MXPA06003133A - Modulation of eif4e expression - Google Patents

Abstract

Oligomeric compounds, compositions and methods are provided for modulating the expression of eIF4E. The antisense compounds may be single- or double-stranded and are targeted to nucleic acid encoding eIF4E. Methods of using these compounds for modulation of eIF4E expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E are provided.

Description

MODULATION OF THE EXPRESSION OF ELF4E FIELD OF THE INVENTION The present invention provides the compositions and methods for modulating the expression of elF4E. In detail, this invention relates to antisense compounds of single or double chain structure, particularly oligonucleotide compounds, which hybridize to nucleic acid molecules, encoding elF4E. Such compounds are shown herein to modulate the expression of elF4E.

BACKGROUND OF THE INVENTION Eukaryotic gene expression must be regulated in such a way that cells can respond rapidly to a wide range of diverse conditions. The process of messenger RNA translation is a step in which gene expression is highly regulated. In response to hormones, growth factors, cytokines and nutrients, animal cells generally activate translation in preparation for the proliferative response. The rate of protein synthesis typically decreases under stress conditions such as osmotic or oxidative stress, DNA damage or nutrient removal. Activation or deletion of the translation of messenger RNA occurs within minutes and control over this process is believed to be exercised in the initiation phase of protein synthesis (Rosenwaid et al., Oncogene, 1999, 18, 2507 -2517; Strudwick and Borden, differentiation, 2002, 70, 10-22). The initiation of the translation makes necessary the coordinated activities of several factors of eukaryotic initiation (eIFs); proteins classically defined by their cytoplasmic localization and ability to regulate the initiation phase of protein synthesis. One of these factors, eukaryotic initiation factor 4E (elF4E) [also known as translation initiation factor eukaryotic4E, eukaryotic translation initiation factor type-4E 1 (elF4EL1), closing binding protein (CBP) and closing binding protein of messenger RNA] was initially isolated as binding protein of the 25 kDa messenger RNA involved in the translation (Rychlik et al., National Proc.Accid.Sci.US, 1987, 84, 945-949) and since then has one of the most highly characterized eIFs. ElF4E present in limiting quantities relative to other initiation factors, is a component of the initiation complexes of elF4F, which is also composed of an adapter protein (scaffold) elF4G and elF4A RNA helicase. In the cytoplasm, elF4E catalyses the rate-limiting step of protein-dependent synthesis specifically binding the 5 '7-methyl GpppX terminal closure structure present in almost all mature cellular messenger RNAs, which serves to deliver Messenger RNA to the elF4F complex. Once bound, the elF4F complex tracks from the 5 'end to the 3' end of the closure, allowing the helicase activity of the elF4F complex RNA to resolve any secondary structure present in the 5 'untranslated region (UTR), thus revealing the codon of the initiation of translation and facilitating the loading of the ribosome on the messenger RNA (Graff et al., Clin Exp. Metastasis, 2003, 20, 265-273; Strudwick et al., differentiation, 2002, 70, 10 -22). The availability of elF4E to be incorporated into the elF4E complex is regulated through phosphorylation as well as through the binding of inhibitory proteins. elF4E is a phosphoprotein that is phosphorylated at serine 209 by the mitogen-activated protein kinase-activated kinase Mnk1 kinase (Flynn et al., J. Biol. Quim., 1995, 270, 21684-21688; Wang et al., J. Bíol, Quím., 1998, 273, 9373-9377, and Waskiewicz et al., Embo J., 1997, 16, 1909-1920). The phosphorylation of elF4E increases its affinity for the closures of messenger RNA, thus raising the rates of translation (Waskiewicz et al., Mol.Colula Biol., 1999, 19, 1871-1880). Increased phosphorylation of elF4E by phorbol esters, cell stresses and cytokines involve MAP kinase (mitogen-activated) p38 and / or Erk signaling pathways, which in alternating response stimulate the activity of Mnk1. Other stresses such as heat shock, sorbitol and hydrogen peroxide stimulate p38 MAP kinase and increase the activity of Mnk1, however these stimuli increase the binding of elF4E to protein 1 linked to elF4E (4E-BP1) (Wang et al. al., J. Biol. Quim., 1998, 273, 9373-9377). The binding of 4E-BP1 to elF4E blocks the phosphorylation of elF4E by Mnk1 (Wang et al., J. Biol. Quim., 1998, 273, 9373-9377). Proteins 1 and 2 linked to 4E act as efficient inhibitors of translation competing with F4G for binding to the dorsal surface of elF4E (Ptushkina et al., Embo J., 1999, 18, 4068-4075). The phosphorylation of the binding proteins of MTOR makes them dissociate from elF4E, allowing the activity of elF4E. A growing number of observations suggest that translation factors localize and function in the nucleus, as well as in the cytoplasm. Transcription and translation are traditionally considered spatially separated in eukaryotes; however, transcription and translation are linked together within the nuclei of mammalian cells (Iborra et al., Science, 2001, 293, 1139-1142). A fraction of elF4E locates the nucleus, suggesting that this translation factor may exhibit some of its control over translation in the nucleus (Lejbkowicz et al., National Proc.Acid Sci. USA, 1992, 89, 9612- 9616). ElF4E is imported into the nucleus with the alpha / beta import pathway by the nucleoplasmic paired elF4E-transporter of the protein (4E-t) (Dostie et al., Embo J., 2000, 19, 3142- 3156). In the nucleus, elF4E can be directly linked by the promyelocytic protein of leukemia (PML), an important regulator of mammalian cell growth and apoptosis (Cohen et al., Embo J., 2001, 20, 4547-4559 ). PML, with its RING domain, modulates elF4E activity greatly reducing its affinity for the structure of the 5 'closure of messenger RNAs (Cohen et al., Embo J., 2001, 20, 4547-4559). An excess of elF4E does not lead to high global rates of translation, but somewhat selectively increases the synthesis of proteins encoded by messenger RNAs that are classified as elF4E-sensitive, including growth-stimulating proteins such as vascular endothelial growth factor ( VEGF), ornithine decarboxylase (ODC) and cyclin D1 (Kevil et al., J. Internal Cancer, 1996, 65, 785-t790, Rosenwaid, Cancer Lett., 1995, 98, 77-82; and Shantz et al. , Cancer Res., 1994, 54, 2313-2316). While ODC and VEGF protein levels rise with increasing initiation of translation, cyclin D1 levels are elevated due to increased transport of cyclin D1 messenger RNA into the cytoplasm (Kevil et al., J. Internal Cancer, 1996, 65, 785-790; Rosenwaid, Cancer Lett., 1995, 98, 77-82; Rousseau et al., National Proc., Acad. Sci. USA, 1996, 93, 1065-1070). Thus, in addition to having a role in the initiation of translation, elF4E can also affect the nucleo-cytoplasmic transport of messenger RNA. The function of elF4E is an essential determinant of the total synthesis and growth of cell proteins (De Benedetti et al., Mol.Cell.Biol., 1991, 11, 5435-5445). In normal cells, elF4E is present in limiting amounts, which restrict translation. The messenger RNAs encoding proteins, necessary for the growth and survival of cells, typically contain a highly structured, 5 'UTR complex, which yields these poor substrates for translation. Many of these messenger RNAs, however, translate well in the presence of excess elF4E and are also upregulated by tumors (Graff and Zimmer, Clin.Exp.Metastasis, 2003, 20, 265-273). Translation of messenger RNAs related to cell differentiation can also be enhanced by elF4E, while increasing levels of elF4E are found in some cell lines that differentiate, including lung epithelial tumor cell lines (Walsh et al. ., differentiation, 2003, 71, 126-134). Over-expression of elF4E has been reported in many human cancers and cancer cell lines and also leads to oncogenic cell transformation and an invasive / metastatic phenotype in animal models. Unlike uncultured, cultured cells, the transformed cell lines express elF4E regardless of the presence of serum growth factors (Rosenwaid, Lett. Cancer, 1995, 98, 77-82). Excess of elF4E leads to aberrant growth and neoplastic morphology in heLa cells and also causes tumorigenic transformation in NIH 3T3 and Rat2 fibroblasts, as judged by independent anchoring growth, formation of transformed foci in culture and tumor formation in mice nudes (De Benedetti et al., National Proc.Acid Sci. USA, 1990, 87, 8212-8216; and Lazaris-Karatzas et al., Nature, 1990, 345, 544-547). In addition, the neoplastic transformation exhibited by cells over-expressing elF4E is associated with the increased translation of ODC (Lazaris-Karatzas et al., Nature, 1990, 345, 544-547). In addition, the high nuclear export of cyclin D1 associated with the increased expression of elF4E is directly linked to the activity of the transformation (Cohen et al., Embo JS, 2001, 20, 4547-4559). These results demonstrate that, when present in excess, elF4E may increase the expression or nuclear export of the growth regulating messenger RNAs. Consequently, the affected cells can proliferate independently of the normal mechanisms of growth control. A pronounced phosphorylation of elF4E is observed in cells transformed with the onhSdrCncoprotein tyrosine kinase src, suggesting that the elongated activity of elF4E, in addition to overexpression, contributes to the loss of growth regulation in transformed cCsas (Frederickson et al., Mol Cell, Biol., 1eaa-p91, 11, 2896-2900). ElF4E is elevated in several human cancers, including but not limited to: non-Hodgkin's lymphomas, colon adenomas and carcinomas, and laryngeal cancers; of the head and the cudo; of the prostate; of the chest and the bladder (Crew et al., Br J. Cancer, 2000, 82, 161-166; Graff et al., Clin. Exp. Metastasis, 2003, 20, 265-273; Haydon et al., Cancer , 2000, 88, 2803-2810; Kerekatte et al., J. Internal Cancer, 1995, 64, 27-31; Rosenwaid et al., Oncogene, 1999, 18, 2507-2517; Wang et al., Am. J Pathol., 1999, 155, 247-255). Over-regulation of elF4E is an early event in colon carcinogenesis, and is frequently accompanied by an increase in cyclin D1 levels (Rosenwaid et al., Oncogene, 1999, 18, 2507-2517). Excess of elF4E is also a reliable predictor of tumor recurrence in carcinomas of the head and cudo, is selectively upregulated in invasive bladder carcinomas and correlates with poor histological grades and advanced stages of metastasis in squamous carcinoma laryngeal cell (team et al., Br J. Cancer, 2000, 82, 161-166; Liang et al., Laryngoscope, 2003, 113, 1238-1243; and Nathan et al., Oncogene, 1997, 15, 579- 584). These results suggest that elevated levels of elF4E participate in the progression as well as cancer initiation. The inhibition of the expression and activity of elF4E has been achieved with the use of antisense mechanisms. Antisense oligonucleotides equipped with the 3'-salient nucleotides modulate the binding of elF4E to the closed 5'-oligoribonucleotides (Baker et al., J. Biol. Quim., 1992, 267, 11495-1 499). The introduction into heLa cells of an episomal vector directed to express an oligonucleotide complementary to 20 nucleotides in the region of the translation start of elF4E reduces the levels of elF4E and concomitantly decreases the rates of cell growth and synthesis of the protein, demonstrating that elF4E is required for cell proliferation (Bommer et al., cell, Mol. Biol. Res., 1994, 40, 633-641; De Benedetti et al., Mol. Cell. Biol. 1991, 11, 5435-5445). The levels of elF4G and the protein component of the scaffold of the elF4F complex are also reduced. Despite decreased levels of translation after inhibition of elF4E, certain proteins continue to be synthesized and many of these have been identified as stress-inducible or heat shock proteins (Joshi-Barve et al., J. Biol. ., 1992, 267, 21038-21043). The same vector reduces elF4E by 50 to 60 percent in fibroblasts of the rat embryo, which is sufficient to inhibit the transformation and ras-mediated tumorigenesis of these cells (Graff et al., J. Internal Cancer, 1995, 60 , 255-263; Rinker-Schaeffer-Schaeffer et al., J. Internal Cancer, 1993, 55, 841-847). In addition, the translation of ODC and the transport of polyamine are decreased, an observation that provides a link between the malignancy, the activity of elF4E and the ras-induced metabolism of polyamine (Graff et al., biochemistry, Biophis, Res. Commun., 1997, 240, 15-20). Stable transformation of a mammary carcinoma line and a squamous cell carcinoma cell line of the head and neck with the elF4E antisense vector results in the reduction of the expression of! Factor 2 of fibroblastic growth (Fgf-2) and the inhibition of tumorigenic and angiogenic capacity of cells in mice, suggesting a causal role of elF4E in tumor vascularization (DeFatta et al., Laryngoscope, 2000, 110, 928- 933; Nathan et al., Oncogene, 1997, 15, 1087-1094). Objective inactivation of a Caenorhabditis elegans homologue of human elF4E, lfe-3, with the small interfering RNA injected into young adult worms leads to embryonic mortality in 100% of the progeny (Keiper et al., J. Biol. Quim. , 2000, 275, 10590-10596). The RNA of small interfering chain structure directed to elF4E has also revealed that the lack of regulation of elF4E participates in cellular transformation. Functional inactivation of elF4E using a small interfering gene-specific 21-nucleotide RNA targeted to a portion of the coding region of human elF4E results in a significant reduction in anchor-independent growth of malignant cholangiocytes, a phenotype associated with the transformed cells. In addition, phosphorylation of elF4E in bad cholangiocytes is dependent on p38 MAP kinase dependent signals, demonstrating a link between p38 MAP kinase signaling and regulation of protein synthesis in the process of cholangiocarcinoma growth (Yamagiwa et al. , Hepatology, 2003, 38, 158-166). Additional evidence, that the inhibition of elF4E activity reduces the tumorigenic potential of cells, is considered in breast cancer cells that express an active constitutive form of the elF4E 4EBP-1 inhibitor, which leads to the arrest of the the cell associated with the down-regulation of cyclin D1 and the cyclin-dependent upregulation of p27K? p1 kinase (Jiang et al., internal cancer cell, 2003, 3, 2). Overexpression of 4E-BP1 in gastrointestinal cancers, where elF4E levels are significantly higher than in normal tissue, correlates with a reduction in distant metastases (Martin et al., J. internal Biochem. Cell. Biol. 2000, 32, 633-642). The patent of E.U.A. No. 5,646,009 claims and describes a hybrid vector in which a segment of the DNA encodes a closing binder protein consisting of elF4E, elF4E factor or a mutant thereof. This patent also discloses a nucleic acid sequence encoding a human elF4E. It is disclosed in the patent of E.U.A. 6,171,798 a method for treating cancer in a patient by administering to cancer cells an antisense construct spanning at least 12 nucleotides of a coding sequence of a gene selected from a group containing a human eIF4E, to orientation 3 '5' with respect to a promoter that controls its expression. The patent of E.U.A. No. 6,596,854 claims and describes the isolated nucleic acid molecules encoding human elF4E variants, wherein said variants have amino acid substitutions in the regions of amino acids 112 and 114-121, or of position 118, or position 119, or place 115 or position 121. European Patent Application No. 1 033 401, and Japanese No. 2001269182 claim a purified nucleic acid spanning at least 10 consecutive nucleotides of a sequence selected from a group of sequences EST-related ones that include a portion of a nucleic acid molecule that encodes human elF4E. These publications also describe the preparation and use of constructs and antisense oligonucleotides to be used in gene therapy.

WO 01/96388 and WO 01/96389 PCT describe and claim isolated polynucleotides spanning a sequence selected from: sequences, sequence complements, sequences consisting of at least 20 contiguous residues of a sequence, sequences that cross by hybridization to a sequence, or sequences having at least 75% or at least 95% identity to a sequence, provided in the sequence listing, which includes a nucleic acid molecule encoding a human elF4E. This publication also claims a method for the treatment of a cancer in a patient, the administration to the patient encompassing a composition of the claimed polynucleotides. WO 03/039443 PCT claims and discloses a method for the preparation of a pharmaceutical composition for the treatment of leukemia characterized in that an antisense oligonucleotide complementary to a polynucleotide encoding a protein corresponding to the marker, selected from a group including a human molecule of the nucleic acid of elF4E, is mixed with the pharmaceutical compounds. The pre-granted publication of the United States No. 20030087852 discloses a plasmid encoding elF4E antisense messenger RNA from the plasmid and cultured mouse cells transfected with this plasmid. The molecules, described in the pre-issued US publication No. 20030144190, are antisense which can be used to decrease or abrogate the expression of a nucleic acid sequence or a protein of the invention, including elF4E. Also described is a plasmid encoding antisense messenger RNA encoding the elF4E of the plasmid and cultured fibroblasts of the constitutive rat expressing this plasmid.

As a consequence of the involvement of elF4E in many diseases, it remains a long felt need for additional agents capable of effectively regulating elF4E. As such, inhibition is especially important in the treatment of cancer, since over regulation of elF4E expression is associated with so many different types of cancer. Antisense technology is an effective means to reduce the expression of gene specific products and has been shown to be uniquely useful in a number of therapeutic, diagnostic, and research uses. The present invention provides the compositions and methods for modulating the expression of elF4E.

COMPENDIUM OF THE INVENTION The present invention is directed to oligomeric compounds, such as antisense compounds, and pharmaceutically acceptable salts thereof, which point to a nucleic acid molecule encoding elF4E and which inhibits the expression of elF4E. Oligomeric compounds can be RNA-type or DNA-type, including oligonucleotides. The oligomeric compounds may be of single or partial chain structure or entirely oligomeric compounds of double-stranded structure and may be chemically modified or unmodified. Pharmaceutical compositions and other compositions comprising these compounds are also provided. Also provided are screening methods for elF4E modulators and methods of modulating the expression of elF4E in cells, tissues or animals comprising contacting said cells, tissues or animals with one or more of the compounds or compositions. of the invention. The methods of treatment of an animal, particularly a human being, are also arranged here. Such methods encompass administering the therapeutically or prophylactically effective amount of one or more of the compounds or compositions of the invention.

DETAILED DESCRIPTION OF THE INVENTION A. General of the Invention The present invention employs oligomeric compounds, such as antisense compounds, oligonucleotides of single or double chain structure and similar species, for use in the modulation of the function or effect of the nucleic acid encoding elF4E. This is accomplished by providing the oligomeric compounds that specifically hybridize with one or more nucleic acid molecules encoding elF4E. As used here, the terms "target nucleic acid" and "nucleic acid molecule encoding elF4E" have been used for the convenience to encompass DNA encoding elF4E, RNA (including pre-RNA and messenger RNA or portions thereof) transcribed from such DNA, and also Complementary DNA derived from such RNA. This modulation of the function of an objective nucleic acid by the compounds that cross by hybridization to it is generally referred to as "antisense". The functions of DNA that will interfere, may include replication and transcription. Replication and transcription, for example, may be of an endogenous cellular template, a vector, a plasmid construct or another. RNA functions that will be interfered with, include functions such as shifting RNA to a protein translation site, shifting RNA to sites within the cell that are distant from the site of RNA synthesis, translation RNA protein, and catalytic activity or formation involving RNA that can be facilitated by RNA. One result of such interference with the function of the target nucleic acid is modulation of elF4E expression. In the context of the present invention, "modulation" and "modulation of expression" can mean both an increase (stimulus), as well as a decrease (inhibition) of the amount or levels of a nucleic acid molecule encoding the gene, eg, DNA or RNA. Inhibition is a form of modulation of expression and messenger RNA is often a target nucleic acid. In the context of this invention, "hybridization" means the pairing of substantially complementary chain structures of oligomeric compounds. In the present invention, a mating mechanism involves the linking of hydrogen, which may be Watson-Crick-Crick, Hoogsteen or reverse hydrogen bonding of Hoogsteen, between complementary nucleosides or nucleotide bases (nucleobases) of the chain structures of oligomeric compounds. For example, adenine ~ and thymine are the complementary nucleobases that are paired with the formation of hydrogen bonds. Hybridization can occur under varying circumstances. An antisense compound is "specifically hybridizable" when the binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity and there is a sufficient degree of complementarity to avoid non-specific binding of the acid sequences nucleic acid of the non-target antisense compound under conditions in which the specific binding is desired, i.e., under physiological conditions in the case of in vivo analysis or therapeutic treatment, and under conditions in which the assays are performed in the case of in vitro analysis. In the present invention the phrase "stringent hybridization conditions" or "stringent conditions" refers to the conditions under which a compound of the invention will cross-hybridize to its target sequence, but to a minimum number of other sequences. The stringent conditions are sequence-dependent and will be different in various circumstances and in the context of this invention, the "stringent conditions" under which oligomeric compounds cross by hybridization to a target sequence are determined by the nature and composition of the compounds oligomers and the analyzes in which they are being investigated. Under general conditions, rigorous hybridization encompasses low concentrations (the <; 0.15M) of salts with inorganic cations such as Na + + or K ++ (ie, low ionic strength), temperature higher than 20 ° -25 ° C below the Tm of the oligomeric complex of the compound: target sequence, and the presence of denaturants such as formamide, dimethylformamide, dimethyl sulfoxide, or sodium dodecyl sulfate detergent (SDS). For example, the hybridization rate decreases 1.1% for each 1% formamide. An example of a high stringency hibitization condition is the 0.1x sodium chloride-sodium citrate buffer (SSC) /0.1% (w / v) SDS at 60 ° C for 30 minutes. "Complementary," as used herein, refers to the ability for accurate matching between two nucleobases in one or two oligomeric chain structures. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid which is a DNA, RNA, or molecule of the oligonucleotide, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligomeric DNA, the RNA, or the compound and subsequent molecule of the oligonucleotide are complementary to each other when a sufficient number of complementary positions in each molecule is occupied by the nucleobases that can bind hydrogen with each other. Thus, "specifically hybridizable" and "complementary" are terms that are used to indicate a sufficient degree of mating or exact complementarity over a sufficient number of nucleobases such that the specific and stable binding occurs between the oligomeric compound and a target nucleic acid. It is understood in the art that the sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. On the other hand, an oligonucleotide can hybridize on one or more segments such by hybridization that intervening or adjacent segments are not involved in the hybridization event (eg, a loop structure, a mismatch or a hairpin structure). ). The oligomeric compounds of the present invention comprise at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%. %, or at least about 95%, or at least the sequence complementarity of about 99% to a region of the target within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a region of the target, and would therefore cross specifically, would represent 90 percent compfementarity by hybridization. In this example, the remaining non-complementary nucleobases can be clustered or intermixed with complementary nucleobases and do not need to be contiguous with each other or complementary nucleobases. As such, an antisense compound that is 18 nucleobases in length that has 4 (four) non-complementary nucleobases that are flanked by two regions of complete complementarity with the target nucleic acid would have total complementarity 77.8% with the target nucleic acid and would thus fall within the scope of the present invention. The percent complementarity of an antisense compound with a region of an objective nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST program known in the art (Altschul et al., Mol., J. Biol., 1990, 215, 403-410; Zhang and Madden, genome Res., 1997, 7, 649-656). Percent of homology, sequence identity or complementarity, can be determined by, for example, the gap program (Wisconsin sequence analysis package, version 8 for Unix, genetics computer group, University research, Madison Wl), with default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Mathematics, 1981, 2, 482-489).

The oligomeric compounds of the present invention also include those variants in which a diverse base is present in one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, variants can be produced that contain thymidine, guanosine or cytidine in this position. This can be done in any of the positions of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit the expression of eiF4E messenger RNA. In some embodiments, the homology, the identity of the sequence or the complementarity, between the antisense compound and the target is about 50% to about 60%. In some modalities, homology, sequence identity or complementarity, is about 60% to about 70%. In some modalities, the homology, the identity of the sequence or the complementarity, is about 70% to about 80%. In some modalities, the homology, the identity of the sequence or the complementarity, is about 80% to about 90%. In some modalities, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%. %, close to 99% or close to 100%.

B. COMPOUNDS OF THE INVENTION In the context of the present invention, the term "oligomeric compound" refers to a polymeric structure capable of cross-linking by hybridization to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, and chimeric combinations thereof. Oligomeric compounds are routinely linearly prepared but can be assembled or otherwise prepared to be circular and may also include branching. Oligomeric compounds may include constructions of double-stranded structure for example, two cross-hybridized chain structures to form double-stranded structure compounds or a single chain structure with sufficient self complementarity to allow hybridization and compound formation completely or partially of double chain structure. In one embodiment of the invention, the antisense double-stranded structure compounds encompass small interfering RNAs (siRNAs). As used herein, the term "siRNA" is thus defined as a double chain structure compound having a first and second chain structure and encompassing a central complementary portion between said first and second chain structures and the terminal portions that are optionally complementary between said first and second said chain structures or with the messenger RNA of the target. Each chain structure can be from about 8 to about 80 nucleobases in length, 10 to 50 nucleobases in length, 12 or 13 to 30 nucleobases in length, 12 or 13 to 24 nucleobases in length or 19 to 23 nucleobases in length. The central complementary portion may be from about 8 to about 80 nucleobases in length, 10 to 50 nucleobases in length, 12 or 13 to 30 nucleobases in length, 12 or 13 to 24 nucleobases in length or 19 to 23 nucleobases in length. The terminal portions can be from 1 to 6 nucleobases in length. The ARNips can not also have any portion of the terminal. The two chain structures of a siRNA can be ligated internally leaving the free terminal 3 'or 5' or can be ligated to form a structure or a continuous loop of the fork. The structure of the fork ^ may contain a projection on the 5 'or 3' terminals producing an extension of the individual chain structure character. In one embodiment of the invention, the antisense double-stranded structure compounds are canonical siRNAs. As used herein, the term "canonical siRNA" is defined as an oligomeric compound of double-stranded structure having a first strand structure and a second strand structure each chain structure being 21 nucleobases in length with the strand structures which are complementary to 19 nucleobases and which have at each end 3 'of each chain structure a thymidine dimer of deoxy (dTdT) which in the compounds of double chain structure acts as a 3' protuberant. In another modality, the antisense double-stranded structure compounds are blunt-ended siRNAs. As used herein the term "blunt-ended siRNA" is defined as an siRNA that has no protuberant terminal. That is, at least one end of the double chain structure compound is blunt. SiRNA if it is canonical or blunt, it acts to remove enzymes from the dhRNA and to drive the recruitment or activation of the antisense mechanism of RNAi. In another embodiment, the individual chain structure RNAi compounds (shRNAs) that act via the RNAi antisense mechanism are contemplated. Other modifications can be made to double-stranded structure compounds and can include conjugate groups attached to one of the terminal, selected positions of the nucleobase, positions of the sugar or to one of the internucleoside bonds. Alternatively, the two chain structures can be linked via a non-nucleic acid moiety or linker group. When formed-of only one chain structure, the dhRNA can take the form of a self-complementary fork-type molecule that doubles behind itself to form a duplo. Thus, the dhRNAs can be completely or partially of double-stranded structure. When it is formed from two chain structures, or from a single chain structure that takes the form of a self-complementary molecule of the fork type folded back on itself to form a double, the two chain structures (or double-forming regions of a single chain structure) are the complementary chain structures of the RNA that pair low in the manner of Watson-Crick-Crick. According to the present invention, "antisense compounds" include antisense oligonucleotides, ribozymes, external oligonucleotides of the leader sequence (EGS), siRNA compounds, single or double chain structure interferers such as siRNA compounds, and other compounds oligomerics that cross by hybridization to at least a portion of the target nucleic acid and modulate their function. As such, they can be DNA, RNA, DNA type, RNA type, or mixtures thereof, or they can be mimetics of one or more of these. These compounds may be oligomeric compounds of single chain structure, double chain, circular or fork structure and may contain structural elements such as internal or terminal pumped, poorly made joints or loops .. Antisense compounds are prepared routinely linear but can be assembled or otherwise prepared to be circular and / or branched. The antisense compounds may include constructions for example, two cross-linked hybridization structures to form an entirely or partially double chain or single chain structure compound with sufficient self-complementarity to allow hybridization and formation of a composed completely or partially of double chain structure. The two chain structures can be linked internally leaving the free terminal 3 'or 5' or can be linked to form a structure or a continuous loop of the fork. The fork structure may optionally contain a projection on the 5 'or 3' terminals producing an extension of the individual chain structure character. The braided compounds of double chain structure may optionally include end projections. Other modifications may include conjugated groups attached to one of the terms, selected positions of the nucleobase, positions of the sugar or to one of the internucleoside bonds. Alternatively, the two chain structures can be linked via a non-nucleic acid moiety or a linker group. When formed of only one chain structure, the dhRNA can take the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplo. A) Yes, the dhRNAs can be completely or partially of double chain structure. Specific inhibition of gene expression can be achieved by the stable expression of the dhRNA hairpins in transgenic cell lines (Hammond et al., National Current Inverter Genet., 1991, 2, 110-119; Matzke et al., Curr. Opin. Genet Developer, 2001, 11, 221-227; Sustained, Revealer of Genes, 2001, 15, 485-490). When it is formed from two chain structures, or from an individual chain structure that takes the form of a self-complementary fork-type molecule bent back on itself to form a double, the two chain structures (or forming regions) of duplo of a single chain structure) are the complementary RNA chain structures that are base pairs in the manner of Watson-Crick-Crick. Once introduced into a system, the compounds of the invention can produce the action of one or more enzymes or structural proteins to effect the slit or other modification of the target nucleic acid or they can work via occupation-based mechanisms. In general, nucleic acids (including oligonucleotides) can be described as "DNA-like" (ie, generally having one or more sugars 2'-deoxy and, generally, T rather than the U bases) or " RNA type "(ie, generally having one or more 2'-hydroxyl or 2'-modified sugars and, generally U rather than the T bases). The nucleic acid helices can adopt more than one type of structure, most commonly forms A and B. It is believed that, in general, oligonucleotides having a B-form form type are "DNA-like" and the which have the shape structure of type A are "RNA type". In some (chimeric) embodiments, an antisense compound may contain the regions of the A and B forms. An example of an enzyme that modifies the target nucleic acid is ARase H, a cellular endonuclease that separates the chain structure from RNA of a double RNA: DNA. It is known in the art that antisense compounds of individual chain structure containing "DNA-like" regions (eg, 2'-deoxy regions) longer than about 3 or 4 consecutive nucleobases can recruit the H-RNAse. Activation of ARase H, therefore, results in cleavage of the target RNA, thereby greatly improving the efficiency of oligonucleotide-mediated inhibition of gene expression. More recently, a dhRNA has been postulated to be involved in the cleavage of the RNA strand structure in the double RNA: RNA observed in the RNA interference process (RNAi). While a well-accepted form of antisense compound is an oligonucleotide of single antisense strand structure, in other contexts, double strand structure RNAs or their analogs are useful. In many species the introduction of double-stranded structures, such as double-stranded structure RNA molecules (dhRNA), has been shown to induce powerful and specific antisense-mediated reduction of the function of a gene or its associated products. gene. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing (Guo et al., Cell, 1995, 81, 611-620, Montgomery et al., National Proc. Acad. Sci. USA, 1998, 95, 15502-15507). The post-transcriptional antisense mechanism defined in Caenorhabditis elegans that resulted from exposure to double-stranded structure RNA (dhRNA) has since been reported to be RNA interference (RNAi). This term has been generalized to mean the antisense-mediated gene that silenced by implicating the introduction of the dhRNA that led to the sequence-spec / T / c reduction of the endogenous directed levels of the messenger RNA (Fire et al., Nature, 1998, 391 , 806-811). RNAi compounds are often referred to as RNAs or RNAi briefly interfering. Recently, it has been shown that it is, in fact, the oligomers of the individual chain structure of the RNA of the antisense polarity of the dhRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697). . RNAi compounds (ie, RNA-like compounds of single or double-stranded or RNA-like structure) and H-dependent individual antisense chain structure compounds bind to their RNA target by base pairing (ie, hybridization) and induce the site-spec / f / 'ca cleavage of the target RNA by specific mRNAs; that is, both work via an antisense mechanism. Vickers et al., J. Biol. Quim., 2003, 278, 7108-7118. In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) and / or deoxyribonucleic acid (DNA), or mimetic, a chimera, an analog or a homologue of that. This term includes oligonucleotides composed of naturally occurring nucleobases that occur, sugars and covalent bonds of the internucleoside (skeleton) as well as oligonucleotides that have non-naturally occurring portions that function similarly. Such modified or substituted oligonucleotides are often desired excessive native forms due to desirable characteristics eg, for example, enhanced cell, enhanced affinity for a target nucleic acid and increasing stability in the presence of nucleases. The antisense compounds according to this invention may encompass an antisense portion of about 8 to about 80 nucleobases (ie from about 8 to about 80 linked nucleosides) in length. This refers to the length of the antisense strand structure or the antisense compound portion. That is, an antisense individual chain structure compound of the invention ranges from about 8 to about 80 nucleobases, and an antisense double-stranded structure compound of the invention (such as a dhRNA, for example) encompasses a chain structure antisense or a portion of 8 to about 80 nucleobases in length. One of ordinary skill in the art will appreciate that it comprises antisense portions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length, or any of the range. In one embodiment, the antisense compounds of the invention have antisense portions of 10 to 50 nucleobases in length. One of ordinary skill in the art will appreciate that it incorporates the antisense compounds having antisense portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleobases in length, or any of the range. In one embodiment, the antisense compounds of the invention have anti-sense portions of 12 or 13 to 30 nucleobases in length. One of ordinary skill in the art will appreciate that it incorporates the antisense compounds having antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length, or any of the range. In some embodiments, the antisense compounds of the invention have antisense portions of 12 or 13 to 24 nucleobases in length. One having ordinary skill in the art will appreciate that it incorporates the antisense compounds having antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleobases in length, or any of the range. In some embodiments, the antisense compounds of the invention have antisense portions of 19 to 23 nucleobases in length. One of ordinary skill in the art will appreciate that it incorporates antisense compounds having antisense portions of 19, 20, 21, 22 or 23 nucleobases in length, or any of the range. Antisense compounds 8-80 nucleobases in length spanning a stretch of at least eight (8) consecutive selected nucleobases within illustrative antisense compounds are considered to be suitable antisense compounds as well.

Exemplary compounds include the oligonucleotide sequences spanning at least the 8 consecutive 5'-terminal nucleobases of one of the illustrative antisense compounds (the remaining nucleobases which are a consecutive stretch of the same oligonucleotide starting immediately counter-current from 5'- terminals of the antisense compound that is specifically hybridizable to the target nucleic acid and continues until the oligonucleotide contains about 8 to about 80 nucleobases). Other compounds are represented by oligonucleotide sequences spanning at least the 8 consecutive 3'-terminal nucleobases of one of the illustrative antisense compounds (the remaining nucleobases that are a consecutive stretch of the same oligonucleotide starting immediately downstream of 3 '). -terminals of the antisense compound that is specifically hybridizable to the target nucleic acid and that continues until the oligonucleotide contains about 8 to about 80 nucleobases). It is also understood that the compounds may be represented by oligonucleotide sequences spanning at least 8 consecutive nucleobases of an internal portion of the sequence of an illustrative compound, and may extend in either or both directions until the oligonucleotide contains about 8 about 80 nucleobases. It should be noted that the oligomeric compounds or acceptable salts of that of the present invention do not include the 5'-AGTCGCCATCTTAGATCGAT-3 'sequence (SEQ ID NO: 454) or 5'-AGUCGCCAUCUUAGAUCGAU-3' of the nucleobase (SEQ. ID NO: 455). In addition, the oligomeric compounds or acceptable salts thereof encompassed by the present invention may consist of, consist essentially of, or encompass pharmaceutical, the specific nucleotide sequences disclosed herein. The phrases "consist essentially of," "consist essentially of," "consisting essentially of," or the like when applied to the oligomeric compounds or acceptable salts thereof encompassed by the present invention relate pharmaceutical to nucleotide sequences as disclosed. here, but containing the additional nucleotides (ribonucleotides, deoxyribonucleotides, or analogs or derivatives thereof as discussed here). Such additional nucleotides, however, do not materially affect the basic and novel characteristics (s) of these oligomeric compounds or pharmaceutically acceptable salts thereof in the modulation, attenuation, or gene expression of the elF4E or function of the RNA that it inhibits, including the effects quantitative specific to these molecules, compared to the corresponding parameters of the corresponding oligomeric or pharmaceutical compounds of the acceptable salts disclosed herein. One who has skill in the art armed with the antisense compounds illustrated herein may, without undue experimentation, identify more antisense compounds.

C. Objectives of the invention "Aiming" an oligomeric compound to a particular molecule of the nucleic acid, in the context of this invention, can be a multi-step process. The process usually begins with the identification of an objective nucleic acid whose function is to be modulated. This target nucleic acid can be, for example, a cellular gene (or messenger RNA transcribed from the gene) which expression is associated with a particular state of the disorder or disease, or a nucleic acid molecule of an infectious agent. In the present invention, the target nucleic acid encodes elF4E. The targeting process also generally includes the determination of at least one region, segment, or target site within the target nucleic acid for the antisense interaction to occur such that the desired effect will result, e.g., modulation of expression. Within the context of the present invention, the term "region" is defined as a portion of the target nucleic acid having at least one structure, function, or identifiable characteristic. Within regions of the target the nucleic acids are segments. The "segments" are defined as smaller or sub-portions of regions within a target nucleic acid. "Sites," as used in the present invention, are defined as positions within a target nucleic acid. Since, as is known in the art, the codon of translation initiation is typically 5 'AUG (in molecules transcribed from messenger RNA; 5 'ATG in the corresponding DNA molecule), the codon of translation initiation is also referred to as the "AUG codon," and the "start codon" or "the start codon of AUG." A minority of genes have a codon of translation initiation having the sequence 5 'GUG, 5' UUG or RNA CUG 5 \ and 5 'AUA, 5' ACG and CUG 5 'have been shown to function in alive. Thus, the terms "codon of translation initiation" and "start codon" can encompass many codon sequences, although the amino acid of the initiator in each case is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes can have two or more alternative start codons, which can be used preferentially for the initiation of translation into a particular type or tissue of the cell, or under a particular system of conditions. In the context of the invention, the "start codon" and the "translation initiation codon" refer to the codon or codons that are used in vivo to initiate the translation of a messenger RNA transcribed from an elF4E encoding the gene , regardless of the sequence (s) of such codons. It is also known in the art that a stop codon of translation (or the "stop codon") of a gene can have one of three sequences, ie, 5 'UAA, 5' UAG and 5 'UGA ( the corresponding DNA sequences are 5 'TAA, 5' TAG and 5 'TGA, respectively). The terms "begin the codon region" and "the codon region of translation initiation" to refer to a portion of such a messenger RNA or gene that ranges from about 25 to about 50 contiguous nucleotides in either direction (ie say, 5 'or 3') of a codon for the initiation of translation. Similarly, the terms "stop the codon region" and "the codon region of translation termination" refers to a portion of such a messenger RNA or gene that ranges from about 25 to about 50 contiguous nucleotides in any direction ( that is, 5 'or 3') of a codon at the end of the translation. Therefore, "the codon region of the start" (or "the codon region of translation initiation") and "the codon region of the stop" (or "the codon region of the translation termination") ") are all regions that can be targeted effectively with the antisense compounds of the present invention. The Open Reading Frame (ORF) or "Reading Coding," which is known-in art to refer to the region between the initiation codon of translation and the codon of translation completion, is also a region that can be targeted effectively. Within the context of the present invention, a region is the intragenic region encompassing the codon of the initiation or termination of the translation of the open reading frame (ORF) of a gene. Other regions of the target include the 5 'untranslated region (5'UTR), known in the art to refer to the portion of a messenger RNA in the 5' direction of the codon of translation initiation, and thus including the nucleotides. between the 5 'closing site and the initiation codon of the translation of a messenger RNA (or of corresponding nucleotides in the gene), and of the 3' untranslated region (3'UTR), known in the art to refer to the portion of a messenger RNA in the 3 'direction of the translation termination codon, and thus including the nucleotides between the codon terminus of the translation terminus and 3' of a messenger RNA (or corresponding nucleotides in the gene). The site of the 5 'closure of a messenger RNA encompasses a N7-methylated guanosine residue bound to the 5' residue of the messenger RNA via the 5'-5 triphosphate linkage. The 5 'closure region of a messenger RNA is considered to include the structure itself of the 5' closure as well as the first 50 nucleotides adjacent to the site of closure. The 5 'closure region is also an objective. Although some eukaryotic transcripts of messenger RNA are translated directly, many contain one or more regions, known as "introns," which are deleted from a transcript before they are translated, (and therefore translated) the remaining regions are known as "exons" and are spliced together to form a continuous sequence of the messenger RNA. Aiming the splice sites, that is, intron-exon junctions or exon-intron junctions, can also be particularly useful in situations where aberrant splicing is involved in disease, or where an overproduction of a particular splicing product is involved. in sickness Aberrant merge junctions due to changes or deletions are also suitable target sites. Transcripts of messenger RNA produced via the process of splicing two (or more) messenger RNAs from different gene sources are known as "fusion transcripts." It is also known that introns can be targeted effectively by using antisense compounds directed to, for example, DNA or pre-messenger RNA. Antisense compounds of individual chain structure such as oligonucleotide compounds that work via a mechanism of ARase H are effective for targeting pre-messenger RNA. It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants." More specifically, the "pre-messenger RNA variants" are the transcripts produced from the same genomic DNA that differentiate from other transcripts produced from the same genomic DNA at its start or stop position and contain intronic and exonic sequence. Upon deletion of one or more of the exon or intron regions, or portions of that during splicing, variants of the pre-messenger RNA produce "smaller variants of the messenger RNA." Therefore, messenger RNA variants are processed variants of messenger pre-RNA and each unique variant of pre-messenger RNA must always produce a unique variant of messenger RNA as a result of splicing. These variants of messenger RNA are also known as "alternative splice variants." If no splicing of the pre-messenger RNA variant occurs then the pre-messenger RNA variant is identical to the messenger RNA variant. It is also known in the art that variants can be produced with the use of alternative signals to start or stop the transcription and that pre-messenger RNAs and messenger RNAs may possess more than a start codon or stop codon. The variants that originate from a pre-messenger RNA or a messenger RNA that use alternative start codons are known as "alternative start variants" of that pre-messenger RNA or messenger RNA. Those transcripts that use an alternative stop codon are known as "alternative stop variants" of that pre-messenger RNA or messenger RNA. A specific type of alternative stop variant is the "variant of the poIyA" in which multiple transcripts resulted from the alternative selection of a "stop signs of the poIyA" by the transcription machinery, thereby producing the transcripts that end in the unique sites of the poIyA. Within the context of the invention, the types of variants described herein are also convenient target nucleic acids. Locations in the target nucleic acid to which convenient oligomeric compounds cross by hybridization are hereinbelow designated "convenient segments of the target." As used herein the term "convenient segment of the target" is defined as at least an 8-nucleobase portion of a region of the target to which an active oligomeric compound is targeted. While not wishing to be limited by theory, it is currently believed that these target segments represent the portions of the target nucleic acid that are accessible for hybridization. While the specific sequences of certain convenient segments of the target are set forth herein, one of skill in the art will recognize that they serve to illustrate and to describe particular embodiments within the scope of the present invention. Additional convenient segments of the target can be identified by one who has ordinary skill. It is not necessary that the "convenient segment of the objective" be identified by this term or included in the table "of the convenient segment of the objective", if there is one. Segments of the target 8-80 nucleobases in length spanning a stretch of at least eight (8) consecutive selected nucleobases within illustrative convenient segments of the target are considered to be suitable for targeting as well. Target segments may include DNA or RNA sequences spanning at least the 8 consecutive 5'-terminal nucleobases of one of the illustrative convenient segments of the target (the remaining nucleobases that are a consecutive stretch of the same DNA or RNA that starts immediately upstream from the 5'-terminal segment of the target and continues until DNA or RNA contains about 8 to about 80 nucleobases). Similarly convenient segments of the target are represented by DNA or RNA sequences spanning at least the 8 consecutive 3'-terminal nucleobases of one of the illustrative convenient segments of the target (The remaining nucleobases that are a consecutive stretch of the same DNA or RNA that begins immediately downstream of the 3'-terminal segment of the target and continues until DNA or RNA contains about 8 to about 80 nucleobases). It is also understood that suitable oligomeric segments of the target can be represented by DNA or RNA sequences spanning at least 8 consecutive nucleobases of an internal portion of the sequence of convenient segments illustrative of a target., and can extend in either or both directions until the oligonucleotide contains about 8 about 80 nucleobases. One who has skill in art armed with the convenient segments of the objective illustrated here will be able, without undue experimentation, to identify other suitable segments of the objective. Once one or more regions, segments or target sites have been identified, oligomeric compounds are chosen that are sufficiently complementary to the target, ie, sufficiently cross the well by hybridization and with sufficient specificity, to give the effect wanted. The oligomeric compounds can also be targeted to the regions of the target nucleobase sequence (eg, for example those disclosed below) encompassing nucleobases 1-80, 81-160, 161-240, 241-320, 321-400, 401-480, 481-560, 561-640, 641-720, 721-800, 801-880, 881-960, 961-1040, 1041-1120, 1121-1200, 1201-1280, 1281-1360, 1361- 1440, 1441-1520, 1521-1600, 1601-1680, 1681-1760, or 1761-1842, or any combination thereof.

D. Validation of selection and objectification In another embodiment, the "convenient target segments" identified herein can be used on a screen for additional compounds that modulate the expression of elF4E. The "modulators" are those compounds that decrease or increase the expression of an encoding elF4E of the nucleic acid molecule and which comprise at least an 8-nucleobase portion that is complementary (ie, antisense) to a convenient segment of the target . The research method covers the steps of contacting a suitable segment of the target of an elF4E encoding the nucleic acid molecule with one or more modulators of the candidate, and selecting it for one or more modulators of the candidate that decrease or increase the expression of an elF4E encoding the nucleic acid molecule. Once it is demonstrated that the candidate modulator or modulators are capable of modulating (eg decreasing or increasing) the expression of an encoding elF4E of the nucleic acid molecule, the modulator can then be employed in other studies investigating the function of elF4E, or for use as an investigation, a diagnosis, or therapeutic agent in accordance with the present invention. In general, the activity of the dhRNA constructs correlated with the activity of the ARase antisense double-stranded compound chain structures directed to the same site. Vickers et al., J. Biol. Quim., 2003, 278, 7108. Thus sequences that are active as either single antisense braided compounds (eg, H-dependent compounds of the ARase) can be used to design chain structure compounds double antisense (eg of the siRNA) and vice versa. Suitable segments of the subject of the present invention can be combined with their respective complementary antisense compounds to form stabilized double chain structure (duplicate) compounds. Such oligomeric portions of double-stranded structure of the compounds have been demonstrated in the art to modulate the expression of the target and to regulate translation as well as the RNA processing via an antisense mechanism. On the other hand, the double chain structure portions may be subject to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene. , 2001, 263, 103-112, Tabara et al., Science, 1998, 282, 430-431, Montgomery et al., National Proc. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al. al., developer of genes, 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., developer of the genes 2001, 15, 188-200). For example, such double-stranded structure portions have been shown to inhibit the target by the classical hybridization of the duplex to the antisense strand structure to the target, thereby driving the enzymatic degradation of the target (Tijsterman et al., Science , 2002, 295, 694-697). The H-based antisense ARase (which generally uses individual chain structure compounds) and the siRNA (which you generally use double chain structure compounds) are antisense mechanisms, typically resulting in the loss of function of the target RNA. The optimized siRNA and the H-dependent oligomeric compounds of the ARase behave similarly in terms of potency, maximum effects, specificity and duration of action, and efficacy. On the other hand it has been shown that in the general, activity of the dhRNA constructs correlated with the activity of the H-dependent antisense individual chain structure compounds of the ARase directed to the same site. An important exception is that the antisense H-dependent compounds of the ARase were generally active against target sites in pre-messenger RNA whereas they were not the siRNAs. Vickers et al., J. Biol. Quím., 203, 278, 7108. The oligomeric compounds of the present invention can also be applied in the areas of drug discovery and objective validation. The present invention comprises the use of the appropriate target compounds and segments identified herein in efforts to discover drugs to produce relationships that exist between the F4E and a disease state, phenotype or condition. These methods include detecting or modulating elF4E comprising contacting a sample, tissue, cell or organism with one or more antisense compounds of the present invention, measuring the level of elF4E nucleic acid or protein and / or phenotypic or chemical related endpoint. at some time after the treatment, and optionally comparing the measured value with an untreated sample or a sample treated with a further compound of the invention. These methods can also be performed to stop it or in combination with other experiments to determine the function of unknown genes for the target validation process or to determine the validity of a particular gene product as an objective for the treatment or prevention of a disease, condition or particular phenotype.

E. Equipment, Research Reagents, Diagnostics and Therapeutics.

The oligomeric compounds of the present invention can be used for diagnosis, therapeutics, prophylaxis and as a reagent and research equipment. In addition, oligomeric compounds, which can inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to clarify the function of particular genes or to distinguish between the functions of several members of a biological pathway. For use in equipment and diagnostics, the compounds of the present invention, alone or in combination with the other compounds or therapeutically, can be used as tools in differentiated and / or combinatorial analyzes and to clarify patterns of the expression of a portion or of the whole complement of genes expressed within cells and tissues. As a non-limiting example, patterns of expression within cells or tissues treated with one or more compounds are compared to control cells or tissues not treated with the compounds and the patterns produced are analyzed for differentiated levels of gene expression while belonging, for example, to the association of disease, signaling pathway, cellular localization, level of expression, size, and the structure or function of the genes examined. These analyzes can be carried out by stimulating the cells or without stimulating them and in the presence or absence of other components that affect expression patterns.

Examples of gene expression analysis methods known in the art include arrays or DNA arrays (Brazma et al., FEBS Lett., 2000, 480, 17-24; Celis et al., FEBS Lett., 2000, 480, 2-16), WISE (the serial analysis of gene expression) (Madden et al., Drugs, Discov.Today, 2000, 5, 415-425), LEE (Enzyme amplification of the restriction of Digested DCNcAs) (Prashar et al., Methods Enzymol., 1999, 303, 258-72), TOGA (total analysis of gene expression) (Sutcliffe et al., National Proc. Acad. Sci. USA, 2000, 97, 1976-81, orders of the protein and proteomics (Celis et al., FEBS Lett., 2000, 480, 2-16; Jungblut et al., Electrophoresis, 1999, 20, 2100-10), label expressed of the ordering sequence (EST) (Celis et al., FEBS Lett., 2000, 480, 2-16, Larsson et al., J. Biotechnol., 2000, 80, 143-57), subtractive fingerprint of RNA (hangover) (Fuchs et al., Anal. Biochemistry, 2000, 286, 91-98; Larson et al., Citometry, 2000, 41, 203-208), subtractive reproduction, differential display (DD) (Jurecic et al., Curr. Opin. Microbiology, 2000, 3, 316-21), comparative genomic hybridization (Carulli et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH techniques (fluorescent in situ hybridization) (Going et al. ., Eur. J. Cancer, 1999, 35, 1895-904) and methods of mass spectrometry (a, Comb. Chem. High Processing Performance Screen, 2000, 3, 235-41). The -specificity and antisense sensitivity is also improved by those skilled in the art for therapeutic uses. Antisense compounds have been used as therapeutic portions in the treatment of disease states in animals: including humans. Antisense drugs, including ribozymes, have been safely and effectively administered to humans and in numerous clinical trials currently underway. It is thus established that antisense compounds are useful therapeutic modalities that can be configured to be useful in treatment regimens, for the treatment of cells, tissues and animals; especially human beings. Treatment of selected animals of companion, zoo, and farm animals, including, but not limited to, cats, dogs, rodents, horses, cows, sheep, pigs, goats, etc. it is contemplated by the present invention. For therapeutic purposes, an animal, such as a human being, under the suspicion of having a disease or a disorder that can be treated, modulating the expression of elF4E, is treated by the administration of compounds according to this invention. For example, in a non-limiting embodiment, the methods encompass the step, of a series of several steps, of administering to the animal in need of such treatment, a therapeutically effective amount of oligomeric compounds that inhibit elF4E. The elF4E compounds of the present invention effectively inhibit the activity or expression of a nucleic acid encoding RNA of the elF4E factor. Because the reduction in RNA levels of the elF4E factor can lead to reduction in elF4E protein levels as well, reduction in protein expression or levels can also be measured. In some modalities, the animal is diagnosed for disease or disorder, prior to treatment. In one embodiment, the oligomeric compounds modulate the activity or expression of the messenger RNA of elF4E by at least about 10%, by at least about 20%, by at least about 25%, by at least about from 30%, in at least about 40%, in at least 'about 50%, in at least about 60%, in at least about 70%, in at least about 75%, in at least about 80%, in at least about 85%, in at least about 90%, in at least about 95%, in at least about 98%, in at least about of 99%, or close to 100%. For example, the reduction of elF4E expression can be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal. The cells contained within the liquids, tissues or said organs that are analyzed can contain a nucleic acid molecule encoding elF4E protein or the elF4E protein itself. The compounds of the invention can be used in pharmaceutical compositions by adding an effective amount of a compound to a suitable excipient, diluent or pharmaceutically or physiologically acceptable carrier. The use of the compounds and methods of the invention may also be useful prophylactically. Thus, the present invention encompasses the use of the compounds disclosed herein as pharmaceuticals, as well as the use of the compounds currently disclosed for the preparation of the drugs for the treatment of disorders as disclosed herein. The compounds of the present invention inhibit the expression of elF4E. Because these compounds inhibit the effects of elF4E activation, the compounds are useful in the treatment of disorders related to the expression of elF4E. Thus, the compounds of the present invention are antineoplastic agents. The present compounds are believed to be useful in the treatment of carcinomas such as neoplasms of the central nervous system: glioblastoma multiforme, asyndocytoma, oligodendroglial tumors, choroidal and ependymal plexus tumors, pineal tumors, neuronal tumors, medulloblastoma, malignant schwannoma, meningioma, sarcoma meningeal; neoplasms of the eye: basic carcinoma of the cell, spinous cell carcinoma, melanoma, rhabdomyosarcoma, retinoblastoma; neoplasms of the endocrine glands: pituitary neoplasms, neoplasms of the thyroid, neoplasms of the adrenal cortex, neoplasms of the neuro-endocrine system, neoplasms of the endocrine gastroenteropancreatic system, neoplasms of the gonads; neoplasms of the head and neck: cancer of the head and neck, oral cavity, pharynx, larynx, odontogenic tumors; neoplasms of the thorax: non-small cell lung carcinoma, small cell lung carcinoma, large cell lung carcinoma, thoracic neoplasms, bad mesothelioma, thymomas, primary cellular germ cell tumors of the thorax; neoplasms of the alimentary canal: neoplasms of the esophagus, neoplasms of the stomach, neoplasms of the liver, neoplasms of the gallbladder, neoplasms of the exocrine pancreas, neoplasms of the small intestine, worm-shaped appendix and peritoneum, adenocarcinoma of the colon and rectum, neoplasms of the anus; neoplasms of the genitourinary area: renal cell carcinoma, neoplasms of the renal pelvis and ureter, neoplasms of the bladder, neoplasms of the urethra, neoplasms of the prostate, neoplasms of the penis, neoplasms of the testicle; neoplasms of the female reproductive organs: neoplasms of the vulva and vagina, neoplasms of the cervix, adenocarcinoma of the uterine collection, ovarian cancer, gynecological sarcomas; neoplasms of the chest; neoplasms of the skin: basic carcinoma of the cell, spinous cell carcinoma, dermatofibrosarcoma, Merkel cell tumor; bad melanoma; neoplasms of bone and soft tissue: osteogenic sarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, primitive neuroectodermal tumor, angiosarcoma; neoplasms of the hematopoietic system: myelodysplastic syndromes, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, leukemia / T-cell lymphoma (HTLV-1), chronic lymphocytic leukemia, hairy cell leukemia, Hodgkin's disease, non-Hodgkin's lymphomas , mast cell leukemia; and neoplasms of children: acute lymphoblastic leukemia, acute myelocytic leukemia, neuroblastoma, bone tumors, rhabdomyosarcoma, lymphomas, rtenal tumors.

Thus, in one embodiment, the present invention provides a method for the treatment of susceptible neoplasms which comprises administering to a patient in need thereof, an effective amount of an isolated single chain structure RNA or an RNA oligonucleotide of double chain structure pointed to elF4E. The shRNA or dhRNA oligonucleotide may be modified or unmodified. That is, the present invention provides the use of an isolated double-stranded RNA structure oligonucleotide directed to elF4E, or a pharmaceutical composition thereof, for the treatment of susceptible neoplasms. In another aspect, the present invention provides the use of an oligonucleotide compound of double-stranded structure isolated from RNA in the manufacture of a medicament for the inhibition of either the expression or overexpression of elF4E. Thus, the present invention provides the use of an oligonucleotide of double-stranded structure isolated from RNA directed to elF4E in the manufacture of a medicament for the treatment of susceptible neoplasms by means of the method described above. The compounds of the present invention are useful for the treatment of hyperproliferative disorders. Specifically, the compounds of the present invention are useful for the treatment of cancer. The compounds of the present invention are particularly useful for the treatment of solid tumors. Thus, the compounds of the present invention are especially useful for the treatment of breast cancer, colon cancer, prostate cancer, lung cancer, liver cancer, bladder cancer, ovarian cancer, of renal cancer and glioblastoma. The antisense compounds of the present invention are particularly useful for the treatment of solid tumors.

F. Modifications As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is usually a heterocyclic base (sometimes referred to as a "nucleobase" or simply a "base"). The two most common classes of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides that also include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to any 2 \ 3 'or 5' or hydroxyl portion of the sugar. In the formation of the oligonucleotides, the phosphate covalently groups the nucleosides adjacent one another to form a linear, polymeric compound. In turn, the respective ends of this linear polymeric compound can be further assembled to form a circular compound, however, linear compounds are generally desired. In addition, the linear compounds can have internal complementarity of the nucleobase and can therefore bend in a way to produce a compound completely or partially of double-stranded structure. Within the oligonucleotides, the phosphate groups are commonly referred to as the oligonucleotide internucleoside backbone builders. The linkage or the normal RNA and DNA skeleton is a 3 'to 5' phosphodiester linkage.

Modified sugar and internucleoside bonds. Specific examples of oligomeric antisense compounds useful in the present invention include oligonucleotides containing, for example, non-naturally occurring internucleoside linkages. As defined in this specification, the oligonucleotides having internucleoside-modified bonds include the internucleoside bonds that retain a phosphorus atom and the internucleoside linkages that do not have a phosphorus atom. For the purposes of this specification, and as sometimes referred to in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside skeleton, can also be considered as oligonucleosides. The oligomeric compounds of the invention may have one or more modified internucleoside linkages. A phosphorylated linkage of the internucleoside is the internucleoside linkage of the phosphorothioate. Other modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other phosphonates including 3'-alkylene phosphonates, alkyl 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including phosphoramidate. '-amino and the aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, phosphonoacetate and thiophosphonoacetate (see Sheehan et al., Nucleic Acid Research, 2003, 31 (14), 4109-4118 and Dellinger et al., J. Am. Chem. Soc, 2003, 125, 940-950), selenophosphates and boranophosphates having 3'-5 'bonds, 2'-5' analogs bound to normal thereof, and those having inverted polarity wherein one or more internucleotide links are 3 'to 3', 5 'to 5' 'or 2' 2 '. Polynucleotides that reverse polarity encompass a simple 3 'to 3' bond in the 3'-plus internucleotide bond, for example, an inverted simple nucleoside residue that can be 'abasic' (the nucleobase is missing or has an hydroxyl group instead of him). Various salts, mixed salts and free acid forms are also included. N3'-P5'-phosphoramidates have been reported to exhibit a high affinity towards a complementary resistance of the chain structure and of the RNA nuclease (Gryaznov et al., J. Am. Chem. Soc, 1994, 116, 3143 -3144). N3'-P5'-phosphoramidates have been studied with some success in vivo to specifically down-regulate the expression of the c-myc gene (Skorski et al., National Proc. Acad. Scí., 1997, 94, 3966-3971; and Faira et al., Biotechnol. National, 2001, 19, 40-44). Patents, representative of the United States, which teach the preparation of the above-mentioned phosphorus bonds include, but are not limited to, United States: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; . 278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; . 453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; . 536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; . 587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which, here, is incorporated for reference. In some embodiments of the invention, the oligomeric compounds may have one or more phosphorothioate and / or heteroatomic internucleoside linkages, in particular -CH2-NH-0-CH2-, -CH2-N (CH3) -0-CH2- ( known as a methylene (methylimino) or MMI backbone), -CH2-0-N (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2- and -O- N (CH3) - CH2-CH2- (wherein the internucleotide bond of the native phosphodiester is represented as -OP (= O) (OH) -0-CH2-).

The internucleoside bonds of the MMI type are described in the above-referenced patent 5,489,677 of the United States. The internucleoside linkages of the amide are described in the above-referenced US Pat. No. 5,602,240. Some skeletons of the oligonucleotide that do not include a phosphorus atom in them have backbones that are formed by the short chain bonds of the alkyl or cycloalkyl internucleoside, the hetero-atom and the mixed alkyl or the cycloalkyl internucleoside bonds, or or more short chain heteroatomic or heterocyclic internucieoside linkages. These include those that have morpholino bonds. (formed in part of the sugar portion of a nucleoside); siloxane skeletons; skeletons of sulfur, sulfoxide and sulfone; skeletons of formacetyl and thioformacetyl; skeletons of methylene formacetyl and thioformacetyl; riboacetyl skeletons; alkene containing skeletons; sulfamate skeletons; skeletons of methyleminomine and methylenehydrazino; Sulfonate and sulfonamide skeletons; skeletons of the amide; and others having mixed parts of the N, O, S and CH2 component. Representative United States patents that teach the preparation of the above-mentioned oligonucleosides include, but are not limited to, United States: 5,034,506; 5,166,315; 5,185,444; . 214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; . 405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and . 677,439, each of which, here, is incorporated by reference. Another group of oligomeric compounds favorable to the present invention includes oligonucleotide mimetics. The term mimetic as applied to oligonucleotides is thought to include oligomeric compounds wherein the furanose ring, or furanose ring and internucleotide linkage, are replaced by new groups, the replacement of only the furanose ring is also referred to in art as being a substitute for sugar. The heterocyclic base subunit or a modified heterocyclic base subunit is maintained for hybridization with an appropriate target nucleic acid. Such an oligomeric compound, an oligonucleotide mimic that has been shown to have excellent hybridization characteristics, is referred to as a peptide nucleic acid (ANP). Nielsen et al., Science, 1991, 254, 1497-1500. The ANPs have favorable hybridization characteristics, high biological stability and are, electrostatically, neutral molecules. In a recent ANP study, the compounds were used to correct an aberrant division in a transgenic mouse model (Sazani et al., Biotechnol. Nacional, 2002, 20, 1228-1233). In oligomeric ANP compounds, the sugar backbone of an oligonucleotide is replaced by an amide containing a backbone, in particular an amindethylglycine backbone. The nucleobases are directly or indirectly linked (-C (= 0) -CH2- as shown below) to the nitrogen atoms of the aza nitrogen of the amide moiety of the skeleton. Representative patents of the United States, which teach the preparation of the ANP oligomeric compounds include, but are not limited to, the United States: 5,539,082; 5,714,331; and 5,719,262, each of which, here, is incorporated by reference. The ANP compounds can be obtained commercially from Applied Biosystems (City Foster, CA, E.E.U.U.). The numerous modifications to the skeleton of the basic ANP are known in the art; particularly useful are ANP compounds with one or more amino acids conjugated to one or both terminals. In detail, lysine 1-8 residues or arginine residues are useful when conjugated to the end of an ANP molecule. Another class of mimic oligonucleotide that has been studied is based on the morpholino linked units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups linking the monomeric units of the morpholino to a morpholino nucleic acid have been reported. A class of linking groups has been selected to give a nonionic oligomeric compound. Non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins (Braasch et al., Biochemistry, 2002, 41 (14), 4503-4510). The oligomeric compounds based on morpholino have been studied in zebrafish embryos (see: Genesis, volume 30, edition 3, 2001 and Heasman, J., Biol., 2002, 243, 209-214). Other studies of morpholino-based oligomeric compounds have also been reported (see: Nasevicius et al., National Genet, 2000, 26, 216-220; and Lacerra et al., National Proc., Acad. Sci., 2000, 97). , 9591-9596). Morpholino-based oligomeric compounds are described in U.S. Patent 5,034,506, published July 23, 1991. The morpholino class of oligomeric compounds has been prepared by having a variety of different groups that were ligated, joined to the subunits monomeric Binding groups can be varied from chiral to achiral, and charged to neutral. U.S. Patent 5,166,315 discloses linkages including -0-P (= 0) (N (CH 3) 2) -0-; U.S. Patent 5,034,506. discloses achiral link of intermorfolino; and U.S. Patent 5,185,444. describes phosphorus containing chiral intermorpholino bonds. Another class of the mimic oligonucleotide refers to nucleic acids of cyclohexenyl (CeAN). The furanose ring normally present in a DNA or RNA molecule is replaced by a cyclohenil ring. The protected phosphoramidite monomers of ANCe DMT have been prepared and used for the synthesis of compounds following the classical phosphoramidite chemistry. Completely modified compounds and oligomeric oligonucleotides of ANCe having specific positions modified with ANCe have been prepared and studied (see Wang et al., J. Am. Chem. Soc, 2000, 122, 8595-8602). In general the incorporation of the ANCe monomers into a DNA strand increases the stability of a DNA / RNA hybrid. Oligoadenylates from ANCe formed complexes with RNA and DNA complements with stability similar to native complexes. The study of the incorporation of ANCe structures into the natural nucleic acid structures was demonstrated by NMR and circular dichroism to proceed with easy conformational adaptation. In addition, the incorporation of ANCe into a sequence that targeted the RNA was stable to the serum and activation of the E. coli ARase, resulting in the cleavage of the target RNA strand structure. Another modification includes bicyclic portions of the sugar for example "Closed Nucleic Acid" (ANCs) in which the 2'-hydroxyl group of the ribosyl sugar ring is linked to the carbon atom 4 'of the sugar ring such that it forms a 2'-hydroxyl group. '-C, 4'-C-oxymethylene linkage to form the bicyclic portion of sugar (reviewed in Elayadi et al., Curr Opinion Invens, Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8 1-7; and Orum et al., Curr. Mol. De la Opinión Ther., 2001, 3, 239-243; see also United States Patents: 6,268,490 and 6,670,461). The bond can be a methylene group (-CH2-) bridging the 2 'oxygen atom and the 4S carbon atom for which the term ANC is used for the bicyclic portion; in the case of an ethylene group in this position, the term ENA ™ is used (Singh et al., Chem. Commun., 1998, 4, 455-456; ENA ™: Morita et al., Bioorganic medicinal chemistry, 2003, 11, 2211-2226). ANC and other sugar bicyclic analogues exhibit very high double thermal stabilities with both complementary DNA and RNA (Tm = +3 to +10 C), stability towards 3'-exonucleolytic degradation and good solubility characteristics. The ANCs are available commercially through "ProLigo" (Paris, France, as well as Boulder, CO, E.E.U.U.). An isomer of ANC that has also been studied is V-L-LNA that has been shown to have superior stability against a 3'-exonuclease (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The V-L-LNAs were incorporated into gapmers and antisense chimeras that demonstrated potent antisense activity. Another bicyclic portion of the similar sugar that has been prepared and studied has the bridge going from the 3'-hydroxyl via a single methylene group to the carbon atom 4 'of the sugar ring in such a way that it forms a 3'-C, 4 bond. '-C-oxymethylene (see U.S. Patent 6,043,060). The conformations of ANCs determined by spectroscopy 2D of RNM have shown that the closed orientation of ANC nucleotides, both ANC of single and double chain structure, binds the phosphate skeleton in such a way as to introduce a higher population of the N-type conformation (Petersen et al., Mol. of J. Recognit., 2000, 13, 44-53). These conformations are associated with improved stacking of nucleobases (Wengel et al., Nucleoside nucleotides, 1999, 18, 1365-1370). ANC has been shown to conformed duplexes of ANC: remarkably stable ANC (Koshkin et al., J. Am. Chem. Soc, 1998, 120, 13252-13253). The ANC: ANC hybridization was shown to be the most thermally stable duplex nucleic acid type system, and the ANC mimic RNA character was established at the double level. Introduction of 3 monomers of ANC (T or A) significantly increased the melting points (Tm = + 15 / + 11) towards DNA complements. The universality of ANC-mediated hybridization has been stressed by the formation of overly stable dupls of ANC: ANC. The RNA-mimicry of ANC was reflected with respect to the conformational restriction of the type N of the monomers and of the secondary structure of the duplo of ANC: RNA. ANCs also double form with complementary DNA, RNA or ANC with highly thermal affinities. Spectra of circular dichroism (DC) show that the duplexes involving completely modified ANCs (especially ANC: RNA) structurally resemble a duplo of the form-A RNA: RNA. Nuclear magnetic resonance (NMR) examination of a duplex ANC: DNA confirmed the 3'-endo conformation of an ANC monomer. DNA recognition of double-stranded structure has also been demonstrated by suggesting the invasion of the chain structure by ANC. Mismatched sequence studies show that ANCs obey Watson-Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference chain structures. The chimeras of DNA. ANC have been shown to efficiently inhibit gene expression when targeted to a variety of regions (5'-untranslated region, codon region of the coding region or region) within the messenger RNA of luciferase (Braasch et al., Research of nucleic acids, 2002, 30, 5160-5167). Potent and non-toxic antisense oligonucleotides containing ANCs have been described (Wahlestedt et al., Proc. National, Acad. Sci. USA A, 2000, 97, 5633-5638.) The authors have shown that ANCs confer various desired characteristics to antisense agents. The ANC / DNA copolymers were not easily degraded in extracts from the serum and from the blood cell. The ANC / DNA copolymers exhibited potent antisense activity in assay systems as disparate as the G-protein receptor coupled to the rat brain and the detection of reporter genes in Escherichia coli. The efficient Lipofectin-mediated delivery of ANC in breast cancer cells in living humans has also been achieved. Other successful live studies involving ANC's have shown the downward precipitation of the opioid delta receptor from the rat without toxicity (Wahlestedt et al., National Proc.Accid. Sci., 2000, 97, 5633-5638) and in another study demonstrated an obstruction of the translation of the long subunit of RNA polymerase II (Fluiter et al., nucleic acids Res., 2003, 31, 953-962). The synthesis and preparation of the monomers, adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil of ANC, together with their oligomerization, and the characteristics of nucleic acid recognition have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). ANCs and the preparation of that are also described in. The first ANC analogues, phosphorothioate-ANC-ANC and 2'-thio-ANCs, have also been prepared (Kumar et al., Bioorg, Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of blocked nucleoside analogs containing duplo of oligodeoxyribonucleotide as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). In addition, the synthesis of 2'-amino-ANC, a new conformationally restricted high-affinity oligonucleotide analogue has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039) . In addition, 2'-Amino- and 2'-methylamino ANC's have been prepared and the thermal stability of their duplo with the complementary RNA and DNA strand structures has been previously reported. Another mimetic oligonucleotide favorable to the present invention that has been prepared and studied is threose nucleic acid. This mimic oligonucleotide is based on threose nucleosides instead of ribose nucleosides. Initial interest in nucleic acid from (3 ', 2') - V-L-threose (ANT) was addressed to the question of whether there was a DNA polymerase that would copy the ANT. It was found that certain DNA polymerases can copy limited stretches of an ANT template (disclosed in C & amp;; EN / January 13, 2003). In another study it was determined that ANT is capable of low Watson-Crick pairing of the antiparallel with complementary oligonucleotides of DNA, RNA and ANT (Chaput et al., J. Am.

Chem. Soc, 2003, 125, 856-857). In one study (3 ', 2' nucleic acid) - L-threose was prepared and compared to the 2 'and the 3' amidate analogues (Wu et al., Organic letters, 2002, 4 (8), 1279 -1282). The amidate analogs were demonstrated in the loop to RNA and DNA with strength comparable to that of RNA / DNA. Additional mimetics of the oligonucleotide have been prepared to include bicyclic and tricyclic nucleoside analogs (see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439; Steffens et al., J. Am. Chem. Soc. , 1999, 121, 3249-3255, Renneberg et al., J. Am. Chem. Soc, 2002, 124, 5993-6002, and Renneberg et al., Nucleic Acids Res., 2002, 30, 2751-2757). These modified nucleoside analogs have been oligomerized through the approach of phosphoramidite and resulting oligomeric compounds containing tricyclic nucleoside analogs have demonstrated increased thermal stabilities (Tms) when crossed by hybridization to DNA, RNA and itself. Oligomeric compounds containing bicyclic analogs of the nucleoside have demonstrated the thermal stabilities that approximated that of the DNA duplos. Another class of the mimic oligonucleotide is referred to as phosphonomonoester nucleic acids that incorporate a phosphorus group in the backbone. This class of olignucleotide mimetic is disclosed to have useful physical and biological and pharmacological characteristics in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as a probe for the detection of nucleic acids. and as auxiliaries for use in molecular biology. Additional oligonucleotide mimetics favorable to the present invention have been prepared wherein a cyclobutyl ring replaces the furanosil ring naturally occurring. The oligomeric compounds may also contain one or more substituted portions of the sugar. Suitable compounds can encompass one of the following at the 2 'position: Oh; F; O -, S -, or N-n-alkyl; O-, S-, or N-n-alkenyl; O-, s or N-alkynyl; or O-alkyl-O-o-alkyl-O-alkyl, wherein the alkyl, the alkenyl and the alkynyl can be substituted or C1 without substituting the C10 alkyl or the C2 for the C10 alkenyl and the alkynyl. Particularly convenient are 0 ((CH2) nO) mCH3, 0 (CH2) nOCH3, 0 (CH2) nNH2, 0 (CH2) nCH3, 0 (CH2) nONH2, and 0 (CH2) nON ((CH2) nCH3) 2, where nyma are from 1 to about 10. Other oligonucleotides encompass one of the following at the 2 'position: C1 to C10 lower alkyl, lower alkyl substituted, alkenyl, alkynyl, alkaryl, aralkyl, Oo-alkaryl or O-aralkyl, SH, SCH3 > OCN, cl, Br, CN, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkyl, aminoacylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic characteristics of an oligonucleotide, or a group for improving the pharmacodynamic characteristics of an oligonucleotide, and other substitutes having similar characteristics. A modification includes 2'-methoxy-oxy (2'-0-CH2CH2OCH3, also known as 2'-0- (2-methoxyethyl) or 2'-moe) (Martin et al., Helv. Chim. Acta, 1995 , 78, 486-504) that is, a group of the alkoxyalkoxy. Another modification includes 2'-dimethylamino oxyethoxy, that is, a group 0 (CH 2) 2ON (CH 3) 2, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also known in art as 2'-0-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), that is, 2'-O-CH2-0-CH2-N (CH3) 2, also described in the examples below. Other modifications include 2'-methoxy (2'-0-CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH = CH2), 2'-O-allyl ( '-O-CH2-CH = CH2) and 2'-fluoro (2'-F). The 2'-modification may be in the arabino position (up) or the ribo position (below). A 2'-arabino modification is 2'-F. Similar modifications can also be made in other positions with respect to the oligonucleotide, particularly the 3 'position of the sugar with respect to the 3' terminal nucleotide or in the '2'-5 linked oligonucleotides and the 5' terminal 5 'position nucleotide. Antisense compounds can also have sugar mimetics such as portions of the cyclobutyl in place of pentofuranosyl sugar. Representative patents of the United States that teach the preparation of such modified sugar structures include, but are not limited to, United States: 4,981,957; 5,118,800; 5,319,080; 5,359,044; . 393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; . 567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; . 627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; . 792,747; and 5,700,920, each of which is hereby incorporated by reference in its entirety. In one aspect of the present invention the oligomeric compounds include the synthetic modified nucleosides to induce a conformation of the 3'-endo sugar. A nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar portion or both to induce a desired conformation of the 3'-endo sugar. These modified nucleosides are used to mimic RNA as nucleosides in order to be able to enhance particular characteristics of an oligomeric compound while maintaining the desirable 3'-endo conformational geometry. There is a clear preference for a double of the type of RNA (helix of the form of A, predominant 3'-endo) as a requirement (eg trigger) of RNA interference that is supported in part by the fact that duplo integrated by 2 '-deoxy-2'-F-nucleosides appear efficient in triggering the RNAi response in the C. elegans system. Characteristics that are enhanced using more stable 3'-endo nucleosides include but are not limited to: modulation of characteristics pharmacokinetics with the modification of protein binding, protein out of regime, absorption and separation; modulation of nuclease stability as well as chemical stability; modulation of oligomer binding affinity and specificity (affinity and specificity for enzymes as well as for complementary sequences); and increase efficiency of RNA cleavage. The present invention provides oligomeric RNAi triggers having one or more nucleosides modified in such a manner as to favor a conformation of the C3'-endo type. The conformation of the nucleoside is influenced by several factors including substitution at the 2 ', 3' or 4 'positions of pentofuranosyl sugar. Electronegative substitutes generally prefer axial positions, while sterically demanding substitutes generally prefer equatorial positions (the principles of nucleic acid structure, Wolfgang Sanger, 1984, Springer-Verlag.) Modification of position 2 'to favor the conformation 3'-endo can be achieved while maintaining the 2'-oh as an element of recognition, as illustrated in table 2, below (Gallo et al., tetrahedron, 2001, 57, 5707-5713. Harry-O'kuru et al., J. Org. Chem., 1997, 62 (6), 1754-1759 and Spiga et al., J. Org. Chem., 1999, 64, 747-754.) Alternatively, the preference for 3'-endo conformation can be achieved by the deletion of 2'-OH as exemplified by 2'deoxy-2'F-nucleosides (Kawasaki et al., J. Med. chem., 1993, 36, 831-841), which adopts the 3'-endo conformation that places the electronegative fluorine atom in the axial position. Other ribose modifications sound, for example substitution at the 4 'position to give modified 4'-F nucleosides (Guillerm et al., Bioorganic and Medicinal Chemical Letters, 1995, 5, 1455-1460; and Owen et al., J. Chem. Org., 1976, 41, 3010-3017), or for example modification to the methanocarba nucleoside analogs of production (Jacobson et al. J. Med. Chem. Lett., 2000, 43, 2196-2203; and Lee et al., Bioorganic and Medicinal Chemical Letters, 2001, 11, 1333-1337) also induce preference for 3'-endo conformation. Along similar lines, the oligomeric triggers of the RNAi response could be composed in such a way that the conformation is blocked in a C3'-endo type conformation, ie the nucleic acid blocked modified one or more nucleosides ( ANC, Singh et al, Chem. Commun., 1998, 4, 455-456), and ethylene bridged nucleic acids (ENA, Morita et al, Bioorganic and medicinal letters of chemistry, 2002, 12, 73-76.). A conformation of modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and DC measurements. Therefore, modifications predicted to induce RNA taste conformations, duplex geometry of form A in an oligomeric context, are selected for use in the modified oligonucleotides of the present invention. The synthesis of numerous modified nucleosides favorable to the present invention is known in the art (see, for example, chemistry of nucleosides and nucleotides vol 1-3, ed.

Leroy B. Townsend, 1988, full pressure, and the examples section below.) The terms used to describe the conformational geometry of homoduple nucleic acids are "Form A" for RNA and "Form B" for DNA The respective conformational geometry for the RNA and DNA duplo was determined from X ray diffraction analysis of the nucleic acid fibers (Arnott and Hukins, Biochemistry, Biophis, Res. Comm., 1970, 47, 1504. ) In general, the double RNA: RNA are more stable and have higher temperatures that melt (Tms) than DNA duplos: DNA (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York , NI, Lesnik et al., Biochemistry, 1995, 34, 10807-10815; Conté et al., Nucleic acids Res., 1997, 25, 2627-2634). The increasing stability of RNA has been attributed to several structural characteristics, most notably the improved stacking interactions of the base resulting from a geometry of form A (Searle et al., Nucleic acids Res., 1993, 21, 2051-2056). The presence of the 2'-hydroxyl in RNA predisposes the sugar towards the fold of the C3 'endo, that is, also indicated as a northern fold, which makes the duplo favor the geometry of the form A. In addition, the 2'-hydroxyl groups of RNA they can form a network of hydrogen-water-mediated bonds that help stabilize the RNA double (Egli et al., Biochemistry, 1996, 35, 8489-8494). On the other hand, the nucleic acids of the deoxy prefer a sugar fold of the less stable endo C2 ', that is, also known as the Southern fold, which is thought to impart a geometry of the B form (Sanger, 1984). (from the nucleic acid structure, Springer-Verlag, New York, Nl). As used herein, the geometry of form B is inclusive of C2'-endo fold and 04'-endo fold. This is consistent with Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, which pointed out that in considering the furanose conformations that give rise to the consideration of the duplos of form B it should also be given a contribution of the fold of 04 '-endo. The DNA hybrid clusters: RNA, however, are generally less stable than duplo pure RNA: RNA, and depending on their sequence can be more or less stable than DNA duplo: DNA (Searle et al., Nucleic acids Res., 1993, 21, 2051-2056). The structure of a hybrid double is intermediate between the geometries of A and of form B, which can lead to poorly stacked interactions (Lane et al., Biochemistry of Eur. J., 1993, 215, 297-306; Fedoroff et al., Mol., J. Biol., 1993, 233, 509-523; González et al., Biochemistry, 1995, 34, 4969-4982; Horton et al., Mol. Del J. Biol., 1996, 264, 521-533). The stability of the duplo formed between an RNA of the target and a synthetic sequence is central to therapies for example but not limited to antisense and RNA interference as these mechanisms require the linkage of a synthetic chain structure of the oligomer to a chain structure of the RNA target. In the antisense case, effective inhibition of messenger RNA requires that antisense DNA have a very high binding affinity to messenger RNA. Otherwise the desired interaction between the synthetic chain structure of the oligomer and the chain structure of the target messenger RNA will occur infrequently, resulting in decreased effectiveness. A commonly used method of modifying the packing of the sugar (puckering) is the subsiiution of the sugar in the 2'-position with a substitute group that influence the geometry of the sugar. The influence on the conformation of the ring is dependent on the nature of the substitution in the 2S position. A number of different substances have been studied to determine its puckering effect of sugar. For example, 2'-halogens have been shown to show that the fluoro 2 'derivative exhibits the largest population (65%) of the C3' endo form., and iodine shows 2 to the lowest population (7%). The populations of adenosine (2'-OH) against deoxyadenosine- (2'-H) are 36% and 19%, respectively. In addition, the efflux of the fluoro 2 'group of the adenosine dimers (2'fluoro-adenosine-2'-deoxy-2'-fluoroadenosine) correlates more closely to the stabilization of the stacked conformation. As expected, the relative duplex stability can be enhanced by the replacement of the 2'-OH groups with the 2'-F groups in such a way that they increase to the C3'-endo population. It is assumed that the highly polar nature of the 2'F bond and the ex treme preference of the C3'-endo can accommodate the stacked conformation in a double of form A. The data of UV hypochromicity, circular dichroism, and 1H NMR also indicate that the degree of stacking decreases as the electronetjativity of the halo subsides. In addition, a spherical bulleus in the 2 'position of the sugar portion is better accommodated in a double of form A than a double of form B. Thus, a 2' substitution in the 3 'terminal of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, puckering preference of the furanose, electrosylic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substitute effects are thought to be determined by the molecular size, electronegaíivity, and hydrophobicity of the substrate. The boiling emulsions of complementary chain oligonucleotides were also increased with the 2'-subsalid diphosphines of adenosine. It is not clear whether the preference of the endo 3 'of the conformation or the presence of the substrate is responsible for the growing link. However, the largest gap of the adjacent bases (stacking) can be achieved with the conformation of endo 3 '. Increasing the percentage of C3'-endo sugars in a modified oligonucleotide directed to a chain reaction of the preorganize RNA target is the chain structure to bind to the RNA. Of the various sugar modifications that have been reported and studied in the literature, incorporation of electron-selective substances such as 2'-fluoro or the 2'-alkoxy change in the conformation of sugar to the (normal) conformation of the endo-pucker. 3'. Esio preorganizes an oligonucleotide which incorporates the modifications to form a conformalional geometry of the form A. The conformation of the form A gives rise to the binding affinity of the oligonucleotide to a chain reaction of the RNA of the object. The representative 2'-subscript is favorable to the present invention to give the conformational characteristics of the A-fo-tma (3'-endo) to the resulting duples including the alkyl 2'-O-alkyl, the 2'-0-substituted alkyl. and the 2'-fluoro substituent groups. Convenient for the subsystem groups are the various alkyl and aryl esters and amines, the amines and the monoalkyl and the dialkyl amines subsumed. It is further thought that the multiple modifications can be made to one or more of the oligomeric compounds of the invention at the multiple sites of one or more monomeric subunits (the nucleosides are convenient) and the in-nucleoside linkages to enhance charac- teristics, for example, but do not limit the activity in a selected use.

Natural and Modified Nucleobases Oligomeric compounds may also include modifications or sub-bases of the nucleobase (often referred to in the ary as the heyrocyclic base or simply as "base"). As used here, "Unmodified nucleobases" or "naíurales" include the adenine of the purine bases (a) and guanine (g), and the pyrimidine base (i), the cyanosine (c) and uracil (u). Modified nucleobases include other syngeneic and naïve nucleobases such as 5-mecylcycinosine (5-me-C), 5-hydroxymethyl, xanin, hypoxanine, 2-aminoadenine, 6-meityl and other alkyl derivatives of adenine and guanine. 2-propyl and other alkyl derivatives of adenine and guanine, 2-iouracil, 2-ioiminoin and 2-iocycinosine, 5-halouracil and cyniosine, 5-propynyl (-) uracil Cc-ch3 and cyanoin and oiro Alkynyl derivatives of the pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-yol, 8-thioaikyl, 8-hydroxyl and you will hear adenines and guanines 8-subsitiated, 5-halo paricularly 5-bromo, 5-trifluoromethyl and other uracils and 5-subsyiid cyanosine, 7-methylaguanine and 7-meyiladenine, 2-F-adenine, 2-amino-adenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Other modified nucleobases include thericric pyrimidines such as phenoxazine citid ina (1 H-pyrimido (5,4-b) (1, 4) benzoxazin-2 (3H) -one), phenoxyzine cyididine (1 H -pyrimido (5, 4-b) (1, 4) benzoyiazine-2 (3H) -one), G-clamps as a subsituid phenoxazine cyididine (eg 9- (2-aminohexy) -H-pyrimido (5,4-b) ( 1, 4) benzoxazin-2 (3H) -one), carbazole cytidine (2H-pyrimido (4,5-b) indol-2 ^ ona), cytidine from pyridoindole (H-pyrido (3? 2 ': 4) , 5) pyrrolo (2, 3-d) pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is substituted by other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Other nucleobases include those disclosed in US Pat. No. 3,687,808 of the United States, those disclosed in the concise encyclopedia of polymer science and engineering, pages 858-859, Kroschwiíz, J.I., ed. Juan Wiley and Sons, 1990, those published by Englisch et al., Angewandie Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, YS, chapter 15, the research and uses of Aníiseníido, pages 289 -302, Crooke, ST and Lebleu, B., ed., press of the CRC, 1993. Closures of these nucleobases are paríicularly useful to increase the binding affinity of the compounds of the invention. Such include pyrimidines 5-subsalides, 6-azapyrimidines and N-2, N-6 and purines subsituted 0-6, including 2-aminopropyladenine, 5-propynyluracyl and 5-propynylcyosine. The 5-methylisocyanin subsides have been demonstrated to increase the acidity of the nucleic acid duplex by 0.6-1.2C and are conveniently lower subsitutions, more particularly when combined with modifications of the 2'-0-methoxy-yl sugar. United States representatives who teach the safe preparation of the modified nucleobases known above as well as other modified nucleobases include, but are not limited to, the above known United States 3,687,808, as well as United States: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; . 594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; . 763,588; 6,005,096; and 5,681,941, each of which is incorporated herein by reference, and United States Patent 5,750,692, which is hereby incorporated by reference. The oligomeric compounds of the present invention can also include polycyclic heterocyclic compounds instead of one or more heterocyclic lower portions. A number of heyerocyclic compounds Iricíclicos have been disclosed previously. These compounds are used routinely in anisic uses to augment the lignite characteristics of the chain structure modified to a chain structure of the target. The modifications studied are pointed to the guanosines for what have been called the G-clamps or the cynidine analogues. Representative analogues that make 3 hydrogen bonds with a guanosine in a second chain statement include 1, 3-diazaphenoxazine-2-one (R10 = O, Rp-R-, 4 = H) (Kurchavov et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846), 1,3-diazaphenoyhiazine-2-one (R10 = S, R11-R14 = H), (Lin ei al, J. Am. Chem of cyclosin, Soc, 1995, 117, 3873-3874) and 6,7,8,9-eierafluoro-1, 3- diazaphenoxazine-2-one (R10 = O, Rn-R14 = F) (Wang et al., Ierahedron Lett., 1998, 39, 8385-8388). Incorporated into oligonucleotides these low modifications were shown to cross hybridization with complementary guanine and the latter was also shown to cross by hybridisation with adenine and to enhance helical thermal stability by exacerbating stacking interactions (also see modified "nucleic acids" given above). of the use of the United States patent filed on May 24, 2002, serial number 10 / 155,920; and resilient "chimeric" oligonucleotides given the United States patent application nuclease filed on May 24, 2002, serial number 10 / 013,295, which are hereby incorporated by reference in their identity). Have been observed hear caracíerísíicas he'Iice-esíabilizaban that when an analog / subsíituto of ciíosina íiene a portion of aminoeíoxi attached to rigid scaffold 1, 3-diazafenoxazina-2-one (R10 = O, Rn = - 0- (CH2) 2-NH2, R.2-14 = H) (Lin et al, J. Am. Chem. Soc, 1998, 120, 8531-8532). Studies that bound demonstrated that a single incorporation could enhance the binding affinity of an oligonucleotide model to its complementary DNA or RNA objeíivo a? Tm of hasia 18 ° concernieníe 5-meíil to cytosine (dC5me), which is the enhancement known affinity for a single modification, still. On the other hand, the increase in helical stability does not compromise the specificity of the oligonucleotides. Oirós heíerocíclicos compuesíos íricíclicos and méíodos of use that are favorable to preseníe use in the invention are described in the serial number 6028183 of paíeníe US, which published the May 22, 2000, and the United States pateníe number of series 6,007,992, which published on December 28, 1999, the conenido that is incorporated here in its ioíalidad.

The enhanced binding affinity of phenoxazine derivatives together with its uncompromised sequence specificity makes it valuable nucleobase analogues for the development of more antisense-based drugs. In fact, the promising data have been derived from the experiments in viiro that showed that the hepanocytes containing phenoxazine substiutions are capable of activating the ARase H, enhancing the cellular consumption and exhibiting a growing aniensis activity (Lin eí al, J. Am Chem. Soc, 1998, 120, 8531-8532). The enhancement of the activity was even more pronounced in the case of the G-clamp, as a single subscript was shown to improve perceptibly the lead in the oligonucleotides of 20mer a 2'-deoxyphosphorus (Flanagan et al., National Proc. Acad. Sci. USA, 1999, 96, 3513-3518). However, in order to optimize the design of the oligonucleotide and to better understand the impact of these heyrocyclic modifications on biological activity, it is important to evaluate its effect on the stability of the oligonucleotide oligonucleotide. Other modified polycyclic heterocyclic compounds such as heimeric cyclic bases are described in but are not limited to, the above known US Pat. Nos. 3,687,808 as well as United States: 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; . 502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,750,692; . 830,653; 5,763,588; 6,005,096; and 5,681,941, and serial number of E.U.A. 09 / 996,292 of the use of pateníe filed on November 28, 2001, each of which is hereby incorporated by reference.

Conjugates Oíra modification of the aniseisenide compounds of the invention chemically involves the binding to the oligomeric compound of one or more portions or conjugations that enhance the activity, cellular dissipation or cellular consumption of the oligonucleotide. These portions or conjugations may include conjugated covalent groups limited to the functional groups as primary or secondary groups of the hydroxyl. The conjugated groups of the invention include polymers, repolar molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic characteristics of oligomers, and groups that enhance the pharmacokinetic characteristics of oligomers. The conjugated groups include lipids, lipids, phospholipids, bioin, tfenazine, folate, phenanthrin, aniraquinone, acridine, fluoresceins, rholamines, coumarins, and the Iinids. Groups that enhance the pharmacodynamic characteristics in the context of this invention include groups that improve consumption, enhance resistance to degradation, and / or consolidate sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic characteristics, in the context of this invention, include groups that improve consumption, dissipation, metabolism or excretion of the compounds of the present invention. The conjugated groups of the representative are described in the use of the international patent PCT / US92 / 09196, filed on October 23, 1992, and the United States patent 6,287,860, the entire access of which is incorporated herein by reference. Conjugated portions include but are not limited to portions of the lipid such as a portion of cholesterol, a cholic acid, an iodide, eg, hexyl-S-yl-yl-y-yl-yl-yiol, an isocholesterol, an aliphatic chain, eg, dodecanediol or undecyl residues, a phospholipid, eg, di-hexadecyl-rac-glyceroi or 1,2-di-O-hexadecyl-rac-glycero-3-H-triethylammonium phosphonation, a polyamine or a polyethylene glycol chain, or acetic acid of the adamanian, a portion of the palmitoyl, or a portion of octadecylamine or of the hexyl amine-o-hexylamino-carbonyl-oxycholesterol-oxylesterol. The compounds of Anisenside of the invention can also be conjugated to the active substances of the drug., for example, aspirin, warfarin, phenylbuzone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) - pranoprofen, carprofen, dansilsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indometicine, a barbiuric, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an amphiboid. Conjugates of the oligonucleotide drug and its preparation are described in the United States patent application 09 / 334,130 (filed June 15, 1999) which is incorporated herein by reference in its entirety. Representative patents of the United States that teach the preparation of oligonucleotide conjugations include, but are not limited to, United States: 4,828,979; 4,948,882; . 218.105, 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802 5,138,045; 5,414,077 5,486,603; 5,512,439; 5,578,718 5,608,046; 4,587,044 4,605,735; 4,667,025; 4,762,779 4,789,737; 4,824,941 4,835,263; 4,876,335; 4,904,582 4,958,013; 5,082,830 5,112,963; 5,214,136; 5,082,830 5,112,963; 5,214,136 5,245,022; 5,254,469; 5,258,506 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is incorporated herein by reference. The oligomeric compounds can also be modified to have one or more groups that are stable, which generally bind to one or both of an oligomeric chain reaction to enhance characteristics such as nuclease stability. They are included in groups that stabilize the closing structures. By "closing process or portion of terminal closure" are the chemical modifications meant, which have been incorporated into or the oligonucleotide terminals (see, for example, Wincoií et al., WO 97/26270, incorporated herein by reference). This is due to oligomeric compounds that contain the nucleic acid molecules of the nucleic acid with the degradation of the exonuclease, and can help in the enigration and / or localization of a cell. The closure may be present in the 5'-terminals (5'-closure) or in the 3'-eterminals (3'-closure) or it may be present in both terminals of an individual chain structure, or one or more of the erythemals. both chain structures of a double-stranded structure compound. The structure of the closure should not be confused with the inverse methylguanosine "5" closes "present in the 5 'exíremo of the naive molecules of the messenger RNA. In non-limiting examples, the 5'-closure includes the inverted abasic residue (portion), 4 ', 5'-meleylene nucleotide; l- (bis-D-eriirofuranosyl) nucleotide, 4'-thio nucleoide, carbocyclic nucleoide; 1, 5-anhydrohexyloyl nucleoide; L-1-nucleoides; alpha-alpha-nucleoides; modified low nucleoide; phosphorus bond; nucleotide of threo-pentofuranosyl; 3 'acyclic, 4'-dry nucleoid; acyclic nucleic acid 3,4-dihydroxybutyl; 3,5-dihydroxypentyl acyclic rioucleoide, portion of 3'-3'-inverse nucleotide; 3'-3'-inverse portion of the abyss; portion of the 3'-2'-inverted nucleoide; 3'-2'-inverse portion of the abyss; phosphated 1,4-bunediol; 3'-phosphoramide; hexylphosphate; aminohexyl phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorus dioxide; or by building a bridge over or not-bridging the methylphosphonate portion (for more details see Wincoií et al., International Publication No. WO 97/26270 of the PCT, incorporated by reference here). For the constructs of the siRNA, the 5'-eximer (the '5-close') is common but not limited to 5'-hydroxy or 5'-phosphate. Particularly the 3'-closure convenienic structures include, for example 4 ', 5'-meyylene nucleoide; l- (beta-D-eritrofuranosyl) nucleoid; 4'-nucleic acid, carbocyclic nucleoide; 5'-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; phosphation 1, 2-aminododecyl; hydroxypropyl phosphate; 1, 5-anhydrohexyloyl nucleoide; L-1-nucleoide; alpha-alpha-nucleoid; modified low nucleoide; phosphorus dioxide; nucleoide of the Ireo-penofofuranosyl; 3 'acyclic, 4'-dry nucleoid; 3,4-dihydroxybuyl nucleoide; 3,5-dihydroxypenilyl nucleoide, portion of the 5'-5'-indoid nucleoide; 5'-5'-inverse portion of the abyss; 5'-phosphoramide; 5'-phosphoroiioaio; phosphated 1,4-bunediol; 5'-amino; Starting a bridge over and / or not opening a bridge over 5'-phosphoramide, phosphorus, and / or phosphorodithioate, bridging or not bridging over meiosilphosphonate and 5'-mercapide portions (for more see Beaucage and Tyer , 1993, íeíraedro 49, 1925; incorporated as reference here). Other groups 3 'and 5'-esiabilizaníes that can be used to cap one or both of an oligomeric compound to impart stability of the nuclease include those disclosed in WO 03/004602 published on January 16, 2003. Chimeric compounds are not necessary that all the positions in a given anisenise compound are uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated into a single nucleoside or even denier only of an antisense compound. The present invention also includes antisense compounds that are chimeric compounds. Compounds or "antisense" chimeric "chimeras," in the context of this invention, are only-or the double-stranded anise-signaling compound, for example, the oligonucleotides, which contain two or more regions chemically dissiminate, each compound of at least one unit of the monomer, i.e., a nucleoid in the case of a compound of the oligonucleotide. Chimeric aniseisenide oligonucleotides are a form of aniseisenidic compound. These oligonucleotides contain at least one region that is modified to confer on oligonucleotide increasing resistance to nuclease degradation, increased cell consumption, load alteration, increasing stability and / or increasing binding affinity for the objeïivo nucleic acid. An additional region of the oligonucleotide can serve as a subsystem for RNAses or other enzymes. By way of example, ARase H is a cellular endonuclease that cleaves the RNA chain strand of a double RNA: DNA. The activation of ARase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficacy of oligonucleotide-mediated inhibition of gene expression. The cleavage of the RNA: RNA hybrids can, in like manner, be accomplished through the actions of endoribonucleases, such as ARase III or cellular and viral RNAseL products that break RNA. The cleavage products of the RNA target can be determined ruíinarly by electrophoresis of the gel and, if necessary, the associated techniques of nucleic acid hybridization known in the art. The antisense chimeric compounds of the invention can be formed as composite structures of two or more oligonucleotides, the modified oligonucleotides, the oligonucleosides and / or mimics of the oligonucleotide as described above. Such compounds have also been referred to in the arie as hybrids or gapmers. Representatives of the United States who teach the preparation of such hybrid structures include, but are not limited to, United States: 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; . 565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is incorporated herein by reference in its entirety.

Salts, prodrugs and bioequivalents The antisense compounds of the invention encompass any salts, esters, or pharmaceutically acceptable salt of such esters, or of any other compound which, upon administration to an animal including a human being, is capable of providing (directly or indirectly) indirectly) the metabolism or the biological residual of that. Thus, for example, access is also drawn to prodrugs and pharmaceutics to the acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of prodrugs, and other bioequivalent. The term "prodrug" indicates a therapeutic agent that is prepared in an inactive or less active form that is converted to an active form (ie, drug) within the body or cells thereof by the action of endogenous enzymes or other chemical products and / or conditions. In detail, the prodrug versions of the oligonucleotides of the invention are prepared as SATE derivatives ((S-acetyl-2-thioeti I) phosphate) according to the methods disclosed in WO 93/24510 to Gosselin et al., Published on 9. December 1993 or in WO 94/26764 to Imbach et al. The term "acceptable pharmaceuological salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: that is, salts that retain the desired biological activity of the parent compound and do not cause undesired toxic effects in addition. The pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali metals and alkaline earth or organic amines. Examples of the metals used as cations are sodium, potassium, magnesium, calcium, and the like. Examples of suitable amines are N, N'-dibenzyleylenediamine, chloroprocaine, choline, diethylamine, dicyclohexylamine, ethylenediamine, N-meylyglucamine, and procaine (see, for example, Berge et al., "Pharmaceutic salts," J. from Pharma Sci., 1977, 66, 1-19). The base addition salts of the acidic compounds are prepared by quenching with the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner. The free acid form can be regenerated by entering in the form of the salt with an acid and isolating the free acid in the conventional manner. The free acid forms differ from their respective salt forms somewhat in physical physical properties as solubility in polar solvenides, but the salts are in a manner equivalent to their respective free acid for the purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable sai of an acid form of one of the components of the compositions of the invention. These include the organic or inorganic acid salts of the amines. Acid salts are hydrochlorides, acetates, salicylates, vitamins and phosphates. You will hear acceptable salts that are well known to those skilled in the art and include pharmaceuticals the basic salts of a variety of inorganic and organic acids, for example, for example, with inorganic acids, such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulphonic, sulfuric or phosphonic acids or N-substituted sulfamic acids, eg acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxyleleic acid, methylmaleic acid, fumaric acid, malic acid, aridic acid , lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, cyclic acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4 aminosalicylic acid, 2 phenoxybenzoic acid, acetoxybenzoic acid, 2, embonic acid, nicotinic acid or isonicoinic acid; and with amino acids, such as the 20 amino acids of alpha involved in the syn- thesis of proteins in nature, for example glutamic acid or aspartic acid, and also with phenylacetic acid, meas- sulphonic acid, ethanesulfonic acid, 2-hydroxy-anesulfonic acid, disulfonic acid 1.2, benzensulphonic acid, 4-methylbenzensulphonic acid, naphlline-2-sulfonic acid, naphialin-1-disulfonic acid, 2 or 3-phosphoglycerous, phosphate of glucose 6, cyclohexylsulfamic acid of N (with the formation of cyclamates), or with others organic acid compounds, such as ascorbic acid. Acceptable salts of compounds can also be prepared pharmaceutically with an acceptable pharmaceutic cation. Suitable acceptable cations are well known to those skilled in the art and include pharmaceutical alkaline earth, alkaline, ammonium and quaternary ammonium cations. Carbonates or hydrogen carbonates are also possible. For oligonucleotides, examples of pharmaceutically acceptable salts include but are not limited to salts formed with cations such as sodium, poiasium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc .; (b) the salts of the acid addition formed with the inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with the organic acids for example, for example, acetic acid, oxalic acid, tariaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, acid malic acid, ascorbic acid, benzoic acid, tannic acid, palmiic acid, "alginic acid, polyglylamic acid, naphthalenesulfonic acid, methanesulfonic acid, p -oluenesulfonic acid, naphialenedisulfonic acid, polygalacyuronic acid, and similar ones, and (d) the salts formed by simple elemental anions such as chlorine, bromine, and iodine.The sodium salts of the antisense oligonucleotides are useful and are well accepted for the adjuvant administration to humans. Sodium salts of the dhRNA compounds are also provided.

D. Formulations Compounds of the invention may also be mixed, encapsulated, conjugated or otherwise associated in different ways, molecules' structures, mixtures of compounds, such as, for example, liposomes, receptor-targeted formulations of molecules, oral, social, topical or other, to assist consumption, distribution and / or absorption. The representative countries of Esíados -Unidos that teach the preparation of consumption, distribution, and / or absorptive-assistance formulations include, but are not limited to, the United States: 5,108,921; 5,354,844; 5,416,016; . 459,127 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804 5,227,170; 5,264,221 5,356,633; 5,395,619; 5,416,016 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528 5,534,259; 5,543,152; 5,556,948; 5,580,575; Y . 595,756, each of which is incorporated herein by reference. The present invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways depending on whether the local or systemic irradiation is desired and on the area to be treated. The administration can be topical (including ophthalmic and mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or Nsufflation of powders or aerosols, including by the nebulizer; inratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarial, subcutaneous, intraperitoneal or infusion intramuscular injection; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2'-0-methoxyethyl modification are believed to be particularly useful for oral administration. Penetration enhancers have been found to enhance bioavailability of orally administered oligonucleotides. Penetration enhancers include surfactants, bile salts, fatty acids, cosmetics, or surfactants, the non-allergen. The capric acid (C10) and / or the lauric acid (C12) and its salts are enriched here to be effective fatty acids for the enhancing biavailabi lity of oligonucleotides; ursodeoxycholic acid (UDCA) and chenodeoxycholic acid (CDCA) are among those shown to be effective salts of bile for oligonucleotide enhancing availability. Delayed release formulations (eg pulsed or pulsatile release) and sustained release formulations are also useful for enhancing bioavailability. The bioadhesive materials can be added to adhere particles of the drug's poroser to the mucosal membranes to enhance consumption. Compositions and pharmaceutic formulations for isotropic administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, aerosols, liquids and powders. Pharmaceutical, conventional aqueous porous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like can also be useful. The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into the association the active ingredients with the carrier (s) or the pharmaceutical excipient (s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with the liquid poriadores or the solid poriadores finely divided or, and then, if necessary, forming the production. The compositions of the present invention can be formulated in any of many possible dosage forms for example, but limiting to, of iableies, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in aqueous, non-aqueous or mixed media. The aqueous suspensions may also contain the suspensions including those which increase the viscosity of the suspension, for example, sodium carboxymethyl cellulose, sorbium and / or dexirane. The suspension can also provide stabilizers. Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foaming and liposome-containing formulations. The compositions and pharmaceutical formulations of the present invention may encompass one or more penetration enhancers, poriants, excipients, or other active or inactive ingredients. Emulsions are typically homogeneous heterogeneous liquids dispersed in water in the form of droplets generally exceeding 0.1 μm in diameters. The emulsions may contain the additional components in addition to the dispersed phases, and the active drug which may be present as a solution in the aqueous phase, the oily phase or itself as a separate phase. Microemulsions is included as a modality of the present invention. Emulsions and their applications are well known in the art and are more fully described in US Pat. No. 6,287,860, which is incorporated herein in its entirety. Formulations of the present invention include liposomal formulations. As used in the present invention, the term "liposome" means a vesicle composed of the amphiphiiic lipids arranged in a double spherical layer or double layer. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed of a lipophilic material and an aqueous interior that conengates the composition that will become enyregar. Cationic liposomes are the positively charged liposomes that are created to interact with the negatively charged molecules of DNA to form a stable complex.Liposomes that are pH sensitive or negatively charged are believed to enclose DNA rather than the complex with it. Cationic and non-cationic liposomes have been used to deliver DNA to cells.Liposomes also include "sterically stabilized" liposomes, a term that, as used herein, refers to liposomes that encompass one or more specialized lipids that, when They are incorporated in the liposomes, giving rise to the liposomes in connection with enhancements of the life courses of the circulation that lack such specialized lipids.The examples of esthetically-sterilized liposomes are those in which the part of the vesicle-formation portion of the lipid of the liposome encompasses one or more glycolipids or is derived from Hoist with one or more hydrophilic polymers, such as a portion of the polyethylene glycol (PEG). Liposomes and their applications are described more fully in US Pat. No. 6,287,860, which is hereby incorporated herein by reference. The formulations and pharmaceutical compositions of the present invention may also include insensitive agents. The use of surfactants in drug products, formulations and in emulsions is well known in the art. The insensitivity agencies and their applications are described more fully in the United States patent 6,287,860, which is hereby incorporated by reference in its entirety. In one embodiment, the present invention employs various penetration enhancers to effect efficient delivery of the nucleic acids, particularly oligonucleotides. In addition to helping the diffusion of non-lipophilic drugs through the cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers can be classified as belonging to one of five broad categories, that is to say, tensoacíivos agents, fatty acids, salts of the bile, chelating agencies, and non agencios insensitive non-chelating. Penetration enhancers and their applications are further described in US Pat. No. 6,287,860, which is incorporated here in its entirety. Various fatty acids and their derivatives acting while penetration enhancers include, for example, oleic acid, lauric acid (C12), capric acid (C10), myristic acid, palmitic acid, esieraic acid, linoleic acid, linolenic acid , -dicapraio, íricaprato, recinleato, monooleina (aka monooleoil-rac-glycerol) 1, dilaurin, caprylic acid, arachidonic acid, 1-monocapraío of glyceryl, 1-dodecilazaciclohepían-2-one, acilcarniíjnas, acilcolinas, mono and di-glycerides and physiologically acceptable salts thereof (ie, olea, lauraio, capraio, mirisíaio, palmiíato, estearaío, linoleae, eic.) (Lee et al., reviews crííicas-in the systems of poríador íerapéuíicos of the drug, 1991, 8: 2, 91-192; Muranishi, critical reviews in the therapeutic carrier systems of the drug, 1990, 7: 1, 1-33; EL-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654 '). Examples of some fatty acids are the capraio of sodium (C10) and the lauraio of sodium (C12), used alone or in the combination in the concentrations of 0.5 to 5%. Exemplary salts of bile include, for example, cholic acid (or its sodium salt, pharmaceutically acceptable sodium compounds), dehydrocholic acid (sodium d-eshydrocolic acid), deoxycholic acid (deoxycholate sodium), acid glycolic acid (sodium glucocole), glycolic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurochole), iaurodeoxycholic acid (sodium iodeodeoxycholic acid), chenodeoxycholic acid (chenodeoxy - sodium bicarbonate), ursodeoxycholic acid (UDCA), taurium-24,25-dihydro-fusidate sodium (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical reviews in the therapeutic systems of the drug, 1991, page 92; Swiniard, Chapter 39 In: The pharmaceutical sciences of Remingion, tenth century Ed., Gennaro, ed., Mack publishing Co., Easion, PA, 1990, p Inan 782-783; Muranishi, Critical Reviews in the Ierapeutical Peripher Systems of the Drug, 1990, 7, 1-33; Yamamoío eí al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashiía eí al., J. Pharm. Sci., 1990, 79, 579-583). UDCA and CDCA have been effectively used as enhancers of penetration for oligonucleotides, and more effectively when combined. Complex formulations containing one or more salts of bile and one or more fatty acids were even more effective, particularly CDCA (with or without UDCA), in conjunction with laurae and capraion (use serial No. 09 / 108,673, Teng and Hardee of the USA, filed on July 1, 1998). One of skill in the field will recognize that the formulations are designed ruíinarly according to their intended use, ie route of administration. Formulations for topical administration include those in which the oligonucleotides of the invention are in the addition with a topical agent of the enyrega such as lipids, liposomes, fatty acids, fatty acid esters, steroids, jquelating agents and insensitivity agents. Lipids and liposomes include (e.g., dioleoylphosphatidyl DOPE eo-amylamine, dimyrisyl-phosphatidyl choline DMPC, diastereoyl-phosphaidyl choline) negaimic (e.g. dimirisioylphosphaidyl glycerol DMPG) and cationic (e.g. dioleoylideneamylaminopropyl DOTAP and dioleoylphosphatidyl enenolamine DOTMA). For isopic or other administration, the oligonucleotides of the invention can be encapsulated within the liposomes or can form complexes in addition to the cationic liposomes. Alternately, oligonucleotides can be formed into complexes with lipids, in deviation to cationic lipids. The fatty acids and esters, the pharmaceutically acceptable salts thereof, and their applications are further described in US Pat. No. 6,287,860, which is here incorporated in its entirety. The isopropic formulations are described in detail in the use of United States Patent 09 / 315,298 filed May 20, 1999, which is incorporated herein by reference in its name. Compositions and formulations for oral administration include powders or granules, microparicolula, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, bags, diapers or mini-ables. Thichans, aromatic substances, diluyeníes, emulsifiers, dispersion aids or carpels may be desirable. Oral formulations are those in which the oligonucleotides of the invention are coadministered with one or more surfacides and chelators of the penetration enhancers. The insensitivity agents include fatty acids and / or esters or salts thereof, the acids of the bile and / or the salts of that. The acids / bile salts and fatty acids and their applications are further described in US Pat. No. 6,287,860, which is incorporated here in its entirety. Also suitable are the combinations of the penetration enhancers, for example, fatty acids / salts conjunctly with the acids / bile salts. A combination is the sodium salt of lauric acid, capric acid and UDCA. Other enhancers of the penetration include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-ceyl ether. The oligonucleotides of the invention can be orally enriched, in granular form including spray dried pariículas, or in complex to form micro or nanoparíicles. Agents forming the oligonucleotide complex and their applications are described more fully in US Pat. No. 6,287,860, which is here incorporated in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in applications 09 / 108,673 (filed July 1, 1998), 09 / 315,298 (filed May 20, 1999) and United States 10,071,822, filed on October 8, 1999. February 2002, each of which is incorporated herein by reference in its entirety. The compositions and formulations for parenteral, injectable or intraventricular administration may include sterile enhancers of the aqueous solutions as they may also contain intermediate buffers, diluents and other suitable additives, but not limited to, penetration, carrier compounds and other pharmaceutically acceptable carriers or excipients. The embodiments of the invention provide the pharmaceutical compositions comprising one or more oligomeric compounds and one or more other chemo-therapeutic agents that function by a non-aniseal mechanism. Examples of the chemo-therapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, daclinomycin, doxorubicin, epirubicin, idarubicin, esububicin, bleomycin, mafosfamide, ifosfamide, cyniosine arabinoside, bis-chloroaryl-urea-urea-chloroethylnitrosurea, busulfan , mitomycin C, actinomycin D, mitramycin, prednisone, hydroxyprogesterone, isosyrosone, ammoxifen, dacarbazine, procarbazine, hexamethylammelamine, penyamelymelamine, mihoxanilone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nigergen mosyaz, melphalan, cyclophosphamide, 6-mercaptopurine, 6-ioguanine, cyarabine , 5-azacylidine, hydroxyurea, deoxycophoricin, 4-hydroxyperoxycholophosphoramide, 5-fluorouracil (5-fu), 5-fluorodeoxyuridine (5-FUdR), meioirexate (MTX), colchicine, taxol, vincristine, vinblastine, the etoposide (Vp-16) ), trimetrexate, irinoiecan, topotecan, gemcitabine, ithioside, cisplatin, p emerexate and diethylsilylsulin (DES). When used with the compounds of the invention, such chemotherapeutic agents can be used individually (eg, 5-fu and oligonucleotide), sequentially (eg, 5-fu and oligonucleotide for a period of time followed by MTX and oligonucleotide), or together with one or more other chemotherapeutic agents (eg, 5-fu, MTX and oligonucleotide, or 5-fu, radio-therapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to drugs and non-steroidal anti-inflammatory drugs, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in the compositions of the invention. Combinations of antisense compounds and other non-anisense drugs are also within the scope of this invention. Two or more combined compounds can be used together or sequentially. In another related embodiment, the compositions of the invention may contain one or more aniseisenide compounds, particularly oligonucleotides, directed to a first nucleic acid and to one or more additional antisense compounds directed to a second target of the nucleic acid. Alimentarily, the compositions of the invention can contain two or more antisense compounds directed to various regions of the same nucleic acid target. Numerous examples of the antisense compounds are known in the art. Compound two or combination can be used together or sequentially.

H. Dosage As used herein, the term "patient" refers to a mammal that is afflicted with one or more disorders associated with the expression or overexpression of elF4E. It will be understood that the desired patient is a human being. It is also understood that this invention is specifically related to the inhibition of mammalian expression or overexpression of elF4E. It is recognized that the qualified person may affect the disorders associated with the expression or overexpression of elF4E by treating a patient who is currently afflicted with disorders with an effective canine of a compound of the present invention. Thus, the terms "irrational" and "irrational" are intended to refer to all processes where there may be rearing, interrupting, arresting, conirring, delaying or stopping the progression of the disorders described here, but do not necessarily indicate a elimination of all the synomies. As used herein, the term "effective amount" or "effective therapeutic amount" of a compound of the present invention refers to a term that is effective in treating or providing the disorders described herein. The formulation of the epepatic compositions and their subsequent administration (dosing) is believed to be denigrate of the ability of those in the arie. The dosage is dependent on severity and the sensitivity of the disease condition to be irritated, with the course of the disease lasting from several days to several months, or until a cure is made or a decrease in the disease is reached. The exact dosing schedules can be calculated from measurements of the accumulation of the drug in the patient's body. People of ordinary ability can easily remove very fine dosages, dosing meioticodologies and repeating. Optimal dosages may vary depending on the relative potency of individual oligonucleotides, and may be generally estimated based on EC50s found to be effective in vitro and live animal models. In general, the dosage is from 0.0001 μg to 100 g per kilogram of body weight, and can be given once or more daily, weekly, monthly or annually, or even once every 2 to 20 years. In some embodiments, the dosage is from 0.0001 μg to 100 g per kilogram of body weight, from 0.001 μg to 10 g per kilogram of body weight, from 0.01 μg to 1 g per kg. kilogram of body weight, from 0.1 μg to 100 mg per kilogram of body weight, from 1 μg to 10 mg per kilogram of body weight, from 10 μg to 1 mg per kilogram of body weight, or from μg 100 to μg 500 per kilogram of body weight, and can be given once or more daily, weekly, monthly or annually, or even once every 2 to 20 years. For compounds of double-stranded structure, the dose must be calculated to represent the increasing charge of the nucleic acid of the second strand (for compounds spanning two strand structures) or the additional length of the nucleic acid (for one strand). self-complementary compound). People of ordinary skill in the field can easily estimate the rates of repetition to dose based on residence times and measured concentrations of the drug in liquids or body tissues. Much work has been done on the absorbency, the dissimilarity, the metabolism and the excretion (known collectively as ADME) of oligonucleotides. ADME is an independent sequence because all the sequences of a given chemistry (eg, the 2 'gapmers of MOE with a skeleton of P = S) have similar physical / chemical properties such as water solubility, molecular weight (approximately 7000) and pKa . Oligonucleotides are eliminated relatively quickly from the plasma (half-life of the distribution approximately 1 hour, distribution completed for 24 hours) by the distribution to the tissues, on iodine but not limited to the liver, kidney, al. spleen and to the marrow. A strong correlation between pharmacokinetics and pharmacodynamics has been demonstrated in tissues including the kidney, liver, bone marrow, adipose tissue, spleen, lymph nodes, lung (via the aerosol) and central nervous system (previously inbred cerebri). ). The half-life of the drug is 1-5 days for the first-generation antiseizure drugs (2'-deoxy with the phosphoryloane skeleton) and 10-28 days for the 2'-moe open oligonucleotides with the phosphoryloate skeletons. Henry et al., Curr. Opin. Invest. Drugs, 2001, 2, 1444-1449. After stenting, it may be desirable to have the patient undergo maintenance therapy to provide for the repetition of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.0001 μg to 100 g per day. kilogram of body weight, once or more daily, once every 20 years. As long as the invention is present, it has been described with specificity according to the insurance of its modalities, the following examples only serve to illustrate the invention and do not intend to limit it equally. Each of the references, accession numbers of GenBank, and similar references in the current use is incorporated herein by reference in its entirety.

EXAMPLES Example 1: Synthesis of the nucleoside Phosphoramidites. The following compounds, including amidites and their intermediates were prepared as described in US Pat. No. 6,426,220 and published PCT WO 02/36743 of the United States; 5'-O-Dimethoxytriyl-Iimidine inimmediate for the amidy of C.C. 5-meityl, 5'-0-dimethyloxyNthiol-2'-deoxy-5-methylcylidine in the middle for amidyia 5-meityl-dC, penulimonium ini-mediated 5'-0-Dimeloxy-yiyl-2'-deoxy-N4-benzoyl-5 -Milcylidine for the amidiía of the CC 5-methyl, (5'-0- (4,4'-Dimethoxytriphenylmethyl) -2'-deoxy-N 4 -benzoyl-5-methylcytidine-3'-0-yl) -2-cyanoethyl-N, N-diisopropylphosphoramidite ( amidiía of CC 5-methyl), 2'-Fluorodeoxydadenosine, 2'-Fluorodeoxyguanosine, 2'-Fluorouridine, 2'-Fluorodeoxycytidine, 2'- 0- (2-methoxy-yiyl) modified the amidies, 2'-0- (2 -methioxyethyl) -5-meiyluridine, intermediate, penultimate intermediate 5'-0-DMT-2'-0- (2-methoxy-yl) -5-methyluridine, (5'-0- (4,4'-Dimethoxy-riphenylmethyl) ~ 2 ' -0- (2-meioxy-thiyl) -5-meylduridine-3'-0-yl) -2-cyano-yl-N, N-diisopropylphosphoramidite (amidite) of MOE T, 5'-0-dimethyloxythiyl-2'-0- ( 2-meioxyethylamino) -5-methylethylidene intermediate, penultimate inium 5'-0-dimethyloxy-yiyl-2'-0- (2-meioxy-yl) -N 4 -benzoyl-5-meityyl-cyidine, (5'-O- (4,4 2-Diaxyryphenylmeryl) -2'-O- (2-meioxy-yl) -N 4 -benzoyl-5-meitylcytidine-3'-O-yl) -2-cyano-yl-N, N-di-propylphosphorazine (amide of MOE 5 -Me-C), (5'-0- (4,4'-Dimeioxy-riphenylmethyl) -2'-0- (2-meioxy) -N6-benzoyl-aden osine-3'-0-yl) -2-cyanoethylo-N, N-diisopropylphosphoramide (amide of MOE A), (5'-0- (4,4'-dimethoxy-phenylmethyl) -2'-0- (2-meioxy-yl) ) -N4-isobuyrylguanosine-3'-0-yl) -2-cyanoethyl-N, N-diisopropylphosphoramidite (amide of MOE G), 2'-0- (Aminooxyethyl) amides of the nucleoside and 2'-0- (dimethylamino) oxieioxi) the amidies of the nucleoside, 2 '- (Dimethylamino oxyethoxy) the amidies. of the nucleoside, 5'-0-ery-Butyldiphenyl-2-yl-2-2'-anhydro-5-meityluridine, 5'-0-yl-Buyldiphenylsilyl-2'-0- (2-hydroxy-yl) -5-methylduridine, 2'- 0 - ((2-philimide oxy) ethiol) -5'-t-Butyldiphenylsilyl-5-methylduridine, 5'-O-yl-Buyldiphenylsilyl-2'-0 - ((2-formaximinooxy) ethyl) -5- meilyduridine, 5'-O-rt-Butyldiphenylsilyl-2'-O- (N, N-dimethylaminoxyethyl) -5-methylduridine, 2'-O- (dimethylaminoxyethyl) -5-methyluridine, 5'-O-DMT-2'- O- (dimethylaminoxy-yl) -5-methylisuridine, 5'-0-DMT-2'-0- (2-N, N-dimethylaminoxy-yl) -5-meityluridine-3 '- ((2-cyano-eryl) -N, N- diisopropylphosphoramidia), 2 '- (Amino-oxy-dioxy) amidies of the gone nuclei, N2-isobuyryl-6-0-diphenylcarbamoyl-2'-0- (2-eylacetyl) -5, -0- (4,4'-dimethyloxy-yl) guanosine -3, - ((2-cyanoethylene) -N, N-diisopropylphosphoramidia) -isobuyryl-6-0-diphenylcarbamoyl-2'-0- (2-eylacetyl) -5'-0- (4,4'-dimethoxy-yl) guanosine-3 '- ((2-cyanoetiyl) -N, N-diisopropylphosphoramidia), amides of the 2'-dimethylamino-dioxy-dioxy (2'-dmaeoe) nucleoside ), 2'-0- (2 (2-N, N-dimethylamino-dioxy) -yryl) -5-methyl, 5'-0-dimethoxy-yl-yl-2'-0- (2 (2-N, uridine from N-) uridine) dimethylamino-dioxy) -ethyl)) - 5-methyl and 5'-0-dimethoxy-yl-yl-2'-0- (2 (2-N, N-dimethylamino-dioxy) -yryl)) - 5-methyl-uridine-3'-0- ( cyanoethylene-N, N-diisopropyl) phosphoramidia. 2'-Deoxy and 2'-methoxy amidites, 2'-Deoxy and 2'-meioxy-cyanoethyldiisopropyl phosphoramidites were purchased from commercial sources (eg Chemgenes, Needham, MA or Glen Research, Inc., Ireland, VA). 2'-0-alkoxy subsides of the nucleoside are prepared as described in US Pat. No. 5,506,351, incorporated herein by reference.For the oligonucleotides synthesized using the 2'-alkoxy amides, the standard cycle for the unmodified oligonucleotides it was used, unless the wait step after the erythrozole pulse and the base was increased to 360 seconds.The oligonucleotides containing the 5-meyyl-2'-deoxycytidine (5-Me-C) nucleosides they were synthesized according to published methods (Sanghvi et al., Nucleic Acids Research, 1993, 21, 3197-3203) using commercially available phosphoramidias (Glen Research, VA Síerling or ChemGenes, Needham, MA) . 2'-Fluoro Amiditas The 2'-fluoro oligonucleotides were synthelised as previously described (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841) and the 5,670,633 of the USA, here incorporated as reference. Briefly, the pro tected N6-benzoyl-2'-deoxy-2'-fluoroadenosine nucleoside was synthesized using commercially available 9-beta-D-arabinofuranosyladenine as starting material and modifying the procedures of the solution whereby the 2'-alpha- Fluoro is produced by a SN2-displacement of a 2'-beía-yiíiio group. Thus N6-benzoyl-9-bead-D-arabinofuranosyladenine was selectively protected in moderate production as the 3 ', intermediate 5'-diteirahydropyranyl (THP). Deprovection of the THP and N6-benzoyl groups was achieved using standard methods and the standard methods were used to obtain the intermediates 5'-dimethoxy-pyridyl- (DMT) and 5'-DMT-3'-phosphoramidia. The synisis of 2'-deoxy-2'-fluoroguanosine was achieved using the tetraisopropyldisiloxanil (TPDS) 9-bead-D-arabinofuranosilguanina proiecto as starting material, and the conversion to the intermediate diisobutyrylarabino furanosylguanosine. Deprotection of the TPDS group was followed by the projection of the hydroxyl group with THP to give arabinofuranosylguanine proessed with di-THP of diisobuyryl. The selective o-deacylation and iriplation were followed by the production of the crude product with the fluoride, then the deprojection of the THP groups. The standard methods were used to obtain 5'-DMT- and 5'-DMT-3'-phosphoramidias. The synisis of 2'-deoxy-2'-Fluorouridine was achieved by the modification of a procedure in which 2,2'-anhydro-1-bead-D-arabinofuranosyluracil was irradiated with 70% hydrogen fluoride-pyridine. %. The standard procedures were used to obtain 5'-DMT and 5'-DMT-3'phosphoramidites. 2'-deoxy-2'-fluorocytidine was synthesized via amination of 2'-deoxy-2'-Fluorouridine, followed by selective screening to give N4-benzoyl-2'-deoxy-2'-fluorocytidine. The standard procedures were used to obtain the 5'-DMT and the 5'-DMT-3'phosphoramidias.

Modified 2'-O- (2-methoxyethyl) amidites Amides of the nucleoside subsumed with 2'-0-meioxy-yl are prepared according to the methods of Martin, Chimica helvetica Acta, 1995, 78, 486-504. 2"- (Aminooxyethyl) amides of the nucleoside and 2 '- (dimethylamino oxyethoxy) amides of the nucleoside Aminooxyethyl and dimethylaminoxyethyl amides are prepared according to the methods of the application number US Pat. No. 6,127,533, hereby incorporated by reference.

Example 2: Synthesis of the oligonucleotide and the oligonucleotide The oligomeric compounds used according to this invention can be conveniently and routinely made with the well-known technique of the solid phase syn- thesis. Equipment for sale is sold by several vendors including, for example, Applied Biosysiems (Fosíer City, CA). Any medium sound for such synthesis known in the art can be employed in addition or alímernaíivamenie. It is well known to use similar techniques to prepare oligonucleotides such as phosphoryloates and alkylated derivatives. Oligonucleotides: Unsubstituted and substituted phosphodiester oligonucleotides (P = 0) are synthesized in an automated DNA synthesizer (Applied Biosysiems model 394) which uses standard chemistry of phosphoramidite with oxidation by iodine. The phosphorothioaids (P = S) are similar to the oligonucleotides of the phosphodiester with the following exceptions: the thiaylide was carried out using a 10% w / v solution of 3, H-1, 2-benzodithiol-3-one, 1 - dioxide in the aceonitrile for the oxidation of the phosphite bonds. The reaction time of the thiaylide was increased to 180 sec and preceded by the normal cappering step. After cleavage of the column and of the perforation of CPG in ammonium hydroxide concentrated in 55C (12-16 hours), the oligonucleotides were recovered by precipitating with >; 3 volumes of ethanol from a 1 M NHOAc solution. The Phosphinate oligonucleotides are prepared as described in US Patent 5,508,270, incorporated herein by reference. The alkyl oligonucleotides of the phosphonation are prepared as described in US Pat. No. 4,469,863, hereby incorporated by reference. The phosphonation oligonucleotides 3'-Deoxy-3'-methylene are prepared as described in US Pat. Nos. 5,610,289 or 5,625,050, incorporated herein by reference. Phosphoramidy oligonucleotides are prepared as described in the patent, 5,256,775 or US Pat. No. 5,366,878, incorporated herein by reference. Alkylphosphonoylioazo oligonucleotides are prepared as described in PCT / US94 / 00902 and PCT / US93 / 06976 of PCT (published as WO 94/17093 and WO 94/02499, respectively), incorporated herein by reference. The 3'-deoxy-3'-amino phosphoramidate oligonucleotides are prepared according to the description in US Pat. No. 5,476,925, incorporated herein by reference. Phosphoric acid oligonucleotides are prepared as described in US Pat. No. 5,023,243, incorporated herein by reference. Borane phosphide oligonucleotides are prepared as described in US Pat. Nos. 5,130,302 and 5,177,198, both of which are incorporated herein by reference. The oligonucleotides containing 4'-ions are synthesized according to the description in US Pat. No. 5,639,873 of the United States, the text of which is hereby incorporated by reference in its entirety. Oligonucleosides: Methyleneiminoimino bound the oligonucleosides, also identified as MMI-linked oligonucleosides, the linked oligonucleosides methylenediimethylhydrazide, also idenified as MDH-linked oligonucleosides, and meyylenecarbonylamino-linked oligonucleosides, also idenified as amide-3-linked oligonucleosides, and the meiylene-aminocarbonyl-linked oligonucleosides, also idenified as amide-4 linked oligonucleosides, as well as the mixed compounds of the skeleton that are linked, for example, of the MMI being altered and of P = 0 or P = S are prepared as described in patents 5,378,825, 5,386. 023, 5,489,677, 5,602,240 and 5,610,289 of the United States, which are incorporated herein by reference. Formaceil and the thioformacetal ligated oligonucleosides are prepared as described in US Pat. Nos. 5,264,562 and 5,264,564, incorporated herein by reference. The ethylene oxide-linked oligonucleosides are prepared as described in US Pat. No. 5,223,618, incorporated herein by reference.Synthesis of ANP The nucleic acids of the peptide (ANPs) are prepared according to any of the several procedures mentioned in the nucleic acids of the peptide (ANP): Synís, characteristic and uses of the poíencial, Bioorganic and Chemisíry medicinal, 1996, 4, 5 -2. 3. They may also be prepared in accordance with US Patents 5,539,082, 5,700,922, and 5,719,262, incorporated herein by reference.

Example 3: RNA synthesis In general, the chemistry of RNA synthesis is based on the selective incorporation of several proiection groups into the skeletal immune reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protection groups includes the silyl ether. In particular, the ablated silicate atoms are used to provide the 5'-hydroxy group conjunctly with an acid-stable oriole-free proving group on the 2'-hydroxyl. This system of protection groups is then used with the standard technology of the solid phase syn- thesis. It is important to have passed the group of projection of the unusable oriole to the acid after the rest of the synthetic steps. On the other hand, the early use of the silyl protection groups during syn- thesis ensures easy removal when desired, without undesired dehydration of 2'-hydroxyl. After this procedure for the sequential protection of the 5'-hydroxyl in conjunction with the protection of the 2'-hydroxyl protecting the groups that differentiated are removed and chemically differentiated to non-stable, RNA oligonucleotides were synillized. RNA oligonucleotides are synthesized in a stepwise manner. Each nucleotide is sequentially added (3 '- to 5'-direction) to an oligonucleotide attached to a solid support. The first nucleoside in the 3'-exíremos of the chain covalenie is attached to a solid aid. The precursor of the nucleoid, a phosphoramidium of the ribonucleoside, and the acyivator are added, joining the second base on the 5'-exíremos of the first nucleoside. The soporide is washed and any unreacted 5'-hydroxyl group is capped with the acetic anhydride to yield the 5'-acetyl portions. The link then is oxidized to the most stable bond and the last desired insanity of P (V). At the end of the nucleoide addition cycle, the 5'-s i i I group is cleaved with the fluoride. The cycle is repeated for each subsequent nucleoid. After synthesis, the methyl protection groups in the phosphates are cleaved in 30 minutes using the 1 M trihydrate disodip-2-carbamoyl-2-cyanoethylene-1,1-dithiolate (S2Na2) in DMF. The deprotection solution is washed from the oligonucleotide bound to solid support using water. The aid was then spiked with 40% meitylamine in the water for 10 minutes at 55 ° C. Esio launches the RNA oligonucleotides in the solution, dissociates the exocyclic amines, and modifies the 2 '- groups. The oligonucleotides can be analyzed by HPLC of the anion gap in the gap. The groups 2'-orioésíer are the last groups of proiección that will be removed. The ore-producing group of the monoethylene glycol of ethylene developed by Dharmacon Research, Inc. (Lafayefie, CO), is an example of a proiection group from the industrial ocean that has the following important characteristics. It is esiable to the conditions of the synosis of the phosphoramidium of the nucleoside and the syn- thesis of the oligonucleotide. However, after synthesis of the oligonucleotide, the oligonucleotide was brought with the meyilamine which cleaves not only the oligonucleotide of the solid support but also removes the acetyl groups from the orioles. The substrates resulting from 2-eylo-hydroxyl in the orthoester are less electronically than would be the case with the acetylated precursor. Subsequently, the modified orioleser becomes more unstable to the acid-cayalized hydrolysis. Specifically, the index of the cleft is approximately 10 times faster after the acetyl groups are removed. Therefore,The Orioleser has sufficient ability to be comparable to the oligonucleotide but, when modified later, the deprotection of the permits will be carried out under relatively mild aqueous conditions comparable to the final production of the RNA oligonucleotide. In addition, RNA synthesis methods are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe et al., J. Am. Chem. Soc, 1998, 120, 11820-11821; Matteucci et al., J. Am. Chem. Soc, 1981, 103, 3185-3191; Beaucage et al, Teirahedron Lett., 1981, 22, 1859-1862; Dahl et al., Acta Chem. Scand., 1990, 44, 639-641; Reddy et al., Tetrahedrom Lett., 1994, 25, 4311-4314; Wincotí et al., Nucleic acids Res., 1995, 23, 2677-2684; Griffin et al., Teirahedron, 1967, 23, 2301-2313; Griffin e al., Teirahedron, 1967, 23, 2315-2331). The antisense compounds of the RNA (RNA oligonucleotides) of the present invention can be synthesized by the methods here or purchased from the research of Dharmacon, Inc. (Lafayette, CO). Once they are synthesized, the complementary RNA antisecretory compounds can then be annealed by the known methods in the arie to form double (duplicated) double-aniseisen compounds. For example, duplo's can be formed by combining 30 μL of each of the complementary oligonucleotide chain oligonucleotide RNAs (50 μM RNA oligonucleotide solution) and 5 μL annealing buffer 15 μL (100 mm acetone). poiasium, 30 millimeters of HEPES-KOH pH 7.4, 2 millimeters of magnesium acetyle) followed by heating for 1 minute at 90 ° C, then 1 hour at 37 ° C. The resulting duplicated antisense compounds can be used in computers, analyzes, screens, or other methods to investigate the role of an objective nucleic acid, or for diagnostic or therapeutic purposes.

Example 4: Synthesis of Chimeric Oligonucleotides The chimeric oligonucleotides, oligonucleosides or oligonucleotides / oligonucleosides of the invention can be of several different types. These include a first type in which the segmentation of the "mouth" of linked nucleosides is placed between the segments of the "5 'and 3" wings of linked nucleosides and of a second type of the "open exile" where the segmen- do not look at the 3 'or the 5' emersals of the oligomeric compound. The oligonucleotides of the first type are also known in the art as "gapmers" or open oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemimers" or "wingmers". (2'-O-Me) - (2'-deoxy) - (2'-O-Me) Chimeric Oligonucleotides Of Phosphorothioate Chimeric Oligonucleotides Having Segments of the Phosphorous Dioxide Oligonucleotide 2'-0-alkyl and phosphorus-2-oligo The deoxyseries are synthesized using a standardized model Applied Biosysiems 394 of the DNA synthesizer, as above. The oligonucleotides are syntheiZed using the siniZer and the 2'-deoxy-5'-dimethoxyyriIylo-3'-0-phosphoramidite automated for the DNA portion and the 5'-dimethoxytrityl-2'-O-methyl-3, -O- phosphoramide for the 2'-O-alkyl portion. The standard cycle of syn- thesis is modified by incorporating coupler passages with increasing reaction times for 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and Deprotected in concentrated ammonia (NH4OH) for 12-16 hours at 55 ° C. Unprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, reduced volume in vacuo and analyzed by spectrophotometry for production and purity by capillary elecrophoresis and by ionic spectrometry). (2, -O- (2-Methoxyethyl)) - (2'-deoxy) - (2'-O- (Methoxyethyl)) Chimeric Oligonucleotides Of Phosphorothioate (2'-0- (2-meioxy)) - (2'-deoxy) - (-2'-O- (methoxyethyl)) The chimeric oligonucleotides of the phosphoryloane were prepared according to the above procedure for the chimeric oligomeric 2'-O-methyl, with the sub-2'-O- (meioxyethyl) of the amidites for the 2'-O-methyl amidites. (2, -O- (2-Methoxyethyl) Phosphodiester) - (2'-deoxy Phosphorothioate) - (2'-0- (2-Methoxyethyl) Phosphodiester) Chimeric Oligonucleotides (2'-0- (2-methoxyethyl phosphodies) ) - phosphoroiioate) of (2'-deoxy- (2'-0- (methoxy-yl) -phosphodieser) the chimeric oligonucleotides are prepared according to the above procedure for the 2'-0-methyl chimeric oligonucleotide with the 2'-0 substitution - (meioxieíilo) of the amiditas for amiditas 2'-0-methyl, oxidation with iodine to generate the phosphodiester internucleotide bonds within the wing portions of the chimeric structures and sulphurization that use 1,1-1,2-benzodiol-3-one 1,1-dioxide (Beaucage's reactive) generate the bonds of the phosphorus inorganic acid for the mouth of the censor. Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides / oligogonosides are synthesized according to US Pat. No. 5,623,065, incorporated herein by reference.

Example 5: Design and Investigation of Duplicate Antisense Compounds Targeting ElF4E According to the present invention, a duplex series of the nucleic acid encompassed by the antisense compounds of the present invention and its complements can be designed to target elF4E. The nucleobase sequence of the double-stranded anisearyl strand contains at least one 8-nucleobase portion of an oligonucleotide in Table 1. The ends of the strand oligonucleotides can be modified by the addition of one or more naive or modified nucleobases to form a projection. The sense chain structure of the dhRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to any terminal. For example, in one modality, both chain structures of the dhRNA double would be complementary over the central nucleobases, each one having projections in one or both of them. It is possible that one end of a duplo was blind and the other was to have protruding nucleobases. In one embodiment, the number of protruding nucleobases is from 1 to 6 in the 3 'eximeme of each duplex chain structure. In another embodiment, the number of protruding nucleobases is from 1 to 6 in the 3'-extruder of only one double-stranded chain. In another modality, the number of protruding nucleobases is from 1 to 6 in one or both of the 5 'of the duplicated chain oligonucleotides. In another mode, the number of outstanding nucleobases is zero. As an example, a duplo that includes an antisense chain structure that has the sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 456) and having a projection of the two-nucleobases of deoxythymidine (dT) would have the following structure: cgagaggcggacgggaccgTT Non-coding chain structure (SEQ ID NO: 457) TTgctcíccgccígcccígc Complementing the coding chain (SEQ ID NO: 458) In another modality, a duplo that includes a chain structure * antisense that has the same sequence CGAGAGGCGGACGGGACCG can be prepared with blind ends (no braided projection) as shown: cgagaggcggacgggaccg Non-coding chain statement (SEQ ID NO: 456) gctctccgcctgcccíggc Complement of coding strand sequence (SEQ ID NO: 459) The duplo can be unimolecular or bimolecular, that is, the sense and the structures of the anisense chain can be part of the same molecule (forming a hairpin or the other structure of the self) or two (or even more) separate molecules. The duplo RNA chain structures can be syntheized by methods reported here or purchased from Dharmacon Research Inc., (Lafayeííe, CO). Once they are synthesized, the complementary chain directions are recumbent. The individual chain oligonucleotides are aliquots and were diluted to a concentration of 50 uM. Once diluted, 30 uL of each chain structure are combined with 1 L of a 5X solution of the annealing annealing buffer. The final concentration of said buffer is 100 milliliters of potassium oil, 30 millimeters of HEPES-KOH pH of magnesium 7.4, and 2mM. The final volume is 75 uL. This solution is incubated for 1 minute at 90 ° C and then centrifuged for 15 seconds. The pipeline is allowed to sit for 1 hour at 37 ° C in which case the dhARN doubles are used in the experiment. The final concentration of the dhRNA double is 20 uM. This solution can be stored frozen (~ 20 ° C) and frozen-thawed up to 5 times. Once they are prepared, duplicate antisense compounds are evaluated for their ability to modulate the expression of elF4E. When the cells reached 80% confluence, they were brought with the duplicated aniseisenide compounds of the invention. For the cells grown in the 96-well plates, the wells are washed once with 200 μL of the OPTI-MEM-1 reducing medium (Gibco BRL) and then irradiated with μL of OPTI-MEM-1 containing 130 μL. 12 μg / mL LIPOFECTIN (Gibco BRL) and the desired two-sided antisense compound in a final concentration of 200 nM. After 5 hours of irradiation, the medium is supplemented by fresh medium. The cells are harvested 16 hours after the irradiation, in which case the RNA is isolated and reduced by the objective measured by RT-PCR.

Example 6: Isolation of the Oligonucleotide After the slit of the solid chrysalis aid and the pore aperioration coniraled in ammonium hydroxide concentrated at 55 ° C for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitating out of 1 M NH4OAc with > 3 volumes of eolian. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight de-ermination) and by capillary electrophoresis of the gel and judged to be at least 70% of the total length of the material. The relative quantities of phosphorus and phosphodieser bonds obtained in the syn- thesis were determined by the corrected molecular weight relative to the production of -16 amu (+ -32 + -48). For some studies the oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. The results obtained with the HPLC-purified material were similar to those obtained with the purified non-HPLC material.

Example 7: Oligonucleotide Synthesis - 96-well Plate Format The oligonucleotides were synthesized via the phosphoramidium chemistry of the solid phase P (III) in an accelerated synthetizer capable of mounting 96 sequences simultaneously in a 96-well form. The bonds of the Phosphodiester in-nucleotide were produced by oxidation with aqueous iodine. Phosphorothioate internucleotide bonds were generated by sulfurization using 1,1-3-H-1,2-benzodithiol-3-one dioxide (Beaucage reagent) in anhydrous acetonitrile. The standard beta-cyanoethyl-diiso-bequia-cyanoethyl-diiso-propyl base-protected phosphoramidites were purchased from commercial vendors (e.g., PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). The non-standard nucleosides are synthesized according to standard or patented methods. Phosphoramidites are used as beía-cianoeíildiisopropil proíegidos base. The oligonucleotides were cleaved for help and stripped with NH4OH concentrated in the elevated temperature (55-60 ° C) for 12-16 hours and the product released after drying in vacuo. The dried produce was then re-suspended in sterile water to produce a main plate from which all the analytical and plaque test samples are then diluted using robotic pipettes.

Example 8: Oligonucleotide Analysis - 96-well Plate Format The concentration of the oligonucleotide in each was determined by the dilution of samples and UV absorption spectroscopy. The integral integrity of the individual products was evaluated by capillary elecirophoresis (CE) in either the 96 cavity format (Beckman P / ACE ™ MDQ) or, because individually prepared samples, in an ad CE apparatus (eg, Beckman P / ACE ™ 5000, ABl 270). The composition of the base and the skeleton was confirmed by the total analysis of the compounds that used the electrospray mass spectroscopy. All plates of the analysis test were diluted from the main plate using single and multi-channel robotic pipelines. The plates were judged to be acceptable if at least 85% of the compounds on the plate were at least [ongiíud completed 85%.

Example 9: Cell Culture and Treatment of the Oligonucleotide - Antisense Compounds of Single Chain Structure The effect of the aniseisenide compounds on the expression of the target nucleic acid can be tested in any of a variety of cell types provided that the acid Objectory nucleus is present at measurable levels. This can be determined ruíinarly using, for example, PCR or norihern analysis of the blot. The following cell types are provided for illustrative purposes, but other types of the cell can be used routinely, provided that the objective is expressed in the cell of the chosen cell. This can easily be determined by routine methods in art, for example blot analysis, ribonuclease protection analyzes, or RT-PCR norimhern staining. T-24 Cells: The human T-24 line of cell carcinoma of the bladder cell carcinoma was obfenida of the American Collection of the Culúura del íipo (ATCC) (Manassas, of the VA). T-24 cells were routinely grown in the "Complete McCoy A" basic media (Inviírogen Corporation, Carlsbad, CA) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, CA), penicillin units 100 per ml, and strepomyomycline 100 micrograms per ml (Inviírogen Corporaíion, Carlsbad, CA) The cells were ruinously passed by the ipsynthesis and the dilution when they reached the confluence of 90% The cells were seeded in 96 well plates ( Hawk-Primary # 353872) at a density of 7000 cells / wells for use in the RT-PCR analysis For Noríhern analysis, the cells can be plated on 100 millimeters or you can hear standard plates of yeast and similarly treated, using appropriate volumes of the medium and the oligonucleotide A549 cells: The human line A549 of the lung carcinoma cell was obtained from the American collection na culture of the Iipo (ATCC) (Manassas, VA). A549 cells were routinely cultured in the basic DMEM media (Inviírogen Corporation, Carlsbad, CA) supplemented with fecal calf serum 10% (Inviírogen Corporaíion, Carlsbad, CA), penicillin 100 units per ml, and 100 micrograms per ml of scleropyomycin (Inviírogen Corporaíion, Carlsbad, CA). The cells were ruíinarly passed by ipsylation and dilution when they reached the 90% confluence. NHDF cells: The human neonatal cutaneous fibroblast (NHDF) was obtained from Clonetics Corporation (Waikersville, MD). NHDFs were routinely maintained in the middle of fibroblast growth (Clonetics Corporation, Waikersville, MD) supplemented as recommended by the supplier. The cells were maintained for up to 10 steps as recommended by the supplier. HEK cells: Human embryonic keratinocytes (HEK) were obtained from Clonetics Corporation (Waikersville, MD). HEKs were held ruíinarly in the middle of the growth of Keraíinocite (Clonetics Corporation, Waikersville, MD) formulated as recommended by the suríídor. The cells were manipulated routinely for 10 steps as recommended by the supplier. B.END cells: The endothelial line b.END of the mouse brain cell was obtained from Dr. Werner Risau in the maximum plank Institute (Bad Nauheim, Germany). The b.END cells were routinely cultured in DMEM, alia glucose (Gibco / Life, Gaihersburg, MD) technologies supplemented with fetal calf serum 10% (Gibco / Life, Gaithersburg, MD). Cells were routinely passed by ipsylation and dilution when they reached 90% confluence. The cells were seeded in the 96-well plates (Falcon-Primary # 3872) at a density of 3000 cells / well for use in the RT-PCR analysis. For Northern staining or other analysis, cells can be seeded over 100 millimeters or other standard tissue culture plates and similarly drawn, using appropriate volumes of medium and oligonucleotide. HeLa Cells: The human cell line of the hepatocellular carcinoma was obtained from the American collection of tissue type culíivo (Manassas, VA). HeLa cells were routinely cultured in DMEM, alia glucose (Inviírogen Corporaíion, Carlsbad, CA) supplemented with 10% fetal bovine serum (Inviírogen Corporaíion, Carlsbad, CA). The cells were ruinarily passaged by trypsinization and dilution when they reached confluence of approximately 90%. Cells were seeded in 24 cavity plates (Falcon-Primary # 3846) at a density of approximately 50,000 cells / well or in 96-well plates at a density of approximately 5,000 cells / well for use in the RT-PCR analysis. For normalization or other analyzes, the cells were harvested when they reached the confluence of approximately 90%. MG U-87 Cells: The human line of the MG cell of glioblasimoma U-87 was obtained from the American collection of American Indian cohosh (Manassas, VA). MG U-87 cells were culminated in DMEM (life technologies of Inviírogen, Carlsbad, CA) supplemented with 10% fetal calf serum (Life technologies from Invitrogen, Carlsbad, CA) and antibiotics. The cells were ruiinarily passed through the syrinization and dilution when they reached proper confluence. Cells were seeded in 96-well plates (Falcon-Primary # 3872) at a density of about 10,000 cells / well for use in RT-PCR analysis. For normalization or further analysis, the cells can be plated over 100 millimeters or other standard plates of tissue culture and similarly, using appropriate volumes of the medium and the oligonucleotide. For northern infection or other analyzes, the cells may be seeded over 100 millimeters or other standard plates of tissue culture and treated similarly, using appropriate volumes of medium and oligonucleotide. Mh-s cells: The roots of the Mh-s cells were purchased from the American Ivy culinae collection (Manassas, VA). The. cells were maintained in the fetal serum made inactive medium calf heat of RPMl containing 1640 10% (FCS) (Hiclone Laboratories, Logan, UT). The cells were plated in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin. Traisameenia with the compound aníiseníido: When the cells reached the confluence 65-75%, were treated with the oligonucleotide. For the cells grown in the 96-well plates, the wells were washed once with 100 μL OPTI-MEM ™ -1 reduced serum (Invitrogen Corporation, Carlsbad, CA) and then brought with 130 μL of OPTI-MEM ™ -1 containing 3.75 μg / mL LIPOFECTIN ™ (Invitrogen Corporation, Carlsbad, CA) and the desired concentration of the oligonucleotide. The cells were irradiated and the damage was done in the process. After 4-7 hours of the raisonning at 37 ° C, the medium was subsumed by fresh medium. The cells were harvested 16-24 hours after the oligonucleotide. The concentration of the oligonucleotide used varies from line of the cell to the line of the cell. To determine the optimum concentration of the oligonucleotide for a particular line of the cell, the cells were irradiated with a positive oligonucleotide of the conírol in a range of concentrations. For human cells the positive oligonucleotide of the conírol is selected from any ISIS 13920 (TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1) that was appended to human H-ras, or from ISIS 18078, (GTGCGCGCGAGGGAGAATC, SEQ ID NO: 2) point to the June-N-terminal human kinase-2 (JNK2). Both controls are the 2'-O-methoxyethyl (2'-0-methoxyethyl) gapmers shown in bold) with a skeleton of phosphorus. For the root or branch cells the positive oligonucleotide of the control is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 3, a gapmer 2'-0-meioxiefile (2'-0-methoxyethyl) shown in bold) with a skeleton of the fosforoíioaío which was aimed at the raíón and c-raf de rala. The concentration of the positive oligonucleotide of the control that results in the inhibition of 80% of cH-ras (for ISIS 13920), of JNK2 (for ISIS 18078) or (for ISIS 15770) the messenger RNA of c-raf is then used as the concentration of the investigation for the new oligonucleotides in the subsequent experiments for that cell line. If the 80% inhibition is not reached, the lowest concentration of the positive oligonucleotide of the conírol that results in the 60% inhibition of cH-ras, of JNK2 or c-Royal Air Force messenger RNA is then used as the concentration of the oligonucleotide invesíigación in the subsequent experiments for that line of the cell. If 60% inhibition is not achieved, that particular line of the cell is deemed as inadequate for experiments of oligonucleotide transfection. The concentrations of the antisense oligonucleotides used here are from 50 nM to 300 nM.

Example 10: Oligonucleotide inhibition analysis of elF4E expression. Anisense modulation of elF4E expression can be assayed in a variety of ways well known in the art. For example, the levels of the messenger RNA of elF4E can be quantified either, by, v. g., Northern Blot, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Quantitative real-time PCR is currently ideal. RNA analysis can be performed on total cellular RNA or poly (A) + messenger RNA. One method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. The northern analysis of the blot is also routine in the art. Quantitative real-time (PCR) can be conveniently achieved using the PRISMA commercially available from ABI PRISM ™ 7600, 7700, or 7900, or sequence detection system, available from the PE-Applied biosystems, Foster City, CA and used according to manufacturer's instructions. The levels of the elF4E protein can be quantified in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoinination), enzyme-linked immunosorbent assay (ELISA) or classify fluorescence-cell acyivate (FACS). The antibodies directed to elF4E can be idenified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Ml), or they can be prepared via conventional monoclonal or polyclonal methods of the antibody aniibody. generation well known in the art.

Example 11: Design of phenotypic analyzes for the use of elF4E inhibitors. Once the elF4E inhibitors have been identified by the methods disclosed here, the compounds are further investigated in one or more phenotypic analyzes, each having predictable measurable endpoints of efficacy in the treatment of a condition or condition. particular of the disease. The phenotypic analyzes, the equipment and the reagents for its use are well known by those skilled in the art and here they are used to investigate the role and / or the association of elF4E in health and disease. Representative phenotypic analyzes, which can be purchased from several commercial vendors, include those to determine the survival of viability, cytotoxicity, proliferation or cell cell (molecular test points, Eugene, O; PerkinElmer, Bosíon, MA), protein-based analysis including enzymatic assays (Panvera, LLC, Madison, Wl; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Productions, San Diego, CA), cell regulation, signal transduction, inflammation, processes and oxidative apoptosis (Assay Designs Inc., Ann Arbor, Ml), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), analysis of angiogenesis, analysis of the formation of the tube, analysis Cyclocine and Hormone "and Metabolic Analysis (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ) In a non-limiting example, the cells were determined to be suitable. for a particular phenotypic analysis (ie, Mcf-7 cells selected for breast cancer study; adipocytes for obesity studies) were brought with the in vitro inhibitors of the in vitro studies or as control compounds at optimum concentrations that are determined by the methods described above. In treated and non-treated cells at the end of the treatment period, they are analyzed by one or more specific methods so that the analysis determines phenotypic end points and outcomes. The pheoyipic endpoints include changes in cell morphology in a close range of dose or irradiation as well as changes in the levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or melales. Cell cycle measurements that include the pH, the cell cycle cycle, the production or excretion of biological indicators by the cell, are also final points of interest.

The analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after the treatment is also used as an indicator of the efficacy or potency of the elF4E inhibitors. Hallmark genes, or those genes suspected to be associated with a condition, a condition, or a specific phenotype of the disease, are measured in irradicated and untraced cells.

Example 12: RNA isolation. Isolation of messenger RNA + Poly (A). The messenger RNA of Poly (A) + was isolated according to Miura et al., (ClinS chem., 1996, 42, 1758-1764). Other methods for the isolation of poly (A) + messenger RNA are ruíinarios in the art. Briefly, for the cells grown in 96-well plates, the growth medium was removed from the cells and each was washed well with 200 μL cold PBS. 60 μL of buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM, vanadyl ribonucleoside complex) was added, the plate was shaken gently and then incubated in the ambient temperature for five minutes. 55 μL of the lisaio was transferred to the covered plates d (T) with 96 cavities of Oligo (AGCT Inc., Irvine CA). The plates were incubated for 60 minutes in ambient temperature, washed 3 times with 200 μl of the freezer buffer (10 milliliters Tris-HCl pH 7.6, EDTA 1 millimeter, NaCl of 0.3 M). After the final wash, the plate was dyed on paper towels to remove excess buffer from the wash and then air dried for 5 minutes. 60 μL of the elution buffer (5 mm Tris-HCl pH 7.6), preheated to 70 ° C, was added well to each plate, the plate was incubated on a hot plate 90 ° C for 5 minutes, and the eluate then it was transferred to a cool plate 96 cavities. "Cells grown in 100 mm or other standard plates can be similarly brought, using the appropriate volumes of all solutions.

Total Isolation of RNA The total RNA was isolated using a RNEASY 96 equipment and in-the-shelf storages purchased from Qiagen Inc. (Valencia, CA) following the manufacturer's recommended procedures. Briefly, for the cells grown in 96-well plates, the growth medium was removed from the cells and each was washed well with 200 μL of cold PBS. 150 μL Buffer RLT was added to each well and the plate was shaken vigorously for 20 seconds. 150 μL of 70% of the ethanol was then added to each well and the mixture mixed by pipetting several times up and down. The samples were then transferred to the RNEASY 96 ™ plate attached to a multiple QIAVAC ™ fitted with a waste collection tray and attached to a vacuum generator. The vacuum was applied for 1 min. 500 μL of buffer RW1 was added to each well of the RNEASY 96 ™ plate and incubated for 15 minutes and the vacuum was requested again 1 minute. Additional 500 μL of buffer RW1 was added-to each cavity of the RNEASY 96 ™ plate and vacuum was requested 2 minutes. 1 ml of the buffer RPE was then added to each cavity of the RNEASY 96 ™ plate and the vacuum requested a period of 90 seconds. The pouring of the RPE buffer was then repeated and the vacuum was requested for an additional 3 minutes. The plate was then removed from the multiple dry QIAVAC ™ and erased in the paper towels. The plate was then reattached to the multiple QIAVAC ™ fitted with a set of tube from the collection containing the tubes of the 1.2 ml collection. The RNA was then rinsed by measuring with a pipette 140 μl of the ARase water freely in each cavity, incubating 1 min., And then applying the vacuum for 3 min. The measuring steps with pipetting and elution can be automated using a Bio-Roboí 9604 from QIAGEN (Qiagen, Inc., Valencia CA). Essentially, after lysing the cells in the culture plate, the plate is transferred to the robot housing where the pipetting, dNase treatment and elution steps are performed.

Example 13: Quantitative real-time PCR analysis of the messenger RNA level of elF4E. Quantification of elF4E messenger RNA levels was achieved by quantitative real-time PCR using ABI 7600, 7700 PRISM ™, or 7900 sequence detection system (PE-Applied biosystems, foster city, CA) according to instructions manufacturer. This is a closed-tube, non-gel-based, fluorescence detection system that allows high-throughput quantification of the processing of polymerase chain reaction (PCR) products in real time. In comparison with standard PCR in which the products of the amplification are quantified after the PCR is finished, the products in quantifiable PCR in real time are quantified while they accumulate. This is achieved by including in the PCR reaction a probe tip of the oligonucleotide that specifically anneals between the forward and reverse PCR primers, and contains two fluorescent dyes. To a reporter who join »the dye (e.g., FAM or JOE, obtained from any Biosystems, Foster PE-Applied City, CA, Operon Technologies Inc., Alameda, CA or Injegrated DNA Technologies Inc., Coralville, IA) binds to the 5 'exíremo of the test probe and to one of the exíinor (e.g., TAMRA, obtained from any Biosystems, Foster PE-Applied Cify, CA, Operon Technologies Inc., Alameda, CA or Integrated DNA Technologies Inc., Coralville, IA) to the 3 'end of the probe. When the probe and the dyes are intact, the reporter's dye emission is turned off by the proximity of the 3 'extinguisher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5'-exonuclease activity of the Taq polymerase. During the extension phase of the PCR amplification cycle, the cleavage of the probe by the Taq polymerase releases the reporter's dye from the remainder of the probe (and therefore from the exponent portion) and a sequence-specific fluorescent signal is generated. With each cycle, additional reagent signal molecules are cleaved from their respective test points, and the fluorescence inity is monitored at regular intervals by the optic of the laser referred to in the ABIS PRISM ™ Detection System. Sequence. In each analysis, a series of parallel reactions containing serial dilutions of the messenger RNA from untraced control samples generates a standard curve which is used to quantify the percent inhibition after testing the antisense oligonucleotide of the test samples. Anis of quantitative analysis of PCR, initiator-probe systems specific to the gene of the target that is measured are evaluated so that their capacity is "multiplexed" with a reaction of the amplification of GAPDH. In multiplexing, the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, the messenger RNA isolated from the treated nd cells is serially diluted. Each dilution is amplified in the presence of primer-probe systems specific to GAPDH only, the target gene only ("single-plexing"), or both (multiplexing). After PCR amplification, standard GAPDH curves and target messenger RNA signal as a function of dilution are generated from the single-plexed and muliplexed samples. If the question and the correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the specific primer for that object is judged. muliplexible. Other PCR methods are also known in the art. The PCR reactants were obtained from Invitrogen Corporation, (Carlsbad, CA). The RT-PCR reactions were performed by the addition of a 20 μL PCR cocktail (2.5x PCR buffer, minus MgCl 2, 6.6 mM MgCl 2, 375 μM dATP, dCTP, dCTP and dGTP, 375 nM each of the primers Inverse and forward, 125 nM probe, 4 Units of RNAse inhibitor, 1.25 Units of PLATINUM® Taq, 5 Units of reverse transcription muLV, as well as a ROX ink of 2.5x) to 96-well plates containing, these, a solution RNA ion of 30 μL-in fotal (20-200 ng). The RT reaction was performed by incubation for 30 min. At 48C. After a thorough incubation at 95 ° C to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were performed: 95C for 15 seconds (denaturation) followed by 60C for 1.5 minutes (annealing / extension). The target quantities of the gene obtained by real-time RT-PCR are the normalized use of either the GAPDH level, a gene whose expression is constant, or by quantifying the total RNA using RiboGreen ™ (Molecular Probes, Inc. Eugene, OR). The expression of GAPDH is quantified by the RT-PCR in real time, by the operation simultaneously with the target, multiplexing, or separately. Total RNA is quantified using the Ribofen ™ RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). The methods of quantification of RiboGreen ™ RNA are taught in Jones, LJ, ei ai, (Biochemístry analífica, 1998, 265, 368-374.) In this analysis, 170 μL of the RiboGreen ™ reagent (RiboGreen ™ reagent diluted 1: 350 in 10mM Tris-HCl, EDTA 1mM, pH 7.5) is measured with a pipette in a 96 well plate containing 30 μL purified, cellular RNA. The plate is read in a CitoFluor 4000 (Applied Biosysiems of PE) with excitation at 485nm and emission at 530nm. The probes and primers for human F4E were designed to hybridize to a human sequence of elF4E, using the published sequence information (accession number of GenBank M15353.1, incorporated herein as NO.SEQ of idenification: 4) For the human elF4E the PCR primers were: front starter: TGGCGACTGTCGAACCG (IDENTIFICATION SEQ NO: 5). reverse initiator: AGATTCGGTTTTCTCCTCTTCTGTAG (IDENTIFICATION SEQ NO: 6). and the PCR probe was: FAM-aaaccacccctacícctaaícccccg-TAMRA (SEQ ID NO: 7) where is the tinie and the TAMRA FAM fluorescenis is the color of the quencher. For human GAPDH the PCR primers were: forward primer: ID NO: 8 GAAGGTGAAGGTCGGAGTC (SEQ). Reverse Initiator: GAAGATGGTGATGGGATTTC (IDENTIFICATION SEQ NO: 9). and the PCR probe was: 5 'Joe-caagcttcccgtícicacacc TAMRA 3' (SEQ ID NO: 10) where the index of the reporter and the TAMRA fluorescent is the color of the former. Probes and primers to elF4E of the raion were designed to hybridize to a sequence of the raffo elF4E, using the published sequence information (accession number of GenBank NM_007917.1, incorporated herein as SEQ ID NO: 11). For the elF4E of the raion the PCR primers were: front starter: AGGACGGTGGCTGATCACA (ID SEQ NO: 12). Reverse initiator: TCTCTAGCCAGAAGCGATCGA (ID SEQ NO: 13). and PCR probe was: FAM-tgaacaagcagcagagacggagtga-TAMRA (SEQ ID NO: 14) where the reporter's dye and the fluorescent TAMRA FAM is the tiniest of the former. For the GAPDH raion the PCR primers were: forward primer: ID NO: 15 of GGCAAATTCAACGGCACAGT (SEQ). reverse initiator: ID NO: 16 OF GGGTCTCGCTCCTGGAAGAT (SEQ). and the PCR probe was: 5 'JOE-AAGGCCGAGAATGGGAAGCTTGTCATC TAMRA 3' (SEQ ID NO: 17) where JOE is the index of the reporter and the TAMRA fluorescein is the same as the exintitor.

Example 14: Northern blot analysis of messenger RNA levels of elF4E. Eighteen hours after the antiseizure treatment, the cell monolayers are washed twice with cold PBS and lysed in 1 ml ARNZOL (TEL-TEST "B" Inc., Friendswood, TX). The RNA RNA is prepared after the recommended pro-molecules of the manufacturer. Twenty micrograms of total RNA are fractionated by elecrophoresis through the 1.2% agarose gels containing 1.1% formaldehyde using the MOPS inertiary buffer system (AMRESCO, Inc. Solon, OH). RNA is transferred from the gel to HYBOND ™ N-N + membranes (Amersham Pharmacia Bioíech, Piscaíaway, NJ) by overnight hair transfer using a Noríhern / Souíhern transfer buffer system (TEL-TEST "B "inc, Friendswood, TX). The transfer of RNA is confirmed by UV visualization. The membranes are fixed by UV bonding using a STRATALINKER Crosslinker UV 2400 (Síraíagene, Inc., La Jolla, CA) and then probed using the QUICKHYB ™ Hybridization Solution (Síraíagene, la Jolla, CA) using the manufacturer's recommendations for rigorous conditions. To designate the human elF4E, a specific probe of the human elF4E is prepared by PCR using the forward primer TGGCGACTGTCGAACCG (SEQ ID NO: 5) and the reverse primer AGATTCCGTTTTCTCCTCTTCTGTAG (SEQ ID NO: 6). To standardize for variations in membranes the loading and transfer efficiency are peeled and probed for the human RNA of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Clonik, Palo Alio, CA). To delect the mouse elF4E, a specific probe of the rand elF4E is prepared by PCR using the forward primer AGGACGGTGGCTGATCACA (SEQ ID NO: 12) and the reverse primer TCTCTAGCCAGAAGCGATCGA (SEQ ID NO: 13). To normalize for membrane variations the loading and transfer efficiency are peeled and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, CA). The cross membranes are visualized and quantified by hybridization using a PHOSPHORIMAGER ™ and IMAGEQUANT ™ Software V3.3 (Molecular Dynamics, Sunnivale, Ca). Data are normalized to GAPDH levels in non-controlled controls.

Example 15: Antisense inhibition of human expression of elF4E by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy. In accordance with the present invention, an array of anisense compounds was designed to target various regions of the human RNA of elF4E, using the published sequences (accession number of GenBank M15353.1, incorporated herein as SEQ ID NO: 4). The compounds are shown in Table 1. The "target site" indicates the first (5'-moo) nucleotide number in the particular human target sequence of elF4E to which the compound binds. All compounds in Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central region of the "gap" consisting of ten 2'-deoxynucleotides, which is flanked on both sides (5 'and the directions 3 ') by the "wings of five nucleoids." The wings are composed of the nucleoside 2'-meioxieíilo (2'-MOE) .The bonds of the internucleoside (skeleton) are the phosphorothioaio (P = S) to íravés of the oligonucleóíido. the cyididium residues are 5-meycylcyidines A second set of aniseisenidic compounds was designed to target various regions of the mouse elF4E RNA, using the published sequences (accession number of GenBank NM_007917.1, incorporated herein as SEQ ID NO: 11 The compounds are shown in Table 1. The "target site" indicates the first (5'-moo) nucleotide number in the particular human target nucleic acid of elF4E to which the compound binds. Table 1 are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, broken down by a central region of the "mouth" which consists of ten 2'-deoxynucleotides, which is flanked on both sides (5 'and 3' directions) by "wings" of five nucleotides ". The wings are composed of 2'-methoxy-thiyl (2'-MOE) nucleoides. The bonds of the inínucleoside (skelenoid) are the phosphoriumium (P = S) through the oligonucleotide. All the cytidine residues are 5-methylcylidines. As the compounds in Table 1 are complementary to the human being and the sequences of the elF4E of the raion, the compounds were analyzed for their effect on human levels of the messenger RNA of elF4E by the actual PCR time as described in other examples here. Damages are averaged from experiments in which A549 cells were treated with the antisense oligonucleotides of the present invention. The positive control for each data point is identified in the path by the ID sequence number. If present, "N.D." indicates "no data".

Table 1 Inhibition of human elF4E messenger RNA levels by chimeric oligonucleotide phosphorylates bearing 2"-MOE wings and a deoxy gap As shown in Table 1, identification SEQ No. 20, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, 33, 34, 37, 38, 39, 40, 42, 43, 44, 46, 47, 51, 52, 54, 56, 57, 58, 59, 60, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 110, 111, 112, 114, 115, 116, 117, 118, 119, 120 and 122 demonstrated at least 50% inhibition of human expression of elF4E in this analysis and are by I agree to it. The idenification SEQ No. 80, 65, 40, 97 and 105 is also convenient. The regions of the object to which these conventional sequences are complementary are referred to herein as "objective objectives are divided into segments" and are therefore convenient for targeting the compounds of the present invention. These conventional sequences of objectivity are shown in table 3. These sequences are shown to contain the image (1) but one of skill in the field will appreciate that the model (1). is generally subsumed by the uracil (u) in RNA sequences. The sequences represent the reverse complement of the suitable antisense compounds shown in table 1. The "site of the target" indicates the first (5'-moo) number of the nucleoide in the particular target nucleic acid to which the oligonucleotide attaches. Also shown in Table 3 is the species in which each of the convenient segments of the target was found.

Example 16: Antisense inhibition of mouse elF4E expression by chimeric phosphorothioate oligonucleotides having 2'-MOE wings and a deoxy open. According to the present invention, the compounds in vector 1, to which is complementary human and the mouse F4E (for example accession number of GenBank of elF4E of mouse NM_007917.1, incorporated herein as SEQ ID NO: 11) they were further analyzed for their effect on mouse elF4E messenger RNA levels by the actual quantitative PCR as described in other examples here. In table 2, the "siiio de la objeíivo" indicates the first (5'-moo) number of the nucleoid in the nucleic acid of the root of the specific object of the elF4E to which the compound binds. The data, shown in table 2, are averages from other experiments in which the b.END cells were irradiated with the antisense oligonucleotides of the present invention. The positive order for each daisy is idenified in the table by the sequence number ID. If present, "N.D." it does not indicate "no harm".

Table 2 Inhibition of mouse elF4E RNA messenger levels by chimeric oligonucleotide phosphorylates bearing 2'-MOE wings and hollow deoxy As shown in Table 2, idenification SEQ No. 21, 23, 24, 29, 30, 40, 45, 57, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 104, 105, 106, 107, 108, 111, 112, 115, 116, 117, 118, 120, 122 demonstrated at least 70% inhibition of mouse elF4E expression in this' experiment and is therefore convenient. The idenification SEQ No. 105, 40, 97 and 80 is also convenient. The objecivo regions to which are conventional sequences are complementary here are referred to as "convenient objeíivo divide in segments" and are therefore convenient to aim for the compounds of the present invention. These conventional sequences of objectivity are shown in table 3. These sequences are shown to contain the thymine (1) but one of skill in the field will appreciate that the model (1) is generally subsumed by the uracil (u) in sequences of the RNA The sequences represented the reverse complement of the aniseisenidian convenienic compounds demonstrated in lines 1 and 2. the "symbol of the object" indicates the first (5 '~ moo) number of the nucleotide in the particular target nucleic acid to which the oligonucleotide attaches . Also shown in Table 3 is the species in which each of the conventional segmenios of the objeíivo was found.

Table 3 Sequence and position of suitable target segments identified in the F4E As you are, "Convenient segmenios de la objeíivo" have been found by the experimentation to be open, and accessible to, to the hybridization with the amphisense compounds of the present invention, one of skill in the field will recognize or be able to verify, with no more experimentation that ruíinaria, other embodiments of the invention that encompass other compounds that hybridize specifically to these convenient segments of the target and therefore inhibit the expression of elF4E. According to the present invention, the anisense compounds include the antisense oligonucleotides, ribozymes, oligonucleotides exíernos of the sequence of the guide (EGS), compounds of the siRNA, choose or compounds of double-strand structure of RNA inference (RNAi) and other compounds oligomerics that cross by hybridization to at least a portion of the target nucleic acid and modulate its function.

Example 17: Western blot analysis of elF4E protein levels. Western blot analysis (immunostaining analysis) can be performed using standard methods. The cells are harvested 16-20 hours after the oligonucleotide treatment, washed once with PBS, suspended in the Laemmli buffer (100 μl / well), boiled for 5 minutes and loaded onto a gel of the SDS-page of 16%. The gels are operated for 1.5 hours at 150 V, and transferred to the membrane to erase western. The appropriate primary antibody directed to elF4E is used, with a secondary irradiated or fluorescently labeled antibody directed against the primary species of the antibody. The bands are displayed using a PHOSPHORIMAGER ™ (Molecular Dynamics, Sunnivale Ca).

Example 18: Effect of antisense inhibition of elF4E expression on cell proliferation. HeLa cells (American VA from the collection, from Manassas culture type), μl 1 x 106 cells / 100, were electroporated with the oligonucleotide of 3.25, 7.5, 15 and 30 μM. The Anisenseid inhibitors of the elF4E ISIS used were ISIS 183750 (SEQ ID NO: 40 and ISIS 298815 (SEQ ID NO: 97).) The oligonucleotides used were ISIS 29848 (NNNNNNNNNNNNNNNNNNNN; Idenification SEQ NO: 207, where N is a mixture of A, C, G, and T) and an oligonucleotide without an ISIS 129688 relation (TTCGCGGCTGGACGATTCAG of the conírol; IDENTIFICATION SEQ NO: 208). A mock-transfusion was also used. Cell proliferation was measured in cells harvested with the 15 μM oligonucleotide using the CiQUANT cell proliferation analysis kit (Molecular Probes, Inc., Eugene O). Inhibitors of the Anisense oligonucleotide of human elF4E ISIS 183750 and ISIS 298815 inhibited cell proliferation after 72 hours by 31% and 36%, respectively, compared to mock-frayed cells. The cells irradiated with the oligonucleotides of the control proliferated at rates at least as large as that of the mock-iridian coníroles. The reduction of the messenger RNA of the elFÁ object was also measured in this experiment. ISIS 183750 and ISIS 299815 IC50s rendered less than μM of 3 (the concentration needed to inhibit messenger RNA from the elF4E levels by 50%) and from the demonstrated inhibition 70-80% at oligonucleotide concentrations of μM 7.5 and above . The oligonucleotides 29848 and 129688 of the control yielded a maximum inhibition of 20% (7.5 μM 129688) but generally gave the inhibition of approximately 10% in other concentrations. The effect of the anisease inhibition of elF4E on cell proliferation was also measured in human glioblastoma cells of U87-mg. The cells of U87-mg (American VA of the collection, of Manassas of culíivo del íipo), μl 1 x 106 cells / 100, were elecroporaíed with ISIS 183750 (SEQ ID NO: 40) and ISIS 298815 (SEQ ID NO: 97 ) and an oligonucleotide without an ISIS 129699 ratio (GGATAGAACGCGAAAGCTTG (of the control); SEQ ID NO: 209) in the μM 7.5. The two antisense inhibitors of elF4E, ISIS 183750 and ISIS 298815, reduced cell proliferation of U87-mg compared to conírol (ISIS 129699) by approximately 12% and 10%, respectively, after 96 hours. The messenger RNA of the EIF4E target was measured at 48 hours after the beginning of the year and reduced by approximately 31% of ISIS 183750 and 36% of ISIS 298815 when compared to the untreated levels of the messenger RNA of the confola elF4E. it was not reduced by the control oligonucleotide ISIS 129699 and was not really increased slightly.

Example 19: Effect of antisense inhibition of elF4E expression in cell cycle. The effect of the aniseisenide compounds of elF4E on the cell cycle was examined. The heLa cells were eleciroforeated with the 30 μM aniseisenid oligonucleotide (ISIS 183750 or 299815) or the control oligonucleotide (ISIS 29848 or ISIS 129688), or transfected mock. The fluorescent iodide of the propidium of the DNA oligonucleotide (pi) was used to measure the DNA content in 48 hours, using the flow cytometry. The results (done in duplicate) are shown in table 4.

Table 4 Cell cycle profile after antisense treatment From the results shown in Table 4 it can be seen that the irradiation with both antiserum compounds of elF4E (ISIS 183750 or ISIS 298815) increased the cell portion in the SubG1 phase, which is generally indicative of apoplosis. The cell portion in G2M was also increased after the ISIS 298815 period.

Example 20: Effect of antisense inhibition of elF4E expression in angiogenesis / tube formation. Angiogenesis is stimulated by numerous factors that promote the interaction of endoíelial cells with each other and with the exíracellular molecules of the maíriz, resulting in the formation of capillary tubes. This process can be reproduced in tissue culture by the formation of an iguus type of endocrine cells. The loss of formation of the tube in the head has been correlated with the inhibition of angiogenesis in vivo (Carmelieí et al., Naíuraleza, 2000, 407, 249-257; and Zhang et al., Cancer research, 2002, 62, 2034- 42), which supports the use of training in viilus of the tube as a final punctuation for angiogenesis. The analysis of the formation of the tube was performed using an in vitro equipment of the analysis of Angiogenesis (Chemicon international, Temecula, CA), or the growth factor reduced Mairigel (biosciences of BD, Bedford, MA). HUVECs were plated in 4000 cells / cavity in 96-well plates. One day later, the cells were transfected with the antisense oligonucleotides and the coninol according to standard published procedures (Monia et al., J. Biol. Quim., 1993, 268 (19), 14514-22) using the oligonucleotide of 75 nM in lipofecíina (Gibco, Grand Island, Nl). Approximately 50 hours post-transfection, cells were transferred to 96-well plates covered with ECMatrix ™ (Chemicon International) or the growth factor overwhelmed Mairigel. Under these conditions, HUVECs not treated form type structures. After an overnight incubation in treated and untreated cells of 37 ° C, they were examined by light microscopy. The individual cavities were assigned discrete accounts from 1 to 5 depending on the degree of tube formation. A count of 1 refers to well without the formation of the tube while a count of 5 is given to the cavities where all the cells are forming an exuberant fibular network. According to the calculation of the assigned discrete basins, the irradiated cells with the inhibitors ISIS 183750 and ISIS 298815 were detected in average counts of the tube formation of approximately 1.5 and 2.25, respectively. Cells treated with the ISIS 29848 random oligonucleotide (NNNNNNNNNNNNNNNNNNNN of the control; SEQ ID NO: 207, where N is a mixture of A, C, G and T) had a mean tube formation count of about 4.25 and cells treated with ISIS 334163 (TGTTACAGTCTTGTACCCTT; SEQ ID NO: 210), a poorly made 6-base union of ISIS 183750, had an average count of about 4.5 tubing. Thus, the formation of the tube is specifically inhibited by 47-67% by the antisense oligonucleotides of elF4E. The inhibitors of Aníiseníido of elF4E can, therefore, inhibit angiogenesis.

Example 21: Inhibition of elF4E expression in mice Eight-week-old rabbits C57BL6 were injected intraperitoneally with the oligonucleotide in saline twice weekly for 3 weeks (6 total doses) at a concentration of the oligonucleotide of 40 mg / kg. The compunds used were the compounds ISIS 183750 (SEQ ID NO: 40), ISIS 299815 (SEQ ID NO: 97), ISIS 298797 (SEQ ID NO: 80) and ISIS 298823 (SEQ ID NO: 105) aníisenide of elF4E. All are oligonucleotide cross-species aniseniseid to elF4E from human and mouse. ISIS 141923 is an unrelated oligonucleotide (of the conírol) (CCTTCCCTGAAGGTTCCTCC; IDENTIFICATION SEQ NO.211). A saline conírol (of the vehicle) was also used. Compared to saline control, ISIS 183750 reduced levels of messenger RNA from elF4E in mouse liver to at least 20% conlrol (about 80% inhibition). The messenger RNA also reduced from the ISF-298815 elF4E levels to approximately 20% conírol. Reduced treatment levels of messenger RNA from elF4E from ISIS 298797 to approximately 30% conírol (70% inhibition) and from the treatment of ISIS 298823 reduced levels of messenger RNA from elF4E to approximately 37% control (63% inhibition). On the contrary, the irradiation with ISIS 141923 did not reduce levels of the messenger RNA of elF4E and actually increased them to approximately 140% of the saline conírol. The proinin levels of EIF4E in the liver of the raion were also measured. Compared to saline control, the treatment with ISIS 183750, ISIS 299815, ISIS 298797 and ISIS 298823 reduced the levels of the elF4E by 77%, 47%, 50% and 47% respectively.; the irradiation with the oligonucleotide ISIS 141923 of the conirdl reduced levels of the elF4E protein by 12%. The mice were brought with any of the aniisenide compounds of elF4E and showed essentially no change in liver, spleen or body weight. There was no significant change in the levels of the liver enzyme (AST / ALT) and the hisisology of the liver appeared the same for the conirol rations treated with saline.

Example 22: Effect of antisense inhibition of elF4E expression on human tumor xenografts in mice Male nude mice were injected subcutaneously into the flank with 5 x 10 6 human carcinoma cells of the Pc-3 prostate (American VA of the collection , of Manassas of the culíura del íipo). The flowering period of Anisensida began when the eggs reached a bad size of 100 mm3, approximately 3 to 3.5 weeks after the implan- tation. The roots were given 50 mg / kg by the antiretroviral injection antisense to elF4E, to ISIS 183750 (SEQ ID NO: 40) or to oligonucleotide ISIS 141923 (SEQ ID NO: 211) of the control in the first dose and then 25 mg / kg every Monday, Wednesday and Friday after that. By day 54 after the implanization of the tumor, the tumors in the rails treated with ISIS 183750 were approximately 450 mm3 in size, approximately a 50% reduction compared to the tumors in mice irradiated with the coniroi, ISIS 141923 (approximately 930 The level of reduction coninued to the end of the study on day 57. Xenoinjerío was also done similarly using the human breast cancer cells Mda-231 (American Collection, Manassas of Iguish Culibae) in In these experiments, ISIS 183750 and ISIS 298815 were tested and gave almost identical reduction in tumor cell growth of 55% and 50%, respectively, compared to the saline expression of the elF4E. were analyzed in the MDA-231 xenoinjerío by analysis of the Wesern blot (which uses the antibody to elF4E of Pharmingen, San Diego C A) and found to be reduced by 45% in the branches framed with ISIS 183750 (SEQ ID NO: 40) and by 39% in the rationed lines with ISIS 298815 (SEQ ID NO: 97), when they were compared to the Xenoinjerío in raíones íraíaron with an oligonucleóíido unrelated conírol (ISIS 141923, SEQ ID NO: 211). ElF4E can be phosphorylated in vivo at the serine residue 209 of the human sequence. The phosphorylated form is often regarded as the proinin's acid base, with increasing phosphorylation often correlated with over-regulation of protein synthesis rates. Western blots using the antibody specific for (pS209) the phosphorylated elF4E (BioSource, Camarillo CA) confirmed a decrease in the phosphorylated form of the F4E after the erary with the anisenside composes ISIS 183750 and 298815, but not a conírol aníiseníido (ISIS 129699). "Cyclin D1 is a proiein of the objective of eiF4E and the proinin of cyclin D1 was also found to be reduced in the xenograft MDA-231 in the irradiated rations with the anisemicide to elF4E. Cyclin D1 was reduced by 40% after This was compared with ISIS 183750 and by almost 50% after treatment with ISIS 298815, when compared to the expression of cyclin D1 in xenograft in mice treated with the oligonucleotide unrelated to ISIS 141923. In a similarly conducted study of the xenograft, The female nude mice were injected subcutaneously into the flank with 5 x 10 6 human lung cancer cells from the non-small-cell H460 (NSCLC) (American VA from the collection, from Manassas of the type culture). Intravenous dosing with the oligonucleotides started once the tumors reached a bad size of 100 mm3. The schedule of the anisic acid irradiation began with an a dose of ISIS 141923 or of ISIS 183750 at 50 mg / kg followed by 25 mg / kg every Monday, Wednesday and Friday-for a 17-day time period. At the end of the study, the malignant volume of the urinary control-isotole group of ISIS 141923 was approximately 2000 mm3 conira 550 mm3 for ISIS 183750 (p <0.001). Example 23: Inhibition of elF-4E through RNA Oligonucleotides of Short Double Chain Structure Design and synais of dhRNA oligonucleotides.

The Genbank human sequence # M15353 from elF-4E was asked for the sequences. The G + C content of selected sequences extends from 30% to 70%. Each of the dhARN orders specific to elF-4E and represented below contains two nucleotides of deoxythymidine at the 3'-terminal end of each chain oligonucleotide duplex oligonucleotide (not shown). Synthesis, duplex formation and purification of gene-specific siRNAs were carried out by Dharmacon Research Inc. that the elF-4E siRNA sequences were selected and tested, and are shown below: elF4E_1: Gene sequence position: 141-159 GC content: EL 53% 5 '-CAGAUGOGCACUCUGGUUU-3' ID SEQ NO: 212 3 '- GUCUACCCGUGAGACCAAA-5' ID SEQ NO: 213 EIF4E_2: Gene sequence position: 195-213 GC content: 63% 5 '- CCUGCGGCUGAUCUCCAAG-3' ID SEQ NO: 214 3 '- GGACGCCGACUAGAGGUUC-5' ID SEQ NO: 215 EIF4E_3: Gene sequence position: 1010-1028 GC conid: 37% 5"- CAACUUGGCAUUUCUAUAC-3 'SEQ ID NO: 216 3' - GUUGAACCGUAAAGAUAUG-5 'SEQ ID NO: 217 A composite of conírol dsRNA, also coniendo Two deoxyimidine nucleoides in the 3'-terminal eminence of each chain structure and complementary to Luciferase pGL2 were purchased from Dharmacon Research Inc. and used in the trial further down the line.

Control: 5 '- CUUACGCUGAGUACUUCGA-3"SEQ ID NO: 218 3' - GAAUGCGACUCAUGAAGCU-5 'SEQ ID NO: 219 Cell culture LNCaP, PC3, HCT116, MDA-231, MCF-7, T24, and the CWR22RV1 cell lines are obtained through the ATCC and grown in the RPMl 1640 medium with Ll-glutamine, without the red of phenol (Gibco) which contains 10% FBS (Hyclone). Transfection of the siRNA in mammalian cells. Mammalian cell lines were plated at 1 x 105 cells in 24-well plates 24 hours after infection. The transitory infections are performed using Oligofectamine (Invitrogen). Briefly, the individual dhRNAs in a concentration between 5 to 500 nM (final volume) are diluted in OpiMEM (Inviirogen) while a separate solution of OpiMEM and Oligofehiamine is incubated in the ambient atmosphere for 5 minutes. The two solutions are mixed, followed by an incubation of the temperament in 30 minutes. Media containing serum is added to the transfection complex for a final volume of 0.5 ml / well. Existing cell media is aspirated and subsumed by complex transfection and incubated for 48-72 h in 37 oC, C02 of 5%.

Immunostaining After 72 hours, the transfection mixture was aspirated gently, and the cells were lysed in 150 ice-cold frozen buffer of UL RIPA (50 milliliters Tris-HCl, pH 7.4, 150 milliliters of NaCl, 1% Np -40, 0.25% Na-na-deoxycholaie, EDTA of 1 millimeter) containing the inhibitors of the proiease of the plasma (biochemical molecular products of Roche), Na3V05 of 1 millimeter and incubated for 30 min. At room temperature and They are stored in the oC -20 for 1-24 hours. Thirty μl of the thawed lysate are added to 10 μl of the injector buffer of the 4X NuPage sample (Inviírogen) which contains 0.2 M DTT. The samples are heated for 5 minutes at 85 ° C and loaded on 4-20% tris-tris-glycine polyacrylamide gels (Invitrogen). The gels are transferred to the membranes of Hybond-P PVDF (Amersham Pharmacia Biotech) for 1100 mA.H in 1X free transfer buffer with 20% meianol. The membranes are blocked in PBS containing nonfat milk of 5% for 1 hour. The antibodies, the anti-elF4E (BD biosciences) and the primary coníra-acíinia (sigma) are diluted in the blockade of the inimerial buffer in 1: 500 and 1: 10,000, respectively and incubate 16 hours in the oC 4. Membranes are washed 3X in PBS, followed by secondary incubation of the anti-root antibody (Sania Cruz) for 2 hours at room temperature. The black / white stains are washed 3X in PBS and brought with the chemiluminescent substrate of SuperSignal West Peak (Pierce) for 1 minute. The captured signal is recorded in a Lumi-lmager F1 (molecular biochemical productions of Roche). The bands corresponding to elF4E and acyinia are quantified using the LumiAnalysí sofíware, and the expression levels of elF4E are determined after normalizing the actin to conyrolar for loading and gel transfer. In the LNCaP cell line, each of elF4E-1, elF4E-2, and elF4E-3 inhibited levels of the elF-4E protein by greater than 50% at concentrations of less than 50 nM. In the cell line CWR22RV1, concentrations of less than 5 nM elF4E-2 inhibited levels of elF-4E protein by greater than 50%. In each cell lines of LNCaP, PC3, HCT116, Mda-231, and Mcf-7, concentrations of elF4E-1 and elF4E-2 less than 50 nM reduced the expression of elF protein -4E wholesale the 50%. Analysis of cell proliferation The cells were plated 24 hours before transfection at a cell density between 1.5-3.0 x 103 cells / cavity in the plates covered with 96-poly-D-lysine. cavities (Becíon Dickinson). Transfection of the elF-4E and conirol siRNAs is performed in duplicate at the siRNA concentrations that are expected to be from 5 nM to 500 nM. The cells are harvested in 3, 6 and 8 days by the addition of propidium iodide (sigma) in the final concentration of 50 g / ml, followed by a meticulous incubation of the ambient environment proiected with light. The plates are measured pre and freezing in a Vicino2 1420 mulíi - eíiqueíe upside down (Wallac). The corrected sums are obtained by resenting pre-freeze measures. In each cell lines of LNCaP, PC3, and MDA-231, concentrations of elF4E-1 and elF4E-2 less than 50 nM reduced cell proliferation by greater than 50%.

Example 24: The activity of the siRNA constructs pointed to elF4E in HeLa cells The "duplicated oligomeric RNA (dhRNA) compounds shown in Table 5 below were prepared as described in previous examples and evaluated in HeLa (American VA) cells. the Manassas collection of the type culture.) The culture methods used for heLa cells are available from the ATCC and can be found, for example, at www.aicc.org For comparison several antisense chimeric single oligonucleotides they were also tested.The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin.The wells were washed once with 200 μL Opi-mem-1 serum-reducing medium (Gibco BRL) and then brought with μL 130 of Opti-mem-1 to obtain the desired dhRNA at a concentration of 25 nM and 2.5 μl / ml LIPOFECTIN ™ ( Gibco BRL) by chain structure of the oligomeric compound. The proceedings were made in duplicate. After 4 or 5 hours of trayacin, the medium was subsituted by fresh medium. The cells were harvested 16 or 18 hours after the treatment of the dhRNA, in which case the RNA was isolated and the target reduction was measured by RT-PCR as described in the previous examples, normalized to Ribogreen. The human initiator / probe system is SEQ ID NO: 5, 6 and 7 used in previous examples. The results are shown in Table 5. The constructs of the siRNA shown consisted in an anysinose chain expression and a signal chain expression. The aniseisenidic chain (AS) structure is first demonstrated in Table 5 below, followed by the chain structure of the sense (S) in the next row. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the phosphates dorsal spines (P = 0) and the 5'-terminal hydroxyl group, and blind -are completed (no dTdT or other projection) unless indicated conirably. Unless otherwise indicated, - single-stranded anisense molecules are chimeric open oligonucleotides with 2'-MOE at nucleotides 1-5 and 16-20 and 2'-deoxynucleotides at positions 6-15, with spines of the phosphorolioaio (P = S) and 5-methylcytosines in each C. it is eniended in the arie that, for the sequences of the RNA, U (uracil) generally subsíiuyeye T (íimina) that is found normally in DNA or DNA-like sequences .

Table 5 RNAip constructs objectified to elF4E- Activity in HeLa cells 338932 AAAACCAGAGUGCCCAUCUG 264 141 Codif 88.2 338957 CAGAUGGGCACUCUGGUUUU 265 0.2 338933 ACUUGGAGAUCAGCCGCAGG 266 195 Code 42.1 338958 CCUGCGGCUGAUCUCCAAGU 267 5.7 338934 AGUAUAGAAAUGCCAAGUUG 268 1010 3 'UTR h 69.3 338959 CAACUUGGCAUUÜCUAÜACU 269 + 6.6 341887 AAACCAGAGUGCCCAUCUGTT 270 141 Codif H 69.5 eIF4E 1 Ribo + sa 4.6 excep_ to 3'dTd T 341886 CAGAUGGGCACUCUGGUUUTT 271 Ribosa exceg to 3'dTd T fifteen twenty "% inhibit" indicates% is from the reduction of elF4E RNA in cells treated with the duplex of the siRNA (or other compound as shown) compared to the unireaíed cells of the conírol. RNA quantification is by RT-PCR. Where "% inhibit" is negative, RNA from the target was increased. The "siiio de la objeíivo" indicates the position of the 5'-nucleoid moo of the object of the objeíivo respecío to No. of the accession of Genbank. M15353.1 to which the compound is specifically hybridizable. The "species" indicates whether the anysenoid sequence is perfectly complementary to the human (h), the rabbit (h), the mouse (m) and / or the rabbit elF4E (rab).

On this screen, the MOE gapmer leads to elF4E was found to be slightly more negative (94% inhibition) than the best siRNA (88% inhibition). Three out of five siRNA constructions in the previously idenified sites of the MOE gapmer lead are negative. Eight constructs of the elF4E siRNA demonstrate the reduction of the objection of 70% or more, and the reduction of seven shows of 75% or more. This is consistent with the conclusions of Vickers et al. (J. Biol. Chem., 2003, 278, 7108-7118), that is, in general, activity of the duplexes of the oligonucleotide of the siRNA correlated with the activity of the H-dependent oligonucleotides of the RNAse (eg, gapmers of MOE) directed to the same site, and the opimimized siRNA and the H-dependent oligonucleotides of the RNAse behave similarly in terms of potency, maximum effects, specificity and duration of action and efficacy. The compounds in the metabolic process were also tested for the ability to reduce levels of PTEN RNA in heLa cells. None of the elF4E-targeted compounds (siRNA or single-wave MOE gapmers) reduced RNA levels of the PTEN target by more than about 20%. The RNA inhibited positive conirol 335449 PTEN from the siRNA by about 85% and the single positive conirol cleaved ISIS 116847 from the MOE gapmer inhibited the PTEN RNA by about 80%.

Example 25: The activity of the siRNA constructs pointed to elF4E in MH-s cells Almost all of the siRNA compounds in the previous year are perfectly complementary to the human erythrocyte RNA and messenger RNA. Here they are tested on the murine alveolar line of the macrophage cell of the rami MH-s. The cells of the raimon's MH-s were purchased from the American Ichipo's Culia collection (Manassas, VA). The cells were manipulated in fecal serum made inactive calf mean heat of RPMl conniving 1640 10% (FCS) (Hyclone Laboratories, Logan, UT). Cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin. The wells were washed once with 200 μL Opfi-mem-1 serum-reducing medium (Gibco BRL) and then irradiated with μL 130 of Opi-mem-1 containing the desired dhRNA at a concentration of 20 nM and 2.5 ul / ml LIPOFECTIN ™ (Gibco BRL) by chain oligomeric compound. The days were made in duplicate. After 4 or 5 hours of irradiation, the medium was replaced by fresh medium. The cells were harvested 16 or 18 hours after the dhARN procedure, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown in Table 6. The demonstrated siRNA constructs consist of an aniseisenid chain expression and a sense chain structure. The antisense (AS) chain structure is shown first in table 6 below, followed by the chain-link structure (S) in the next row. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. Unless otherwise indicated, single-chain, aniseisenidic oligonucleotide molecules are chimeric, open oligonucleotides with 2'-MOE at nucleoids 1-5 and 16-20 and 2'-deoxynucleosides at positions 6-15, with spines of the phosphorus dioxide (P = S) and 5-meylycycinosines in each C. II is enlisted in the art that, for RNA sequences, U (uracil) generally substi tutes T (imine) which is normally found in DNA or DNA-like sequences . Write the names, species, chemistry and the sequences as in previous years.

Table 6 Activity of elF4E siRNA constructs in mouse MH-S cells Example 26: Additional siRNA constructs pointed to elF4E and activity in heLa cells. An additional step of the gene was made to identify additional RNAs that inhibit elF4E. The constructs were screened in HeLa cells at a concentration of 50 nM. The duplicated oligomeric RNA (dhRNA) compounds shown in lane 7 below were prepared as described in earlier examples and evaluated in HeLa cells (American Type Collection, Culosa Manassas VA). The culture methods used for HeLa cells are available from the ATCC and can be found, for example, at www.atcc.org. For comparison several single antisense braided chimeric oligonucleotides were also tested. The cells were placed in the 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin. The wells were washed once with 200 μL Opíi-mem-1 reducing medium-serum (Gibco BRL) and then irradiated with 130 μL of Opíi-mem-1 containing the desired dhRNA at a concentration of 50 nM and 2.5 ul / ml LIPOFECTIN ™ (Gibco BRL) by oligomeric compound chain oligonucleotide. The treatments were done in duplicate. After 4 or 5 hours of irradiation, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA., in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown in table 7. The demonstrated siRNA constructs consist of an antisense strand structure and a strand chain expression. The antisense chain (AS) structure is shown first in Table 7 below, followed by the chain string (S) in the next row. Unless otherwise indicated, all dual-chain constructions are unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. Unless otherwise indicated, the individual chain anysinose molecules are chimeric open oligonucleotides with 2'-moe in nucleoids 1-5 and 16-20 and 2'-deoxynucleosides in positions 6-15, with spines of phosphorus dioxide (P = S) and 5-meylycycinosines in each C. it is eniended in the arie that, for RNA sequences, U (uracil) generally subsides T (imine) that is normally found in DNA or DNA-like sequences .

Table 7 Activity of elF4E siRNA in HeLa cells "% is of inhib" indicates% is of the reduction of elF4E RNA in the cells treated with the double of the siRNA (or the other compound as shown) compared to the unireaíed cells of the conírol. Where "% inhib" is negative, the RNA of the target is increased. The quantification of the RNA is by RT-PCR. "Site of the objective" indicates the position of the 5'-nucleoid moo of the object of the objeíivo respecío to No. of the accession of Genbank. M15353.1 to which the compound is specifically hybridizable. The "species" indicates whether the anisensid sequence is perfectly complementary to the human (h), the rabbit (h), the rabbit (m) and / or the rabbit elF4E (rab).

Example 27: The activity of the siRNA constructs pointed to elF4E in MH-s cells. Almost all the siRNA compounds in the above table are perfectly complementary to the mouse and the messenger RNA of elF4E of the human being. Here they are tested on the murine alveolar line of the macrophage cell of the raion Mh-s. The cells of the raimon's MH-s were purchased from the American Ichipo's Culia collection (Manassas, VA). The cells were manipulated in fecal serum made inactive calf mean heat of RPMl coniendo 1640 '10% (FCS) (Hyclone Laboratories, Logan, UT). The cells were placed in 96-well plates at a density of 5000 cells / wells and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin. The wells were washed once with 200 μL Opíi-mem-1 serum reduction medium (Gibco BRL) and then irradiated with μL 130 of Opi-mem-1 containing the desired dhRNA at a concentration of 50 nM and 2.5 ul / ml LIPOFECTIN ™ (Gibco BRL) by oligomeric compound chain oligonucleotide. The days were made in duplicate.

After 4 or 5 hours of the year, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and the target was measured by RT-PCR as described in previous examples. The results are shown in table 8. The demonstrated siRNA constructs consist of an aniseisenid chain structure and a signal chain structure. The structure of the aniseisenid chain (AS) is shown; The string, the target site, the species, the chemistry, and the sequence are the same as in earlier years. It is enlightened in the arie that, for the RNA commands, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the hydroxyl 5'-euthymine group. Unless otherwise indicated, the antisense molecules of the individual chain structure are chimeric open oligonucleotides with 2'-moe in nucleosides 1-5 and 16-20 and 2'-deoxynucleosides in positions 6-15, with dorsal spines of phosphorothioate (P = S) and 5-meylycytosines in each idenity of the C. aniseisenid chain is demonstrated.

Table 8 Activity of elF4E siRNA constructs in mouse MH-S cells "% inhib" indicates% is from the reduction of eIF4E RNA in the irradicated cells with the duplex of the siRNA (or other compound as shown) compared to the unireaíed cells of the conírol. If "% inhib" is negative, RNA from the target increases. The quantification of the RNA is by RT-PCR. "Objective site" indicates the position of the 5'-nucleotide mole of the objelivo siíío respecío to Genbank accession No..

M15353.1 to which the compound is specifically hybridizable. The "species" indicates whether the anisense sequence is perfectly complementary to the human (h), the rat (h), the root (m) and / or the elF4E of the rabbit (rab).

Example 28: IC50 experiment of the reaction at a certain dose of elF4E siRNA constructs in HeLa cells. A dose-response experiment was carried out on heLa cells using methods of irradiation and RNA concentration of 0, 1 nM, 1.0 nM, 10 nM and 100 nM, and an IC50 (concentration of the compound resulting in the 50% inhibition of elF4E compared to the uniped compound) was calculated for sure of the anion compounds. The results are shown in figure 9. The identity of the chain structure of Anisentido is demonstrated. The symbolic chain structure, the objective plane, the species, the chemistry and the sequence are as in earlier years.

Table 9 IC50s of siRNA compounds in HeLa cells One of the ana- lyzed constructs of the siRNA was chosen for the additional evaluation and analysis of the SAR (structure-activity relationship). These father's constructs for analysis of the SAR of the siRNA are as shown here. It is understood in the arie that, for the RNA it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. "338918 consirucción" Seníido: 5'-UAGAGCUAAAGGUGAUAAGA-3'ISIS 338943 (SEQ ID NO: 237) AS: 3'-AUCUCGAUUUCCACUAUUCU-5'ISIS 338918 (SEQ ID NO: 236) "338910 consirucción" Seníido: 5'-AAGGAUCCAGGAAUAUGACA-3'ISIS 338935 (SEQ ID NO: 221) AS: 3'-UUCCUAGGUCCUUAUACUGU-5'ISIS 338910 (SEQ ID NO: 220) "338927 consirucción" Seníido: 5'-AGAAGACACCUUCUGAGUAU-3'ISIS 338952 (SEQ ID NO: 255) AS: 3'-UCUUCUGUGGAAGACUCAUA-5'ISIS 338927 (SEQ ID NO: 254) "338914 consirucción" Seníido: 5'-CAUUGGUGAAGGAUCCAGGA-3'ISIS 338939 (SEQ ID NO: 229) AS: 3'-GUAACCACUUCCUAGGUCCU-5'ISIS 338914 (SEQ ID NO: 228) Example 29: ElF4E siRNA constructs with alternating 2 'modifications The four siRNA constructs chosen in the previous example ("father" constructs) were compared to the siRNA constructs that are modified by the 2'-0-methyl modifications (2'-O-Me or 2'OMe) and 2'-fluoro (2'-F). The duplicated oligomeric RNA (dhRNA) compounds shown in Table 10 below were prepared as described in earlier examples and evaluated in HeLa cells (American VA of Manipotae, Manassas collection of the lupus). The culinary methods used for HeLa cells are available from the ATCC and can be found, for example, at www.aicc.org. For comparison, several chimeric oligonucleotides of individual chain anysinose structure were also tested. The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The wells were washed once with 200 μL Opium-mem-1 reducing medium-serum (Gibco BRL) and then brought with μL 130 of Opi-mem-1 to condense the desired dhRNA at concentrations of 0.2, 2 and 20 nM and 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) by oligomeric compound chain oligonucleotide. The riots were made in duplicate. After 4 or 5 hours of the travail, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown in Table 10. The demonstrated siRNA constructs consist of an antisense strand structure and a straight chain strand. For the 2'-OMe / 2'-F alternating modified compounds, the sense and anisense chain structures were modified, with the 5'-moo nucleoside in the sense chain structure which was a 2'-F and the 5'-moo nucleoside in the anisense chain structure that was a 2'-O-Me, so that the two kinds of modification are out of register in the duplicated molecule. It should be noted that the parent compounds are 20mers and the 2'modified compounds shown are 19mers, lacking the base pair that corresponds to the 5'moo of the sense string structure (ie, duplo as shown ^) than these are shown in Table 10. The 2'-0-methyl nucleosides are shown in bold; 2'-fluoro are underlined. The unmodified ribose is shown in smooth outer case. It is enlightened in the arie that, for RNA sequences, U (uracil) generally subsides T (imine) that is normally found in DNA or DNA-like sequences.

Table 10 elF4E siRNA constructs with alternating 2 '-O-Me and 2'-F modifications "% is of inhib" indicates% is of the reduction of elF4E RNA in the cells brought with the double of the siRNA (or the other compound as demonstrated) compared to the untreated cells of the conírol. NORMAL UPPERCASE of UYPE = unmodified RNA with the skeleton of the phosphate. The 2'-0-methyl nucleosides are shown in bold; 2'-fluoro are underlined. For several of the constructions, the construction that was aliquoted 2'-0-methyl / 2'-fluoro (2'-OMe / 2'F) was demonstrated to be comparable or better than to the father's construction (unmodified RNA) in the efficiency of the reduction of the messenger RNA of elF4E. In addition, the stability of the tested modified construction was more than eight times that of the unmodified compound (refer to them in the following example).

Example 30: Stability of alternating 2'-O-methyl / 2'-fluoro siRNA constructs in mouse plasma. The in-vacuo duplex RNA was analyzed by diluted mouse-plasma using an electrophoresis method of extraction and capillary tube similar to those previously described (Leeds et al., Anal. Biochemistry, 1996, -235, 36-43; Geary e, al., anal, Biochemistry, 1999, 274, 241-248). The plasma of the root irradiated with Heparin, from the female of 3-6 months, the Balb / c roots (laboratories of the Charles River) were thawed from -80 ° C and diluted to 25% ( v / v) with the saline progeny phosphate (140 milliliters of NaCl, 3 milliliters of kCl, 2 milliliters of potassium phosphate, 10 millimeters of sodium phosphate). The nmol approximately 10 of the pre-annealed siRNA, at a concentration of μM 100, was added to the 25% plasma and incubated at 37 ° C for 0, 15, 30, 45, 60, 120, 180, 240, 360, and 420 minutums. The aliquots were removed at the indicated time, brought with EDTA to a final concentration of 2 millimeters, and placed on ice at 0 ° C until analyzed by capillary electrophoresis of the gel (Beckman P / ACE Mdq-mdq-uv with the eCap DNA capillary tube). The peak area of the duplex of the siRNA was measured and used to calculate the percentage of siRNAs iniacio resíaníes. The glyphosate of adenosine (ATP) was added at a concentration of 2.5 millimeters at each injection as the standard calibration standard. A puncture of zero time was taken up by siRNA that diluted in phosphorous saline followed by capillary elecrophoresis. The inaccurate siRNA of the percent was plotted against time, allowing the calculation of a first-order pseudo period. The results are shown in table 11.

Table 11 Stability of alternating 2'-O-methyl / 2'-fluoro siRNA constructs in mouse plasma The construction (unmodified) of the father is approximately 50% degraded after 30 minutes and almost after 4 hours (gone in 6 hours). In contrast, the 2'-O-methyl / 2'-fluoro alternating construction remains relatively unchanged and 75% remains even after 6 hours.

Example 31: Additional modifications of siRNA Additional siRNA assemblies with various modifications were prepared and tested as described in earlier examples. The duplicated oligomeric RNA (dhRNA) compounds shown in Table 12 below were prepared as described in previous examples and evaluated in heLa cells (American Type Culture Collection, Manassas VA). Culinary methods used for heLa cells are available from the ATCC and can be found, for example, at www.aicc.org. The cells were placed in 96-well plates at a density of 5000 cells / wells and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The wells were washed once with 200 μL Opium-mem-1 medium reduced serum (Gibco BRL) and then brought with μL 130 of Opium-mem-1 containing the desired dhRNA in a range of concentrations of 2.5 μl / ml LIPOFECTIN (Gibco BRL) by chain structure of the oligomeric compound. The treatments were done in duplicate. After 4 or 5 hours of the travail, the medium was replaced by fresh medium. Cells were harvested 16 or 18 hours after tracing dhRNA, in which case RNA was isolated and target reduction was measured by RT-PCR as described in earlier examples. For the stability analysis, the siRNA duplexes were incubated in heparinized mouse plasma at 25% at 37 ° C and analyzed by capillary electrophoresis of the gel with an internal standard of reference. The results are shown in Table 12. The constructs of the siRNAs shown are consisted of an aniseisenid chain expression and a senid chain strand. Unless otherwise indicated, all double-stranded stream constructions are the unmodified RNA, that is, ribose sugars with the phosphate backbones (P = O) and the 5'-terminal hydroxyl group. Unless indicated singly, antisense molecules of individual chain structure are chimeric open oligonucleotides with 2'-MOE at nucleotides 1-5 and 16-20 and 2'-deoxynucleotides at positions 6-15, with spines of the phosphorus dioxide (P = S) and 5-meylycycinosines in each C. It is understood in the art that, for RNA sequences, U (uracil) generally substitutes T (thymine) which is normally found in DNA or DNA-like sequences . The 2'-0-methyl nucleosides are shown in bold; 2'-fluoro are underlined, the 4'-thio nucleosides are shown in lowercase and the unmodified ribose is shown in plain Tidal CAPSULE. Compound 338918_338943 is (ribose, skeleton of P = O) unmodified construction of the parent. 349892_338943 has 2'F in positions 1-5.8.9, 12-17 and 2'Ome in position 6.7, 10, 11, 18-20 of the antisense chain structure; the chain structure of the sense is unmodified (ribose, skeleton of P = 0). 345847_345849 is a 19mer with the ribose and 2'OMe (outside the register) nucleosides that are aliquoted in both chain elucidations. The 5 'most nucleoside of the sense chain is ribose and the 5' most nucleoside of the anlisenide chain structure is 2'OMe. 351831_351832 is a 19mer with aligning the 2'-F and 2'OMe nucleosides (outside the record) in both chain structure. The 5 'most of the nucleoside of the chain structure of the sense is 2'-F and the 5' most of the nucleoside of the antisense chain expression is 2'OMe. 352824_342764 is a 19mer with 4'-ion nucleosides in each case of the aniseisenid chain (the chain expression of the signal is unmodified). 352827_342764 is a 19mer with 4'-ion nucleosides in the 5'-terminal emines of the antisense strand structure and 2'-OMe nucleosides in the 3'-emines of the antisense strand structure (the sense strand structure is unmodified ). 349890_338935 is a 20mer with the 2'-F / 2'-OMe mixed modifications of the anysinose chain structure (the character string is unmodified). The antisense chain structure has 2'-F at positions 1-5, 8, 9, and 12-17 and 2'-OMe at positions 6.7, 10, 11, 18-20 (beginning at the end of the 5). 349891 338939 is a 20mer with the 2'-F / 2'-OMe mixed modifications of the anysinose chain structure (the chain name is unmodified). The aniseisenidic chain expression has 2'-F at positions 1-5, 8, 9, and 12-17 and 2'-OMe at positions 6.7, 10, 11, 18-20 (beginning at the end of the 5). 351097_338952 is a 20mer with 2'-F / 2'-OMe mixed modifications of the antisense chain statement (the string structure of the string is unmodified). The antisense chain structure has 2'-F at positions 1-5, 8, 9, and 12-17 and 2'-OMe at positions 6.7, 10, 11, 18-20 (beginning at the end of the 5). "It should be noted that the compues of the parent are 20mers and some of the 2'modified demosides are 19mers, lacking the low par that corresponds to the 5'th pair of the string string (ie, duplo as demonstrated) ) that these are shown in labia 12. The 2'-0-methyl nucleosides are shown in bold, 2'-fluoro is underlined, the 4'-thio nucleosides are shown in lowercase and the unmodified ribose is shown in text CAPITAL SHIFT.

Table 12 Additional modifications of elF4E siRNA and Activity - summary NORMAL TYPE CAPSULE = unmodified RNA with phosphate skeletons Bold = 2'-0-methyl RNA with phosphate skeleton; Surayado = 2'-fluoro RNA with phosphate skeleton Tiny = 4'-thio RNA with phosphorylated skeleton "% inhibited" indicates% reduction of elF4E RNA in cells treated with the double siRNA (or the other compound as demonstrated) compared to non-trailed cells of conírol. The 2'-0-meityl nucleosides are shown in bold; 2'-fluoro are underlined The mixed construction 2'-0-methyl / 2'-fluoro (block) (2'-OMe / 2'F) - 349892_338943 was shown to be comparable or better than the father's construct (RNA unmodified) in the efficiency of the messenger RNA reduction of elF4E. Construct 2'-0 ~ methyl / unmodified alternate 345847_345849 was tested twice and also shown to be comparable or better than to father construction (unmodified RNA) in the efficiency of elF4E messenger RNA reduction, with enhanced stability. Modified consíuction 4'-thio block 352824_342764 was less active than the father but at the same time esiable. The 4'-thio / 2'-0-meityl construction 352827_342764 was comparable to the parent in efficacy. The damage of the still unknown problem has not been met.

Example 32: The open modified siRNA constructs activity in HeLa cells. Additional constructs of the siRNA were tested in HeLa cells. The duplicated oligomeric RNA (dhRNA) compounds shown in Table 13 below were prepared as described in earlier examples and evaluated in HeLa cells (American VA, Manassas collection of the lice culicura). The culinary methods used for HeLa cells are available from the ATCC and can be found, for example, at www.atcc.org. The cells were placed in 96-well plates at a density of 5000 cells / wells and grown in DMEM with high glucose, 10% FBS, 1% penicillin / strepomycin. The cavities were washed once with 200 μL Opium-mem-1 reduced serum medium (Gibco BRL) and then brought with μL 130 of Opium-mem-1 to condense the desired dhRNA at the concentrations of 0.1, 1, 10 and 100 nM and 2.5 μl / ml LIPOFECTIN (Gibco BRL) for the oligomeric compound. The days were made in duplicate. After 4 or 5 hours of irradiation, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. For stability analysis, siRNA duplexes were incubated in 25% heparinized mouse plasma in 37C and analyzed by capillary gel electrophoresis with an internal reference standard. The results are shown in Table 13. The constructs of the siRNA demonstrated consist of an anysinose chain expression and a straight chain sequence. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the phosphor dorsal spines (P = 0) and the 5'-ferminal hydroxyl group. Unless otherwise indicated, the individual chain oligonucleotide molecules are chimeric open oligonucleotides with 2'-MOE at nucleoides 1-5 and 16-20 and 2'-deoxynucleotides at positions 6-15, with spines phosphorolioaio (P = S) and 5-methylcytosines in each C. It is enlistened in the arie that, for RNA sequences, U (uracil) generally subsitutes T (imine) that is normally found in DNA or DNA-like sequences. Compound 338918_338943 is (ribose, skeletal of P = O) unmodified construction of the parent. 349892_338943 has 2'F in positions 1-5.8.9, 12-17 and 2'Ome in positions 6.7, 10, 11, 18-20 of the aniseisenidic chain structure; the chain statement of the symbol is unmodified (ribose, skeleton of P = O). 349896_338943 has 2'F in positions 1-5, ribose in positions 6-15, and 2'Ome in positions 16-20 of the anysinose chain structure, counting the 5 'end of the AS chain structure; the seníido chain expression is unmodified (ribose, skeleton of P = O). 349894_338935 has 2'F at positions 1-5, ribose at positions 6-15, and 2'Ome at positions 16-20 of the anisense-chain expression, counting from the 5'-end of the AS-chain sequence; the chain statement of the symbol is unmodified (ribose, skeleton of P = O). 349895_338939 has 2'F in positions 1-5, ribose in positions 6-15, and 2'Ome in positions 16-20 of the anysinose chain sequence, ending with the 5 'end of the chain AS; the chain statement of the symbol is unmodified (ribose, skeleton of P = 0). 349897_338952 has 2'F at positions 1-5, ribose at positions 6-15, and 2'Ome at positions 16-20 of the antisense strand, counting from the 5 'end of the AS chain structure; the chain structure of the symbol is unmodified (ribose, skeleton of P = 0). These are shown in table 13. The nucleosides 2'-0-mei'l are shown in bold; 2'-fluoro is underlined, the 4'-io-nucleosides are shown in lowercase and the unmodified ribose is shown in plain text. It is eniended in the arie that, for RNA, it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences.

Table 13 Activity of Gapped Modified elF4E siRNA NORMAL TYPE CAPITALS = unmodified RNA with phosphory skeleton Negrillas ~ = 2'-0-methyl RNA with the skeleton of the phosphate; Underlined = 2'-fluoro RNA with RNA with phosphory skeleton Lower case = 4'-ioI RNA with the phosphorylate skeleton "% inhibited" indicates% of the reduction of elF4E RNA in the irradiated cells with the duplex of the siRNA (or the compound oxide as demonstrated) compared to the non-irritated cells of the control. The 2'-0-methyl nucleosides are shown in bold; 2'-fluoro are underlined.

Example 33: The activity of alternating 2"-Ome modified the 19mer blind siRNA in the final heLa-microwalk cells (no release projection) around the F4E_1 (341887) The duplicate oligomeric RNA (dhRNA) compounds shown in Figure 14 below they were prepared as described in previous examples and evaluated in heLa cells (American VA from the collection of Manassas of the chypous culmura) .The cells were placed in 96-well plates at a density of 5000 cells / well and floods. in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin The cavities were washed once with 200 μL of reduced serum media Opi-mem-1 (Gibco BRL) and then irradiated with 130 μL of Opium. mem-1 containing the desired dhRNA in a concentration of 0.2, 2 and 20 nM plus 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per oligomeric chain structure were prepared in duplicate. or 5 ho After the treatment, the medium was replaced by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples.

The results are shown in Table 14. The constructs of the demonstrated siRNA consist of an anysinose chain expression and a straight chain sequence. The anisic acid (AS) chain structure is shown first in table 14 below, followed by the letter chain statement (S) in the row below. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. It is eniended in the arie that, for RNA, it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. 338932 is an unchanged 20mer ribose with phosphate skeleton phosphate (P = O) and 5 ', directed to the site of elF4E_1 (341887) 19mer. 338957 is an unchanged 20mer ribose with phosphate skeletal fissure (P = O) and 5 '. 346658 is an unmodified 19mer ribose with the phosphate skeleton (P = O) and the 5 'phosphate directed to the F4E_1 (at 341887) (no release). 346660 is an unmodified 19mer ribose with phosphated phosphorylated skeleton (P = O) and 5 '. 346J561 is a ribose and 2'-OMe that are aligned with the skeleton of phosphate and phosphate terminal 5S 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the exíremo 5 '. 346-659 is a ribose and 2'-OMe that alternate 19mer with the phosphate skeleton and the 5'eminimal phosphate. 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the 5 'eximere. 346662 is an unmodified 19mer ribose with phosphate phosphate skeleton (P = O) and 5 '. 346664 is an unmodified 19mer ribose with phosphate skeletal phosphate (P = 0) and 5S 346665 is a ribose and 2'-OMe that alternate 19mer with the phosphate backbone and the 5'erminal phosphate. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the 5 'end. 346663 is a ribose and 2'-OMe that alternate 19mer with the skeleton of the phosphory and the phosphory of the 5'-terminal. 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the 5 'eximere. 346666 is an unmodified 19mer ribose with phosphated phosphorylated skeleton (P = O) and 5S 346668 is an unmodified 19mer ribose with phosphated phosphorylated skeleton (P = O) and 5S 346669 is a ribose and 2'-OMe that are aliquoted 19mer with the phosphate and phosphate skeleton of the 5S 2'OMe terminal in the nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the 5 'end. 346667 is a ribose and 2'-OMe that alternate 19mer with the skeleton of the phosphoresis and the phosphory of the 5S 2'OMe iodine in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 beginning with the exíremo 5 '. Table 14 Alternating 2'-O-Me / blind end ribose 19mers microwaik near elF4E_1 (341887) Example 34: The activity of alternating the modified blunt-ended 2'-Omex RNA in HeLa-microcamino 21mer cells around the F4E_1 (341887) The duplicate oligomeric RNA (dhRNA) compounds shown in table 15 below were prepared as described in FIG. previous examples and evaluated in the heLa cells (American VA of the collection, of Manassas of the culíura del íipo). The culinary methods used for HeLa cells are available from the ATCC and can be found, for example, at www.aicc.org. The cells were placed in the 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / strepomycin. The wells were washed once with 200 μL of reduced serum medium Opti-mem-1 (Gibco BRL) and then treated with μL 130 of Opti-mem-1 with the desired dhRNA at a concentration of 0.2, 2 and 20. nM plus 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per oligomeric compound chain strand. The treatments were done in duplicate. After 4 or 5 hours of treatment, the medium was replaced with fresh medium. The cells were harvested 16 or 18 hours after the treatment of the dhRNA, in which case the RNA was isolated and reduction of the objective measured by RT-PCR as described in previous examples. The results are shown in Table 15. The constructs of the demonstrated siRNA consist of an anisentic chain structure and a sense strand structure. The antisense chain (AS) structure is first shown in Table 15 below, followed by the string structure (S) in the following row. Unless otherwise indicated, all constructions of double-stranded structure are the unmodified RNA, ie, ribose sugars with the phosphate backbones (P = 0) and the 5'-érminal hydroxyl group. It is eniended in the arie, which, for the ordering of RNA, U (uracil) subsides generally T (thymine), which is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. 338932 is an unmodified 20mer ribose with phosphorylated phosphorylated phosphide (P = 0) and 5 directed to the elF4E_1 site. 338957 is an unchanged 20mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5erminal. 346674 is an unmodified 21mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5'-terminal. 346676 is an unmodified 21mer ribose with the skeleton of the phosphate (P = 0) and the phosphate of the 5S 346675 iodine is a ribose and 2'-OMe that are aligned with the skeleton of the phosphate and the phosphorus of the 5S 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 starting with the 5 'eximer. 346677 is a ribose and 2'-OMe that are aligned with the skeleton of the phosphory and the phosphory of the 5'-terminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 starting with the eximeum 5S 346678 is an unmodified 21mer ribose with phosphate skeleton (P = 0) and phosphate of the 5 'terminal. 346680 is an unmodified 21mer ribose with the phosphate backbone (P = O) and the 5 'terminal phosphate. 346679 is a ribose and 2'-OMe that alternate 21mer with the phosphate backbone and phosphate of the 5 'end. 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 starting with the 5 'eximere. 346681 is a ribose and 2'-OMe that are aligned with the skeleton of the phosphate and phosphate of the 5 'terminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 starting with the 5 'end.

Table 15 Alternating 21mer modified rome2'-Omex siRNA in HeLa -microcamino cells near elF4E_1 (341887) Example 35: The activity of 4'-thioribose modified the 19mer siRNA in HeLa cells. The duplicated oligomeric RNA (dhRNA) compounds shown in Table 16 below were prepared as described in previous Examples and evaluated in heLa cells (American VA of the Manassas collection of culture type). The culture methods used for HeLa cells are available from the ATCC and can be found, for example, at www.aicc.org. The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The wells were washed once with 200 μL of the reduced serum medium Opi-mem-1 (Gibco BRL) and then brought with 130 μL of Opium-mem-1 containing the desired dhRNA at a concentration of 0.02, 0.2 , 2 and 20 nM with 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) by oligomeric compound chain oligonucleotide. The riots were made in duplicate. After 4 or 5 hours of the travail, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown on page 16. The constructs of the siRNAs shown consist of an anisentic chain expression and a chain structure. The aniseisenidic chain (AS) is first shown in table 16 below, followed by the sense chain (S) in the next row. Unless otherwise indicated, all constructions of double-stranded DNA are unmodified RNA, ie, ribose sugars with the phosphate backbones (P = 0) and the 5'-terminal hydroxyl group. It is understood in the art that, for RNA orders, U (uracil) generally substitutes T (thymine) which is normally found in DNA or DNA-like sequences. The 2'-0-methyl nucleosides are shown in bold, the unmodified ribose nucleosides are in PLAIN SHIFT and the 4 'is in lowercase. All the sequences in Table 16 are 19mers of SEQ ID NO: 301 (antisense strand structure) / SEQID NO: 302 (sense strand structure). 342744 is an unmodified 19mer ribose with the phosphate backbone (P = 0) and the 5 'terminal phosphate. 342764 is an unmodified 19mer ribose with the phosphate backbone (P = 0) and the 5 'terminal phosphate. 352824 has 4'-thio at positions 1, 2, 3, 17, 18 and 19 of the nucleosides (ie, three at each terminal) with the ribose at positions 4-16. The skeleton is P = 0, phosphate terminal 5S 352819 has nucleoside 4'-thio at positions 1, 2, 3, 4, 16, 17, 18 and 19 (that is, four in each terminal) with the ribose in positions 5-14. The skeleton is P = 0, phosphate of the 5 'terminal. 352827 has 4'-thio nucleosides at positions 1, 2, 3, and 2'-OMe at positions 17, 18 and 19 with ribose at positions 4-16. The skeleton is P = 0, phosphate from the 5S terminal 352826 has 4'-thio nucleosides at positions 1, 2, 3, 10, 13 and 17-19 with ribose at positions 4-9, 11, 12 and 14-16. The skeleton is P = 0, phosphate of the 5 'terminal. 352825 nucleoside 4'-thio at positions 1, 2, 3, 7, 10, 13 and 17-19 with ribose at positions 4, 5, 6, 8, 9, 11, 12 and 14-16. The skeleton is P = 0, phosphate terminal 5S Table 16 Activity of modified 4'-thioribose 19mer siRNA Several of the 4'-thio constructions were demonstrated to be IC50s in the picomolar range.

Example 36: Activity of additional elF4E siRNAs with 2'-O-methyl modifications based on construction 338914.

The duplicate oligomeric RNA (dhRNA) compounds shown in Table 17 below were prepared as described in previous Examples and evaluated in HeLa cells (American VA from the Manassas collection of the lice culia). The culture methods used for HeLa cells are available from the ATCC and can be found, for example, at www.aicc.org. The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The cavities were washed once with 200 μL of the reduced serum medium Opti-mem-1 (Gibco BRL) and then irradiated with μL 130 of Opium-mem-1 containing the desired dhRNA at a concentration of 0.5, 5 and 50 nM with 2.5 μl / ml LIPOFECTIN (Gibco BRL) per chain structure of the oligomeric compound. The drawings were made in duplicate. After 4 or 5 hours of treatment, the medium was replaced by fresh medium. The cells were harvested 16 or 18 hours after the dhARN procedure, in which case the RNA was isolated and the target reduction was measured by RT-PCR as described in previous examples. The results are shown on page 17. The constructs of the siRNAs shown are consisted of an anysinose chain expression and a straight chain expression. The antisense strand (AS) is first shown in Table 17 below, followed by the string structure (S) in the next row. Unless otherwise indicated, all double-stranded constructions are the unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. It is understood in the art that, for RNA, it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. The 2'-0-mefyl nucleosides are demonstrated in bold, unmodified nucleosides of ribose in the PLAIN CAPITAL. 338914 is with a ribose without modifying the skeleton, phosphoresis (P = 0) and phosphorylation of the 5 'terminal. 338939 is with a ribose without modifying the skeleton, the phosphate (P = O) and phosphate of the 5 'terminal. 345840 is with 19mer alternating ribose and 2'-OMe skeleton phosphate and phosphate terminal 5S 2'OMe at nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the 5 'end. 345842 is 19mer with the ribose that is alíerna and 2'-OMe with the skeleton of the phosphate and phosphate of the 5 'terminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the 5 'eximere. 345735 is 20mer with the ribose the phosphory skeleton (P = 0) and the 5 'terminal phosphate, with the 2'O-Me nucleosides at positions 16-20 and at positions 1-15 beginning with the 5'-eximer. . 345843 is 20mer with the ribose the phosphory skeleton (P = 0) and the 5 'terminal phosphate, with the 2'O-Me nucleosides at positions 2-19 and at positions 1 and 20 beginning with the 5' end . 345838 is 20mer with ribose the phosphory skeleton (P = 0) and the 5'final phosphory, with the 2'O-Me nucleosides in positions 6, 12, 15 and 18-20 and in positions 1-5, 7 -11, 13, 14, 16, 17 and 20 starting with the 5 'eximere. 345839 is 20mer with ribaosa the phosphory skeleton (P = O) and the 5'erminal phosphory, with the 2'O-Me nucleosides at positions 6, 7, 10, 11, 18-20 and at positions 1-5 , 8, 9, and 12-17 that starts with the 5 'eximere.

Table 17 Activity of additional elF4E RNAips with modifications 2'- O-methyl based on a construction 338914 Example 37: Additional elf4E siRNAs with the 2"-O-methyl modifications based on the 338910 construct. The duplicated oligomeric RNA (dhRNA) compounds shown in figure 18 below were prepared as described in earlier examples and evaluated in the cells. HeLa (American Type of Culture, Manassas Collection of the Type) Culture methods used for HeLa cells are available from the ATCC and can be found, for example, at www.atcc.org. in plates of 96 cavities in a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / srepicomycin Cavities were washed once with 200 μL of reduced serum medium Opi-mem -1 (Gibco BRL) and then irradiated with 130 μL of Opi-mem-1 containing the desired dhRNA in a 0.5, 5 and 50 nM concentration with 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per chain ester. of the oligomer icos The íraíamieníos were done in duplicate. After 4 or 5 hours of irradiation, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and the target was measured by RT-PCR as described in previous Examples. The results are shown on page 18. The constructs of the siRNAs shown consist of an anysinose-chain expression and a senin-chain expression. The anysinose chain (AS) sequence is first shown in Table 18 below, followed by the string structure of the string (S) in the next row. Unless otherwise indicated, all double-stranded structure constructs are unmodified RNA, ie, ribose with phosphate backbone sugars (P = 0) and 5'-iodine hydroxyl group. It is understood in the art that, for RNA, it orders, U (uracil) substiíuye generally T (íimina) that is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. 338910 is an unchanged 20mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5'-terminal. 338935 is an unchanged 20mer ribose with phosphous skeleton (P = 0) and phosphorylation of the 5 'terminal. 345731 is 19mer with ribose and 2'-0Me with the skeleton of the phosphorus and the phosphorus of the iodine that are aliquoted to 5S 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the exíremo 5 '. 345733 is 19mer with the ribose that is alíerna and 2'-OMe with the skeleton of the phosphates and phosphates of the 5erminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the eximer 5S 345713 is 20mer with the skeleton of the phosphate and phosphate of the 5'erminal. Ribose in nucleosides 1-15 and nucleosides 2'OMe in positions 16-20 starting with the 5'-eximer. 345734 is 20mer with the skeleton of the phosphate and the phosphory of the 5 'terminal. Ribose in nucleosides 1 and 20 and nucleosides 2'OMe in positions 2-19 starting with the 5'-eximer. 345729 is 20mer with and the skeleton of the phosphorescent phosphate of the 5 'terminal. Ribose in nucleosides 1-5, 7, 8, 10, 11, 13, 14, 16 and 17 and nucleosides 2'OMe in positions 6, 9, 12, 15 and 18-20 starting with the 5'-eximer. 345730 is 20mer with the skeleton of the phosphate and the phosphory of the 5 'terminal. Ribose in nucleosides 1-5, 8, 9, 12, 13, 14, 15, 16 and 17 and nucleosides 2'OMe in positions 6, 7, 10, 11 and 18-20 starting with the 5 'end.

Table 18 Additional elF4E siRNAs with 2'-O-methyl modifications- based on 338910 construct Example 38: Additional siRNAs of elF4E with 2'-O-methyl modifications based on construction 338927 The duplicate oligomeric compounds of RNA (dhRNA) shown in Table 19 below were prepared as described in previous Examples and evaluated in HeLa cells (American VA of the collection, of Manassas of the Iipo culture). The culinary methods used for HeLa cells are available from the ATCC and can be found, for example, at www.atcc.org. The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The wells were washed once with 200 μL of the Opi-mem-1 reduced serum medium (Gibco BRL) and then brought with 130 μL of Opium-mem-1 containing the desired dhRNA at a concentration of 0.5, 5 and 50 nM. with 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per oligomeric compound chain strand. The reports were made in duplicate. After 4 or 5 hours of irradiation, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown in Table 19. The constructs of the demonstrated siRNA consist of an anysinose chain expression and a straight chain sequence. The anysinose chain (AS) sequence is first shown in table 19 below, followed by the sense chain (S) in the next row. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the phosphor dorsal spines (P = 0) and the 5'-érminal hydroxyl group that is enyiende in the arie, which, for the ordering of RNA, U (uracil) generally subsides T (imine) which is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. 338927 is a 20mer unmodified ribose with the phosphate backbone (P = 0) and the 5 'terminal phosphate. 338952 is a 20mer unmodified ribose with the phosphate backbone (P = 0) and the 5 'terminal phosphate. 345854 is 19mer with ribose and 2'-OMe with the phosphate skeleton and the iodine phosphate that are altered 5 '. 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the 5S end 345856 is 19mer with the alternating ribose and 2'-OMe with the skeleton of the phosphate and phosphory of the 5 'terminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with the 5 'eximere. 345851 is 20mer with the skeleton of the phosphate and phosphate of the 5S Ribose lerminal in nucleosides 1-15 and 2'OMe nucleosides in positions 16-20 beginning with the 5 'eximere. 345857 is 20mer with the phosphate backbone and the 5'erminal phosphate. Ribose in nucleosides 1 and 20 and nucleosides 2'OMe in positions 2-19 starting with the 5'-eximer. 345852 is 20mer with and the skeleton of the phosphate phosphates of the 5 'terminal. Ribose in nucleosides 1-5, 7, 8, 10, 11, 13, 14, 16 and 17 and nucleosides 2'OMe in positions 6, 9, 12, 15 and 18-20 starting with the 5'-eximer. 345853 is 20mer with the skeleton of the phosphate and the phosphory of the 5 'terminal. Ribose in nucleosides 1-5, 8, 9, 12, 13, 14, 15, 16 and 17 and nucleosides 2'OMe in positions 6, 7, 10, 11 and 18-20 starting with the 5 'end.

Table 19 Additional elF4E RNAse with 2'-O-methyl modifications- based on 338927 construct Example 39: Additional siRNAs of elF4E with 2'-O-methyl modifications based on construction 338918 The duplicated oligomeric RNA (dhRNA) compounds shown in table 20 below were prepared as described in previous Examples and evaluated in HeLa cells (American VA of the collection, Manassas of the Iguish Culíura). The culinary methods used for HeLa cells are available from the ATCC and can be found, for example, at www.aicc.org. Cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / strepomycin. The wells were washed once with 200 μL of the reduced serum medium Opti-mem-1 (Gibco BRL) and then treated with 130 μL of Opti-mem-1 containing the desired dhRNA at a concentration of 0.5, 5 and 50 nM. with 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per chain structure of the oligomeric compound. The treatments were done in duplicate. After 4 or 5 hours of the travail, the medium was replaced by fresh medium. Cells were harvested 16 or 18 hours after the dhRNA was harvested, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous Examples. The results are shown on page 20. The constructs of the siRNA shown consist of an anysinose chain expression and a straight chain sequence. The aniseisenid chain (AS) sequence is first shown in Table 20 below, followed by the chain structure of the line (S) in the next row. Unless otherwise indicated, all dual-chain constructions are unmodified RNA, ie, ribose with sugars from the dorsal spines of the phosphate (P = 0) and hydroxyl group 5'-érminal. It is eniended in the arie that, for the RNA it orders, U (uracil) subsitutes generally T (thymine), which is normally found in DNA or DNA-like sequences. The 2'-0-methyl nucleosides are shown in bold. 338918 is an unchanged 20mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5'-terminal. 338943 is an unchanged 20mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5'-terminal. 345847 is 19mer with ribose and 2'-OMe with the skeleton of the phosphate and the phosphorus of the iodine that are aliquoted 5 '. 2'OMe in nucleosides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19 starting with the 5 'eximere. 345849 is 19mer with ribose that is alíerna and 2'-OMe with the skeleton of the phosphate and phosphates of the 5 'terminal. 2'OMe in nucleosides 2, 4, 6, 8, 10, 12, 14, 16 and 18 starting with eximere 5. "345844 is 20mer with the phosphate and phosphate backbone of the 5S Ribose terminal in nucleosides 1-15 and nucleosides 2'OMe at positions 16-20 beginning with the 5 'end 345850 is 20mer with the phosphate backbone and the phosphory of the 5'erminal.Rose in nucleosides 1 and 20 and nucleosides 2'OMe in the positions 2-19 which begins with the eximere 5 ', 345845 is 20mer with and the skeleton of the phosphate phosphate of the 5' terminal, Ribose in the nucleosides 1-5, 7, 8, 10, 11, 13, 14, 16 and 17 and 2'OMe nucleosides at positions 6, 9, 12, 15 and 18-20 starting with the 5S end 345846 is 20mer with the phosphate backbone and the 5S Ribose phosphate backbone at nucleosides 1-5, 8, 9, 12 , 13, 14, 15, 16 and 17 and 2'OMe nucleosides at positions 6, 7, 10, 11 and 18-20 starting at the 5 'end.

Table 20 Additional elF4E RNAips with 2'-O-methyl modifications based on the construction 338918 Example 40: The activity of 4"-tioribose modified and mixed the 19mer siRNA in heLa cells.The duplicated oligomeric RNA (dhRNA) compounds shown in Table 21 below were prepared as described in previous Examples and evaluated in heLa cells ( American VA collection, from Manassas of the type culture). The culture methods used for heLa cells are available from the ATCC and can be found, for example, at www.aicc.org. The cells were placed in 96-well plates at a density of 5000 cells / well and grown in DMEM with alia glucose, 10% FBS, 1% penicillin / sreptomycin. The cavities were washed once with 200 μL of reduced serum medium Opti-mem-1 (Gibco BRL) and then treated with 130 μL of Opti-mem-1 containing the desired dhRNA at a concentration of 0.02, 0.2 , 2 and 20 nM with 2.5 μl / ml LIPOFECTIN ™ (Gibco BRL) per chain structure of the oligomeric compound. The trainings were made in duplicate. After 4 or 5 hours of irradiation, the medium was subsumed by fresh medium. The cells were harvested 16 or 18 hours after the irradiation of the dhRNA, in which case the RNA was isolated and reduced by the objective measured by RT-PCR as described in previous examples. The results are shown in Table 21. The constructs of the siRNAs shown consist of a chain reaction and an anysinose and chain sequence. The aniseisenidic chain (AS) sequence is first demonstrated in table 21 below, followed by the senile chain structure (S) in the next row. Unless indicated conirably, all constructions of double-stranded structure are the unmodified RNA, that is, with ribose sugars, the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. It is understood in the arie that, for the RNA it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. They are all 19mers of NO. SEQ of the idenification: 301 (NO of the ideníificación esírucura of chain aníiseníido) / SEQ: 302 (esírucura of chain seníido). 342744 is an unmodified ribose 19mer with the skeleton of the phosphate (P = 0 and phosphate of the 5S 342764 iodine is an unmodified ribose 19mer with the skeleton) of the phosphate (P = O and phosphate of the 5'erminal. -iio in positions 1, 2, 3, 17, 18 and 19 of the nucleosides (ie, ire in each case) with the ribose in positions 4-16.The skeleton is P = O, phosphate terminal 5 ' 52819 has 4'-thio nucleosides at positions 1, 2, 3, 4, 16, 17, 18, and 19 (ie, four at each terminus) with ribose at positions 5-14 The skeleton is P = Or, phosphate from the 5'-terminal 352627 has 4'-thio nucleosides at positions 1, 2, 3, and 2'-OMe at positions 17, 18 and 19 with ribose at positions 4-16. The skeleton is P = 0, 5'-terminal phosphate 352826 has 4'-thio nucleosides at positions 1, 2, 3, 10, 13 and 17-19 with ribose at positions 4-9, 11, 12 and 14-16. The skeleton is P = O, phosphate terminal 5S 352825 t It has 4'-thio nucleosides at positions 1, 2, 3, 7, 10, 13 and 17-19 with ribose at positions 4, 5, 6, 8, 9, 11, 12 and 14-16. The skeleton is P = O, phosphory of the 5 'terminal. 354604 has 4'-thio nucleosides at positions 1, 2, 3, and 2'-OMe at positions 17, 18 and 19 with ribose at positions 4-16. The skeleton is P = 0, phosphorus of the 5 'terminal.

Table 21 Activity of modified 4'-thioribose and mixed 19mer siRNA in HeLa cells Several of the 4'-thio constructions were shown to have IC50s in the picomolar range.

Example 41: The activity of the siRNA constructs pointed to elF4E in glioblastoma cells of magnesium U-87. Modified or unmodified siRNA constructs demonstrated in previous tables are tested for their ability to reduce levels of human elF4E messenger RNA in U-87 magnesium cells using the methods described above. The human glioblastoma cell line U-87 is obtained from the ATCC (Rockville Md.) And maintained in Iscove's DMEM medium supplemented with inactive heat-made fetal calf serum of 10%. Experiments of the reaction to dose engineering are performed as described in previous Examples to obtain IC50 values.

Example 42: Additional siRNAs directed to human elF4E.

Additional RNAips were designed to human messenger RNA from elF4E (GenbankS accession No. M15353.1, ID NO. SEQ: 4) in alternating form 2'-0-methyl / 2'-OH in the structure of antisense chain and 2'-OH / 2'-0-methyl which is afferent in the straight chain. The skeleton is the phosphoresis (P = 0) and the emines 5 'is 5'-OH, although it will be understood that these and you will hear of the siRNA constructs shown here, they can also be synthesized with a 5'-phosphate group. The antisense strand structures are shown in Table 22; chain structures of the chain are complemen- tially complementary and not proven. < The "target site" refers to the 5 'position of the region of the objecivo respecío to the human sequence of the elF4E M15353.1 (NO.SEQ of the ideníificación: 4) to which the oligonucleóíido was apunía.

Table 22 Additional ARNips objectified to human elF4E Example 43: Additional antisense compounds directed to elF4E. A system of oligonucleotides of the phosphorothioate of the uniform 2'-O-meioxy-yl (2'-moe) was syntheiZed, directed to the 5 'closing region of the messenger RNA of elF4E, that is, the 5' end of the adjacent messenger RNA. at the close 5 '. These are shown in Table 23. All cytosines are 5-methylcycinsines. While it does not wish to be limited by theory, 2'-moe oligonucleotides are not completely created to be subtracts to the RNAse H and are not believed to be able to be inferred by the derivation of the process via an occupation-only or a skeletal mechanism rather than via degradation of the messenger RNA target. The "objective of the objective" refers to the position respects the messenger RNA of the elF4E (NO.SEQ of the idenification: 4 or 11 as indicated).

Table 23 2'-O-methoxyethyl antisense oligonucleotides objectified to the 5 'closure region of elF4E messenger RNA 335024 TAGATCGATCTGAT UTR 397 335025 TTAGATCGATCTGA UTR 398 A series of PNA oligomers were also synthesized that point to the same sites as the oligonucleotides in plate 23. These are shown in plate 24. Each has a lysine at the 3 'end of the oligomer. As with the completely modified 2 'MOE compounds, the PNA oligomers are not believed to be substrates for the H-RNAse.

Table 24 PNA antisense oligomers objectified to the 5 'close region of elF4E messenger RNA Example 44: LNA and modified 2'-OMe siRNA. The duplicated oligomeric RNA (dhRNA) compounds shown in Table 14 below were prepared as described in previous Examples and evaluated in HeLa cells (American VA of the Manassas collection of culture type). Cells were plated in 96-well plates at a density of 5000 cells / well and grown in DMEM with high glucose, 10% FBS, 1% penicillin / strepomycin. The cavities were washed once with 200 μL of reduced serum medium Optim-mem-1 (Gibco BRL) and then treated with 130 μL of Opti-mem-1 containing the desired dhRNA at a concentration of 0.2, 2 and 20. nM plus 2.5 μi / ml LIPOFECTIN (GIBCO BRL) by chain oligomeric compound. The days were made in duplicate. After 4 or 5 hours of irradiation, the medium was replaced by fresh medium. The cells were harvested 16 or 18 hours after the dhRNA tranomy, in which case the RNA was isolated and the target was measured by RT-PCR as described in previous Examples. The results are shown in figure 25. The constructs of the siRNAs shown consist of an antisense chain structure and a chain structure. The anisentide chain (AS) expression is shown first in table 25 below, followed by the straight chain statement (S) in the next row. Unless otherwise indicated, all dual-chain constructions are the unmodified RNA, ie, ribose sugars with the dorsal spines of the phosphate (P = 0) and the 5'-iodine hydroxyl group. It is eniended in the arie that, for RNA, it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. The 2'-0-meityl nucleosides are shown in bold. The nucleosides of LNA are in iíálicas. 338910 is an unchanged 20mer ribose with the phospho skeleton (P = 0) and the 5S 338935 ransferase phosphoresis is an unchanged 20mer ribose with phosphate skeleton (P = 0) and phosphorylation of the 5'erminal. 352493 is 20mer with LNA in positions 6, 9, 12, and 15 (ionic), 2'-0-methyl in positions 18-20 (bold), and ribose in the resinate positions. 338914 is an unchanged 20mer ribose with the phosphate skeletal (P = 0) and the 5 'terminal phosphate. 338939 is an unchanged 20mer ribose with the phosphate backbone (P = 0) and the 5S 352494 terminal phosphate is 20mer with LNA in positions 6, 9, 12 and 15 (italic), 2'-0-methyl in the positions 18-20 (in bold) and the ribose in the Residen positions. 338918 is an unchanged 20mer ribose with the phosphate backbone (P = 0) and the 5'-terminal phosphory. 338943 is an unchanged 20mer ribose with the skeleton of the phosphate (P = 0) and the phosphory of the 5'-terminal. 352495 is 20mer with LNA in positions 6, 9, 12 and 15 (italic), 2'-0-metl in positions 18-20 (bold) and ribose in the remaining positions. 338927 is an unchanged 20mer ribose with the phosphate backbone (P = O) and the 5'-terminal phosphate. 338952 is an unchanged 20mer ribose with the skeleton of the phosphate (P = O) and the phosphate of the 5 'terminus. 352496 is 20mer with LNA in positions 6, 9, 12 and 15 (iíálicas), 2'-O-methyl in positions 18-20 (in bold) and ribosa in the positions restaníes.

Table 25 LNA and 2'-OMe modified siRNA Example 45: The activity of additional siRNAs pointed to human elF4E.t The siRNAs of Table 22 were tested for the ability to reduce levels of elF4E RNA in HeLa cells. These compounds were designed to the human messenger RNA of elF4E (Accession No. of Genbank, M15353.1, IDENTIFICATION SEQ N0: 4). Unless observed, the aniseisenid chain expressions are aligning 2'-0-meityl / ribose starting with 2'-0-methyl at position 1 (ie, the positions with odd numbers are 2'-0-methyl and the even positions are ribose) and the chain esírucíuras of seníido esíán alíernando ribosa / 2'-0-meíil beginning with the ríbosa in position 1 (that is to say, the positions with odd numbers are ribosa and the even positions are 2'- 0-meil). The skeleton is the phosphate (P = 0) and the 5'-terminal is 5'-oh, although it will be understood that these and other constructs of the siRNA demonstrated here can also be synthesized with a 5'-phosphate group. Note that the construction of ISIS 351831_351832 is in the same sequence as construction 345847_345849 but the first one is aligning 2'-0-methyl / 2'-fluorine (the antisense strand sequence is 2'-0-methyl in odd numbered positions and '-fluoro pairs, the string statement has 2'F in odd-numbered positions and 2'-0-mef-pairs). The compounds shown in Table 26 were tested at the low dose of 5 nM in HeLa cells as in Examples. The results are shown in Table 26. The demonstrated siRNA constructs consist of an aniseisenid chain structure and a senid chain expression. The antisense (AS) chain structure is shown first in the downlink, followed by the string statement in the next row. It is eniended in the arie that, for RNA, it orders, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. The results are shown as reduction of the percent of the RNA of the elF4E ("% of inhib") in the labia 26. The "target site" refers to the atmoo position of the region of the target with respect to the sequence human of elF4E M15353.1 ,. (SEQ ID NO: 4) to which the oligonucleotide is targeted. Table 26 Activity of additional RNAs objectified to human elF4E The duplexes of the siRNA that aniseate braid have NO. SEQ ID: 236, 301, 343, 347, 355, 359, 360, 361, 363, 364, 365, 367, 370, 372, 373, 374, 375, 376, 384, 387, or 391 inhibited elF4E in this analysis for at least 10%.

Example 46: antisense RNA of individual chain structure (asRNA) pointed to elF4E A series of antisense oligonucleotides of the RNA of single chain structure apunished to human elF4E (NO.SEQ of idenification: 4) was synthesized. Everything is RNA (ribose sugars) with the phosphorus-phosphate skeletal bonds in parallel lysates and a 5 'phosphate closure. The HuVEC endothelial line of the human umbilical vein cell is obtained from the American collection of the type culture (Manassas, VA). The HuVEC cells are ruinously culminated in EBM (Clonetics Corporation Walkersvllle, MD) supplemented with the SingleQuots supplements (Cloneíics Corporaíion, Waikersville, MD). The cells are ruíinarly passed by the syrinization and the dilution when they reach the confluence of 90% and manipulated for 15 steps. Cells are seeded in the 96-well plates (Hawk-Primary # 3872) at a density of 10000 cells / cavity for irradiation with RNA * oligonucleotides (30 nM oligonucleotide concentration). The sequences and the results of the irradiation (the reduction of the RNA of elF4E levels) are shown in figure 27. It is understood in the art that, for the RNA, U (uracil) subsides generally T (imine) that is normally found in DNA or DNA-like sequences. As an example on Examples, the "objective site" refers to the most 5 'position in the region of the objective respect to the human sequence of elF4E M15353.1 (SEQ ID NO: 4) to which the oligonucleotide is "% inhibited" refers to the percent reduction in elF4E RNA (demonstrated the standard deviation of ±).

Table 27 Activity of individual antisense RNA strand structure objectified to elF4E in HuVEC cells As demonstrated in the above, all antisense RNA compounds of individual chain structure could reduce human levels of elF4E RNA by at least 10%. Compounds that reduced elF4E RNA level by at least 20%, at least 30%, at least 40% or at least 50% are especially suitable for use as inhibitors of elF4E expression. ISIS 347402 (SEQ ID NO: 228) gave the largest reduction in elF4E expression in this experiment. A dose-response analysis of this compound of the individual chain antisense RNA was made in heLa cells using antisense RNA concentrations of 1 nM, 10 nM and 100 nM. ISIS 347402 gave an inhibition in a dose-dependent manner of elF4E expression, with a 41% reduction in elF4E expression in 10 nM and a 67% reduction in 100 nM (no effect was observed in 1 dose of the nM in this experiment).

Example 47: The activity of the double-stranded structure siRNA compounds with antisense strand structure sequences corresponding to antisense strand structure RNA compounds The double stranded strand RNA compounds were prepared as in the above Examples. The antisense strand oligonucleotides of the dupls are identical in sequence to the anish sense strand RNAs used in the previous Example, but were made with a phosphod-iesier skeleton (P = 0). The chain's characterization is complemen- tially complementary to the anysinose chain structure. (which thus forms a double blind terminated 20mer) and also has a skeleton of P = 0. Both chain structures are unmodified RNA. The siRNA duplexes were used at a concentration of 25 nM to treat the HeLa cells as described in previous Examples of the siRNA. The effect of the treatment on levels of the elF4E RNA in HeLa cells is as shown in Table 28, "% inhib" refers to the percentage reduction in the elF4E RNA (demonstrated the standard deviation of ±). Only the sequence of the aniseisenid chain structure is shown on plate 28. It is shown in the arie that, for RNA, it orders, U (uracil) generally subsides T (imine) that is normally found in DNA or DNA-like sequences.

Table 28 Activity of double-structure compound siRNAs corresponding to antisense compounds of chain structure RNA Antisense compounds of double-stranded RNA structure are SEQ. ID. NO: 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 260, 262, 264, 266 or 268 at least 10% inhibition of elF4E RNA levels. The aniseisenidic compounds of the RNA whose aniseisenidic chain residues are SEQ ID NO: 220, 224, 226, 228, 230, 232, 236, 238, 240, 246, 250, 254, 256, 260, 262, 264, or 268 at least 50% inhibition of elF4E RNA levels and is therefore also particularly suitable inhibitors of elF4E expression. Thus the individual and double strand anysinose RNA molecules can cause the inhibition of t-ELF4E RNA levels. Composites that are acíivos in versions of chain structure individual tanio as double (that is to say, the structure of active chain antiseníido with or without an esírucíura of chain complemeníaria seníido) are believed to be particularly useful. The various modifications of the invention, in addition to those described herein, will be evident to the experts in the foregoing description. Such modifications are intended to fall within the scope of the appended claims. Each reference (including, but not limited to, newspaper articles, United States and non-U.S., patent use publications, international publications of patent use, accession numbers of the gene bank, and the like) cited in the present application are incorporated herein by reference in their entirety. US Provisional Application No. 60 / 504,110 filed September 18, 2004 and United States Provisional Application No. 60 / 576,534 filed June 3, 2004, t is each incorporated herein by the reference in its toality.

Claims (54)

1. CLAIMS 1. An oligomeric compound or pharmaceutically acceptable salts thereof, which: is from 8 to 80 nucleobases in length; It has an aniseisenidic portion of 8 to 80 nucleobases in length; it is apunit to a nucleic acid molecule encoding elF4E; and which modulates the expression of elF4E, with the proviso that said oligomeric compound or pharmaceutically acceptable sai thereof does not include the sequence 5'-AGTCGCCATCTTAGATCGAT-3"or 5'-AGUCGCCAUCUUAGAUCGAU-3 'and where when inhibition is a modulation of the expression of elF4E, the degree of said inhibition is at least about 50% 2. The oligomeric compound or pharmaceutically acceptable salt thereof of claim 1, which is from 19 to 23 nucleobases in length, and wherein The aniseisenide portion is from 19 to 23 nucleobases of length 3. The oligomeric compound or pharmaceutically acceptable salt thereof of claim 1 or 2, which comprises an oligonucleotide. 4. The pharmaceutically acceptable oligomeric compound or sai thereof is acceptable according to any one of claims 1 to 3, which encompasses a chimeric oligonucleotide. 5. The oligomeric compound or pharmaceutically acceptable salt thereof, according to any of claims 1 to 4, which is a single chain structure. 6. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1 to 4, which is complete or partial of double-stranded speech. 7. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1 to 6, which encompasses an aniseisenidic nucleic acid molecule that specifically hybridizes to a 5'-untranslated region, a start region, a coding region, a stop region or a 3'-untranslated region of said nucleic acid molecule encoding elF4E. 8. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-7, comprising an oligonucleotide having at least one chemically modified internucleoside linkage, sugar moiety, or nucleobase. 9. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 8, comprising an oligonucleotide wherein said chemically modified internucleoside linkage is a phosphorothioane linkage. 10. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 8, comprising an oligonucleotide wherein the modified chemically modified sugar portion has a 2'-0-meioxy-yl substratum. 11. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 8, comprising an oligonucleotide wherein said portion of chemically modified sugar has a 2'-0-methyl, 2'-fluoro substituent, 04'-íio. 12. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 8, comprising an oligonucleotide wherein said chemically modified nucleobase is cytosine, wherein cyanosine has a 5-position methyloyliene. 13. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-5 or 7-12, comprising a single strand oligonucleotide of 20 nucleobases in which each link of the internucleoside is a phosphorothioane linkage; nucleotides 1 - . 1-5 and 16-20 which read from the closure end 5 'to the closure end 3' comprise a sugar 2'-0-methoxyethyl; nucleotides 6-15 are 2'-deoxynucleotides, and each residue of cytosine is a 5-methyl-cytosine. 14. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-12, comprising at least a portion of peptide nucleic acid. 15. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1 to 12, which comprises at least one portion of closed nucleic acid. 16. The compound of any one according to claims 1-12, which is a compound of siRNA wherein at least one eximere of said compound is blunt. 17. The compound according to any of claims 1-12, which is a compound of the siRNA wherein at least one chain structure of said compound encompasses one or more salienic nucleosides. 18. The compound according to claim 17, wherein the number of leaving nucleosides is from one to six. 19. The compound according to claim 17, wherein the nucleoside or the protruding nucleosides are deoxythymidine (dt) nucleosides. 20. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-19, which is in the form of a sodium salt. 21. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-20, having at least about 95% complementarity with said nucleic acid molecule encoding elF4E. 22. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-21, which comprises at least an 8-nucleobase portion of SEQ ID NO: 20, 21, 22, 23, 24, 25, 26 , 28, 29, 30, 31, 32, 33, 34, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 51, 52, 54, 56, 57, 58, 59, 60 , 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 , 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 110, 111, 112, 114, 115, 116 , 117, 118, 119, 120, or 122. 23. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1-21, which encompasses a nucleotide sequence selected from the group consisting of SEQ ID NO: , 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, 33, 34, 37, 38, 39, 40, 42, 43, 44, 45, 46, 47, 51, 52 , 54, 56, 57, 58, 59, 60, 63, 64, 65, 66, 67, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 110, 111, 112, 114, 115, 116, 117, 118, 119, 120, and 122. 24. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 22 or 23, wherein each bond of the internucleoside is a phosphorothioate linkage. 25. The pharmaceutically acceptable oligomeric compound or sai thereof is acceptable according to claim 22 or 23, wherein nucleotides 1-5 and 16-20 reading from the 5 'to 3' closing end comprise a sugar 2'-0-methoxy-yl, and nucleoli 6-15 are 2'-deoxynucleotides. 26. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 22 or 23, wherein each cytosine residue is a residue of 5-methylcyclosin. 27. The oligomeric compound or pharmaceutically acceptable salt thereof according to claim 23, comprising SEQ ID NO: 40 or SEQ ID NO: 97. 28. The oligomeric compound or pharmaceutically acceptable salt thereof according to claims 22 to 27, wherein each internucleoside linkage is a phosphorothioane linkage; nucleotides 1-5 and 16-20 which read at the 5 'end to the 3' end encompass a 2'-0-methoxyethyl sugar, nucleotides 6-15 are 2'-deoxynucleotides, and each residue of the cytosine is a 5- mecylcyosine 29. The compound according to any of claims 1-21 or 24 wherein the antisense strand structure of said compound encompasses at least a portion of 8-nucleobases of SEQ ID NO: 213, 215, 217, 220, 222 , 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 260, 262, 264, 266, 268, 270, 272, 274 , 283, 285, 287, 289, 291, 293, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333 , 335 or 337. 30. The compound according to any of claims 1-21 or 24 wherein the antisense strand structure of said compound encompasses SEQ ID NO: 213, 215, 217, 220, 222, 224, 226 , 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 260, 262, 264, 266, 268, 270, 272, 274, 283, 285 , 287, 289, 291, 293, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335 or 337 31. The compound according to any of the r claims 1-21 or 24 wherein the antisense strand structure of said compound encompasses at least a portion of 8-nucleobases of one of SEQ ID NO: 339-394. 32. The oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 22-31, which is in the form of a sodium salt. 33. A pharmaceutical or veterinary composition, comprising an oligomeric compound or a pharmaceutically acceptable salt thereof according to any of claims 1-32, and a carrier, excipient, or pharmaceutically or physiologically dilute pharmaceutically acceptable. 34. A method of inhibiting the expression of elF4E in a cell, an organ, or an organ, comprising swirling in vacuo with said cell, organ or organ and an effective amount of said oligomeric compound or pharmaceutically acceptable salt thereof of any one of claims 1 to 32 so that the expression of elF4E is inhibited. 35. A method for decreasing the proliferation of a cell in which elF4E is expressed, comprising in quenching in conjunction with said cell and an effective amount said oligomeric compound or pharmaceutically acceptable salt thereof of any of claims 1 to 32 to inhibit the proliferation of said cell. 36. A method of preventing or eradicating a condition or disease associated with the expression or overexpression of elF4E, comprising administering to a patient an effective amount of an oligomeric compound or pharmaceutically acceptable salt thereof of any of claims 1 to 32 37. The method according to claim 36, wherein the condition or said disease or condition is a hyperproliferative disease or condition. 38. The method of claim 37, wherein the hyperproliferative condition or disease is a cancer, a tumor, or a condition characterized by unwanted aberrant angiogenesis. 39. The method of claim 37, wherein the aforementioned hyperproliferative condition or disease, associated with the expression or overexpression of elF4E is selected from a group consisting of breast cancer, cancer of the head and neck, cancer colorectal cancer, obesity, lung cancer, bladder cancer, ovarian cancer, renal, and glioblastoma. 40. A method of preventing or decreasing angiogenesis, comprising administering to a patient an effective canine of an oligomeric compound or pharmaceutically acceptable salt thereof of any one of claims 1 to 32. 41. A method of preventing or decreasing tumor growth in a patient comprising administering to a patient an effective amount of an oligomeric compound or pharmaceutically acceptable salt thereof from any of claims 1 to 32. 42. The method according to any of claims 36-41, wherein said patient is a mammal. 43. The method according to any of claims 36 to 41, wherein said patient is a human being. 44. An antisense oligonucleotide, comprising a nucleoide sequence selected from the group consisting of SEQ ID NO: 40 and SEQ ID NO: 97, wherein each linker of the ininoleucleoside is a phosphoryloane linkage; nucleotides 1-5 and 16-20 reading from the 5 'end to the 3' end comprise a 2'-0-methoxyethyl sugar; the nucleosides 6-15 are 2'-deoxynucleicides; each residue of the cytosine is a 5-methylcytosine, and it is in the form of a sodium salt. 45. A pharmaceutical or veterinary composition, said antisense oligonucleotide of claim 44, and a pharmaceutically or physiologically acceptable excipient, excipient, diluent or excipient. 46. A method of preventing or treating a condition associated with the expression or overexpression of elF4E, comprising administering to a patient, an effective amount of an oligonucleotide of claim 44. 47. The method according to claim 1. 46, wherein said condition associated with the expression or overexpression of elF4E is selected from the group consisting of, breast cancer, head and neck cancer, colon cancer, prostate cancer, lung cancer, cancer of the bladder, ovarian cancer, renal cancer, and glioblasíoma. 48. A method for decreasing angiogenesis, comprising administering to a patient an effective amount of an oligomeric compound or a pharmaceutically acceptable salt thereof of claim 44. 49. A method for inhibiting the expression of elF4E in a cell, tissue, or organ, comprising contacting said cell, tissue or organ and an effective amount of said oligomeric compound or pharmaceutically acceptable salt thereof of claim 44, as well as inhibiting the expression of elF4E. 50. Use of an oligomeric compound or pharmaceutically acceptable salt thereof according to any of claims 1 to 32, or an antisense oligonucleotide of claim 44, for the manufacture of a medicament for the prevention or treatment of a condition associated with the expression or overexpression of elF4E. 51. The compound of claim 1, wherein said compound encompasses an antisense nucleic acid molecule that is specifically hybridizable to a 5'-closure region of the nucleic acid molecule encoding elF4E. 52. The compound according to claim 51, which is a compound of individual chain structure, having at least one PNA or a 2'-0-methoxyethyl portion. 53. The compound according to claim 52, which is uniformly PNA or uniformly 2'-0-meioxy-yl. 54. The compound according to claim 51, comprising at least a portion of 8-nucleobases of SEQ ID NO: 395, 396, 397 or 398.