapeutically effective amount of the composition of this invention, preferably a fusion protein of this invention. .

In one embodiment, a composition of this invention can contain an active member selected from the group consisting of a drug delivery construct as described herein, a conjugate of a drug described herein and a fusion protein as described herein (eg, example including its pharmaceutically acceptable chemical equivalents). Formulation of BA-05 and other compositions of this invention The compositions and methods of this invention may include a pharmaceutically acceptable carrier and a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a fraction of transport of the polypeptide cell membrane and of an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues. In one aspect, a wide variety of polymeric carriers can be used in a formulation of this invention. Representative examples of the polymeric carriers include poly (ethylene-co-vinyl) acetate, PVA, partially hydrolyzed poly (ethylene-co-vinyl acetate) such as poly (ethylene-co-vinyl acetate-co-vinyl alcohol) each of which may be optionally crosslinked at about 40%, poly-D, L-lactic acid including its low molecular weight oligomers and its high molecular weight polymers; poly-L-lactic acid including its low molecular weight oligomers and its high molecular weight polymers; polyglycolic acid (PGA); copolymers of lactic acid and glycolic acid, polycaprolactone, polyvalerylactone, poly (anhydrides), copolymers of polycaprolactone with polyethylene glycol, copolymer of polylactic acid with polyethylene glycol, polyethylene glycol; and its combinations and mixtures. The copolymers may comprise from about 1% to about 99% by weight of the first polymer and of about 99% > to about 1% of the second polymer. Application of BA-05 to Stop the Expansion of a Tumor The compositions of the present invention such as anti-neoplastic and anti-metastatic compositions can be formulated in a variety of ways. For example, in one embodiment, a pharmaceutical composition containing a therapeutically effective amount of a including its low molecular weight oligomers and its high molecular weight polymers; it may consist of a microsphere, wherein the fusion protein is mixed with or imbibed in a matrix consisting of a pharmaceutically acceptable polymeric carrier, optionally in the presence of water (from about 0.1% to about 15% in one embodiment; , the microsphere suspended in an aqueous medium in another embodiment), a pharmaceutically acceptable buffer salt, a pharmaceutically acceptable surface active agent, a pharmaceutically acceptable carbohydrate, a pharmaceutically acceptable emollient and the like. In another embodiment, a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, can consisting of a paste, a cream, an ointment, a suppository, a suspension in a pharmaceutically acceptable oil and the like. In another embodiment, a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, can consist of a film, for example in which the fusion protein is combined or mixed together with a pharmaceutically acceptable carrier such as an aqueous gelatin or an aqueous protein or a polymeric carrier or a combination thereof, optionally in the presence of a species of crosslinking agent that can crosslink the carrier, the mixture is then coated in a film or laminate, optionally in the presence of a film base or a support or matrix, and is dry or dehydrated, optionally by the addition of heat or by means of lyophilization. The films can be prepared in unit or bulk dosage forms and divided and cut into unit dosage forms. In another embodiment, a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and an exotransferase unit of Clostridium botulinum C3, or one of its functional analogues, can Consist of an aerosol or sprayable or aerosolizable composition such as a suspension or solution of the protein in a pharmaceutically acceptable fluid such as an aqueous solution of a buffer, optionally with a tonicity modifier; in a pharmaceutically acceptable fluid such as a supercritical or liquefied gas such as carbon dioxide or propane or a fluorocarbon or fluorohydrocarbon or bromofluorocarbon or low molecular weight chlorofluorocarbon and the like, each is a gas at 37 ° C and at ambient pressure, the The composition is suitable for use for example in inhalation or as an aerosol such as spray application on the tissue surface. In another aspect, the compositions of the present invention can be formulated to contain a fusion protein such as BA-05 and an additional anti-neoplastic and anti-metastatic factor or agent. In another aspect the compositions of the present invention can be formulated to contain a variety of additional compounds, in order to provide formulations of fusion proteins formulated with certain physical properties (eg, elasticity related to the incorporation of a pharmaceutically acceptable plasticizing agent, a particular melting point such as about 30 ° C by the use of a polyethylene glycol, or a specific release rate which can be related to a degree of crosslinking or hydration rate in a matrix or for the solubilization of a matrix or for solubilization Preferentially a component of a matrix that can leave pores in the matrix, through that carrier fluid such as water can help the transport of the fusion protein out of the matrix and into the desired site in the body of a mammal. Within certain embodiments of the invention combinations may combine e in order to achieve a desired effect (for example two or more microsphere compositions of the invention can be combined in order to achieve a modified release rate of a fusion protein of this invention such as slow and rapid or prolonged release of one or more antineoplastic and anti-metastatic factors). The compositions of the present invention such as those containing BA-05 can be administered either alone or in combination with a pharmaceutically acceptable carrier and / or pharmaceutically and physiologically compatible excipients, diluents, tonicity modifying agents, buffers and the like. Preferably those carriers are acceptably non-toxic to a receptor when used in combination with the doses and at the therapeutically effective concentrations of the fusion protein employed. In one aspect the preparation of a pharmaceutical composition of this invention consists in combining the therapeutically effective amount of a fusion protein of this invention with one or more components of a carrier such as water; a pharmaceutically acceptable salt or a buffer solution; a pharmaceutically acceptable antioxidant such as ascorbic acid; one or more pharmaceutically acceptable polypeptides (e.g., a peptide containing from about 2 to about 10 amino acid residues), one or more pharmaceutically acceptable proteins; one or more pharmaceutically acceptable amino acids such as an amino acid essential for human; one or more carbohydrates or pharmaceutically acceptable carbohydrate-derived materials such as glucose, sucrose, sorbitan, trehlosa, mannitol, maltodextrin, dextrins, cyclodextrin and combinations thereof, in one aspect that carbohydrate preferably consists of a non-reducing carbohydrate such as a sugar or reducing agent when it is desired to avoid the Maillard reaction (which occurs when components such as a reducing sugar and an amino acid or a peptide or a protein react with each other) or in another aspect such a carbohydrate preferably contains a reducing carbohydrate such as a reducing sugar when a Maillard reaction is desired; a pharmaceutically acceptable chelating agent such as EDTA, or DTPA, which is a chelating agent for a metal ion such as a divalent metal ion (for example Ca + 2, Fe + 2 and the like) or a trivalent metal ion (for example Fe + 3, Y + 3, Ln + 3, Eu + 3 and other lanthanides, and the like and which may optionally contain a radionuclide); glutathione; and other stabilizers and excipients known in the art of formulating a protein material. Preferred carriers include a sterile buffered saline at a pH in the range of about 6 to 8, preferably at about a pH of 7.4, and a sterile isotonic composition comprising a saline solution mixed with non-specific pharmaceutically acceptable serum albumin. The pharmaceutical compositions of this invention can be sterile, sterilizable, and sterilized. A preferred method of sterilization is the filtration of a pharmaceutical composition through a 0.2 micron filter in a sterile environment. The sterile filtered composition can be introduced into a bottle, preferably into a sterile bottle, into a unit dose volume amount or into an entire multiple of a unit dose amount (for example as an amount of 2 dose units, an amount of 3 dose units, an amount of 4 dose units, etc.) preferably under an inert atmosphere such as sterile nitrogen or argon and the containers are sealed with a pharmaceutically acceptable stopper, optionally with a crimped lid. In another aspect, the pharmaceutical composition is dry upon removal of the water, for example the aqueous medium can be removed from each bottle by means of a drying process such as by means of lyophilization or evaporation to leave a dry or dehydrated matrix containing the fusion protein of this invention, before sealing and covering the bottle. In another aspect the potator may consist of a sterile or sterilizable hypertonic solution of a pharmaceutically acceptable matrix-forming material or excipient that is compatible with the fusion protein, for example such as a pharmaceutically acceptable non-reducing carbohydrate, together with a compound or a fusion protein of the invention, that hypertonic solution can be placed in a flask and dried (for example by lyophilization) to provide a matrix containing the fusion protein and the matrix-forming excipient, which can be sealed in the vial with a lid . Before use, the sterile water can be added to the bottle for example by means of a syringe or sterile cannula, the water will dissolve the matrix to provide a solution or suspension of the fusion protein. Sufficient water may be added to provide the reconstituted solution or suspension or the appropriate isotonic solution for injectable or implantable use. The pharmaceutical compositions of the invention can be prepared to be suitable for administration to a mammal, such as a patient in need of treatment, by a variety of different routes. Preferred routes of administration include for example intrarticular, intraocular, intranasal, intraneural, intradermal, intraosteal, sublingual, oral, topical, intravesical, intrathecal, intravenous, intraperitoneal, intracranial, intramuscular, subcutaneous, inhalation, atomization and inhalation, application directly in a tumor, or at the site of the disease, application directly on or within the remaining margins after resection of a tumor, other representative routes of administration, enteral application optionally together with a gastroscopic procedure, and colonoscopy, each of the which may be outpatient procedures and do not require procedures in the operating room or prolonged hospitalization, but may require the presence of medical personnel. The pharmaceutical compositions provided herein may be placed in containers together with packaging material that provides instructions regarding the use of those materials. Generally those instructions will include a description of the concentration of the active agent, as well as within certain embodiments, relative amounts or identities of the excipient ingredients or diluents (eg water, saline or PBS). In addition, it may be necessary to reconstitute the anti-neoplastic and anti-metastatic composition, or the pharmaceutical composition to give a pharmaceutically acceptable solution or suspension by means of the addition of water and optionally also with stirring or sonication.

The pharmaceutical compositions of this invention can be used in a wide variety of surgical procedures. For example, in one aspect of the present invention a pharmaceutical composition (in the form of for example a powder solution or suspension suitable for application in an atomized or aerosol or spray form, or coated on a film) can be applied by means of spray (a sprayable or aerosol forming form) or by means of lamination (of a film) on a surface of a tissue area in a patient in need of treatment before, during or after surgical removal of a tumor such as a first tumor, and optionally a quantity of normal tissue immediately adjacent to the tumor, of tissue area, leaving the resection a margin of normal tissue around the site of excision of the tumor (margin of the tumor) in the area of the tissue. In one aspect this method can prevent or substantially delay or inhibit the metastatic growth of a second tumor in adjacent normal tissues after the removal of the first tumor in the patient. In another aspect this method can prevent the expansion of the disease (eg cancer) to adjacent tissues. Within other aspects of the present invention, a pharmaceutical composition of the present invention (for example in the form of a spray or an aerosol) can be delivered by means of an endoscopic procedure, in which the composition is sprayed or applied by spray. Within a patient to provide a coating consisting of a fusion protein of this invention on a tumor and / or the tissue surrounding or adjacent to the tumor within a patient, the tumor is accessed or visualized by endoscopic means. In another aspect the coating of a pharmaceutical composition in a tissue near a tumor or close to the tumor excision site can inhibit angiogenesis in the region of the tissue that is coated by means of the pharmaceutical composition. Still within the other aspects of the present invention, a pharmaceutical composition of this invention can coat the surface of an implantable device such as surgical mesh, wire, stent or coronary spiral, prosthesis and the like, to form a coated device, the coating has a fusion protein of this invention and optionally a polymeric carrier, the coated device can be implanted into a tissue or organ in a patient as part of a surgical treatment, such as the surgical removal of a cancerous or benign tumor, the pharmaceutical composition can preventing or inhibiting or delaying or slowing the growth of a second tumor near the site of placement of the device, and in another aspect, it can also prevent or inhibit or delay or retard the growth of a second tumor in a tissue or organ remote to the site of placement of the implanted device. The concentration of the fusion protein can be from 0.01% to 20% by weight of the carrier forming a coating on the device, and the thickness of the coating can be from about 20 microns to about 1 millimeter. The coating can be applied by means of coating techniques known in the art of coating devices. For example, a coating consisting of a pharmaceutical composition of this invention can be applied to the surface of a device by means of a spray or aerosol applicator in which the composition in the form of a solution in a liquid or fluid having a solvent or As a suspension in a liquid or fluid, the liquid or fluid can evaporate during and after application as spray or aerosol, spray or aerosolize on the surface of the device. Optionally, the coated composition may contain reactive chemical functional groups such as olefins or anhydride groups or active or accepting esters of the Míchael reaction such as carbon-carbon double bonds conjugated to a carbonyl group, the double bond can react with an amine of a protein or peptide or gelatin such as a carrier protein, the reactive chemical functional groups can form crosslinks in the carrier chemically or photochemically, which can prevent solubilization or limit or modify or control the swelling (as a function of the concentration of the reactive functional groups or the time of exposure to the crosslinking conditions such as ultraviolet or gamma radiation of the coated device) of the coated carrier by means of an aqueous fluid in the tissue in which the device is implant The control of swelling can be useful in controlling the rate at which the fusion protein of this invention migrates from the device to tissue near the device and beyond to the patient's body. A wide variety of crosslinking chemistry known in the art may be useful in this aspect of the invention as long as the biological activity of the fusion protein is not lost or eliminated. If an organic solvent or supercritical fluid or liquefied gas is used in the coating process, then a pharmaceutically acceptable carrier can be selected, which does not dissolve immediately in the aqueous medium present in the tissue near the implant site but allowing the the fusion protein permeate the aqueous medium. Other coating methods may be used as for example the dip coating of a composition, by painting, the coating by curtain and the lamination of a pharmaceutical composition of this invention. In one embodiment, the surface of a device can be first coated with a first coating layer or primer layer which is then substantially coated with a pharmaceutical composition of the invention as a second coating layer. The primer layer can be selected to adhere to the surface of the metallic or polymeric device and adhere to the carrier of the second coating layer. The primer layer can also comprise immobilized chemical functional groups (which for example can be attached to a polymer in the primer layer) and which can form crosslinking bonds with the second layer. The primer layer can optionally contain relatively mobile molecules which have for example two or more reactive functional groups, those molecules can migrate to the second layer and react with the chemical functional groups, to form molecular crosslinking bridges. In another embodiment, a third pharmaceutically acceptable layer can be applied on a second layer, the third layer can be free of fusion protein. The third layer can serve to control or modify the release rate of the fusion protein of the device, for example by being able to dissolve or swell or increase its permeability with respect to water or fusion protein as a function of time to expose the second layer comprising the pharmaceutical composition of this invention to aqueous tissue media. In one embodiment of the invention, a surgical mesh device comprising a pharmaceutical composition of the present invention is applied to the surface of a wire or polymeric mesh, it can be used or implanted in a patient (for example subsequent to the resection of the colon) for provide support to the residual tissue structure. The coated mesh device can deliver a therapeutically effective amount of the active component (such as BA-07) of the pharmaceutical composition sufficient to prevent cancer recurrence by preventing the growth of a second tumor close to the implantation site of the device. covered. The fusion protein can migrate from the device at a rate sufficient to provide a range of therapeutically effective concentration in the tissue near the device. A concentration range presently preferred is about 0.0001 micrograms of fusion protein per cubic centimeter (cc) of tissue to about 1000 micrograms of fusion protein per cubic centimeter of tissue. A most preferred currently therapeutically effective concentration range is from about 0.001 micrograms of fusion protein per ce to about 50 micrograms per second of tissue. In another embodiment a coated mesh device can deliver a therapeutically effective amount of the active component (such as BA-07) of the pharmaceutical composition sufficient to prevent cancer recurrence by preventing the growth of a second tumor remotely from the site of cancer. implant of the coated device. In other aspects of the present invention, methods are provided for the treatment of a patient at the site of the residual tissue left in the excision margin of a first tumor (site of tumor excision) consisting of the administration of a pharmaceutical composition of this invention to a residual tissue in the margin of resection of a first tumor of a cancer subsequent to the excision of the first tumor, in such a way that the recurrence of the second cancer tumor and the formation of new blood cases at the residual tissue site in the margin of the first one are inhibited tumor. In one embodiment of the invention, a pharmaceutical composition of the invention such as a pharmaceutical composition containing BA-07 is administered directly to the residual tissue at a site of tumor excision (eg applied by smear, brush, brushstroke, spray). , aerosol, injection, washing, soaking or otherwise coating the tumor resection margins with the pharmaceutical composition Alternatively, a pharmaceutical composition of this invention such as a pharmaceutical composition containing BA-07 in the form of a surgical paste Ointment, cream, suspension, gel and the like can be applied to the tissue surface In a preferred embodiment of the invention, a pharmaceutical composition of this invention consists of a fusion protein such as BA-07 applied to the residual tissue in the site of removal of a liver tumor such as after resection of a liver malignancy. Another preferred embodiment of the invention, a pharmaceutical composition of this invention containing a fusion protein such as BA-07 is applied after a neurosurgical operation for example related to the removal of a tumor in the brain). Within an aspect of the present invention a pharmaceutical composition of this invention containing a fusion protein such as BA-07 can be administered to the residual tissue of the resection margin of a wide variety of tumors, including for example breast tumors, colon, brain and liver. For example, in one embodiment of the invention, a pharmaceutical composition of this invention comprising a fusion protein such as BA-05 can be administered to residual tissue near the site of removal of a first tumor of neurological cancer subsequent to the removal of the first tumor. , in such a way that the expansion of the cancer cells in the residual tissue and the formation of a second tumor and the formation of new blood vessels in the tissue at the site of the residual margin of the first tumor is inhibited. The brain is located with high functionality: this is each specific anatomical region specializes in the performance of a specific function. The location of cancer in a patient's brain (and brain pathology) may be more important than the type of tissue or tumor. A relatively small tumor or lesion in a key area of the brain can be much more devastating than a much larger lesion in a relatively less important area of the brain. A lesion on the surface of the brain may be relatively easy to surgically remove, whereas a tumor of comparable size but located deep in the brain may not be relatively easy to surgically remove because access to the deep tumor would require disruption of the participating tissue , as it will cut through many vital structures to reach or access and remove the deep tumor. In addition, benign tumors in the brain can be dangerous for a patient. A benign tumor can grow in a key area and cause significant damage to adjacent brain tissue and its function. Although a benign tumor can be cured by surgical resection, removal of the tumor from deep tissue may not be possible. If a benign tumor is not monitored it can grow, increase in volume and cause greater intracranial pressure. If such condition is left untreated, the vital structures in the brain can be compressed and the patient can die. The incidence of malignant tumors in the CNS (central nervous system) is approximately 8 to 16 cases per 100.00 people. The prognosis of a primary malignant tumor of the brain is discouraging with a median survival of less than one year, even after surgical resection. Brain tumors, especially gliomas, are predominantly a local disease that can recur to approximately two centimeters of the original focus after surgical removal. Representative examples of brain tumors that can be treated using the compositions and methods described herein include such tumors as anaplastic astrocytoma, gioblastoma multiforme, pilocytic astrocytoma, oligodendroglioma, ependymoma, myxopapillary ependymoma, subependymoma, cholloid plexus papilloma, neuronal tumors such as neuroblastoma. , ganglioneuroblastoma, ganglioneuroma and medulloblastoma, pineal pineoblastoma and pineocytoma gland tumors, meningeal tumors such as meningioma, meningeal hermangiopericytoma, meningeal sarcoma, tumors of the cells lining the nerves such as schwannoma (neurolemone) and neurofibroma, lymphoma Hodgkin, non-Hodgkin's lymphoma, (including the primary and secondary subtypes of Hodgkin's lymphoma); deformative tumors such as craniopharyngioma, epidermoid cysts, dermoid cysts and colloid cysts; and metastatic tumors located in the brain that can be derived from virtually any tumor, most commonly derived from tumors of the lung, breast, melanoma, kidney and gastrointestinal tract. In one embodiment of this invention, the pharmaceutical compositions of the invention can be applied locally, such as topically or by means of topical application in the oral cavity, and topical instillation in the exposed tissue in the eye, ear and nose, of such that no more than 10% and preferably no more than 1% of the unit dose of a fusion protein of this invention (such as BA-077) enters directly into the bloodstream of a patient. In another embodiment of this invention, the pharmaceutical compositions of the invention can be administered systemically such as by injection into a blood vessel or lymphatic vessel, for example by means of intravenous injection. Additional modes of administration include intraperitoneal, subcutaneous, intramuscular, rectal (such as in dosage form by suppository), vaginal (e.g. in the form of a pessary) and peroral delivery. The dosage forms of this invention can act as a reservoir containing a fusion protein of this invention, a fusion protein that can migrate to tissue near the reservoir site. Compositions for use in topical administration include for example liquid or gel preparations preferably suitable for penetration through the skin such as creams, liniments (for example applied to the skin by means of friction), lotions, oils, ointments , pastes and drops suitable for the tissue supply of organs such as eyes, ears, nose. In one embodiment of the invention, the fusion protein can have a molecular weight of about 240,000 daltons to about 300,000 daltons. In another embodiment the composition provided herein can be formed as a film with a thickness between 100 microns and 2 millimeters, or thermologically active compositions which are liquid at a temperature (for example above 25 ° C) and solid or semi-solid (for example below about 25 ° C). In another aspect of the present invention, methods are provided for treating remaining residual tissue at a malignant tumor excision site, which consists of administering a pharmaceutical composition of this invention containing a fusion protein such as BA-05 to the margins. of residual resection of a tumor in a patient subsequent to the excision of the patient's tumor, in such a way that the local recurrence of the cancer and the formation of new blood vessels at the site are inhibited. In another aspect of the present invention, methods are provided for treating a tumor excision site, which consists in administering a composition containing BA-05, regardless of resection of a tumor subsequent to the excision, in such a way that it is inhibited. the local recurrence of cancer and the formation of new blood vessels at the site. Another aspect of the invention consists of a pharmaceutical composition of this invention in a kit of parts such as a kit containing a container and a pharmaceutical composition of the invention; a kit containing a sealed vial and a pharmaceutical composition of the invention; a kit containing a sterile syringe and a pharmaceutical composition of the invention; a kit consisting of a sterile syringe and containing a pharmaceutical composition of the invention; a device containing a spray or spray applicator and a pharmaceutical composition of the invention; a device containing an applicator in the form of a brush and a pharmaceutical composition of the invention; a kit containing a brush-shaped cannula and a pharmaceutical composition of the invention; an equipment containing a powder applicator and a pharmaceutical composition of the invention (the powder applicator can be used to administer a pharmaceutical dosage of this invention in powder form by means of a spray applicator of a dry powder (e.g. lyophilized) in a topical application to a tissue; a device containing a coated implantable device and a pharmaceutical composition of the invention, performing administration by implant. Pharmaceutical products are provided, comprising for example a fusion protein such as BA-05 which disrupts Rho signals, in a container; and device such as a syringe or tool or a brush or applicator device (such as a spray or spray applicator device) in a second container, which is to be used to apply the fusion protein such as BA-05, to the tissue that forms the walls of a tumor cavity after surgical removal of the tumor, or apply to the skin, for example after the removal of a malignant melanoma. The pharmaceutical composition, the method and its use, according to the present invention is intended to be applied to the mammal. In some embodiments, the term mammal is intended to include humans, while in other embodiments, the term mammal is meant to mean a non-human mammal. These and other aspects of the present invention will become apparent upon reference to the following detailed description and the appended figures. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates the effect of a composition of this invention containing a fusion protein BA-07 on the proliferation of human endometrial adenocarcinoma cells HEC1 B measured by means of tritiated thymidine incorporation. The vehicle (10) is a saline solution buffered with phosphate, and BA-07 is used in concentrations of 1 μg / ml (11), 10 μg / ml (12) and 50 μg / ml (13). The proliferation of cancer cells is reduced in a dose-dependent manner. Figure 2 illustrates the effect of a composition of this Invention containing a fusion protein BA-07 on the proliferation of human melanoma cells SK-MEL-1 measured by incorporation of tritiated thymidine. The vehicle is a saline solution buffered with phosphate, and BA-07 is used in concentrations of 1 μg / ml, 10 μg / ml and 50 μg / ml. The proliferation of cancer cells is reduced in a dose-dependent manner. Figure 3A illustrates the formation of tubes by means of HUVEC endothelial cells grown in a matrix of Matrigel ™. This assay is a cell culture assay for angiogenesis. Tube formation can be observed in the control that does not contain a fusion protein of this invention, Figure 3A (box 30). Figure 3B illustrates the formation of tubes by means of HUVEC endothelial cells grown in a matrix of Matrigel ™. The cultures treated with a composition of this invention comprises a fusion protein BA-07, it has fewer tubes demonstrating an inhibition of angiogenesis as shown in Figure 3B, box 31. Figure 4 shows the inhibition of the growth of human renal carcinoma cells TK-10 by means of a composition of this invention comprising a fusion protein, BA-07 as measured by growth inhibition assay with sulforhodamine B (SRB) . The BA-07 fusion protein is used at concentrations of 0.1 μg / ml, 1 μg / ml, 10 μg / ml AND 100 μg / ml. In all the concentrations used, the proliferation of cancer cells is reduced. The reduction in the proliferation of cancer cells is dose dependent. At a protein concentration of 100 μg / ml the composition of the invention induced cell death of the cancer cells. Figure 5 shows the inhibition of growth of lung cancer cells by non-small cells HOP-62 by means of a composition of this invention comprising a BA-07 fusion protein measured by the growth inhibition assay with sulforhodamine B ( SRB). The BA-07 fusion protein is used at concentrations of 0.1 μg / ml, 1 μg / ml, 10 μg / ml and 100 μg / ml. In all the concentrations used, the proliferation of cancer cells is reduced. The reduction in the proliferation of cancer cells is dose dependent. Figure 6 shows the inhibition of growth of CNS SF-286 cancer cells by means of a composition of this invention comprising a BA-07 fusion protein measured by the growth inhibition assay with sulforhodamine B (SRB). The BA-07 fusion protein is used at concentrations of 0.1 μg / ml, 1 μg / ml, 10 μg / ml and 100 μg / ml. In all the concentrations used, the proliferation of cancer cells is reduced. The reduction in the proliferation of cancer cells is dose dependent. Figure 7 shows the reduction in RhoA levels after incubation with 10 micrograms per milliliter of fusion protein 1 hour, 2 hours, 4 hours, 6 hours, and 24 hours after administration of a pharmaceutical composition containing a fusion protein of this invention and a pharmaceutically acceptable carrier. Figure 8 shows growth inhibition (as% growth versus vehicle control as reference) of Caki-1 renal carcinoma cells by means of a composition comprising a BA-07 fusion protein,% growth is measured by means of the SRB test at concentrations of 0.1, 1, 10 and 100. DETAILED DESCRIPTION All the references indicated here that describe more detailed procedures, devices and composition relevant to the invention are incorporated by reference. A method for producing a fusion protein of this invention such as BA-05. BA-05 is the name given to the protein of this invention made by ligating a cDNA sequence encoding C3 with a 19-mer fusogenic peptide. To demonstrate the method for producing a fusion protein of this invention, an example of an antennapedia sequence added to the C-terminus of the C3 polypeptide can be used. The stop codon at the 3 'end of the DNA sequence can be replaced with an EcoR1 site by means of polymerase chain reaction (PCR) using the primers 5'GAA TTC TTT AGG ATT GAT AGCX TGT GCC 3' (SEQ. ID NO: 1) and 5'GGT GGC GAC CAT CCTCCA AAA 3 '(SEQ ID NO: 2). The PCR product can be sub-cloned into a pSTBIue-1 vector (Novagen, city) then cloned into a pGEX-4T vector using the BamHI and Not I restriction sites. This vector can be called pGEX-4t / c3. A useful antennapedia sequence to be added to the 3 'end of C3 in pGEX-4T / C3 can be created by PCR from the pET-3A vector (Bloch-Gallego (1 993) 120: 485-492; and Derossi (1994) 269: 10444-10450), subcloned into a blunt vector pSTBIue 1, then cloned into pGEX-4T / C3, using the EcoRI and SalI restriction sites, creating pGEX-4T / C3APL. The analysis of the DNA sequence can be performed in the sequence that produces the best response according to this invention. The Pgex-4t / c3apl clone (SEQ ID no: 3) is a currently preferred sequence and provides a protein that is a preferred composition of this invention. An example of a fusion protein similar to C3 is called Pgex-4t / c3aplt (Seq.I D. No: 4). Two PCR primers are designed to transfer a series of recombinant constructs (BA-05) in the pET system: the upper primer 5 'ggatctggttccgcgtcatatgtctagagtcgacctg 3' (SEQ D # 38) lower primer 5 'cgcggatccattagttctccttcttccacttc 3' (SEQ ID no 39). A BamHI site at the 5 'end of SEQ ID NO. 39 ggatccatta; the TGA is replaced by TAAT (atta, in SEQ ID NO 39). A useful program to amplify the product using Pfu polymerase consists of: 95 ° 1 cycle of 5 \ then 94 ° C 2 '? 56 ° C 2 ' ? 70 ° C 10 cycles of 2 \ then 94 ° C 2 '? 70 ° C 30 cycles of 3 'and storage at 4 ° C. A QIAEXI I kit (Qiagen) can be used to purify a slice of agarose gel containing the desired DNA band. The insert and the vector are digested with BamHI and Ndel following the manufacturer's instructions, purified using agarose gel electrophoresis and QIAEXII equipment (Qiagen), and incubated together overnight with T4 DNA ligase following the manufacturer's instructions . E. coli (DHdalfa, or preferably XL1 -Blue) is transformed with the ligation mixture. The clones can be verified by means of small-scale induction and SDS-PAGE and can be ensured by means of immunodeter- sion of the crude lysates with anti-C3 antibody. The plasmid DNA is purified and its purity can be detected. DNA sequencing can be performed (for example by means of the LiCor in which the entire strip is sequenced over the entire length of the clone). A first construct prepared in this way (pET3a-BA-.07, SEQ ID NO: 7) co-interacted with the theoretical DNA sequence of pGEX / APLT with a slight change in 5. A second construction pET3a-BA-07 can be prepared at subcloning the target of pET3a-BA-07 in the pET9a vector by breaking the pET3a construct with BamHI and Ndel (New England BiolAbs, Beverly MA) according to the manufacturer's instructions. Plasmid DNA pET9a can be broken with the same enzymes. The DNA of the insert and the vector can be purified by means of agarose gel electrophoresis. The insert can be ligated into the new vector using T4 DNA ligand (New England BiolAbs, Beverly MA). The ligated ADB can be transformed into DHdalfa cells and the DNA can be prepared by QIAGEN mini or maxi-teams. The clones can be characterized by restriction digestion and insert DNA sequence in both directions (eg BioS &T, Lachina, Quebec). The DNA construct can be transformed into BL21 (DE3) and BL21 (DE3) / pLysS cells. The expression of protein pET9a-BA-07 (SEQ I D No. 57) is higher in BL21 (DE3) compared to BL21 / DE3) / pLysS. The proteins of the present invention can be prepared from bacterial cell extracts, or by means of recombinant techniques by means of transformation, transfection or infection of a host cell with all or a part of the DNA fragment encoding the fusion protein such as a DNA fragment encoding BA-05 with a transport sequence derived from antennapedia in a suitable expression vehicle. One skilled in the art of molecular biology will understand that any of a wide variety of expression systems can be used to provide a recombinant protein of this invention. The precise host cell used is not generally critical to the invention but variations in yields from one type of host cell to another can be expected. A fusion protein can be purified by using protein purification techniques known in the art such as affinity purification techniques or column chromatography using resins that separate the molecules based on properties such as charge, size and hydrophobicity. Useful affinity techniques include those that employ a specific antibody (e.g. GST) for the fusion protein to be expressed. The histidine-tagged proteins can be eluted selectively with imidazole-containing buffers. Alternatively, the recombinant protein can be fused to an immunoglobulin Fc domain. Such a fusion protein can be purified using a protein A column. Any of these techniques can be automated and optimized to provide superior reproducibility and high performance by using specialized commercial liquid chromatography equipment for protein purification. It is proposed that the small molecule, peptide or other mimetic of the antagonists described above they are also included by the invention. Evaluations of the bioactivity of a pharmaceutical composition comprising a fusion protein of this invention such as BA-05. Change in inactivation The ability of BA-05 and BA-07 to inactivate Rho can be demonstrated using a cell culture assay. In this assay the cancer cell line is planted in a tissue culture under the conditions to be used. For example, NG108 cells can be inoculated and allowed to proliferate to semi-confluence. NG108 is a neuroblastoma X glioma formed by the fusion induced by the Sendai virus of the mouse neuroblastoma clone N18TG-2 and the clone of the rat gi6 C6 BU-1. The cells are then harvested homogenized and a Rho pulldown assay is performed. The trial puli downusa a "primer" that is linked to activate Rho. In our assays we can use for example the Rho binding domain (RBD) of the rotechin. Other proteins, such as Rho kinase, can also be used. The "bait" is bonded to a granule in such a way that it can precipitate from the homogenate. RBD is linked to GTP-Rho in the homogenized and is not ligated with GDP-Rho. In this way, the Rho active in cell culture can be quantitatively tested. The extent to which BA-07 inactivates Rho in the cell line can be demonstrated by treating a sample of cells from the cell line before performing the polishing test. A polished down test can be used to determine the amount of active Rho in a solid tumor. A tumor sample is homogenized in the buffer, a polishing test is performed, and the amount of Rho in GTP can be compared to the amount found in non-cancerous tissue. This assay for detecting active Rho can be used as a diagnostic for tumors consisting of cells with highly activated levels of Rho and that can respond according to the invention, for example to therapy with BA-07. The measurement of activated Rho may be more sensitive than simply examining Rho expression levels. In polishing down in situ assay can be used to detect GTP Rho in section. For this test, cryosections (each approximately 16 μm thick) of tumor samples are incubated, post-fixation with 4% PFA, with bacterial lysate containing the RBG-GTS overnight at 4 ° C. sections are then washed 3 times in TBS, blocked in 3% BSA for approximately 1 hour at room temperature and incubated with an anti-GST antibody (Cell signaling, New England Biolabs, Mississauga, Canada) and with antibodies specific for the cell type to identify specific cells and incubate overnight at 4o C, sections are washed with TBS and incubated for 2 hours at room temperature with secondary antibodies conjugated with FITC, Texas Red or rhodamine to reveal immunoreactivity (Jackson ImmunoResearch, Misissauga, Canada). Details of the BA-05 DNA and protein sequence With respect to this invention, a useful fusion protein designated BA-05 has the following DNA coding sequence shown using conventional nomenclature G.A.T and C. In the. oligonucleotide sequences of this invention the symbols G, C, A and T have their conventional meaning. GGATCCTCTA GAGTCGACCT GCAGGCATGC AATGCTTATT CCATTAATCA 50 AAAGGCTTAT TCAAATACTT ACCAGGAGTT TACTAATATT GATCAAGCAA 100 AAGCTTGGGG TAATGCTCA TATAAAAAGT ATGGACTAAG CAAATCAGAA 150 AAAGAAGCTA TAGTATCATA TACTAAAAGC GCTAGTGAAA TAAATGGAAA 200 GCTAAGACAA AATAAGGGAG TTATCAATGG ATTTCCTTCA AATTTAATAA 250 AACAAGTTGA ACTTTTAGAT AAATCTTTTA ATAAAATGAA GACCCCTGAA 300 AATATTATGT TATTTAGAGG CGACGACCCT GCTTATTTAG GAACAGAATT 350 TCAAAACACT CTTCTTAATT CAAATGGTAC AATTAATAAA ACGGCTTTTG 400 AAAAGGCTAA AGCTAAGTTT TTAAATAAAG ATAGACTTGA ATATGGATAT 450 ATTAGTACTT CATTAATGAA TGTTTCTCAA TTTGCAGGAA GACCAATTAT 500 TACAAAATTT AAAGTAGCAA AAGGCTCAAA GGCAGGATAT ATTGACCCTA 550 TTAGTGCTTT TGCAGGACAA CTTGAAATGT TGCTTCCTAG ACATAGTACT 600 TATCATATAG ACGATATGAG ATTGTCTTCT GATGGTAAAC AAATAATAAT 650 TACAGCAACA ATGATGGGCA CAGCTATCAA TCCTAAAGAA TTCGTGATGA 700 ATCCCGCAAA CGCGCAAGGC AGACATACAC CCGGTACCAG ACTCTAGAGC 750 TAGAGAAGGA GTTTCACTTC AATCGCTACT TGA 783(SEQ ID NO: 56) Protein coding sequence pGEX-4TBA-05 Gly Ser Ser Arg Val Asp Leu Gln Ala Cys Asn Ala Tyr Ser lie Asn 1 5 10 15 Gln Lys Ala Tyr Ser Asn Thr Tyr Gln Glu Phe Thr Asn Me Asp Gln 20 25 30 Wing Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys 35 40 45 Ser Glu Lys Glu Wing Me Val Ser Tyr Thr Lys Ser Wing Ser Glu lie 50 55 60 Asn Gly Lys Leu Arg Gln Asn Lys Gly Val lie Asn Gly Phe Pro Ser 65 70 75 80 Asn Leu lie Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met 85 90 95 Lys Thr Pro Glu Asn Me Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr 100 105 1 10 Leu Giy Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr lie 1 15 120 125 Asn Lys Thr Wing Phe Glu Lys Wing Lys Wing Lys Phe Leu Asn Lys Asp 130 135 140 Arg Leu Glu Tyr Gly Tyr Me Be Thr Ser Leu Met Asn Val Ser Gln 145 150 155 160 Phe Wing Gly Arg Pro He He Thr Lys Phe Lys Val Wing Lys Gly Ser 165 170 175 Lys Wing Gly Tyr Me Asp Pro Me Being Wing Phe Wing Gly Gln Leu Glu 180 185 190 Met Leu Leu Pro Arg His Ser Thr Tyr His He Asp Asp Met Arg Leu 195 200 205 Being As Asp Gly Lys Gln He He Thr Thr Met Met Met Gly Thr 21 0. 215 220 Wing He Asn Pro Lys Glu Phe Val Met Asn Pro Wing Asn Wing Gln Gly 225 230 235 240 Arg His Thr Pro Gly Thr Arg Leu 245 (SEQ ID NO: 37) Primer 1 useful for producing BA-07: ggatctggtt ccgcgtcata tgtctagagt cgacctg (SEQ ID NO: 38) Primer 2 useful for producing BA-07: Cgcggatcca ttagttctcc ttcttccact te (SEQ ID NO: 39) DNA sequence coding for pET9a-BA-07 Protein sequence pET9a-BA-07 Met Ser Arg Val Asp Leu Gln Ala Cys Asn Wing Tyr Ser He Asn Gln 1 5 10 15 Lys Wing Tyr Being Asn Thr Tyr Gln Glu Phe Thr Asn lie Asp Gln Wing 20 25 30 Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys Ser 35 40 45 Glu Lys Glu Wing Me Val Being Tyr Thr Lys Being Wing Being Glu He Asn 50 55 60 Gly Lys Leu Arg Gln Asn Lys Gly Val He Asn Gly Phe Pro Being Asn 65 70 75 80 Leu He Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met Lys 85 90 95 Thr Pro Glu Asn He Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr Leu 1 00 1 05 1 10 Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr Me Asn 1 15 120 125 Lys Thr Wing Phe Glu Lys Wing Lys Wing Lys Phe Leu Asn Lys Asp Arg 130 135 140 Leu Giu Tyr Gly Tyr Me Ser Thr Ser Leu Met Asn Val Ser Gln Phe 145 150 155 160 Wing Gly Arg Pro He He Thr Lys Phe Lys Val Wing Ala Gly Ser Lys 16 5 170 175 Wing Gly Tyr He Asp Pro He Be Wing Phe Wing Gly Gln Leu Glu Met 180 185 190 Leu Leu Pro Arg His Being Thr Tyr His He Asp Asp Met Arg Leu Ser 195 200 205 Being Asp Gly Lys Gln He He He Thr Wing Thr Met Met Gly Thr Wing 210 21 5 220 Me Asn Pro Lys Glu Phe Val Met Asn Pro Wing Asn Wing Gln Gly Arg 225 230 235 240 His Thr Pro Gly Thr Arg Leu 245 (SEQ. I D. NO: 57) An amino acid residue consists of the group -NH-CR? R2-CO- when the amino acid residue is located internally in a peptide.

The residue is formed from the corresponding amino acid NH2CR1R2-COOH, where Ri and R2 are associated substituents in the central carbon of the amino acid to form the remainder of the amino acid, by the loss of H2O to form an amide or peptide bond with another amino acid, one in nitrogen and the other in the carbonyl of the carboxylic acid. An amino acid residue at the N-terminus of a peptide comprises the group NH2CR-? R2-COOH, in which nitrogen is bound via a peptide bond with another amino acid residue in the peptide. The amino acid residues that may be present in the peptide and protein sequences of this invention are sometimes referred to with three-letter or one-letter codes commonly used in the art, the codes comprising: glycine Glty or G; Alanine as Ala or A; valina as Val or V; leucine as Leu or L; isoleucine as He or I; methionine as Met or M; phenylalanine such as Phe or F; Tryptophan Trp or W; proline as Pro or P; serine as Ser or S; Threonine as Thr or T; cysteine as Cys or C; tyrosine such as Tyr or Y; asparagine as Asn or BN; glutamine as Gl or Q; Asp or D aspartic acid; glutamic acid Glu or E; lysine as Lyz or K; arginine as Arg or R; and histitine as His or H. Other amino acids that are not essential amino acids can be introduced using peptide synthesis methods known in the art or by means of chemical modification such as by means of acylation (such as by means of the reaction of a lysine group epsilon amine with an active ester having a carbonyl group to obtain a bond in the episol amine and the carbonyl group), alkylation, urea formation, urethane formation, and the like to add to the chemical chain functional groups of peptides containing hydrophobic groups (eg, C1 to C18 alkyl and / or aralkyl, which may be saturated, unsaturated or contain carboxylic groups such as proline amide) to add positively charged groups such as quaternary ammonium alkyl groups or basic amino groups which may be protonated at a pH found in a cancer patient or both. In the peptides and proteins of this invention, the relatively non-polar and hydrophobic amino acid residues may consist of G, A, V, L, I, M, F, W and P; the relatively polar and hydrophilic amino acid residues may consist of S, T, C, Y, N and Q; the anionic and hydrophilic amino acid residues may consist of D and E, wherein in each of D and E a carboxylic acid functional group may be in deprotonated form as an anionic carboxylate; the cationic and hydrophilic amino acid residues may consist of K in which the basic epsilon basic amino group may be in protonated form as a cationic ammonium group; H wherein the imidazole nitrogen may be in protonated form to provide a cationic imidazolium group and R which may comprise a protonated amidate group. Anti-metastatic properties of a pharmaceutical composition containing a fusion protein of this invention. In one aspect a pharmaceutical composition comprising a fusion protein of this invention can be administered for example by means of injection or by a topical application such as by means of a coating method or other method as described to a tissue close to or which presents a first tumor in a mammal in need of treatment and can inhibit the migration of the metastatic tumor cell in the mammal, the tumor cell originating from a site of the first tumor in the mammal, to a site in a healthy or normal tissue of the mammal that is functionally related and close to the tissue in which the first tumor resides. For example, a pharmaceutical composition containing a fusion protein of this invention can be administered to nearby kidney tissue or that exhibits a renal tumor of a mammal and can inhibit the migration of the renal tumor matastatic tumor cell in the kidney to a healthy tissue in the same kidney in which the first tumor resides. In another aspect, a pharmaceutical composition containing a fusion protein of this invention can be administered for example by injection or coating or other method described herein to a nearby tissue or presenting a first tumor in a mammal in need of treatment, and can inhibit the migration of a metastatic tumor cell in the mammal, the tumor cell originates from a site in the first tumor of the mammal, to a site in a healthy or normal tissue or organ in the mammal that is functionally detached or remote of the tissue in which the first tumor resides. For example, a pharmaceutical composition containing a fusion protein of this invention can be administered to a tissue in the brain that presents a brain tumor, and can inhibit the migration of metastatic brain tumor cells in healthy tissues anywhere in the body such as tissues of the liver, spleen or lung.

In another aspect, after administration of a pharmaceutical composition containing a fusion protein of this invention to a patient in need of treatment, metastatic migration of a malignant tumor cell is prevented or prevented and substantially or completely prevented. the formation of a secondary tumor and can prevent the spread of malignant cancer in a patient. Demonstration that a fusion protein of this invention such as BA-07 can reduce cell motility The therapeutic effectiveness of a pharmaceutical composition containing a fusion protein of this invention (such as BA-05) as an anti-metastatic agent can be demonstrated for example, quantitatively, by means of an in vitro two-dimensional cell invasion assay. In that assay, the inhibition of the malignant cell's metastatic migration capacity can be measured through the use of purchased Boyden cameras. The Boyden chambers have 2 compartments, with the upper and lower compartments separated by a membrane. The extent of cell migration is measured by inoculating a total number of cells in the upper compartment and counting the fraction of the total number of cells migrating to the lower compartment. Growth factors can be added to the lower compartment to improve cell migration. This model is useful as a model of cell migration. This model is useful as a model of the migration of cancer cells in vivo in a mammal. To test the ability of a pharmaceutical composition to present a fusion protein of this invention (such as BA-07 in phosphate-buffered saline which is isotonic with the blood of a mammal) to block the migration of tumor cells, The composition containing BA-07 is added to different concentrations of BA-07 to the cancer cells in the upper compartment. The fraction of the total number of cells that migrate to the lower compartment in the presence of a fusion protein composition in the presence of the fusion protein are counted and coveraged with the controls in which the fusion protein has a zero concentration. The number of cancer cells that look in an experimental control model such as migration in a cancer patient that is not treated with a composition of this invention. The number of cancer cells that migrate in the presence of an aliquot of a composition of the invention model such migration in a cancer patient being treated with an aliquot of a composition of this invention. The difference between the latter and the experimental cell migration numbers of control can be expressed as a percentage by weight and can be in the range of 100% (this is complete inhibition of metastatic cell migration) to approximately 5%, preferably from 100% to about 50%, more preferably from about 1 00% to 75%, and more preferably from about 100%) to 90%. An amount of 0% can be observed when a first control vehicle is compared with a second control vehicle which can be equal to the first control vehicle. A calculation of this percentage is given by solving the expression = [(number of cells that migrate in the control minus the number of cells that migrate in the presence of the fusion protein divided by (number of cells that migrate in the control)} by 100%). The therapeutic effectiveness of a pharmaceutical composition containing a fusion protein of this invention (such as BA-05) as an anti-metastatic agent can be demonstrated at least quantitatively and in one aspect by means of an in vitro three-dimensional cell invasion assay. . In such an assay, the inhibition of the metastatic migration capacity of a malignant cell can be measured by the change in the capacity of a cell. malignant to migrate through a matrix MATRIGELtm after treatment of the cell with a pharmaceutically acceptable formulation of this invention containing a fusion protein of this invention in a carrier vehicle in relation to the ability of the malignant cell to migrate through MATRIGEL® matrix after treatment with the carrier vehicle as reference control the carrier vehicle does not contain fusion protein. In one aspect a fusion protein of this invention can inhibit the migration of a metastatic tumor cell in a tissue matrix model to produce an inhibitory change such as a reduction in the migration rate of the cell or as a reduction in the distance of migration of the cell in a period of time. The relative change in the migration distance of a malignant cell through a matrix model is equal to the difference in the migration distance of a cell in the presence of a fusion protein plus the vehicle and the migration distance of the cell in the presence of a control vehicle in the absence of the fusion protein, the difference is divided by the migration distance of the control vehicle. Relative changes can be expressed as a percentage by weight and can be in the range of 100% (ie complete inhibition of metastatic cell migration) to about 5%, preferably from 100% to about 50%, more preferably from about 100% to 75%, and more preferably from about 100% to 90%. An amount of 0% can be observed when a first control vehicle is compared to a second control vehicle which can be equal to the first control vehicle. In one embodiment the comparison of the efficiencies of two fusion proteins A and B of this invention, fusion proteins differ from one another in their amino acid sequence, such as for example in the respective improvement to the membrane penetration sequence, can provide different observed percentages of the inhibition of the migration of a given tumor cell type caused by A and B. The relative differences (either absolute percentages such as 100% by A versus 80% by B, or qualitative differences such as A is better than B) of the inhibition may be the same between tumor types or may vary between tumor types. In one aspect, a fusion protein of this invention can substantially inhibit (100%) the metastatic migration of at least one type of tumor cell. In another aspect, a fusion protein of this invention can substantially inhibit (1 00%) the metastatic migration of at least two types of tumor cells. A useful assay is based on the observed ability of the invasive tumor cell to migrate through an artificial basement membrane (MATRIGEL ™). In this trial, the change in the capacity of different types of cancer cells, each with a different ability to migrate through the MATRIGEL ™. In this trial, the change in the capacity of different types of cancer cells, each with a different ability to migrate through the MATRIGEL ™ in the absence of treatment with a composition of this invention, and therefore different metastatic invasivities they are evaluated by exposure to a concentration or dosage range of a fusion protein of this invention from 0.1 μg / ml to 100 μg / ml. A preferred concentration range is about 0.001 micrograms of fusion protein per cubic centimeter (cc) of tissue to about 100 micrograms per cubic centimeter of tissue. Matrigel ™ matrix (BD Biosciences) is a solubilized base membrane preparation extracted from EHS mouse sarcoma, a tumor rich in ECM proteins. Its main components are laminin, UV collagen, heparan sulfate proteglycans, and entactin. At room temperature Matrigel ™ BD matrix polymerizes to produce a biologically active matrix material that can mimic the mammalian cell base membrane, where the cells can behave in vitro in a manner similar to in vivo conditions. Matrigel ™ matrix can provide a physiologically relevant environment for studies of cell morphology, biochemical function, migration or invasion and gene expression. Inhibition of angiogenesis by means of a pharmaceutical composition containing a fusion protein of this invention such as BA_05 and its effect on capillary or tubular structures In one aspect a pharmaceutical composition consisting of a fusion protein of this invention can be administered for example by means of injection or coating or other method described herein to a tissue close to or presenting a first tumor in a mammal in need of treatment and can inhibit the process of angiogenesis of a metastatic tumor cell or a group of tumor cells in the mammal, the tumor cell or group of cells that originate from the site of the first tumor in the mammal, to a site in a healthy or normal tissue of the mammal that is functionally related and close to the tissue in which the first one resides. tumor. For example, a pharmaceutical composition containing a fusion protein of this invention can be administered to nearby renal tissue or that presents a renal tumor of a mammal and can inhibit the migration of the renal tumor cell from the tumor in the kidneys to a healthy tissue in the same kidney in which the first tumor resides. In another aspect, a pharmaceutical composition containing a fusion protein of this invention can be administered for example by injection or coating or other method described herein to a nearby tissue or presenting a first tumor in a mammal in need of treatment, and can inhibit angiogenesis of a metastatic tumor cell in the mammal, the tumor cell originates from a site in the first tumor of the mammal, to a site in a healthy or normal tissue or organ in the mammal that is functionally detached or remote of the tissue in which the first tumor resides. For example, a pharmaceutical composition containing a fusion protein of this invention can be administered to a tissue in the brain that presents a brain tumor, and can inhibit the migration of metastatic brain tumor cells in healthy tissues anywhere in the body such as tissues of the liver, spleen or lung. In another aspect, after administration of a pharmaceutical composition consisting of a fusion protein of this invention to a patient in need of treatment, angiogenesis associated with metastatic formation and growth of the malignant tumor cell can be prevented or inhibited. The administration of a pharmaceutical composition consisting of a fusion protein of this invention to a patient in need of treatment, can substantially reduce or completely prevent the angiogenesis associated with the formation of a secondary tumor and can prevent the expansion and rootedness of malignant cancer. in a patient. The formation of new blood vessels by means of angiogenesis is important in the growth of the first tumor and the subsequent growth of a second tumor formed by a cell or group of cells of the first tumor by means of metastasis. Inhibition of angiogenesis by means of a pharmaceutical composition having a fusion protein of this invention such as BA-07 can be evaluated in an in vitro system useful for the study of angiogenesis in the growth of a tumor, this is a system that consists of the culture of endothelial cells in the presence of a base membrane extract (matrigel). Under experimental observation conditions, capillary-like structures or tubes associated with angiogenesis or capillary blood vessel formation can be observed under the microscope. The inhibitory effect of a fusion protein of this invention such as BA-05 on the progress of angiogenesis or on the formation of a tubular capillary network or on the interruption of the process or the progress of angiogenesis associated with tumors can be observed by means of of the following disappearance of tubular structures in a trial with matrigel. In a matrigel trial, matrigel (approximately 12.5 mg / ml) is thawed at approximately 4o C. The matrix (approximately 50 ul) is added to each well of a 96-well plate and allowed to solidify for about 10 minutes to about 37 ° C. Wells containing solid Matrigel are incubated for approximately 30 minutes with HUVEC cells at a concentration of approximately 15,000 cells per well. When the cells adhere, the medium is removed and replaced by means of fresh medium supplemented with a fusion protein of this invention such as BA-05 and incubated at 37 ° C for about 6 to 8 hours. The control wells are incubated only with medium. To analyze the growth, tube formation can be visualized with the microscope at an increase of for example 50X. The relative average length Yx of the capillary network derived from angiogenesis observed in an evaluation of a pharmaceutical composition containing a fusion protein x, of this invention can be quantified using the Northern Eclipse software according to the instructions. The data of a typical Matrigel test experiment for example related to the effect of a pharmaceutical composition containing a fusion protein designated as BA-05 on the length of the capital network derived from angiogenesis are summarized in Table 1. These data show that network formation was inhibited by about 13% to about 20% under the dose and formulation conditions used against the inhibition produced by a control vehicle in which zero inhibition provides 100% growth. This effect on angiogenesis can be improved by using higher doses of fusion protein and by preincubation of HUVEC cells with BA-05 prior to the addition of cells to Matrigel. Table 1 Anti-angiogenesis effect of a pharmaceutical composition comprising a fusion protein BA-05, on the average length of a capillary network in a matrix Matrigel assay Antiproliferative activity of tumor cells of the pharmaceutical composition containing a fusion protein of the invention such as BA-07 The demonstration that a fusion protein of this invention such as BA-07 can affect multiple aspects of cell genotypes malignancies can be shown by monitoring the incorporation of tritiated trimide in proliferating and growing cells where tritiated thymidine added to the cell culture medium is taken up in the cells and becomes part of the source of thymidine triphosphate used by each cell to synthesize DNA The titrated thymidine is covalently incorporated into the DNA macromolecules in each of the cells. In cells that are not growing or in cells that are suffering death by apoptosis or by necrosis, thymidine tritiated either is not taken into the cell or is released from the cell medium after lysis of the cell. The incorporation of tritiated thymidine can be used as a general measure of the effect of a fusion protein of this invention such as BA-07 on cell growth, cell division, cell stability and cell death. Cell lines in which BA-07 induces a reduction in 3H-thymidine include: human endometrial cancer cell line HEC 1 B, human colorectal cancer cell line CaCo2, human melanoma cancer cell line SK-MEL-2, and the cancer cell line of the human CNS A-172. The data in Table 2 illustrate the effects of changes in dose amounts of a composition containing a fusion protein of this invention BA-08 administered to each of eight representatives of human cancer cell lines on tritiated thymidine incorporated in the eight human cancer cell lines: HEX 1 B, Caco-2, SK-MEL-1, HT1080, MCF8, SW480, 293S and A172. The dose of BA-07 fusion protein administered was found in the 50-fold range from about 1 microgram per milliliter to 10 microgram per milliliter to about 50 microgram per milliliter (ug / ml). Table 2 Data on the response of human tumor cell lines with respect to the administration of a BA-07 fusion protein, measured by the incorporation of tritiated thymidine Unexpectedly it was observed that those cell lines of human tumors present a reduced cell proliferation in the presence of the fusion protein. Table 2 shows the percentage of growth compared to a control value of 100%.

The tumor cell lines can be divided into three separate groups with respect to the incorporation of tritiated thymidine. A composition of this invention containing the fusion protein BA-07 has a pronounced effect on cell proliferation in the HEC 1 B cell line, which is an endometrial carcinoma cell line with an inhibition of proliferation related to an inhibitory concentration of the 50% (IC50) less than 1 ug / ml. In addition to the inhibition there is a dose-response effect of greater inhibition at a higher concentration of BA-07. In the Caco 2 and SK-MEL-1 cell lines, shown in Table 2, a fusion protein has a strong inhibitory effect on cell proliferation as evidenced by a lower level of incorporation of tritiated thymidine in the cells of each line cell phone. Abbreviations used in the description ADP adenine dinucleotide phosphate ATCC American culture type ADPC3 exotransferase C3; C3 exoenzyme; C3 transferase FBS fetal bovine serum HEPES buffer HEPES MMP Matrix metalloproteinase NAD Nicotinamide adenine dinucleotide NCI National Cancer Institute PBS Saline buffer buffered with SRB Sulfohordamin B TCA Trichloroacetic acid The invention is illustrated below in various modalities and aspects with the following examples not limiting. Example 1 General method useful for preparing a fusion protein according to the invention To demonstrate a useful method for preparing a fusion protein of this invention, an example of an antennapedia sequence added to terminal C of the C3 polypeptide is used. The DNA sequence to be added to the C-terminus can be any DNA sequence that results in the addition of at least one amino acid to the C-terminus of the C3 polypeptide. The stop codon at the 3 'end of the DNA sequence can be replaced with an EcoR1 site by means of polymerase chain reaction (PCR) using the primers 5'GAA TTC TTT AGG ATT GAT AGCX TGT GCC 3' (SEQ. I D. NO: 1) and 5'GGT GGC GAC CAT CCTCCA AAA 3 '(SEQ ID NO: 2). The PCR product can be sub-cloned into a pSTBIue-1 vector (Novagen, Madison Wisconin) then cloned into a pGEX-4T vector (Amersham Biosciences, Baie d'Urfe, Quebec) using the BamHI and Not I restriction sites. vector can be called pGEX-4T / C3 and provides a general method for preparing a fusion protein of this invention. A useful antennapedia sequence to be added to the 3 'end of C3 in pGEX-4T / C3 can be created by PCR from the pET-3A vector containing the antennapedia sequence (Bloch-Gallego (1 993) 120: 485-492; and Derossi (1994) 269: 10444-10450), subcloned into a blunt vector pSTBIue 1, then cloned into pGEX-4T / C3, using the EcoRI and SalI restriction sites, creating pGEX-4T / BA- 14. The manipulations of the target plasmid sequence, such as by using nucleases present in the plasmid DNA or purchased enzymes that result in new DNA sequences, digestion of the exonuclease, site-directed mutagenesis using two synthetic oligonucleotides containing the desired DNA sequence incorporated in pGEX4T / BA-14, can be used to produce new DNA sequences that when expressed in an appropriate system produce proteins that can be purified by standard methods such as affinity or standard chromatography using methods such as ion exchange to separate by charge, size exclusion chromatography to separate by size and other methods of protein purification. The proteins are tested in assays for ability to permeate cells and the proteins are tested in assays to determine their ability to antagonize Rho activity. DNA sequence analysis can be performed on the plasmid sequences that produce better responses than C3 exotransferase, each compared as a control. The pGEX-4T / BA-14 gene (SEQ ID NO: 3) is a currently preferred sequence and provides a protein that is a preferred composition of the invention. An example of a fusion protein similar to C3 is called pGEX-4T / BA-05 (SEQ ID NO.37). The proteins of the present invention can be prepared from extracts of bacterial cells, or by the use of recombinant techniques by means of transformation, transfection or infection of a host cell with all or a part of the DNA fragment encoding a protein of fusion such as the DNA fragment encoding BA-05) with a transport sequence derived from antennapedia in a suitable expression vehicle. Example 2 Preparation of a BA-05 fusion protein The method of example 1 can be used to prepare a fusion protein designated BA-05, the fusion protein contains an amino acid sequence. BA-05 is the name given to the protein made by ligating a cDNA encoding C3 to a cDNA encoding a fusogenic 19-mer peptide. An example of a fusion protein similar to C4 is denoted pGEX-4T / BA-05 (SEQ ID NO.37). This C3-like fusion protein is prepared by the method described to manipulate antennapedia DNA in the DNA of pGEX4T / C3. Twenty or more C3-like fusion proteins are expressed and purified as described by the manufacturer (Amersham BioSciences , Baie D'Urfe, Quebec). The twenty proteins are examined in their ability to inactivate Rho in an in viro system. Proteins that inactivate Rho to a large extent, as measured by the elevated growth of neurites compared to the control vehicle or the control protein glutathione-S-transferase (GST) are subjected to further analysis. The products of this process can include proteins such as BA-14, a protein described in the general example, or new fusion proteins produced by means of the cloning method, the fusion proteins can have properties such as molecular weight and activity in the Rho inactivation bioassays different from those of the BA-14 fusion protein molecule or different from a non-fusion protein control protein C3. The new fusion proteins may contain a C3 amino acid sequence, but they will be altered at the carboxyl terminus due to the method used. Example 3 Preparation of a fusion protein BA-07 The method of example 1 can be used to prepare BA-07, the fusion protein contains the following amino acid sequence: Met Ser Arg Val Asp Leu GIn Ala Cys Asn Ala Tyr Ser He Asn Gln 1 5 10 15 Lys Wing Tyr Being Asn Thr Tyr Gln Glu Phe Thr Asn He Asp Gln Wing 20 25 30 Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys Ser 35 40 45 Glu Lys Glu Wing He Val Ser Tyr Thr Lys Ser Wing Ser Glu He Asn 50 55 60 Gly Lys Leu Arg Gln Asn Lys Gly Val He Asn Gly Phe Pro Ser Asn 65 70 75 80 Leu He Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met Lys 85 90 95 Thr Pro Glu Asn ie Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr Leu 100 105 1 10 Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr Me Asn 1 15 120 125 Lys Thr Ala Phe Glu Lys Ala Lys Ala Lys Phe Leu Asn Lys Asp Arg 130 135 140 Leu Glu Tyr Gly Tyr Me Ser Thr Ser Leu Met Asn Val Ser GIn Phe 145 150 155 160 Wing Gly Arg Pro He He Thr Lys Phe Lys Val Wing Lys Gly Ser Lys 165 170 175 Wing Gly Tyr He Asp Pro He Wing Wing Phe Wing Gly Gin Leu Glu Met 180 185 190 Leu Leu Pro Arg His Ser Thr Tyr His He Asp Asp Met Arg Leu Ser 195 200 205 Be Asp Gly Lys Gln Me Me Thr Thr Wing Met Met Gly Thr Wing 210 215 220 Me Asn Pro Lys Glu Phe Val Met Asn Pro Wing Asn Wing Gln Gly Arg 225 230 235 240 His Thr Pro Gly Thr Arg Leu 245 (SEQ. ID. NO: 57) Two PCR primers were designed to transfer a series of recombinant constructs (BA-05) into the pET-9a vector (Novagen, Madison, Wisconsin) to create the BA-07 protein when expressed in an appropriate expression system: the upper primer 5 'ggatctggttccgcgtcatatgtctagagtcgacctg 3' (SEQ D # 38) primer lower 5 'cgcggatccattagttctccttcttccacttc 3' (SEQ ID no. 39). A BamHI site at the 5 'end of SEQ ID NO. 39 is ggatccatta; the TGA is replaced by TAAT (atta, in SEQ I D NO 39). A useful program to amplify the product using Pfu polymerase consists of: 95 ° 1 cycle of 5 \ then 94 ° C 2 '? 56 ° C 2 '? 70 ° C 1 0 cycles of 2', then 94 ° C 2 '? 70 ° C 30 cycles of 3 'and storage at 4 ° C. A QIAEXI I kit (Qiagen) can be used to purify a slice of agarose gel containing the desired DNA band. The insert and vector are digested with BamHI and Ndel following the manufacturer's instructions, purified using agarose gel electrophoresis and a QIAEXI I kit (Qiagen), and incubated together overnight with T4 DNA ligase following the instructions. manufacturer. E. coli (DHdalfa, or preferably XL1 -Blue) is transformed with the ligation mixture. The clones can be verified by means of small-scale induction and SDS-PAGE and can be ensured by means of immunodetection of the crude ones with anti-C3 antibody. The plasmid DNA is purified and its purity can be detected. DNA sequencing (can be performed for example by means of the LiCor in which the entire strip is sequenced over the entire length of the clone). A first construct prepared in this way (pET3a-BA-.07, SEQ I D. NO.7) coincided with the theoretical DNA sequence of the construction pGEX / BA-05 with a slight change in 5 'due to the strategy of cloning A second construct pET9a-BA-07 can be prepared by subcloning the insert of pET3a-BA-07 into vector pET9a by breaking the pET3a construct with BamHI and Ndel (New England BioiAbs, Beverly MA) according to the manufacturer's instructions. Plasmid DNA pET9a can be broken with the same enzymes. The DNA of the insert and the vector can be purified by means of agarose gel electrophoresis. The insert can be ligated into the new vector using T4 DNA ligase (New England BioLabs, Beverly MA). The ligated DNA can be transformed into DHdalfa cells and the DNA can be prepared by QIAGEN mini or maxi-teams. The clones can be characterized by restriction digestion and insert DNA sequence in both directions (eg BioS &T, Lachina, Quebec). The DNA construct can be transformed into BL21 (DE3) and BL21 (DE3) / pLysS (Novagen, Madison, Wl) cells or another suitable expression system. Example 4 General method for taking tritiated thymidine as a measure of proliferation and useful for demonstrating that the BA-07 fusion protein reduces the proliferation of cancer cells 3 H-thymidine incorporation assay Medium and cell lines It is tested the microplasma of the cell lines and it was found to be negative before starting the studies. The cell lines were obtained from ATCC. The HEC-1 B line is grown in E-MEM supplemented with 10% FBS and 1% HEPES. The Caco-2 line is grown in E-MEM supplemented with 20% FBSm 1% HEPES, 1 mM sodium pyruvate and 0.1 mM non-essential amino acid. The SK-MEL-1 line is grown in McCoy supplemented with 10% FBS and 1% HEPES. Volumes of 1 0Ol of 2x the working solution of the fusion protein, positive controls and vehicle controls were inoculated in triplicate into microtiter plates with 96 wells containing cells (4 x 103/100 μl), giving a final volume of 200 μl. Plates are placed at 37 ° C in an incubator with 100% humidity, and 5% CO2. After approximately 54 hours of incubation, a volume of 20 μl of titrated thymidine (3 H-thymidine) (ICN, Montreal, Canada), containing 1.0 μCi, is added to each well. 3 H-Thymidine is prepared in RPMI-1640 supplemented with 10% FBS. The cultures are incubated in the same conditions indicated above, for another 18 hours. At the end of the incubation, the cells are harvested with an automatic cell collector (Tomtec), and the incorporated per minute (cpm) count of 3H-thymidine measured with a microplate scintillation counter (TopCount XT, Packard). The demonstration that a fusion protein of this invention such as BA-07 can affect multiple aspects of the phenotypes of malignant cells can be shown by monitoring the incorporation of tritiated thymidine in the proliferation and growth of cells, wherein the tritiated thymidine added to the cell culture medium is taken into the cells and becomes part of the source of the timid triphosphate that is used by each cell to synthesize the DNA. Tritiated thymidine is covalently incorporated into the DNA macromolecules in each of the cells that are not growing or in the cells that are dying by apotosis or by necrosis, the tritiated thymidine either is not taken in the cell or is released in the medium cell after lysis of the cell. The incorporation of tritiated thymidine can be used as a general measure of the effect of a fusion protein of this invention such as BA-07 on cell growth, cell division, cell stability and cell death. Cell lines in which BA-07 induces a reduction in 3H-thymidine include: the human endometrial cancer cell line HEC 1 B, the human colorectal cancer cell line CaCo2, the human melanoma cancer cell line SK-MEL- 2 and the cancer cell line of the human CNS A-172. The data in Table 2 illustrate the effects of changes in the dosage amounts of a composition comprising a fusion protein of this invention, BA-07, administered to each of eight representatives of human cancer cell lines in the incorporation of tritiated thymidine the eight human cancer cell lines: HEX 1 B, Caco-2, SK-MEL-1, HT1080, MCF8, SW480, 293S and A172. The dose of BA-07 fusion protein administered was found in the 50-fold range from about 1 microgram per milliliter to 10 microgram per milliliter to about 50 microgram per milliliter (ug / ml). Example 5 General method for the determination of angiogenesis inhibition The formation of new blood vessels in a cell culture model by culturing endothelial cells in the presence of a base membrane matrix (Matigel) is studied. human umbilical vein endothelial cells (H UVEC) are harvested from culture broths by means of tripinization, and resuspended in the culture medium consisting of EBM-2 (Clonetics), FBS, hydrocortisone, hFGF, VEGF, R3-IGF -1, ascorbic acid, hEGF, GA-1000, heparin. Matrigel (12. d mg / ml) is thawed at 4 ° C, and dO ml Matrigel is added to each well of the plate with 96 wells, and allowed to solidify for 10 minutes at 37 ° C. Growth medium at a concentration of 1 d, 000 cells / well are added to each well, and allowed to adhere for 6 hours. The BA-07 fusion protein is added to the well at a concentration of approximately 10 mg / ml, and in other wells PBS is added as a control. The crops are allowed to grow for another 6 to 8 hours. The growth of the tubes can be visualized by means of a microscope with an increase in dOX, and the average length of the capillary network was quantified using the Northern Eclipse software. The treatment of the cells in the Matrigel assay with fusion protein BA-07 reduces the formation of tubes (see figure 3). Example 6 General method to demonstrate the effect of a fusion protein on the inhibition of cancer cell proliferation Growth inhibition assay with Sulforhodamine B (SRB) A staining assay with the sulforhodamine B protein (SRB, provided by Molecular Porbes) for in vitro measurement of cellular protein content was developed and subsequently adapted for routine use in the in vitro antitumor selection NCI (Skeham et al., 1990). The SRB is linked to the basic amino acids of the cellular protein and the colorimetric evaluation provides an estimate of the total mass of the protein that is related to the number of cells. This test is based on the assumption that dead or broken cells are removed during the procedure or that they do not contribute to the colorimetric endpoint. The SRB assay may overestimate the surviving fraction of the cells. Protocol for the SRB assay These tests are conducted on a panel of NCI 60 cell lines. The cells are cultured in RMPI-L 640 medium supplemented with d% fetal bovine serum and L-glutamine according to the ATCC recommendations for each cell line . The cells with logarithmic growth trypsinize and count. The cells are inoculated in a titration microplate depending on the time to double the individual cell lines in 100 μl of growth medium. The microplates are incubated at 37 ° C, d% CO2 and 100% relative humidity for 24 hours to summarize the exponential growth. After 24 hours, two plates of each cell line are fixed in situ with TCA to represent a measurement of the cell population for each cell line at the time of the addition of the test article (To). The TCA is removed and the plates are incubated at room temperature for at least 24 hours to dry. A fusion protein of this invention is prepared and stored frozen in the form of lyophilized powder. It can be reconstituted with sterile water to form a pharmaceutical composition with about 4.42 micrograms of fusion protein per microliter in 1 mM sodium phosphate, buffer pH 7.4. For each dose point, serial dilutions of the base solution are prepared with the complete medium containing 50 μg / ml gentamicin to provide fusion protein at 200 μg / mol, 20 μg / mol, 2 μg / mol, 0.2 μg / mol, and 0.02 μg / mol. Aliquots of 1 00 μl of those dilutions of the test article are added to the appropriate well which already contains 1 00 μl of medium to achieve the logarithmic final dose dilution series of the fusion protein.

After the addition of the protein (this is the drug), the microplates are incubated for an additional period at 37 ° C, 5% CO2 and 100% relative humidity. The assay ended by fixing the protein in the cells at the bottom of the wells using trichloroacetic acid (TCA). The plates are dried and then 100 μl of SRB solution at 0.4% (w / v) in 1% acetic acid is added to each well. The plates are incubated with a protein binding dye for 10 minutes at room temperature. After dyeing the unbound dye, it is removed by lacquering with 1% acetic acid and the plates are dried. The ligated dye is solubilized by adding 200 μl of 10 mM Trizma base while the plates are mixed gently. The amount of dye is measured by reading the optical density with a microplate reader at a wavelength of 51 5 nm. The data is analyzed with an Excel spreadsheet. T0 = mean absorbance over time of the fusion protein addition (time 0) C = mean absorbance for the control (without drug containing test article) T¡ = Average absorbance per article of fusion protein (different dose points) in the dilution series) A percentage growth is calculated for each of the test article concentrations:% growth = [(Ti-To) / (C-To)] x100 for concentrations where You > To. % growth inhibition = [(Ti-To) / (To)] x100 for concentrations where Ti < To.

% Growth inhibition can be used to prepare a table to compare the effect with different doses. Graphs of percentage growth are plotted and the points at which dose response curves intersect with PG values of +50, 0 and -50 are used to calculate Gl50, TGl and LC50. Gl50, or concentration required to inhibit growth at 50% is the relevant parameter of the fusion protein. Example 7 Specific use of the SRB assay to demonstrate inhibition of cell growth in human cancer cell lines Table 3 GI50 (concentration for 50% inhibition of cell growth) after treatment with the fusion protein measured by assay means SRB) A fusion protein of this invention BA-07, has an effect on 4 of 6 human tumor cell lines tested with 3H-thymidine and an effect of about 10% of the cell lines of the NCI selection. In the SRB test, it seems to have cytostatic properties; growth is inhibited compared to controls but the overall amount of the protein does not decrease compared to the amount measured at time zero (Tz). These results are consistent with in vivo data showing that C3 transferase is not highly toxic to animals. The observed Gl50 values are in the nanomolar to micromolar range, given a molecular weight of approximately 27 kDa for the fusion protein. Example 8 Detection of Rho Activated by Pull-down Assay NG 108 cells are cultured in the cell culture in the presence of 5% fetal bovine serum (FBS), 1% penicillin-streptomycin (P / S). After the cells settle (3-6 hours at 37 ° C), BA-05 is added to the cultures. To break the cells, they are washed with buffered saline with ice-cold Tris (TBS) and broken in modified RIPA buffer (50 mM Tris pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS , 500 mM NaCl, 10 mM MgCl 2, 10 μg / ml leupeptin, 10 μg / ml aprotinin, 1 mM phenylmethyl sulfonyl fluoride (PMSF)). Cell lysates are clarified by centrifugation at 13,000 g for 10 minutes at 4 ° C and maintained at minus 80 ° C (-80 ° C). The purification of the GST-Rho binding domain (GST-RBD) is carried out with cell lysates, which are thawed and resuspended in 500 uL of RI PA buffer per 1 million cells. To produce the GST-Rho binding domain (GST-RBD), bacteria expressing GST-RBD in a pGEX vector are cultured in L (LB) broth with 100 μg (/ ml ampicillin). dilute to 1: 10 in 4600 ml of LB and incubate in a bacterial incubator with shaking at 37 ° C for 2 hours.Isopropyl-β-D-thiogalactopyranosine (0.5 mM) is then added to the incubated cultures for 2 hours. The bacteria are then harvested by means of centrifugation at 5, 000 g for 15 minutes. The pellets are then resuspended in 40 ml of lysis buffer (50 mM Tris pH 7.5, 1% Triton-X, 150 mM NaCl, 5 mM MgCl 2, 1 mM DTT, 10 μg / ml leupeptin, 10 μg / ml aprotinin, 1 mM PMSF). After sonification, the lysates are centrifuged at 14,000 rpm for 30 minutes at 4 ° C. Frozen cell cultures are homogenized in RIPA buffer (dO mM Tris pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate , 0.1% SDS, 500 mM NaCl, 10 mM MgCl 2, 10 μg / ml leupeptin, 10 μg / ml aprotinin, 1 mM PMSF). The homogenates and cell lysates are clarified by centrifugation for 10 minutes at 1 3,000 g at 4 ° C. Then they are incubated for 50 minutes at 4 ° C with GST-RBD coupled to the granules of glutathione agarose (Sigma, Oakville Canada) . The granules are then washed 4 times and eluted in a sample buffer. The Rho bound to GTP and the total Rho present in the tissue homogenates are detected by means of western blot. The proteins are transferred to nitrocellulose and probed using a RhoA monoclonal antibody (Santa Cruz, Santa Cruz, California). Bands with secondary antibodies bound to peroxidase (Promega, Madison, Wyoming) and HRP-based chemiluminescence reaction (Pierce, Rockford, Illinois) were visualized. The densitometry analysis is performed to quantify the signal in each band. Example 9 Use of the Rho polishing assay as a diagnostic to diagnose or determine which tumors can respond to fusion protein therapy using BA-07 as an example Tumor biopsy samples are obtained by means of surgical removal from a tissue in a mammal (for example a human patient) to leave a residual tissue in the margin of the excised tumor using the entire tumor is removed. The samples are frozen in dry ice or in liquid nitrogen. Extruded tissue samples of approximately 5 mm2 are homogenized in 500 ul of RI PA buffer (dO Mm Tris pH 7.2, 1% Triton X-100, 0.5% sodium deoxycholate, 0.% SDS, 500 mM NaCl, 10 mM MgCl 2, 10 mg / ml of leupeptin, 10 mg / ml of aproptinin, 1 mM of PMSF). The homogenates are clarified by means of two 1 0 minute centrifugation at 13,000 g at 4 ° C to provide samples for further analysis. The samples are then incubated for 50 minutes at 4 ° C with GST-RBD coupled to agarose glutathione granules, prepared as described in Example 8. Rho bound to GTP and the total Rho present in the tissue homogenates are detected by means of western blot. To detect which cells in the sample of the biopsy have Rho activated, the cryostat sections can be prepared. The bacterial lysates of RBD-GST are clarified by centrifugation at 14.00 rpm for 30 minutes at 4 ° C. Activated Rho is detected by incubating the section with bacterial lysate containing RBD-GST. Crinoections of rat spine (thickness of approximately 16 μm) are incubated, after post-fixation with 4% PFA, with the bacterial lysate overnight at 4 ° C. The sections are then washed 3 times in TBS, they are blocked in 3% BSA for 1 hour at room temperature and incubated with the anti-GST & (Cell Signallig, New England Biolabs, Mississauga, Canada) and with antibodies specific for the cell type. In the case of a brain tumor, a neuron-specific antibody (NeuN) or astrocyte-specific antibody (GFAP) can be used to detect the type of cells with activated Rho to aid in the diagnosis of the tumor. The sections are washed in TBS and incubated for 2 hours at room temperature with FITC, secondary antibodies conjugated with Texas red or rhodamine (Jackson ImmunoResearch, Mississauga, Canada). Example 10 General method for detecting the reduction of metalloproteinase activity (MMP) The activity of metalloproteinase is detected by means of zymography where the proteolytic activity of enzymes is separated in polyacrylamide gels under non-reducing conditions. To detect metalloproteinase activity, glatinolytic activity is detected in the culture medium of Caki-1 colon carcinoma cells by means of gelatin zymography. The Caki-1 cells are incubated with BA-07 at 0.1, 1.0 or 10 μg / ml or buffer as control for 24 hours. An aliquot (25 μl) of the culture medium is subjected to SDS / PAGE with 7.5% polyacrylamide containing 1 mg / ml gelatin, and the polypeptides are separated under non-reducing conditions. To determine the MMP activity, the SDS is removed by incubation for 30 minutes at room temperature in 2.5% (v / v) Triton X-100. This stage is repeated, followed by five rinses with ddH2. The gel is then incubated for 20 hours at 37 ° C in a buffer containing 50 mM Tris-HCl, pH 7.6, 0.2 M NaCl, 45 mM CaCl2 and 0.02% (v / v) Brij-35. The gel is stained with brilliant blue coomassie R-250, and fading. The enzymatic activity in the gelatin substrate is detected as transparent bands in a blue base. The identity of the MMP enzyme with gelatinase activity is determined with a positive control such as HT-1080 in those experiments. Example 11 Detection of the reduction of metalloproteinase activity after treatment with BA-07 The method of example 10 is employed using fusion protein BA-07. A reduction in metalloproteinase activity is observed. Example 12: Formulation of a fusion protein in a sterile solution An amount of therapeutically effective unit dose of a fusion protein of this invention such as BA-07 is dissolved in a unit dose volume of a sterile isotonic solution such as isotonic PBS. sterile to form a unit dose amount of the solution, which is filtered through a 0.2 micron filter under aseptic conditions.

The filtrate is collected in a sterile flask under an inert atmosphere (for example nitrogen or argon). The bottle is then sealed with a stopper and a crimped lid and stored at room temperature. The amount of the unit dose of the solution in the bottle containing the fusion protein such as the fusion protein BA-07 can be administered to a patient by means of injection such as by means of intravenous delivery, infusion or by means of injection directly into a tumor site in a mammal such as a tumor in a human patient, or by injection into the margins of the site of excision of a tumor in the tissue of a mammal such as a tissue in a human patient. Two or more bottles each containing a quantity of unit dose can be prepared in a similar manner and the unit dose amounts can be administered by injection during a therapeutically effective treatment time, to a patient who needs treatment. In this way a sequence of administrations of the unit dose amount can be performed to the tissue of a patient or systematically to a patient. For example, a quantity of unit dose of a composition of a fusion protein can be administered once a day to a patient, or once every two days to a patient, or once a week to a patient. In addition, the amount of the therapeutically effective unit dose of a pharmaceutical composition comprising a fusion protein can be administered to a patient having a tumor in a patient's tissue systematically one or more times before the tumor is excised and / or at the margins identified by diagnosis of the tumor in the patient or one or more occasions before the tumor is removed by surgical removal, and / or directly in the tumor tissue one or more times before the tumor is excised, and / or systematically one or more occasions after the tumor is removed. The number of such administrations of repeated unit doses and the amount of the fusion protein per unit dose form may vary between patients and between tumor types and tumor sizes in order to prevent the growth of a second tumor in the presence of a first tumor or after the removal of the first tumor. Example 13 A lyophilized formulation A solution containing a dose amount of a composition of this invention containing a fusion protein such as BA-07 dissolved in a pharmaceutically acceptable isotonic aqueous medium containing a pharmaceutically acceptable buffer salt and / or a pharmaceutically acceptable carbohydrate readily soluble in water (preferably a sugar or a pharmaceutically acceptable non-reducing cyclodextrin) is filtered sterile (for example through a 0.2 micron filter) under aseptic conditions, the filtrate is placed in a sterile container, the filtrate is placed in a sterilized container, the filtrate is frozen, the frozen aqueous solution is lyophilized aseptically under reduced pressure in a pharmaceutically acceptable lyophilizer to produce a dry matrix containing the fusion protein in the flask, the flask is returned to the atmospheric pressure under one atom sterile inert sphere, the bottle is sealed with a sterile cap (for example together with a crimped lid). The sealed vial is labeled with its content and dosage amount and placed in a kit in conjunction with a second sealed sterile vial containing sterile water for injection in a quantity useful for transfer into the first vial containing the lyophilized fusion protein with in order to reconstitute the fusion protein matrix to a solution as a unit dosage form. In another embodiment, the fusion protein can be dissolved in an initial volume of aqueous medium containing a hypertonic aqueous medium, the solution is sterile filtered, the filtrate is filled into a bottle, and lyophilized to form a dry matrix. The dry matrix can be dissolved or reconstituted in a volume of sterile water greater than the original. The larger volume is sufficient to form an isotonic solution for the injection. Alternatively, a hypertonic solution can be used for administration by infusion into a drip bag containing a larger volume of aqueous isotonic medium such that the hypertonic solution is substantially diluted. Optionally, a bottle containing a volume of sterile water in a suitable amount to reconstitute the matrix to a unit dosage form is distributed as a kit with the lyophilized protein. Preferably the reconstituted composition consists of an isotonic solution. The fusion protein can be used for intravenous delivery, and / or infusion and / or direct injection into a tumor with this formulation in a manner similar to that of the previous example. Example 14 Formulation in a polymer A composition of this invention containing a fusion protein is formulated, such as BA-07, when mixed in a copolymer of polyglycolic acid (PGA) and polylactic acid (PLA). The copolymers can degrade 2-6 months after implantation depending on the ratio of PGA to PLA. In a PGA / PLA formulation, they are used and dissolved in a non-denaturing organic solvent at concentrations of 0.d-dO%, preferably 0.1-3.9%. The polymer solution can then be expanded with a spatula or emptied onto the surface of a film or sponge based on polysaccharides or applied by spray coating or dip or other useful means, and then dried by removing the solvent. Composite mesh such as a mesh containing a pharmaceutically acceptable, dissolvable and / or degradable polymer can be made to incorporate a fusion protein such as BA-07, which will be released as the mesh degrades. The mesh can be implanted at the site of surgical resection of a tumor and the fusion protein will be released to prevent metastasis and the growth of any remaining tumor cells. Example 15 General method for treating the margin of an excised tumor A composition of this invention containing a fusion protein, such as BA-07, formulated in a pharmaceutically acceptable cream can be used to treat the skin excision site. An example is the treatment of malignant malanoma, where that cream is placed on the skin surrounding the excision site. In one aspect such a formulation of a cream containing the fusion protein such as BA-07 can be administered to the skin before the tumor is removed and used to treat the tumor between the period of the first biopsy and before the positive histological diagnosis. The cream when applied to the tumor site can prevent tumor expansion and metastasis. Example 16 Prevention of the growth of a second tumor in the margin of a tumor A composition of this invention that contains a fusion protein, such as BA-07, for example such as an aqueous solution described herein or that formulated in a surgical adhesive gel. such as fibrin adhesive or hydrogel, can be used to treat the area of a surgical resection of a tumor. An example is the treatment of healthy colon after colonic carcinoma of a colon cancer. Healthy colon tissue surrounding the tumor region prior to tumor excision can be treated with a fusion protein composition such as BA-07, after removing the tumor and associated tissue, in a surgical gel such as a sealant of fibrin, and it will be useful to prevent the formation of additional lesions in the residual tissue. Example 17 General method for demonstrating preclinical efficacy in a mammal A melanoma cell line is implanted subcutaneously in a first group of nude mice (Charles River Laboratories). The tumors grow in the mice of the first group of mice, are collected and transplanted individually in each mouse (one tumor per mouse) of a second group of mice. A daily injection of a pharmaceutical composition of this invention containing an effective dose of a fusion protein such as BA-07, which is estimated to be in the range of 10-100 ug / ml of tumor volume, in a vehicle Pharmaceutically acceptable is administered to each mouse in the second group of mice. Control animals are injected with vehicle as control. The growth of the tumor is measured, and histological procedure is carried out to measure the markers of malignant keratocytes such as immunoprotein gamma 10. The composition containing the fusion protein prevents or inhibits the growth of tumors in the second mice. Example 18 Use of a composition comprising a fusion protein applied to the surface of a device implanted in the breast in the prevention and recurrence of breast cancer A therapeutically effective amount of a pharmaceutical composition of this invention that contains a fusion protein is used to coat the surface of a pharmaceutically acceptable breast implant A tumor is removed from the breast tissue in a patient, optionally with co-administration (both pre- and post-operatively) of a pharmaceutical composition of this invention as described above. The hollow space created by the excision of the tumor is at least partially filled with the breast implant coated with the pharmaceutical composition containing a fusion protein, and the wound created by the excision and / or the implant is closed. The growth of a second tumor in the residual tissue of the tumor margin is substantially inhibited or prevented. Example 19 General Method for the preparation of a fusion protein DNA sequence of a representative fusion protein BA-14. Nucleotide sequence of the protein of representative fusion BA-14 (SEQ. ID NO. 3) ggatcctcta gagtcgacct gcaggcatgc aatgcttatt ccattaatca aaaggcttat 60 tcaaatactt accaggagtt tactaatatt gatcaagcaa aagcttgggg taatgctcag 120 tataaaaagt atggactaag caaatcagaa aaagaagcta tagtatcata tactaaaagc 180 gctagtgaaa taaatggaaa gctaagacaa aataagggag ttatcaatgg atttccttca 240 aacaagttga aatttaataa acttttagat aaatctttta gacccctgaa ataaaatgaa 300 aatattatgt tatttagagg cgacgaccct gcttatttag gaacagaatt tcaaaacact 360 cttcttaatt caaatggtac aattaataaa acggcttttg aaaaggctaa agctaagttt 420 ttaaataaag atagacttga atatggatat attagtactt cattaatgaa tgtctctcaa 480 tttgcaggaa gaccaattat tacacaattt aaagtagcaa aaggctcaaa ggcaggatat 640 attgacccta ttagtgcttt tcagggacaa cttgaaatgt tgcttcctag acatagtact 600 tatcatatag acgatatgag attgtcttct gatggtaaac aaataataat tacagcaaca 660 atgatgggca cagctatcaa tcctaaagaa ttcgtgatgg aatcccgcaa acgcgcaagg 720 cagacataca cccggtacca gactctagag ctagagaagg agtttcactt caatcgctac 780 ttgac ccgtc ggcgaaggat cgagatcgcc cacgccctgt gcctcacgga gcgccagata 840 aagatttggt tccagaatcg gcgcatgaag tggaagaagg agaactga 888 Protein sequence of fusion protein BA-14 (SEQ ID NO 4) Gly Being Being Arg Val Asp Leu Gln Wing Cys Asn Wing Tyr Being He Asn 1 5 1 0 15 Gln Lys Wing Tyr Being Asn Thr Tyr Gln Glu Phe Thr Asn He Asp Gln 20 25 30 Wing Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys 35 40 45 Ser Glu Lys Glu Wing Me Val Ser Tyr Thr Lys Ser Wing Being Glu Me 50 5d 60 Asn Gly Lys Leu Arg Gln Asn Lys Gly Val He Asn Gly Phe Pro Ser 65 70 75 80 Asn Leu Lie Lys Gln Val Glu Leu Asp Lys Ser Phe Asn Lys Met 85 90 95 Lys Thr Pro Glu Asn He Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr 100 105 1 10 Leu Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr Me 1 1 5 120 125 Asn Lys Thr Ala Phe Glu Lys Ala Lys Ala Lys Phe Leu Asn Lys Asp 130 135 140 Arg Leu Glu Tyr Gly Tyr Me Ser Thr Ser Leu Met Asn Val Ser Gln 145 150 155 160 Phe Ala Gly Arg Pro Me He Thr Gln Phe Lys Val Wing Lys Gly Ser 165 170 175 Lys Wing Gly Tyr He Asp Pro He Wing Wing Phe Gln Gly Gln Leu Glu 180 185 190 Met Leu Leu Pro Arg His Ser Thr Tyr His He Asp Asp Met Arg Leu 195 200 205 Ser Ser Asp Gly Lys Gln He lie lie Thr Ala Thr Met Met Gly Thr 21 0 215 220 Ala He Asn Pro Lys Glu Phe Val Met Glu Ser Arg Lys Arg Ala Arg 225 230 235 240 Gln Thr Tyr Thr Arg Tyr Gln Thr Leu Glu Leu Glu Lys Glu Phe His 245 250 25d Phe Asn Arg Tyr Leu Thr Arg Arg Arg He Glu Me Wing His Wing 260 26d 270 Leu Cys Leu Thr Glu Arg Gln Me Lys He Trp Phe Gln Asn Arg Arg 276 280 28d Met Lys Trp Lys Lys Glu Asn 290 29d To demonstrate the method of preparing a fusion protein of this invention, an example of an antennapedia sequence added to the C-terminus of the C3 polypeptide is useful. A DNA sequence to be added to the C-terminal can be any DNA sequence that will result in addition of at least one amino acid to the C-terminus of a peptide containing a C3-polypeptide. First the Pgex2t-c3 plasmid DNA (n Lamarche, McGill University) is prepared using standard methods. The stop codon at the 3 'end of the DNA sequence can be replaced with an EcoR1 site by means of polymerase chain reaction (PCR) using the primers d'GAA TTC TTT AGG ATT GAT AGCX TGT GCC 3' (SEQ. ID NO: 1) and d'GGT GGC GAC CAT CCTCCA AAA 3 '(SEQ I D. NO: 2). The PCR product can be sub-cloned into a pSTBIue-1 vector (Novagen, Madison Wisconin) then cloned into a pGEX-4T vector (Amersham Biosciences, Baie d'Urfe, Quebec) using the BamHI and Not I restriction sites. This vector can be called pGEX-4T / C3 and provides a general method for preparing a fusion protein of this invention. A useful antennapedia sequence to be added to the 3 'end of C3 in pGEX-4T / C3 can be created by PCR from the pET-3A vector containing the antennapedia sequence (Bloch-Gallego (1993) 120: 486-492; Derossi (1 994) 269: 10444-1 0460), subcloned into a blunt vector pSTBIue 1, then cloned into pGEX-4T / C3, using the EcoRI and SalI restriction sites, creating pGEX-4T / BA-14. Nucleotide sequence of BA-14 (SEQ. ID NO. 3) ggatcctcta gagtcgacct gcaggcatgc aatgcttatt ccattaatca aaaggcttat 60 tcaaatactt accaggagtt tactaatatt gatcaagcaa aagcttgggg taatgctcag 120 tataaaaagt atggactaag caaatcagaa aaagaagcta tagtatcata tactaaaagc 180 gctagtgaaa taaatggaaa gctaagacaa aataagggag ttatcaatgg atttccttca 240 aacaagttga aatttaataa acttttagat aaatctttta ataaaatgaa gacccctgaa 300 aatattatgt tatttagagg cgacgaccct gcttatttag gaacagaatt tcaaaacact 360 cttcttaatt caaatggtac aattaataaa acggcttttg aaaaggcíaa agctaagttt 420 ttaaataaag atagacttga atatggatat attagtactt cattaatgaa tgtctctcaa 480 tttgcaggaa gaccaattat tacacaattt aaagtagcaa aaggctcaaa ggcaggatat 640 attgacccta ttagtgcttt tcagggacaa cttgaaatgt tgcttcctag acatagtact 600 tatcatatag acgatatgag attgtcttct gatggtaaac aaataataat tacagcaaca 660 cagctatcaa atgatgggca tcctaaagaa ttcgtgatgg aatcccgcaa acgcgcaagg 720 cccggtacca cagacataca gactctagag ctagagaagg agtttcactt caatcgctac 780 ttgacccgtc ggcgaaggat cgagatcgcc cacgccct gt gcctcacgga gcgccagata 840 aagatttggt tccagaatcg gcgcatgaag tggaagaagg agaactga 888 Protein sequence of fusion protein BA-14 (SEQ ID NO 4) Gly Ser Ser Arg Val Asp Leu Gln Ala Cys Asn Ala Tyr Ser He Asn 1 5 1 0 15 Gln Lys Ala Tyr Ser Asn Thr Tyr GIn Glu Phe Thr Asn He Asp Gin 20 25 30 Wing Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys 35 40 45 Ser Glu Lys Glu Wing He Val Ser Tyr Thr Lys Ser Wing Ser Glu lie 50 55 60 Asn Gly Lys Leu Arg GIn Asn Lys Gly Val He Asn Gly Phe Pro Ser 65 70 75 80 Asn Leu He Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met 85 90 95 Lys Thr Pro Glu Asn He Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr 100 105 1 10 Leu Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr lie 1 15 120 125 Asn Lys Thr Wing Phe Glu Lys Wing Lys Wing Lys Phe Leu Asn Lys Asp 130 135 140 Arg Leu Glu Tyr Gly Tyr lie Being Thr Ser Leu Met Asn Val Being Gln 14d 150 155 160 Phe Wing Gly Arg Pro He Me Thr Gln Phe Lys Val Wing Lys Gly Ser 165 170 175 Lys Wing Gly Tyr Me Asp Pro Me Being Wing Phe Gln Gly Gln Leu Glu 180 185 190 Met Leu Leu Pro Arg His Ser Thr Tyr His Me Asp Asp Met Arg Leu 195 200 205 Being Ser Asp Gly Lys Gln He He lie Thr Wing Thr Met Met Gly Thr 210 21 5 220 Ala lie Asn Pro Lys Glu Phe Val Met Glu Ser Arg Lys Arg Ala Arg 225 230 235 240 Gln Thr Tyr Thr Arg Tyr Gln Thr Leu Glu Leu Glu Lys Glu Phe His 245 250 25d Phe Asn Arg Tyr Leu Thr Arg Arg Arg Me Glu He Ala Hís Ala 260 26d 270 Leu Cys Leu Thr Glu Arg Gln Me Lys Me Trp Phe Gln Asn Arg Arg 276 280 28d Met Lys Trp Lys Lys Glu Asn 290 29d The proteins of the present invention can be prepared from bacterial cell extracts, or by means of recombinant techniques by means of transformation, transfection or making a host cell with all or a portion of the DNA fragment encoding the fusion protein such as a DNA fragment encoding BA-Od with a transport sequence derived from antennapedia in a suitable expression vehicle. Example 20 Preparation of a fusion protein, BA-05 An example of a fusion protein similar to C3 is denoted pGEX-4T / BA-05 (SEQ.I D. D. NO.4). BA-05 is the name given here to the protein prepared by ligating a cDNA encoding C3 to a cDNA encoding a 19-mer fusogenic peptide. The method of Example 19 can be used to prepare a BA-05 fusion protein, which contains the following amino acid sequence: Protein coding sequence Pgex-4tba-0d (SEQ ID NO: 4) Gly Ser Ser Arg Val Asp Leu Gln Ala Cys Asn Wing Tyr Ser He Asn 1 5 1 0 15 Gln Lys Wing Tyr Being Asn Thr Tyr Gln Glu Phe Thr Asn l ie Asp Gln 20 25 30 Wing Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys 35 40 45 Ser Glu Lys Glu Wing He Val Ser Tyr Thr Lys Ser Wing Ser Glu He 60 dd 60 Asn Gly Lys Leu Arg Gln Asn Lys Gly Val lie Asn Gly Phe Pro Ser 66 70 7d 80 Asn Leu He Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met 8d 90 9d Lys Thr Pro Glu Asn He Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr 100 105 1 10 Leu Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr He 1 1 5 120 125 Asn Lys Thr Wing Phe Glu Lys Wing Lys Wing Lys Phe Leu Asn Lys Asp 130 135 140 Arg Leu Glu Tyr Gly Tyr He Ser Thr Ser Leu Met Asn Val Ser Gln 145 150 155 160 Phe Wing Gly Arg Pro He He Thr Gln Phe Lys Val Wing Lys Gly Ser 165 170 175 Lys Wing Gly Tyr He Asp Pro He Be Ala Phe Gln Gly Gln Leu Glu 180 185 1 90 Met Leu Leu Pro Arg His Ser Thr Tyr His He Asp Asp Met Arg Leu 1 95 200 20d Be Ser Asp Gly Lys Gln He He He Thr Ala Thr Met Met Gly Thr 210 215 220 Ala He Asn Pro Lys Glu Phe Val Met Glu Ser Arg Lys Arg Ala Arg 225 230 235 240 Gln Thr Tyr Thr Arg Tyr Gln Thr Leu Glu Leu Glu Lys Glu Phe His 24d 260 2dd Phe Asn Arg Tyr Leu Thr Arg Arg Arg He Glu Me Ala His Wing 260 265 270 Leu Cys Leu Thr Glu Arg Gln He Lys Me Trp Phe Gln Asn Arg Ard 27d 280 286 Met Lys Trp Lys Lys Glu Asn 290 295 This protein from fusion similar to C3 is prepared by means of the described method to manipulate a DNApedia ADn in the pGEX4T / C3 DNA, producing Pgex4t / ba-14. A clone with a displacement mutation is selected and the protein is produced and tested. When the cultures give positive results despite (in the presence of a mutation, the plasmid DNA is sequenced again to confirm the mutation.) The new clone is called BA_0d To confirm the sequence of C3APLT, the coding sequence of both strips The sequence of this clone is given in the examples (BA-Od nucleotide sequence); SEQ ID NO. 3, the amino acid sequence of BA-Od; I KNOW THAT. ID. DO NOT. 4). Another useful method to produce BA-05 is to prepare pGEX-4T (BA-14, then use the site-directed mutagenesis technique using two complementary oligonucleotide primers such as (SEQ ID NO: 58) 5 'CCTAAAGAAT TCGTGATGAA TCCCGCAAAC GCGCA 3' and SEQ ID NO: 69 5 'TGCGCGTTTG CGGGATTCAT CACGAATTCT TTAGG 3') containing a deletion of 1 base pair in the DNA of pGEX4T-BA14. A QuikChange kit (Stratagene, LaJolla, CA) is used to incorporate the deletion using the extension of the primers in the presence of nucleotides. The following temperature cycle is useful for BA-Od preparation: 1 cycle from 3 'to 96 ° C, then 1 8 cycles at 9d ° C for 30 s, 55 ° C for 1 minute and 68 ° C for 10.6 minutes . The DNA is then treated with the restriction enzyme Dpnl as described by the manufacturer. A portion of the reaction is then transformed into E. coli DHdalfa or XL1-Blue. Individual colonies of E.coli are isolated on agar plates containing selective antibiotics and cultured in LB + ampicillin medium. The DNA is isolated using a MidiPrepa kit (Qiagen). The sequence of the DNA of 5 clones is reactivated and the sequence change is confirmed. The purified protein can be used as a Rho antagonist in biological systems. To prepare the recombinant BA-Od (SEQ ID No. 3) the plasmids containing the corresponding cDNA (pGEX-4T / BA-0d) are transformed into competent bacteria E. coli strain XL-1 blue. The bacteria are cultured in L broth (1 Og / I of bacto-tryptone, dg / l of yeast extract, 10 g / l of NaCl) with ampicillin at 60 ug / ml (BMC-Roche), in a shaking incubator for 1 hour at 37 ° C, and 400 rpm. Isopropyl is added. beta. -D-thiogalactopyranoside (I PTG) (Gibco) at the final concentration of O.d mM to induce the production of recombinant protein and the culture is grown for another 6 hours at 37 ° C and 260 rpm. Bacteria pellets were obtained by centrifugation in 260 ml centrifuge bottles at 7000 rpm for 6 minutes at 4 ° C. Each pellet was resuspended in 10 ml of buffer A (60 mM Tris, pH 7.6, 60 mM NaCl, d mM MgCl2, 1 mM DTT) plus 1 mM PMSF. All the resuspended pellets are pooled and transferred to a 100 ml beaker on ice. Remaining buffer A with PMSF is added to the collected sample. The bacterial sample is sonicated 6 x 20 seconds using a Sonson 450 probe sonicator. Both the bacteria and the probe are cooled on ice for 1 minute between each sonification. The sonification is centrifuged on a Sorvall SS-34 rotor at 16,000 rpm during 12 minutes at 4 ° C to clarify the cream. The cream is transferred to fresh tubes of SS-34 and reagit at 12,000 rpm for 12 minutes at 4 ° C. Up to 20 ml of glutathione-agarose granules (Sigma) are added to the clarified lysate and placed on a plate Rotary for 2 to 3 hours. The granules are washed 4 times with buffer B (Shock absorber A, NaCl is 150 mM, without PSMF) then 2 times with buffer C (buffer B + 2.5 mM CaCl2). The final wash is poured until the granules create a thick slurry. To remove the glutartion S transferase sequence from the recombinant protein, add 20 Y of thrombin (bovine, plasminogen-free, Calbiochem), the granules are left in a rotor overnight at 4 ° C. After dissociation with thrombin granules are loaded onto an empty column of 20 ml. Approximately 20 aliquots of 1 I are collected by means of elution with PBS. The samples of each aliquot of 0.5 are spread on nitrocellulose and stained with amido black to determine the protein peak. The aliquots containing the fusion proteins are pooled and 100 microliters of p-aminobenzamidine agarose granules (Sigma) are added and allowed to mix for 45 minutes at 4 ° C. This last step removes thrombin from the recombinant protein sample . The recombinant protein is centrifuged to remove the granules and then concentrated using a Centriprep-10 concentrator (Amicon). The concentrated recombinant protein is desalted with a PD-1 0 column (Pharmacia, containing Sephadex G-25M) and ten aliquots of O.d ml are collected. A spot spotting is performed on those samples to determine the protein peak, and the appropriate aliquots are collected and sterilized by filtering and stored at -80 ° C. A protein assay (DC assay, Biorad) is used to determine the concentration of the recombinant protein. The purity of the sample is determined by SDS-PAGE and bioactivity bioassay with NG-108 cells. The products of this process may include fusion proteins such as BA-14 as described in the general example, or new fusion proteins produced by means of the cloning method having properties such as molecular weight and activity in the inactivation bioassay. of Rho, different from those of the BA-14 molecule or the control protein C3, such as BA-05. These new fusion proteins will contain the C3 sequence and will be altered at the carboxyl terminus due to the method used. Example 21 Preparation of a BA-07 fusion protein The method of example 1 can be used to prepare a BA-07 fusion protein containing the following amino acid sequence: Met Ser Arg Val Asp Leu Gln Ala Cys Asn Ala Tyr Ser Me Asn Gln 1 d 10 15 Lys Ala Tyr Ser Asn Thr Tyr Gln Glu Phe Thr Asn He Asp Gln Wing 20 26 30 Lys Wing Trp Gly Asn Wing Gln Tyr Lys Lys Tyr Gly Leu Ser Lys Ser 35 40 46 Glu Lys Glu Wing He Val Tyr Thr Lys Ser Wing Ser Glu He Asn 50 56 60 Gly Lys Leu Arg Gln Asn Lys Gly Val He Asn Gly Phe Pro Ser Asn 65 70 75 80 Leu He Lys Gln Val Glu Leu Leu Asp Lys Ser Phe Asn Lys Met Lys 85 90 95 Thr Pro Glu Asn He Met Leu Phe Arg Gly Asp Asp Pro Wing Tyr Leu 100 1 05 1 10 Gly Thr Glu Phe Gln Asn Thr Leu Leu Asn Ser Asn Gly Thr He Asn 1 15 120 125 Lys Thr Wing Phe Glu Lys Wing Lys Wing Lys Phe Leu Asn Lys Asp Arg 130 135 140 Leu Glu Tyr Gly Tyr lie Ser Thr Ser Leu Met Asn Val Ser Gln Phe 145 150 165 160 Wing Gly Arg Pro He He Thr Lys Phe Lys Val Wing Lys Gly Ser Lys 165 170 175 Wing Gly Tyr He Asp Pro Be Wing Phe Wing Gly Gln Leu Glu Met 180 185 190 Leu Leu Pro Arg His Ser Thr Tyr His He Asp Asp Met Arg Leu Ser 195 200 205 Ser Asp Gly Lys Gln He Me Thr Wing Thr Met Met Gly Thr Wing 210 21 d 220 He Asn Pro Lys Glu Phe Val Met Asn Pro Wing Asn Wing Gln Gly Arg 226 230 235 240 His Thr Pro Gly Thr Arg Leu 245 (SEQ. ID. NO: 57) Two PCR primers were designed to transfer a series of recombinant constructs (BA-05) into the pET-9a vector (Novagen, Madison, Wisconsin) to create the BA-07 protein when expressed in an expression system appropriate: the upper 5 'primer GGATCTGGTTCCGCGTCATATGTCTAGAGTCGACCTG 3' (SEQ D # 38) lower primer d 'CGCGGATCCATTAGTTCTCCTTCTTCCACTTC 3' (SEQ ID No. 39). A Bam H I site at the d 'end of SEQ ID NO. 39 is ggatccatta; the TGA is replaced by TAAT (atta, in SEQ ID NO 39). A useful program to amplify the product using Pfu polymerase consists of: 96 ° 1 cycle of 5 ', then 94 ° C 2'? 66 ° C 2 '? 70 ° C 1 0 cycles of 2', then 94 ° C 2 '? 70 ° C 30 cycles of 3 'and storage at 4 ° C. A QIAEXI I kit (Qiagen) can be used to purify a slice of agarose gel containing the desired DNA band. The insert and the vector are digested with BamHI and Ndel following the manufacturer's instructions, purified using agarose gel electrophoresis and a QIAEXI I kit (Qiagen), and incubated together overnight with T4 DNA ligase following the instructions of maker. E. coli (DHdalfa, or preferably XL1 -Blue) is transformed with the ligation mixture. The clones can be verified by means of small-scale induction and SDS-PAGE and can be ensured by means of immunodetection of the crude lysates with anti-C3 antibody. The plasmid DNA is purified and its purity can be detected. DNA sequencing (can be performed for example by means of the LiCor in which the entire strip is sequenced over the entire length of the clone). A first construct prepared in this way (pET3a-BA-.07, SEQ ID NO: 7) coincided with the theoretical DNA sequence of the pGEX / BA-Od construct with a slight change in d 'due to the cloning strategy . A second construct pET9a-BA-07 can be prepared by subcloning the insert of pET3a-BA-07 into the vector pET9a by breaking the pET3a construct with BamHI and Ndel (New England BiolAbs, Beverly MA) in accordance with the manufacturer's instructions. Plasmid DNA pET9a can be broken with the same enzymes. The DNA of the insert and the vector can be purified by means of agarose gel electrophoresis. He Nsert can be ligated into the new vector using T4 DNA ligase (New England BioLabs, Beverly MA). The ligated DNA can be transformed into DHdalfa cells and the DNA can be prepared in mini or maxi-equipment QIAGEN The clones can be characterized by restriction digestion and DNA sequencing in both directions (e.g. BioS &T, Lachina, Quebec). The DNA construct can be transformed into cells BL21 (DE3) and BL21 (DE3) / pLysS (Novagen, Madison, Wl) or another suitable expression system. Example 22 General method for taking tritiated thymidine as a measure of cell proliferation 3 H-thymidine incorporation assay The presence of microplasma of cell lines was examined and found to be negative before the start of the studies. Cell lines are obtained from the American Collection of Culture Types (ATCC) (Rockville, MD). The HEC-1 B line is cultured in minimal Eagles essential medium (E-MEM) supplemented with 10%) of fetal bovine serum (FBS) and 1% of HEPES. The Caco-2 line is grown in E-MEM supplemented with 20% FBS, 1% HEPES, 1 mM sodium pyruvate and 0.1 mmM non-essential amino acid. The SK-MEL-1 line is grown in minimal McCoy medium supplemented with 10% FBS and 1% HEPES. Volumes of 1 μl each of 2X working solution of C3.07, positive and negative controls are planted in triplicate in 96-well microtiter plates containing cells (4x1 03/100 μl), giving a final volume of 200 μl. The plates were placed in an incubator at 37 ° C with a humidity of 1 00% and 5% CO2. After 54 hours of incubation, a volume of 20 μl of tritiated thymidine (3 H-thymidine) (ICN, Montreal, Canada), containing 1.0 μCi, is added to each well. The 3H-thymidine is prepared in RPM1-1640 medium supplemented with 10% FBS. The cultures are incubated in the same conditions described above for an additional 18 hours. At the end of the incubation, the cells are harvested with an automatic cell harvester (Tomtec) and the incorporated counts per minute (cpm) of 3H-timidine are measured with a mciroplate scintillation counter (TopCount NXT, Packard). The values of the wells treated with the fusion protein BA-07 are compared to the values of the control vehicle. The data is plotted in counts per minute (cpm) on the Y axis and the dose of the fusion protein on the X axis.

Claims

CLAIMS 1. A method for preventing or inhibiting the uncontrolled proliferation and expansion or migration of metastatic neoplastic cells from a cancer in a mammal, which consists of administering to the mammal a therapeutically effective amount of a pharmaceutical composition comprising a conjugate of cell-permeable fusion protein consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues.
2. A method of preventing or inhibiting proliferation and expansion or uncontrolled migration, within a margin of resection of a host tissue near the site of removal of a tumor of a cancer in a mammal, of a metastatic neoplastic cell residing in the margin of resection, which consists in administering a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium exotransferase unit C3 botulinum, or one of its functional analogues, administration is performed directly on the surface of the resection margin or below the surface of the resection margin that remains in the mammal, that administration in a time interval prior to, or subsequently a, or prior to and subsequently to the removal or removal of the tumor r.
3. A method for preventing the growth of a malignant cell tumor in a host tissue in a mammal of a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a transport fraction. of the polypeptide cell membrane and of a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, wherein the fusion protein simultaneously prevents or inhibits at least two of the migration of the malignant cells, the proliferation of the cells malignant, angiogenesis or formation of tubular structure or growth of the capillary network near the malignant cell and the secretion of an active metalloproteinase of the malignant cell. 4. A method for preventing growth within a resection range of a host tissue near a site of removal or removal of a first tumor from a cancer in a mammal, of a second tumor comprising a residual cancer tumor cell, the method consists of administering a therapeutically effective amount of a pharmaceutical composition containing a cell-permeable fusion protein conjugate consisting of a polypeptide cell membrane transport fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues, the administration is performed directly on the surface of the resection margin or below the surface of the resection margin that remains in the mammal, that administration in a time interval prior to, subsequent to or prior to subsequent to the removal or removal of the first tumor, where the fusion protein simultaneously prevents or inhibits at least two of the: migration of residual tumor cells, proliferation of residual tumor cells, angiogenesis or formation of tubular structure or growth of the capillary network near the residual tumor cell and the secretion of a active metalloproteinase of the residual tumor cell. 5. The method of claim 1, wherein the fusion protein conjugate has SEQ ID NO. 4. The method of claim 1, wherein the cancer is selected from the group consisting of breast, brain, colon, skin, lung and liver cancer. The method of claim 1, wherein the cancer is a brain tumor selected from the group consisting of equal tumors, neuronal tumors, tumors of the pineal gland, tumors of the meninges, tumors of the nerve covers, lymphomas, deformative tumors, and metastatic tumors located in the brain and derived from tumors of the lung, breast, melanoma, lung, and gastrointestinal tract. The method of claim 1, wherein the cancer is a brain tumor selected from the group consisting of anaplastic astrocytoma, gioblastoma multiforme, pilocytic astrocytoma, oligodendroglioma, ependymoma, myxopapillary ependymoma, subependymoma, choroidal plexus papilloma, neuroblastoma, ganglioneuroblastoma, ganglioneuroma and medulloblastoma, pineoblastoma and pineocitoma, meningioma, meningeal hermangiopericytoma, meningeal sarcoma, schwannoma (neurolemone) and neurofibroma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, primary and secondary subtypes of Hodgkin's lymphoma, craniopharyngioma, epidermoid cysts, dermoid cysts and cysts colloids The method of claim 1, wherein the therapeutically effective amount is from about 0.001 microgram per cubic to about 50 microgram per kilogram of tissue. The method of claim 1, wherein the therapeutically effective amount is from about 0.001 microgram of fusion protein per cubic centimeter (cc) of tissue to about 100 microgram per cubic centimeter of tissue. eleven . The method of claim 1, wherein the therapeutically effective amount is from about 1 microgram per millimeter to about 10 micrograms per millimeter to about 50 micrograms per millimeter. The method of claim 1, wherein the administration is performed by injection, topical application or by implant. The method of claim 1, wherein the. administration is selected from the group consisting of intra-articular, intraocular, intranasal, intraneural, intradermal, intraosteal, sublingual, oral, topical, intravesical, intrathecal, intravenous, intraperitoneal, intracranial, intramuscular, subcutaneous, inhalation, atomization and inhalation application directly in a tumor, application directly at the site of the disease, application directly on or within the remaining margins after resection of a tumor, enterally, enterally together with a gastroscopic procedure, and ECRP. 14. The method of claim 1, wherein the transposer portion of a polypeptide cell membrane contains a peptide that contains about 5 to 50 amino acids. 15. The method of claim 1, wherein the Closiridium boiulinum C3 exoirransferase unit comprises the amino acid sequence designated by the fusion proverin sequence BA-05. 16. The method of claim 1, wherein the functional analog comprises a proiein which has activity in the range of 50% to 500% of that of the exoirransferase unit of Closlridium boíulinum C3. 17. The method of claim 1, wherein the pharmaceutical composition comprises a pharmaceu- tically acceptable portion. 18. The method of claim 1, wherein the pharmaceutical composition comprises a pharmaceutically acceptable portion selected from the group consisting of poly (ethylene-co-vinyl) acetylene, PVA, partially hydrolyzed poly (ethylene-co-vinyl) acetylene, poly (ethylene-co-vinyl acetyl-co-vinyl alcohol), a re-cycled poly (ethylene-co-vinyl) acetylene, a poly (ethylene-co-vinyl) acetic acid, partially hydrolyzed relicic, a poly (ethylene-co- vinyl acetyl-co-vinyl alcohol), poly-D, L-lactic acid, poly-L-lactic acid, polyglycolic acid, PGA, copolymers of lactic acid and glycolic acid, polycaprolactone, polyvalerolacíone, poly (anhydrides), copolymers of polycaprolactone with polyethylene glycol, copolymer of polylactic acid with polyethylene glycol, polyethylene glycol; and its combinations and mixtures. 9. The method of claim 1, wherein the pharmaceutical composition comprises a pharmaceutically acceptable portion selected with a pharmaceutically acceptable portion that consists of an aqueous gel, an aqueous product, a polymeric agent, a reagent agent, and a combination of the ingredients. same. The method of claim 1, wherein the pharmaceutical composition comprises a pharmaceutically acceptable portion that consists of a maize. twenty-one . The method of claim 1, wherein the pharmaceutical composition has a pharmaceutically acceptable contaminant consisting of water, a pharmaceutically acceptable amorigating salt, a pharmaceutically acceptable amorphous solution, a pharmaceutically acceptable amphiphene, ascorbic acid, one or more pharmaceutically acceptable polypeptides of low molecular weight, a peptide with from 2 to 10 amino acid residues, one or more pharmaceutically acceptable proteins, one or more pharmaceutically acceptable amino acids, an amino acid essential for humans, one or more pharmaceutically acceptable carbohydrates, one or more carbohydrate derivatives pharmaceutically acceptable, a non-reducing sugar, glucose, sucrose, sorbifol, sugar, mannitol, maliodextrin, dexyrin, cyclodexirin, a pharmaceutically acceptable drug agent, EDTA, DTPA, a standard formula for a on meíálico divalenie, a chelating agent for an ionic meíálico írivaleníe, gluíaíion, a non-specific pharmaceutically acceptable serum albumin, and its combinations. 22. The method of claim 1, wherein the pharmaceutical composition is sterile. 23. The method of claim 1, wherein the pharmaceutical composition is sterilizable. 24. The method of claim 1, wherein the pharmaceutical composition is sterilized. 26. The method of claim 1, wherein the pharmaceutical composition is in a bottle in a unit dose amount or in a quantity which is a multiple number of a unit dosage amount. 26. The method of claim 1, wherein the pharmaceutical composition is dry. 27. The method of claim 1, wherein the pharmaceutical composition comprises a dehydrated maize. 28. The method of claim 1, wherein the pharmaceutical composition has a pharmaceutically acceptable portion. 29. The method of claim 1, wherein the pharmaceutical composition comprises a melting proiein in a lyophilized maize. 30. Use of a pharmaceutical composition comprising a cell-permeating fusion proiein conjugate consisting of a transferase fraction of the polypeptide cell membrane and a Clostridium boiulinum C3 exoransferase unit, or one of its functional analogues to prevent or inhibit the unlevelled proliferation and expansion or migration of neoplastic meiaspic cells from a cancer in a mammal. 31 Use of a pharmaceutical composition comprising a cell-permeating fusion proiein conjugate consisting of a transferase fraction of the polypeptide cell membrane and of an I exoirransferase unit of Closíridium boíulinum C3, or one of its functional analogues for the prevention or inhibition of proliferation and expansion or disambiguated migration, within a resection margin of an amphiirion cell close to the site of removal of a tumor of a cancer in a mammal, of a meiaspical neoplastic cell residing in the margin of resection. 32. Use of a pharmaceutical composition comprising a cell-permeable fusion proiein conjugate consisting of a transferase fraction of the polypeptide cell membrane and an exoirransferase unit of Clostridium bolulinum C3, or one of its functional analogues to prevent the growth of a malignant cell tumor in a mammalian amphyric cell, where the fusion protein simulinely prevents or inhibits at least two of the migration of the malignant cells, the proliferation of malignant cells, angiogenesis or formation of lubricious growth or growth of the capillary network near the malignant cell and the secretion of an active metalloproteinase of the malignant cell. 33. Use of a pharmaceutical composition comprising a cell-permeating melting proiein conjugate consisting of a transferase fraction of the polypeptide cell membrane and an exoirransferase unit of Closíridium bofulinum C3, or one of its functional analogues to prevent growth in a resection margin of a host tissue close to a site of removal or removal of a first tumor of a cancer in a mammal, of a second tumor comprising a residual cancer cell of cancer, in which the prolein of Simultaneous fusion prevents or inhibits at least two of the following: migration of residual tissue cells, proliferation of residual tissue cells, angiogenesis or fibrous esophagus formation or growth of the capillary network near the residual tissue cell and secretion of a meifaloproininase activates the residual tissue cell. 34. The use according to one of claims 30 to 33, wherein the fusion propion conjugate is SEQ ID NO.
4. The use according to one of claims 30, 31 or 33, in which the cancer is selected from the group consisting of breast, brain, colon, skin, lung and hepatic cancer. 36. The use according to claim 3d, wherein the cancer is a brain tumor selected from the group consisting of glial tumors, neuronal tumors, pineal gland tumors, meningeal tumors, tumors of the nerve coverings, lymphomas, Deforming tumors, and meiasíáíicos tumors located in the brain and derived from tumors of the lung, breast, melanoma, lung, and gasíroiniesíinal tract. 37. The use according to claim 36, wherein the cancer is a cerebral tumor selected from the group consisting of anaplastic asyrocytosis, mulifiform gioblasíoma, pilocyclic asyrocytosis, oligodendroglioma, ependymoma, myxopapillary ependymoma, subependymoma, papilloma of the choroid plexus, neuroblastoma, ganglioneuroblasíoma, ganglioneuroma and medulloblasíoma, pinooblasíoma and píneocifoma, meningioma, meningeal hermangiopericiíoma, meningeal sarcoma, schwannoma (neurolemona) and neurofibroma, Hodgkin's lymphoma, non Hodgkin's lymphoma, primary and secondary subtypes of Hodgkin's lymphoma, craniofaringioma, epidermoid cysts, dermoid cysts and you wanted colloids. 38. The use according to one of claims 30 to 37, wherein the pharmaceutical composition is formulated for a dosage form of about 0.001 microgram per gram to about 50 microgram per gram of tissue. 39. The use according to one of claims 30 to 37, wherein the pharmaceutical composition is formulated for a dosage form of approximately 0.001 microgram of melting proiein per cubic centimeter (cc) of approximately 100 micrograms per centimeter. cubic of ice. 40. The use according to one of claims 30 to 37, wherein the pharmaceutical composition is formulated for a dosage form of about 1 microgram per milliliter to about 10 micrograms per millimeter to about 50 micrograms per millimeter. 41 The use according to one of claims 30 to 40, in which the pharmaceutical composition is formulated for injection, topical application or implant. 42. The use according to one of claims 30 to 40, wherein the pharmaceutical composition is formulated for an application mode selected from the group consisting of intra-articular, in-radicular, intranasal, intraneural, intra-ralmal, iniroraleal, sublingual, oral application. Itopic, intravesical, intraial, intravenous, inirapraeal, infracranial, inframuscular, subcutaneous, inhalation, inhalation, inhalation, direct application in a tumor, direct application in the disease, direct application to or within the margins of the resins after resection of a tumor, initially, in June, with a gasoscopic procedure, and ECRP. 43. The use according to one of claims 30 to 42, wherein the transporphic portion of the polypeptide cell membrane confers a peptide containing from about 5 to 60 amino acids. 44. The use according to one of claims 30 to 42, wherein the Clostridium botulinum C3 exoirransferase unit comprises the amino acid sequence designated by the SEQ ID NO: 4 sequence of the BA-Od fusion protein. 46. The use according to one of claims 30 to 44, wherein the functional analog comprises a protein having activity in the range of 60% to 500% of that of the exotransferase unit of Closíridium boíulinum C3. 46. The use according to one of claims 30 to 45, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier. 47. The use according to one of claim 46, wherein the pharmaceutically acceptable carrier is selected from the group consisting of acetylated poly (ethylene-co-vinyl), PVA, partially poly (ethylene-co-vinyl) acetate. hydrolyzed, poly (ethylene-co-vinyl acetyl-co-vinyl alcohol), a re-cycled poly (ethylene-co-vinyl) acetyl, a poly (ethylene-co-vinyl) acetyl, partially hydrolyzed re-cyclic, a poly (ethylene-co -vinyl acetamide-co-vinyl alcohol) crosslinked, poly-D, L-lactic acid, poly-L-lactic acid, polyglycolic acid, PGA, lactic acid and glycolic acid copolymers, polycaprolactone, polyvalerylactone, poly (anhydrides), copolymers of polycaprolactone with polyethylene glycol, copolymer of polylactic acid with polyethylene glycol, polyethylene glycol; and its combinations and mixtures. 48. The use according to one of claim 46, wherein the pharmaceutically acceptable carrier consists of an aqueous gelatin, an aqueous protein, a polymeric portion, a crosslinking agent, and a combination thereof. 49. The use according to one of claim 46, wherein the pharmaceutically acceptable carrier consists of a matrix. 50. The use according to one of claim 46, wherein the pharmaceutically acceptable carrier consists of water, a pharmaceutically acceptable amorphous salt, a pharmaceutically acceptable buffer, a pharmaceutically acceptable antioxidant, ascorbic acid, one or more pharmaceutically acceptable polypeptides. of low molecular weight, a peptide with from about 2 to 10 amino acid residues, one or more pharmaceutically acceptable proies, one or more pharmaceutically acceptable amino acids, an amino acid essential for human, one or more pharmaceutically acceptable carbohydrates, one or more derivatives derived from pharmaceutically acceptable carbohydrates, a non-reducing sugar, glucose, sucrose, sorbilol, trehalose, mannitol, maltodexirin, dexyrin, cyclodextrin, a pharmaceutically acceptable chelating agent, EDTA, DTPA, a chelating agent for a divalent metal ion, a chelating agent for a frivalenic metallic ion, gluiaion, a pharmaceutically acceptable non-specific serum albumin, and combinations thereof. 51 The use according to one of claims 30 to 50, wherein the pharmaceutical composition is sterile. 52. The use according to one of claims 30 to 50, the pharmaceutical composition is sterilizable. 53. The use according to one of claims 30 to 60, wherein the pharmaceutical composition is sterilized. 64. The use according to one of claims 30 to 63, wherein the pharmaceutical composition is in a bottle in a unit dose quantity or in a quantity which is a whole multiple of a unit dosage amount. dd. The use according to one of claims 30 to 54, in which the pharmaceutical composition is dry. 66. The use according to one of claims 30 to 54, wherein the pharmaceutical composition comprises a dehydrated matrix. 57. The use according to one of claims 30 to 54, wherein the pharmaceutical composition consists of a melting prophene in a lyophilized maize. 58. Use of a pharmaceutical composition comprising a cell-permeable fusion protein conjugate consisting of an ransporic fraction of the polypeptide cell membrane and an exofransferase unit of Closíridium boíulinum C3, or one of its functional analogs for preparing a medicament to prevent or inhibit the uncontrolled proliferation and expansion or migration of metastatic neoplastic cells from a cancer in a mammal. 59. Use of a pharmaceutical composition comprising a cell-permeable fusion proiein conjugate consisting of a polypeptide cell membrane transparty fraction and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues for preparation a drug for the prevention or inhibition of uncontrolled proliferation and expansion or migration, without a margin of resection of a host tissue close to the site of removal of a cancer tumor in a mammal, of a meiasitic neoplastic cell residing in the margin of resection. 60. Use of a pharmaceutical composition comprising a cell-permeable fusion protein conjugate consisting of a transpore fraction of the polypeptide cell membrane and a Clostridium botulinum C3 exotransferase unit, or one of its functional analogues for preparation a medicament for preventing the growth of a malignant cell tumor in a host tissue in a mammal, wherein the fusion protein simulinely prevents or inhibits at least two of the migration of the malignant cells, the proliferation of the malignant cells, the angiogenesis or the formation of a tubular growth or growth of the capillary network near the malignant cell and the secretion of an acíiva mefaloproteinasa of the malignant cell. 61 Use of a pharmaceutical composition comprising a cell-permeable fusion protein conjugate consisting of a transferase fraction of the polypeptide cell membrane and an exoirransferase unit of Closíridium boíulinum C3, or one of its functional analogues for preparing a medicament to prevent the growth of a resection margin of an amphiphilic entity close to a site of removal or removal of a first tumor of a cancer in a mammal, of a second tumor comprising a residual tumor cell of cancer, in which the fusion protein simulsimally prevents or inhibits at least two of the following: migration of residual tissue cells, proliferation of residual tissue cells, angiogenesis or formation of tubule leakage or growth of the capillary network near the residual tissue cell and the secretion of a meíaloproininasa acíiva of the cell íum residual oral 62. Use according to one of claims 58 to 61, wherein the fusion protein conjugate has SEQ I D NO. 4. 63. The use according to one of claims 58, 59 or 61, in which the cancer is selected from the group consists of breast, brain, colon, skin, lung and hepatic cancer. 64. The use according to claim 63, wherein the cancer is a brain tumor selected from the group consisting of glial tumors, neuronal tumors, pineal gland tumors, meningeal tumors, tumors of the nerve covers, lymphomas, Deformative tumors, and meiastatic tumors located in the brain and derived from tumors of the lung, breast, melanoma, lung, and gas. 65. The use according to claim 63, wherein the cancer is a brain tumor selected from the group consisting of anaplastic asycytoma, muliform gioblastoma, pilocytic astrocytoma, oligodendroglioma, ependymoma, myxopapillary ependymoma, subependymoma, papilloma of the choroid plexus, neuroblastoma, ganglioneuroblastoma, ganglioneuroma and medulloblasima, pineoblastoma and pineocifoma, meningioma, meningeal hermangiopericytoma, meningeal sarcoma, schwannoma (neurolemone) and neurofibroma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, primary and secondary subtypes of Hodgkin's lymphoma, craniopharyngioma, epidermoid cysts, dermoid cysts and colloid cysts. 66. The use according to one of claims 58 to 65, wherein the pharmaceutical composition is formulated for a dosage form of about 0.001 microgram per gram to about 50 micrograms per gram of tissue. 67. The use according to one of claims 58 to 65, wherein the pharmaceutical composition is formulated for a dosage form of about 0.001 microgram of fusion protein per cubic centimeter (cc) of tissue at approximately 100 micrograms per centimeter. cubic of ice. 68. The use according to one of claims 58 to 65, wherein the pharmaceutical composition is formulated for a dosage form of about 1 microgram per millimeter to about 10 micrograms per milliliter to about 50 micrograms per millimeter. 69. The use according to one of claims 58 to 68, wherein the pharmaceutical composition is formulated for injection, topical application or implant. 70. The use according to one of claim 1 or any one of claims 58 to 68, wherein the pharmaceutical composition is formulated for an application mode selected from the group consisting of intraocular, infra-ocular application., iníranasal, inlraneural, iníradérmica, intraosíeal, sublingual, oral, lópica, iníravesical, intraíecal, intravenous, intraperiíoneal, intracranial, nframuscular, subcutaneous, inhalation, atomization and inhalation, application directly in a tumor, application direcmente in the siíío of the disease , direct application in or outside the margins resitantes after the resection of a tumor, generally, in June with a gastroscopic procedure, and ECRP. 71 The use according to one of claims 58 to 70, wherein the polypeptide cell membrane delivery portion contains a peptide containing from about 5 to 60 amino acids. 72. The use according to one of claims 68 to 71, wherein the exoirransferase unit of Closíridium boíulínum C3 comprises the amino acid sequence designated by the sequence SEQ ID NO: 4 of the fusion protein BA-05. 73. The use according to one of claims 58 to 72, wherein the functional analog comprises a proiein which has activity in the range of 50% to 500% of that of the exoirransferase unit of Clostridium botulinum C3. 74. The use according to one of claims 68 to 73, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier. 76. The use according to one of claim 74, wherein the pharmaceutically acceptable carrier is selected from the group consisting of poly (ethylene-co-vinyl) acetylate, PVA, partially poly (ethylene-co-vinyl) acetylate. hydrolyzate, poly (ethylene-co-vinyl acetyl-co-vinyl alcohol), a re-cyclic poly (ethylene-co-vinyl) acrylate, a poly (ethylene-co-vinyl) partially hydrolyzed hydrolyzed re-cyclic, a poly (ethylene- co-vinyl acetyl-co-vinyl alcohol) reiciculate, poly-D, L-lactic acid, poly-L-lactic acid, polyglycolic acid, PGA, copolymers of lactic acid and glycolic acid, polycaprolactone, polyvalerylacphone, poly (anhydrides), copolymers of polycaprolactone with polyethylene glycol, copolymer of polylactic acid with polyethylene glycol, polyethylene glycol; and its combinations and mixtures. 76. The use according to one of claim 74, wherein the pharmaceutically acceptable portion is consisted of an aqueous gelaine, an aqueous proiein, a polymeric portion, a re-binding agent, and a combination thereof. 77. The use according to one of claim 74, wherein the pharmaceutically acceptable carrier consists of a maize. 78. The use according to claim 74, wherein the pharmaceutically acceptable portion consists of water, a pharmaceutically acceptable amorphous salt, a pharmaceutically acceptable buffer, a pharmaceutically acceptable antioxidant, ascorbic acid, one or more pharmaceutically acceptable polypeptides. of low molecular weight, a peptide with from about 2 to 10 amino acid residues, one or more pharmaceutically acceptable propins, one or more pharmaceutically acceptable amino acids, an amino acid essential for human, one or more pharmaceutically acceptable carbohydrates, one or more materials derived from pharmaceutically acceptable carbohydrates, a nonreducing sugar, glucose, sucrose, sorbitol, trehalose, manifol, maltodextrin, dextrin, cyclodexirin, a pharmaceutically acceptable pharmaceutically acceptable agent, EDTA, DTPA, a chelating agent for a divalent melalic ion, a chelating agent for an iridium meíálico ion, gluíafión, a pharmaceutically acceptable non-specific serum albumin, and combinations thereof. 79. The use according to one of claims 58 to 78, wherein the pharmaceutical composition is sterile. 80. The use according to one of claims 58 to 78, the pharmaceutical composition is sterilizable. 81 The use according to one of claims 58 to 78, wherein the pharmaceutical composition is sterilized. 82. The use according to one of claims 68 to 81, wherein the pharmaceutical composition is in a bottle in a unit dose quantity or in a quantity which is an integer multiple of a unit dosage amount. 83. The use according to one of claims 58 to 82, wherein the pharmaceutical composition is dry. 84. The use according to one of claims 58 to 82, wherein the pharmaceutical composition comprises a dehydrated maize. 85. The use according to one of claims 58 to 82, wherein the pharmaceutical composition comprises a melting proiein in a lyophilized maize.