MXPA06003211A - Adrenergic receptor snp for improved milking characteristics - Google Patents

Abstract

Disclosed herein is a method for screening for the allele associated with a desired SCS phenotype, which comprises:obtaining a DNA sample from a bull to be tested for the desired SCS phenotype;and detecting the presence of an adenine at position 11 in a gene encoding a bovine beta2-adrenoreceptor. Also disclosed is a milking attribute PCR-RFLP kit containing a pair of primers which flank the 11th nucleotide position of the bovine beta2-adrenoreceptor gene, and a restriction enzyme specific for the CCCGGG site, which can be SmaI.

Description

SNP ADRENERGIC RECEPTOR TO IMPROVE MILKING CHARACTERISTICS FIELD OF THE INVENTION The present invention relates, in general, to the field of molecular biology, human and bovine genetics, and desirable milking characteristics. In particular this invention provides a method for using genetics to predict the milking characteristics of cows. BACKGROUND OF THE INVENTION Several publications or patents are referred to in the development of this application to describe the prior state of the technique to which the invention pertains. Each of these publications or patents is incorporated herein by reference. Full citations of scientific publications are set forth in the text or at the end of the specification. Domestic animals are bred to improve the useful attributes of animals. For cows, milking characteristics are a very useful attribute, both milk volume and milking flow rate. Many dairy cows are artificially inseminated using semen1 from stallions acquired from companies committed to selling improved quality genetic characteristics for milking cows. However, while it is possible to measure Ref.: 170911 the overall statistical average of the milking characteristics of the daughters of a particular stallion, it is not yet possible to predict any degree of improvement in the milking characteristics of a particular offspring. procreated by the reproduction of a cow with a particular bull. In order to make a more accurate prediction of the characteristics of a particular daughter, it is necessary to better understand the genetics of milking characteristics. It is known that some milking characteristics are linked to other traits. A relationship between adrenergic receptor concentrations and milking capacity in first-time cows has been elucidated by Roets, et al. ("Relationship between milkability and adrenoceptor concentrations in teat tissue in primiparous co s", J Dairy Sci 69 (12) .2131-3131, 1986). After, Roets et al. ("Relationship between numbers of alpha2- and beta2-adrenoceptors in teat tissue and blood cells and milkability of primiparous cows", J Dairy Sci 72 (12): 3304-33-13, 1989) reported on numbers of adrenergic receptors -alpha2 and -beta2 in the blood cells and nipple tissue and the milking capacity of first-time cows. Subsequently, Roets et al. ("Relationship between numbers of alpha2- and beta2-adrenoceptors on blood cells of bulls and milkability of their daughters", J Dairy Sci, 62 567-575, 1995) analyzed the numbers of adrenergic receptors-beta2 and -alpha2 in cells of the blood of bulls and the milking capacity of their daughters. Additionally, Blum et al.

("Catecholamines, oxytocen and milk removal in dairy cows", J Dairy Res, 56 (2): 167-177, 1989) reported that treatment with phentolamine (an alpha-adrenergic blocker) and isoproterenol (a beta-adrenergic receptor agonist) facilitated each one the extraction of the milk. Brown et al. ("Relationship of milking rate to somatic cell count", J Dairy Sci, 69 (3): 850-854, 1986) promoted the possibility that the milking speed was correlated with both the cell count - somatic (SCS, for its acronym in English) and mastitis.

Many studies have established correlations between mastitis and SCS (see, for example, MacMillan et al., "Associations between dry cow therapy, clinical mastitis, and somatic cell count score with milk and fat production in New Zealand dairy herds", J Dairy Sci, 66 (2): 259-265, 1983; Reneau, "Effective use of dairy herd improvement somatic cell counts in mastitis control", J Dairy Sci, 69 (6): 1708-1720, 1986, and McClelland, " A comparison of objective and subject measures of milking speed on Canadian Holstein-Friesians ", University of 3uelph, 1983). In addition, a positive correlation between milking speed and SCS was confirmed by Boettcher et al. ("Development of an udder health index for sire selection based on somatic cell score, udder conformation, and milking speed", J Dairy Sci, 81 (4) .1157-1168, 1998). The DNA sequence in, and around, the bovine adrenergic receptor-beta2 gene (ADRB2) was found in the public genome database (acquisition number Z86037; Einspanier et al., "Expression of the beta2 adrenergic receptor in the cattle", direct request to the Genetic Bank, acquisition No. Z86037, 1997 and AF331034; Schimpf et al., "Genetic mapping of the ADRB2 gene on cattle chromosome 7", Anim. Genet 32 (6): 390, 2001). These sequences included -the ADRB2 coding region (1257 bases included from the ATG start codon to the TAA stop codon), as well as the 233 5 'end bases of the ATG start codon and the 550 base 3' end of the codon of TAA termination. What is required is a way to determine which bulls will produce cows with improved milking capacity and a method to improve the results of a breeding program for milking capacity. SUMMARY OF THE INVENTION This document describes a method of reproducing cows to improve the milking characteristics that includes the step of selecting the genotype of the parents of the cow for the allele associated with a desired SCS phenotype. The method comprises the steps of obtaining a DNA sample from a bull to be tested for the desired SCS phenotype; and detecting the presence of adenine at position 11 in a gene encoding a bovine adrenergic-beta2 receptor. The method can be executed by direct sequence, first extension, restriction fragment length polymorphism, and allele-specific hybridization. In another embodiment, a method identifies a bull whose daughters cows have a short duration of milking. This method comprises the steps of obtaining a DNA sample from a bull; combining the DNA with a pair of PCR probes comprising the sequences SEQ IDs of 1 and 2- or SEQ IDs 3 and 4; incubate the DNA under conditions that allow DNA links by the PCR probes to produce DNA amplimers; isolate the DNA amplimers; combining the DNA amplimers with a restriction enzyme specific for CCCGGG for a time sufficient to produce a mixture of DNA fragments of the amplimers comprising CCCGGG; apply the mixture of DNA fragments to a gel and allow the migration of the components of the mixture for a sufficient time so that they separate; and observe the DNA sizes on the gel, with the longer fragments that are correlated with the genotype A and with the best SCS phenotype, and the smaller fragments that are associated with the genotype C and the less desirable SCS phenotype.

In another embodiment a PCR-RFLP milking attribute kit contains a pair of primers which flank the position of the nucleotide key of the bovine adrenergic-beta2 receptor gene, and a restriction enzyme specific for the CCCGGG site. The restriction enzyme can be Smal. The primer pairs are selected from pair 1 (SEQ ID Nos. 1 and 2) or pair 2 (SEQ ID Nos. 3 and 4). Other objects, features and advantages of the present invention will become apparent to a person skilled in the art after reviewing the specification and claims. DETAILED DESCRIPTION OF THE INVENTION In this description it is described that the genetic differences in the allele for the adrenergic receptor-beta2 gene (ADR2) are associated with the milking characteristics of milking cows. This allows the use of genetic tools and analysis in the reproduction of cows to begin to accurately predict the milking characteristics of the daughters of specific bulls raised with specific maternal cows. The work described begins with the proposal that the polymorphism of the DNA sequence in and around the adrenergic receptor-beta2 (ADRB2) bovine can cause or be associated with the genes that cause the associations observed. First, bovine ADRB2 was subcloned and sequenced, extending the region of the known sequence more than was previously publicly available. The sequence obtained through this work, which was not previously included in the public domain, includes 876 additional bases 5 'end of those described above. These bases are a total of 1099 which are 5 'for the ATG start codon. A further number of 695 bases 3 'end of the bases reported previously were also sequenced. These bases include a total of 1245 bases 3 'for the TAA termination codon. With this information at hand, we were able to design oligonucleotide primers to be used to amplify and execute locus-specific sequences of the expanded regions of the genomic DNA of the bovine ADRB2 gene. These primers were used to amplify the genomic DNA of 24 Holstein dairy cows and 12 Brown Swiss cows. After obtaining the comparative genomic sequence, the sequence was analyzed using the polyPhred computer program (Washington University, St. Louis, MO) and a sequence of the Single Nucleotide Polymorphism (SNP) at position 11, inclusive of the ATG start codon (hereinafter referred to as "A11C"). The published sequence indicates the presence of a cytosine nucleotide (C). The inventor discovered a variant allele with an adenine nucleotide (A) in that position. Substitution of A by C at position 11 of the nucleotide altered the amino acid sequence of the ADRB2 protein by replacing a proline with a histidine at the 4-position of the amino acid of the protein. A restriction fragment length polymorphism-polymerase chain reaction (PCR-RFLP) assay capable of detecting the presence of nucleotide (s) A and / or C was subsequently designed and validated. the AllC locus. This assay is based on the presence or absence of the smallest restriction enzyme recognition site (CCCGGG) in the DNA fragments which have been amplified by one of two primer pairs. The allele A in the AllC locus changes this sequence to CACGGG, which is not recognized, therefore it is not digested by smal and consequently it was identified as a heavier nucleotide in the PCR-RFLP test. It was found that this polymorphism is associated with milking characteristics. In particular, allele A in the AllC locus is associated with a somatic cell count (SMS) higher and therefore with a faster milking speed. This makes it possible to raise dairy cattle to increase the proportion of herds that have the allele A in the AllC locus, to improve the overall milking speed of the herd. The A allele is effective in both heterozygous and homozygous conditions to improve the performance of the animal. "Polymorphism" generally refers to the ability of an organism or gene to occur in two or more different ways. In particular for the purposes of the invention, "Polymorphism" refers to two or more different forms of the same gene. "Single Nucleotide Polymorphism" or "SNP" refers to a polymorphism that results from a difference in a single nucleotide. A "Restriction Enzyme" refers to a -endonuclease which contains- the double-stranded DNA in a specific nucleotide sequence and then, if both strands of the DNA lack the appropriate modification in that sequence (including but not limited to methylation), the DNA is divided either in the recognition sequence or in another site in the DNA molecule. Restriction enzymes are denoted by abbreviations of three letters followed by a designation of type and / or a Roman numeral distinguishing different enzymes of the same species or type. The recognition sequences are written from 5 'to 3' for one strand only. Examples of restriction enzymes include Smal, BamHi, BC1I, EcoRI, HindIII, and Xbal. The term "Allele" refers to any one or more alternative forms of a given gene or segment of DNA; both or all alleles of a given gene are concerned with the same trait or characteristic, but the product or function coded for / by a particular allele differs qualitatively and / or quantitatively from that coding by / for other alleles of that gene. In a diploid cell or organism the members of an allelic pair (in this case, the two alleles of a given gene) occupy corresponding positions (loci) on a pair of homologous chromosomes; If these alleles are genetically identical, the cell or organism will be the homozygote. If the alleles are genetically different, the cell or organism will be the heterozygote with respect to the particular gene. .-_ - -. The polynucleotides of the present invention can be prepared by two general methods: (1) Suitable nucleotides can be synthesized from triphosphates, or (2) can be isolated from biological sources. Both methods use protocols well known in the art. The availability of the nucleotide sequence information allows the preparation of an isolated nucleic acid molecule of the invention by oligonucleotide synthesis. Synthetic oligonucleotides can be prepared by the phosphoramidite method employed in the Applied Biosystems 37A DNA Synthesizer or similar devices. The resulting construct can be purified according to methods known in the art, such as high performance liquid chromatography (HPLC). In this way the complementary segments produced can be hybridized so that each segment possesses a cohesive term appropriate for the coupling of an adjacent segment. Adjacent segments can be linked by a hybridized cohesion term in the presence of DNA ligase to construct a full-length double-stranded molecule. A synthetic DNA molecule constructed in this way can then be cloned and expanded into an appropriate vector. The invention will be better understood when considering the following examples that are not a limitation. Unless otherwise specified, general cloning procedures are used, such as those established in Sambrook et al., MOLECULAR CLONING, Cold Spring Harbor Laboratory (1989) or Ausubel et al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons (2001). Example 1. The valuation of mRNA levels in leukocytes of cows with fast milking speeds vs. slow. Eight animals were selected with respect to their milking duration and were grouped as slow or fast. For the initial determinations, the milking animals were numbered with 90, 264, 279 and 321. The fast milking animals were numbered with 272, 273, 281 and 289. Their blood (approximately 15 mL) was collected in Vacutainer tubes filled with EDTA (BD , Franklin Lakes, NJ). The known sequences of NCBI were used along with those of the "Oligo" program to designate specific primer sets for GAPDH, beta2-adrenergic receptors, -betal, -alpha2, and beta-arrestin. From the blood samples, the RNA was isolated using the Rneasy RNA isolation protocol (Qiagen, Valencia, CA). A total blood volume was mixed with 5 volumes of erythrocyte lysis buffer. The mixture was incubated on ice, and during the incubation was vortexed briefly twice. The mixture was then centrifuged at 400 g for 10 minutes at 4 ° C. The supernatant was removed and the pellet of leukocyte stored. The leukocyte pellet was added with more EL buffer and vortexed to suspend the leukocytes again. The mixture was centrifuged again, after the supernatant was removed. The leukocyte pellet was released by shaking the tube. The RLT buffer solution (Qiagen) (with 10 μl-mercaptoethanol added per 1 ml of buffer) was added to the leukocytes; for an initial blood volume of 4.0 ml or less, 2.0 ml was added; and for a larger volume of blood, 4.0 ml was added. Then the mixture was homogenized until the sample was homogenized. An equal volume of 70% alcohol was added to the homogenated lysate and vigorously stirred. Finally, the sample, which includes any precipitate that could have formed, was applied to a Rneasy midi rotation column placed in a 15 ml centrifuge tube and centrifuged for 3000 to 5000 g for 5 min. For samples exceeding 4.0 ml, the extra sample was applied successively to the same column and the continuous-flow discarded. After the continuous flow has been discarded, 4.0 ml of RW1 buffer was added to the RNeasy column and centrifuged at 3000-5000 for 5 min. to wash the column. The Continuous Flow was discarded. Subsequently, 2.5 ml of RPE buffer solution (diluted with 4 volumes of ethanol (96-100%)) was added to the column which was again centrifuged at 3000-5000 for 2 min. Another 2.5 ml quantity of RPE buffer was added to the column which was centrifuged at 3000-5000 for 5 min. to dry the column of the column-rotation. The RNA was eluted from the column by adding 150 μl or 250 μl of RNase-free water to the column, which was left to stand for 1 min and then centrifuged at 3000-5000 g for 3 min. A second volume of free water of RNase was added to the column and stopped spinning. Then the RNA was precipitated in salt according to the manufacturer's protocol. Subsequently the RNA was treated with DNA-free DNase to extract trace levels of DNA, in accordance with the manufacturer's protocol (Ambion, Austin, TX). With the RNA sample already purified as described above, 0.1 volume of 10X DNase I buffer solution and 1 μl of DNase I (2 units) were added to the RNA, the solution was mixed little by little and incubated at 37 ° C for 20 minutes. -30 min. The reagent of In DNase activation was resuspended by rapid agitation or vortexing. From that tube, most of 0.1 volume or 5 μl was added to the sample and well mixed. The tube was incubated for 2 min. at room temperature. Then the tube was centrifuged at 10,000 g for about 1 min. to granulate the DNase activation reagent. A spectrophotometry was then used to determine the RNA concentration, and 1 μg of RNA was loaded onto a 1% agarose gel using etidium bromide to ensure quality. Following the manufacturer's protocol, RNA cDNA templates were made using Omniscript (Qiagen) for a Real Time PCR analysis. The Omniscript 10X RT buffer solution, the dNTP mix and the RNase-free water were first defrosted and mixed by vortex. The Qiagen RNase inhibitor was diluted with a final concentration of 10 units / μl in RT lx buffer solution and vortexed briefly. The master mix (2.0 μl of lOx RT buffer solution, 2.0 μl of dNTP mixture, 2.0 μl of oligo dT primer (10 μM), 0.5 μl of Rnase inhibitor (10 units / μl), 1.0 μl of Omniscript reverse transcriptase and double water distilled) was prepared on ice. The Master solution was distributed to the different tubes, and the RNA template (0.6 to 0.68 μl / tube) was added and mixed. The resulting solutions were incubated at 37 ° C for 60 min. All samples were run with the LightCycler system protocol (Idaho Technology, Inc., Salt Lake City, UT) using the SYBR-green kit from Roche Molecular Biochemicals, except for the beta-2 adrenergic receptor, for which the SYBR-green kit (Qiagen). The samples were run in duplicate, and all were normalized using GAPDH. The thresholds of the cycle (determined by the second derivative of the rising curve) of the samples were then compared between the slow and fast milking groups. To determine if there were any significant differences between slow and fast milking groups, the SAS statistical package was used to develop a Pearson correlation coefficient. The results suggested that milking duration and milking extraction speed are associated with the amount of beta-2 adrenergic receptor mRNA levels in the blood, and it was decided to characterize more fully the beta-2 adrenergic receptor gene in cattle. It was discovered that there is a polymorphism of the beta-2 adrenergic receptor in the nucleotide key (A replaced C in some occasions, resulting in a substitution of histidine for proline in the fourth amino acid) Example 2. Associations Between the AllC and SCS Genotype and / or the Milking Speed in Dairy Cows Bovine DNA samples are available from the population (Gene Evaluation and Mapping Laboratory, Bldg 200 Rm 2A, ARS-USDA, BARC-East Beltsville, MD 20705) Cooperative Dairy DNA Repository (CDDR) The SCS phenotypes have been obtained for all CDDR animals For a subset of CDDR animals, there are also data on milking speed (MS) First, the CDDR animals with MS data were genotyped , along with a subset of the rest of the CDDR animals that represent the phenotypic classes with Somatic Cell Count (SCS) "high" and "low", with the AllC assay, DNA samples were obtained and tested The data sets were distributed and analyzed in duplicate. The analysis revealed a correlation between the AllC and SCS. Six hundred sixty-three animals of the CDDR were genotyped for the AllC locus using any of the following primer pairs: TGGAACTGGCTGAACTGACA (SEQ ID No. 1) AGTTGATGGCTTCCTTGTGG (SEQ ID No. 2) AGGTCCGCTCGCTGAGG (SEQ ID No. 3) GTTCCAGCGTGACGTTTTG (SEQ ID No. 4) Table 1 shows a disproportionate distribution of AllC genotypes in the phenotypic categories of SCS "High" and "Low". Table 1. AllC genotypes and SCS distribution of 663 CDDR bulls. AA AC CC Total High # 9 88 248 345 Low # 5 55 258 318 Total 14 143 506 663 Prop. High 0. .643 0 .615 0 .490 0.520 Prop. Low to 0.357 0 .385 0 .510 0.480 Additionally, Table 2 contains the estimated average of the transmitted capacities (ETA) for the SCS and frequencies by AllC genotype. The results of the statistical analyzes of the data indicate that the AA, AC, and CC genotypes are significantly different from the average SCS (p <0.025) and that the AA and AC genotypes are significantly higher than the average SCS. (p <0.01). Additionally, animals with the CC genotype have significantly different (in this case, lower) SCS phenotypes than animals with AA and AC genotypes (p <0.05).

Table 2 Average ETS of SCS and frequency by genotype AllC among 663 bulls CDDR. AA AC CC Total ETA of SCS 314.5 312.8 307.0 0.520 Freq. of 0.021 0.216 0.763 Genotype Table 3 shows the distribution of the milking speed (MS) classifications according to the genotype, and the Table illustrates the average ETA for the MS per genotype. Due to the small number of AA animals, there is no significant association between MS and the AllC genotype at the -5% level. However, the trend in Table 3 clearly shows that the CC genotype has a lower proportion of bulls that transmit fast MS. Table 3. AllC Genotypes and Milking Speed distribution of 663 CDDR bulls. AA AC CC Total High # 13 46 108 167 Low # 7 36 120 163 Total 20 82 228 330 Prop. Fast 0. .650 0, .561 0 .474 0.506 Prop. Slow 0, .350 0,, 439 0. .526 0.494 In Table 4, the AA genotype tends to have a higher ETA average for MS.

Table 4. Average ETA for milking speed and frequency per AllC genotype among 663 CDDR bulls. AA AC CC ETA of MS 70 68.81707 64.02609 Freq. of 0.061 0.248 0.691 Genotype From these tables it is evident that the AA and AC genotypes (which are significantly associated with SCS) are also associated with higher milking rates. This is in agreement with the studies (McClelland, "A comparison of objective and measures of milking speed on Canadian Holstein-Friesians", University of Guelph, 1983, and Boettcher et al., "Development of an udder health index for sire selection based on somatic cell score, udder conformation, and milking speed ", J Dairy Sci 81 (4): 1157-1168, 1998) that have shown that the highest milking speed is genetically correlated with higher SCS and resistance to mastitis. Since the bulls that had MS ETAs represented only a subset (330) of the whole group (663), this is probably, that with a larger sample size, a significant association could be shown between the MS and the locus AllC. This discovery allows, for the first time, the testing and selection of animals for breeding and / or alternative management practices based on the results of the invented trial. The results of the test correlate with the SCS and allow the selection of animals with improved MS and resistance to mastitis. In addition to using these findings to select animals for SCS-related phenotypes, these findings can be used to select animals in an attempt to effect changes in the population with respect to DM and resistance to mastitis. Applying the trial will allow the selection of animals with SCS that will ultimately improve livestock averages for MS and resistance to mastitis.

This invention also includes a kit containing reagents that can be used to identify the allelic composition at the loci described herein. The present invention is not limited to the modalities described and exemplified above, but it has the ability to vary and modify within the scope of the appended claims. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (7)

1. CLAIMS Having described the invention as above, the content of the following claims is claimed as property. A method for reproducing cows with desirable milking characteristics, characterized in that it comprises the steps of: a. Identify the allele of the bovine adrenergic receptor-beta2 gene in at least one of the animals of a potential parent; and b. reproduce male and female animals to raise a daughter "counting" with ~ at least one allele of the beta-adrenergic receptor gene associated with improved milking characteristics. The method according to claim 1, characterized in that the method for identifying the allele includes isolating DNA from the parent and selecting it with a method selected from the group consisting of direct sequence, primer extension, restriction fragment length polymorphism, and allele-specific hybridization. 3. The method according to claim 1, characterized in that the purification method is provided to identify AllC alleles. 4. A method to identify a bull whose daughters cows will have a faster milking time, the method is characterized in that it comprises the steps of: a. get a DNA sample from a bull; b. combining the DNA with a pair of PCR probes including the sequences SEQ IdDs 1 and 2 or SEQ IDS 3 and 4; c. incubate DNA under conditions that allow DNA bound by PCR probes to produce DNA amplimers; d. isolate the DNA amplimers; and. combining the DNA amplimers with a restriction enzyme specific for CCCGGG for a time sufficient to produce a mixture of DNA fragments from the amplimers comprising CCCGGG; F. applying the DNA fragment mixture to a gel and allowing the migration of the components of the mixture for a sufficient time so that they separate, and g. observe the DNA sizes on the gel, with the longer fragments that are correlated with the genotype A and with a better SCS phenotype, and the smaller fragments are associated with the C genotype and the less desirable SCS phenotype. 5. A PCR-RFLP milking attribute kit, characterized in that it comprises: a pair of primers which flank the position of the nucleotide key of the adrenergic receptor-beta2 gene, and a restriction enzyme specific for the CCCGGG site. 6. The kit according to claim 5, characterized in that the restriction enzyme is Smal. The kit according to claim 5, characterized in that the pairs of primers are selected from pair 1 (SEQ ID Nos. 1 and 2) or pair 2 (SEQ ID Nos. 3 and 4).