MXPA05013065A - Modulation of survivin expression - Google Patents

Abstract

Compounds and compositions are provided for modulating the expression of survivin. The compounds, exemplified by those acting through an RNAi antisense mechanism of action, include double-stranded and single-stranded constructs, as well as siRNAs, canonical siRNAs, blunt-ended siRNAs and single-stranded antisense RNA compounds. Methods of using these compounds for modulation of survivin expression and for treatment of diseases associated with expression of survivin are provided.

Description

EXPRESSION MODULATION OF SURVIVINA FIELD OF THE INVENTION The present invention provides compositions and methods for the modulation of survivin expression. In particular, this invention relates to antisense compounds, particularly double-stranded oligonucleotides that specifically hybridize with nucleic acids encoding human survivin. Such oligonucleotides have been shown to modulate the expression of survivin.

BACKGROUND OF THE INVENTION An outstanding feature of cancer cells is uncontrolled proliferation. Among the differences that have been discovered between normal and tumor cells is resistance to the programmed cell death process also known as apoptosis (Ambrosini et al., Nat. Med., 1997, 3, 917-921). Apoptosis is a process that multicellular organisms have evolved to avoid the uncontrolled proliferation of cells as well as to eliminate cells that have become diseased, harmful or that are no longer necessary. The process of apoptosis involves a cascade of multistages in which cells are degraded from the inside through a concerted action of proteolytic enzymes and DNA endonucleases, resulting in the formation of apoptotic bodies that are then removed by sequestering cells. Research to date has shown that much of the intracellular degradation is carried out through the action of caspases, a family of proteolytic enzymes that unfold adjacent to the aspartate residues (Cohen, Biochemistry Journal, 1 997, 326 , 1-16). The finding that most tumor cells display resistance to the apoptotic process has led to the view that therapeutic strategies aimed at attenuating the resistance of tumor cells to apoptosis may represent a novel means to stop the distribution of tumors. Neoplastic cells (Ambrosini et al., Nat. Med., 1997, 3, 917-921). One of the mechanisms through which tumor cells are thought to acquire resistance to apoptosis is the overexpression of survivin, a recently described member of the caspase inhibitor family IAP (an inhibitor of apoptosis). To date, overexpression of survivin has been detected in tumors of the lung, colon, pancreas, prostate, breast, stomach, non-Hodgkin's lymphoma and neuroblastoma (Adida et al., Lancet, 1998, 351, 882-883 Ambrosini et al., Nat. Med., 1997, 3, 917-921; Lu et al., Cancer Res., 1998, 58, 1 808-1 812). A more detailed analysis has been carried out in the neuroblastoma where it was found that the overexpression of survivin was segregated with the tumor histologies known to be associated with a poor prognosis (Adida et al., Lancet, 1998, 351, 882-883 ). Finally, Ambrosini et al, describe the transfection of HeLa cells with an expression vector containing a 708 nt fragment of the human cDNA encoding the effector cell protease receptor 1 (EPR-1), the coding sequence of which is complementary to the coding strand of survivin (Ambrosini et al., J. Bio, Chem., 1 998, 273, 1 1 177-1 1 182). This construct caused a reduction in cell viability. It has recently been found that survivin plays a role in the regulation of the cell cycle. It has been found to be expressed in the G2 / M phase of the cell cycle in a regulated form by the cycle, and is associated with the microtubules of the mitotic set. Disruption of this interaction results in a loss of the anti-apoptotic function of survivin and an increased activity of caspase 3 during mitosis. Caspase 3 is associated with apoptotic cell death. It is therefore believed that survivin can counteract an induction by omission of apoptosis in the G2 / M phase. It is believed that overexpression of survivin in cancer can overcome this apoptotic checkpoint, allowing the undesirable survival and division of cancer cells. The antisense survivin construct described by Ambrosini above, is found to downregulate endogenous survivin in HeLa cells and increase caspase-3 dependent apoptosis in cells in the G2 / M phase. Li et al. , Nature, 1 998, 369, 580-584. In many species, the introduction of double-stranded RNA (dsRNA) induces powerful and specific silencing of genes. This phenomenon occurs both in plants and animals, and has roles in the viral defense and silencing mechanisms of the transposon (Jorgensen et al., Plant Mol., Biol., 1996, 31, 957-973; Napoli et al. , Plant Cell, 1990, 2, 279-289). The first evidence that dsRNA can lead to the silencing of genes in animals, came from work in the nematode, Caenorhabditis elegans, where it has been shown that feeding, dipping or injecting dsRNA (a mixture of both strands of sense as antisense) results in a much more efficient silencing than the injection of sense or antisense strands alone (Guo and Kemphues, Cell, 1995, 81, 61-1-620; Fire et al., Nature 391: 806-81 1 (1,998), Montgomery et al., Proc Nati, Acad Sci USA 95: 15502-15507 (1998), PCT International Publication WO99 / 32619; (Fire et al., Nature, 1998, 391, 806-810. Timmons et al., Gene, 2001, 263, 1 03-1 12; Timmons and Fire, Nature, 1 998, 398, 854). Since then, the phenomenon has been demonstrated in various organisms including Drosophila melanogaster (Kennerdell et al. ., Cell 95: 1017-1026 (1998)), and embryonic mice (Wianny et al., Nat. Cell Biol. 2: 70-75 (2000)). Post-transcriptional gene binding has been termed RNA interference (RNAi) and has been reverted to generally refer to the gene silencing process involving dsRNA, which leads to a specific sequence reduction of gene expression by means of degradation of the target mRNA (Tuschl et al. , Genes Dev., 1999, 13, 3191-3197).

It has been demonstrated that fragments of dsRNAs of 21 and 22 nt having 3 'overlays are specific mediators of the canonical sequence of the RNAi. These fragments, which are called short interfering RNAs (siRNAs) are generated by a proing reaction of the RNase I 1 type from more extensive dsRNA. The chemically synthesized siRNA also mediates the efficient cleavage of the targeting RNA with the cleavage site located near the center of the region encompassed by the siRNA leader strand. (Elbashir et al., Nature, 2001, 41 1, 494-498). Characterization of expression suppression of endogenous and heterologous genes elicited by 21-23 nucleotides siRNAs has been investigated in various mammalian cell lines, including HeLa and human embryonic kidney (293) cells (Elbashir et al., Genes and Development, 2001, 1 5, 188-200). Recently, it has been shown that the oligomers of Single-stranded RNA (ssRNA or RNAs) of antisense polarity, can be potent inducers of gene silencing and that single-stranded oligomers are ultimately responsible for the RNAi phenomenon (Tijsterman et al., Science, 2002, 295, 694-697 ). U.S. Patent Nos. 5,898,031 and 6,174,094 each of which is incorporated herein by reference, disclose certain oligonucleotides having properties of the RNA type. When hybridized with RNA, these oligonucleotides serve as substrates or for an RNasads enzyme with a resultant cleavage of the RNA by the enzyme (Crooke, 2000; Crooke, 1999).

As a result of these advanin the understanding of apoptosis and the role that expression of survivin plays in providing a growth advantage to a wide variety of tumor cell types, there is a great desire to provide compositions of matter. that can modulate the expression of survivin. It is widely desired to provide a method of diagnosis and detection of nucleic acids encoding survivin in animals. It is also desired to provide methods of diagnosis and treatment of conditions resulting from the expression of survivin. In addition, improved research kits and reagents are desired for the detection and study of nucleic acid encoding survivin. Thus, the present invention provides a class of novel survivin inhibitors, compositions comprising these compounds and methods of using the compounds.

BRIEF DESCRIPTION OF THE INVENTION The present invention is directed to oligomeric compounds, particularly single- and double-stranded antisense compounds that target a nucleic acid encoding survivin, and which modulate the expression of survivin. In some embodiments, the antisense compounds are oligonucleotides. In some embodiments the oligonucleotides are RNAi oligonucleotides (which are predominantly RNA or RNA-like). In other embodiments, the oligonucleotides are RNase H oligonucleotides (which are predominantly DNA or DNA type). Still in other embodiments, the oligonucleotides can be chemically modified. Also provided are pharmaceutical compositions and other compositions comprising the antisense compounds of the invention. In addition, methods of modulating the expression of survivin in cells or tissues comprising contacting the cells or tissues with one or more of the antisense compounds or compositions of the invention are provided. Further provided are methods of treating an animal particularly of a human suspected of having or being prone to a disease or condition associated with the expression of survivin, by administering a therapeutically or prophylactically effective amount of one or more of the oligonucleotides or compositions of the invention. In another embodiment, the present invention provides the use of a compound of the invention in the manufacture of a medicament for the treatment of any and all conditions described herein. The disease or condition can be a hyperproliferative condition. In a modality, the hyperproliferative condition is cancer. The oligomeric compounds of the present invention are inhibitors of the expression or overexpression of survivin. Because these compounds inhibit the effects of the expression or overexpression of survivin, the compounds are useful in the treatment of disorders related to survivin activity. Thus, the compounds of the present invention are anti-neoplastic agents. The present compounds are believed to be useful in the treatment of carcinomas such as neoplasms of the central nervous system: glioblastoma multiforme, astrocytoma, oligodendroglial tumors, choroidal and ependymal plexus tumors, pineal tumors, neuronal tumors, medulloblastoma, schwannoma, meningioma, sarcoma, the meninges; neoplasms of the eye: basal cell carcinoma, squamous cell carcinoma, melanoma, rhabdomyosarcoma, retinoblastoma; neoplasms of the endocrine glands: neoplasms of the pituitary, neoplasms of the thyroid, neoplasms of the adrenal cortex, neoplasms of the neuroendocrine system, neoplasms of the gastro-entero-pancreatic endocrine system, neoplasms of the gonads; neoplasms of the head and neck: cancer of the head and neck, oral cavity, pharynx, larynx, odontogenic tumors; Chest neoplasms: large cell lung carcinoma, small cell lung carcinoma, non-small cell lung carcinoma, neoplasms of the chest, malignant mesothelioma, thymomas, primary germ cell tumors of the thorax, neoplasms of the alimentary canal: neoplasms of the esophagus, neoplasms of the stomach, neoplasms of the liver, neoplasms of the gallbladder, neoplasms of the exocrine pancreas, neoplasms of the small intestine, appendix and veriform peritoneum, adenocarcinoma of the colon and rectum, neoplasms of the anus; neoplasms of the genitourinary tract: renal cell carcinoma, neoplasms of the renal pelvis and ureter, neoplasms of the bladder, neoplasms of the urethra, neoplasms of the prostate, neoplasms of the penis, neoplasms of the testes, neoplasms of the female reproductive organs, neoplasms of the vulva and vagina, cervical neoplasms, adenocarcinoma of the uterine body, ovarian cancer, gynecological sarcomas; neoplasms of the chest; neoplasms of the skin: basal cell carcinoma, squamous cell carcinomas, dermatofibrosarcoma, Merkel cell tumor; malignant melanoma; neoplasms of bone and soft tissue: osteogenic sarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, primitive neuroectodermal tumor, angiosarcoma; neoplasms of the hematopoietic system: meilodisplastic syndromes, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, leukemia / T cell lymphoma and HTLV-1, chronic lymphocytic leukemia, hairy cell leukemia, Hodgkin's disease, non-Hodgkin lymphomas , mast cell leukemia, and neoplasms of children: acute lymphoblastic leukemia, acute myelocytic leukemia, neuroblastoma, bone tumors, rhabdomyosarcoma, lymphomas, renal tumors. Thus, in one embodiment, the present invention provides a method for the treatment of susceptible neoplasms comprising: administering to an animal particularly a human, an effective amount of a single-stranded oligonucleotide (ssRNA or ssRNA or aRNA) or double-stranded oligonucleotide (ARNds or siRNA) directed to survivin. The ssRNA or dsRNA oligonucleotide can be modified or unmodified. That is, the present invention provides the use of a double-stranded RNA oligonucleotide directed to survivin, or a pharmaceutical composition thereof for the treatment of susceptible neoplasms. In another aspect, the present invention provides the use of an isolated double stranded RNA oligonucleotide compound in the manufacture of a medicament for inhibiting the expression or overexpression of survivin. Thus, the present invention provides the use of an isolated double-stranded RNA oligonucleotide, directed to survivin in the manufacture of a medicament for the treatment of susceptible neoplasms by means of the methods described above. The compounds of the present invention are especially useful for the treatment of pancreatic cancer, prostate cancer, colon cancer, breast cancer, lung cancer, bladder cancer, liver cancer, ovarian cancer, renal cancer, glioblastoma and lymphoma that It's not from Hodgkin. Another embodiment of the present invention is a method of treating an animal, particularly a human having a disease or condition characterized by reduction in apoptosis which comprises administering to a patient a therapeutically effective amount of an antisense compound of 8 to 80 nucleobases of length directed to a nucleic acid molecule encoding human survivin so as to inhibit the expression of survivin. The present invention also provides a method of modulating apoptosis in a cell comprising contacting a cell with an antisense compound of from 8 to 80 nucleobases in length directed to a nucleic acid molecule encoding human survivin so that it is modulates apoptosis Still in another embodiment of the inventionis a method of modulating cytokinesis in a cell comprising contacting a cell with an antisense compound of 8 to 80 nucleobases in length directed to a nucleic acid molecule encoding human survivin, so as to modulate the cytokinesis The present invention also provides a method of modulating the cell cycle in a cell comprising contacting a cell with an antisense compound of 8 to 80 nucleobases in length directed to a nucleic acid molecule encoding human survivin so that it is module the cell cycle. In yet another embodiment of the invention, there is provided a method of inhibiting cell proliferation, comprising contacting cells with an effective amount of an antisense compound of 8 to 80 nucleobases in length directed to a nucleic acid molecule that encodes human survivin, so as to inhibit the proliferation of cells. In one embodiment, the cells are cancer cells. The method may further comprise administering a chemotherapeutic agent to the patient. In yet another embodiment, there is provided a method of modulating the apoptosis of hyperproliferative cells comprising contacting the cells with an effective amount of an antisense compound of 8 to 80 nucleobases in length, addressed to a nucleic acid molecule encoding the human survivin so that the apoptosis of the cells is modulated. In one embodiment, the cells are hyperproliferative cells and apoptosis is enhanced by the antisense compound. In another modality, the modulation of apoptosis is the sensitization to an apoptotic stimulus. In one embodiment, the apoptotic stimulus is a cytotoxic chemotherapeutic agent. The method may further comprise contacting the cells with a chemotherapeutic agent.

DETAILED DESCRIPTION OF THE INVENTION The present invention employs single- and double-stranded oligomeric antisense compounds, particularly single- or double-stranded oligonucleotides which are of RNA or RNA-like oligonucleotides and single-stranded oligonucleotides that are either DNA or DNA-like for their use in the modulation of the function of the nucleic acid molecules encoding survivin, finally modulating the amount of survivin produced. This is achieved by providing antisense compounds which hybridize specifically with one or more nucleic acids encoding survivin. As used herein, the terms "targeting or targeting nucleic acid" and "survivin encoding the nucleic acid" encompass the survivin encoding the DNA, RNA (including pre-mRNA and mRNA or portions thereof) transcribed of such DNA, and also the cDNA derived from such RNA. The specific hybridization of an oligomeric compound with its targeting nucleic acid in complementary sense interferes with the normal function of the nucleic acid. This modulation of the function of a target nucleic acid by compounds that specifically hybridize thereto is generally referred to as antisense and such compounds can be described as being in an antisense orientation relative to the target. The functions of the DNA with which it interferes include replication and transcription. The functions of the RNA to be interfered include for example translocation of the RNA, to the site of protein translation, translation of the RNA protein, splicing of the RNA to produce one or more species of mRNA and the catalytic activity that can be involved or facilitated by the RNA The overall effect of such interference with the nucleic acid targeting function is the modulation of the expression of survivin in the RNA and / or the protein level. In the context of the present invention, "modulation" means an increase (stimulation) or decrease (inhibition) in the expression. In the context of the present invention, inhibition is a desired form of modulation of gene expression and RNA and in some embodiments mRNA is a suitable target. It is appropriate to target specific nucleic acids for antisense. The "targeting" of an antisense compound to a particular nucleic acid, in the context of this invention, is a multi-step process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This can be for example a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule of an infectious agent. In the present invention, the objective is a nucleic acid molecule encoding survivin. The targeting process also includes determining a site or sites within this gene for the antisense interaction to occur in a manner such that the desired effect will result, for example, the detection or modulation of mRNA and / or protein expression. Within the context of the present invention, an intragenic site is the region spanning the start of translation or the stop codon of the open reading structure (ORF) of the gene. Since, as is known in the art, the initiation codon of the translation is typically 5'-AUG (in molecules transcribed with RNA; 5'-ATG in the corresponding DNA molecule), the start codon of the translation is also refers to the "codon AUG", the "start codon" or the "start codon AUG". A minority of genes has a start codon of the translation that has the sequence of RNA 5'-GUG, 5'-UUG and 5'-CUG while the start codons of the translation of 5'-AUA, 5'- ACG and 5'-CUG have been shown to work in vivo. Thus, the terms "translation start codon" and "start codon" can encompass many codon sequences although the initiating amino acid in each case is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have 2 or more alternative start codons, any of which may be preferably used for the initiation of translation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, the start codon and start codon of translation refers to the codon or codons that are used in vivo to initiate translation of a mRNA molecule transcribed from a gene encoding survivin, regardless of the sequences of such codons. It is also known in the art that a translation stop codon (or stop codon) of a gene can have one of three sequences, that is 5'-UAA, 5'-UAG or 5'-UGA (the corresponding sequences of DNA are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start codon region" and "start codon region" of the translation refer to a portion of such mRNA or gene spanning from about 25 to about 50 contiguous nucleotides in either direction (ie, 5 'or 3). ') from a start codon of the translation. Similarly, the terms region of the stop codon and "region of the translation stop codon" refer to a portion of such an mRNA or gene encompassing about 25 to about 50 contiguous nucleotides in any direction (ie, 5 '). or 3 ') from a stop codon of the translation. The open reading structure (ORF) or coding region, which is known in the art to refer to the region between the start codon of translation and the stop codon of the translation, is also a region that can be effectively directed. Other target regions include the 5 'untranslated region (5'UTR) known in the art to refer to the portion of an mRNA in the 5' direction from the start codon of the translation, and thus includes nucleotides between the site of 5 'close and the start codon of the translation of a corresponding mRNA or nucleotides in the gene, and the 3' untranslated region (3'UTR) known in the art to refer to the portion of an mRNA in the 3 'direction from the stop codon of the translation, and thus includes nucleotides between the stop codon of translation and the 3 'end of a corresponding mRNA or nucleotides on the gene. The 5 'closure of an mRNA comprises a N7 methylated guanosine residue attached to the residue that is further in 5' of the mRNA by means of a 5'-5 'triphosphate ligation. The 5 'closing region of an mRNA is considered to include the 5' closure structure itself as well as the first 50 nucleotides adjacent to the closure. The 5 'closing region can also be an effective target region.

Although some transcripts of eukaryotic mRNA are directly translated, many contain one or more regions known as introns, which are excised from a transcript before they are translated. The remaining (and therefore translated) regions are known as exons, and they are spliced together to form a continuous sequence of mRNA. The mRNA splice sites, that is the intron and exon junctions, can also be target regions and are particularly useful in situations where aberrant splicing is implicated in diseases, or where an overproduction or a product is involved in the disease. of splicing mRNA in particular. Once one or more target sites have been identified, antisense oligomeric compounds typically in an antisense oligonucleotide are chosen to be sufficiently complementary to the target that is, they hybridize sufficiently well and with sufficient specificity to give the desired effect. In the context of this invention, "hybridization" means hydrogen bond which can be Watson-Crick, Hoogsteen or Hoogsteen inverted hydrogen bond, between nucleotide or complementary nucleoside bases. For example, adenine and thymine are complementary nucleobases that are paired through the formation of hydrogen bonds. "Complementary" as used herein, refers to the ability of an accurate match between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide can bind to hydrogen with a nucleotide in the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to one another in that position. The oligonucleotide and the DNA or RNA are complementary to one another when a sufficient number of corresponding positions in each molecule are occupied by the nucleotides that can be hydrogen bonded to one another. Thus, that "specifically hybridizes" and "complementary" are terms used to indicate a sufficient degree of complementarity or precise matching so that a stable and specific binding occurs between the oligonucleotide and the target of DNA or RNA. It is understood in the art that the sequence of an antisense compound need not be 1 00% complementary to those of its target nucleic acid to be specifically hybridizable. An antisense compound, is specifically hybridizable when the binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, to cause a partial or complete loss of function, and there is a sufficient degree of complementarity to avoid a nonspecific binding of the antisense compound to the non-target sequences under conditions in which the specific binding is desired, that is, under physiological conditions in the case of therapeutic treatment, or under conditions in which in vitro assays are carried out or in vivo. Additionally, an oligonucleotide can hybridize on one or more segments in such a way that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, hairpin structure, or no match). The compounds of the present invention comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or, at least 95%), at least 99, or 100% sequence complementarity with a target region within the target nucleic acid sequence to which they are directed. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to the target region, and therefore would specifically hybridize, would represent 90% complementarity. In this example, the remaining non-complementary nucleobases can be grouped or dispersed with complementary nucleobases and do not need to be contiguous with each other or with complementary nucleobases. As such, an antisense compound having 18 nucleobases in length, having 4 non-complementary nucleobases which are flanked by 2 regions of complete complementarity with the target nucleic acid, would have 77.8% overall complementarity with the target nucleic acid, and would thus fall within the scope of the present invention. The percentage complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). The homology in percentage, sequence identity or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wl), using default parameters which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments the homology, sequence identity or complementarity between the antisense compound and the target is between about 50% up to about 60% > . In some embodiments, the homology, sequence identity or complementarity is between about 60% up to about 70%. In some embodiments, homology, sequence identity or complementarity is between about 70% and about 80%. In some modalities the homology, sequence identity or complementarity is between around. 80% and around 90%. In some embodiments the homology, sequence identity or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99 % or around 1 00%. Antisense compounds are commonly used as research and diagnostic reagents. For example, antisense oligonucleotides that can inhibit the expression of genes with exquisite specificity are often used by ordinary experts to produce the function of particular genes. Antisense compounds are also used for example, to distinguish between functions of various members of a biological path. The antisense modulation has therefore been articulated for research use. There are multiple mechanisms by which short synthetic oligonucleotides can be used to modulate gene expression in mammalian cells. A commonly exploited antisense mechanism is the RNase H-dependent degradation of targeted RNA. RNase H is a ubiquitously expressed endonuclease that recognizes the antisense heteroduplex DNA-RNA by hydrolyzing the DNA strand. An additional antisense mechanism involves the use of enzymes that catalyze the cleavage of the RNA-RNA duplexes. These reactions are catalyzed by a class of RNase enzymes including, but not limited to, RNase 11 and RNase L. The antisense mechanism known as RNA interference (RNAi) operates on RNA-RNA hybrids and the like. Both antisense based on RNase H (usually using single-stranded compounds) and RNA interference (usually using double-stranded compounds known as SsRNA) are antisense mechanisms, which typically result in the loss of the function of the target RNA. Oligomeric siRNA and optimized RNase H-dependent oligomeric compounds behave similarly in terms of potency, maximum effects, specificity and duration of action and efficiency. Additionally it has been shown that in general, the activity of the dsRNA constructs correlates with the activity of the RNase H-dependent single-stranded antisense compounds directed to the same site. An important exception is that the RNase H-dependent antisense compounds were generally active against the target sites in pre-mRNA whereas the ssRNAs were not. These data suggest that in general, the sites in the target RNA that were not active with the RNase H-dependent oligonucleotides were not similarly good sites for siRNA. Conversely, a significant degree of correlation was found between the active oligonucleotides of RNase H and siRNA, suggesting that if a site is available for hybridization to an RNase H oligonucleotide then it is also available for hybridization and cleavage by the RNase H complex. SiRNA. Consequently, once the appropriate target sites have been determined by any antisense method, these sites can be used to design constructs that operate by an alternative antisense mechanism (Vickers et al., 2003, J. Biol. Chem. 278, 7108 ). On the other hand, once a site has been shown to be active for an RNAi oligonucleotide or an RNAse H, a single-stranded oligonucleotide (ssRNA or aRNA) can be designed. In some embodiments of the present invention, double stranded antisense oligonucleotides are suitable. These double-stranded antisense oligonucleotides can be RNA or RNA-like and can be modified or not modified in that the oligonucleotide, if modified, retains the RNA: RNA hybridization and recruitment and (activation) properties of a Rnasa ds. In other embodiments, the single-stranded oligonucleotides (ssRNA or RNAs) can be of the RNA type. In other embodiments of the present invention, single-stranded antisense oligonucleotides are suitable. In some embodiments, the single-stranded oligonucleotides may be of the DNA type in which the oligonucleotide has well-characterized structural characteristics for example a plurality of unmodified 2 'Hs or a stabilized column such as for example phosphorothioate, which is structurally suitable for interaction with an objective oligonucleotide and the recruitment and (activation) of RNase. Although oligonucleotides are a form of antisense compound, the present invention comprises other oligomeric antisense compounds, including, but not limited to, oligonucleotide mimics such as those described below. The compounds according to this invention may comprise from about 8 to about 80 nucleobases. In another embodiment, the oligonucleotide is from about 10 to 50 nucleotides in length. In yet another embodiment, the oligonucleotide is 12 to 30 nucleotides in length. In yet another embodiment, the oligonucleotide is 12 to 24 nucleotides in length. In yet another embodiment, the oligonucleotide is 19 to 23 nucleotides in length. Some embodiments comprise at least a portion of 8 nucleobases of a sequence of an oligomeric compound that inhibits the expression of survivin. The dsRNA or siRNA molecules directed to survivin and their use in the inhibition of survivin mRNA expression are also embodiments within the scope of the present invention. Oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, variants containing thymidine (or uridine if it is RNA), guanosine or histidine can be produced in this position. This can be done in any of the oligonucleotide positions. Thus, a 20-mer may comprise 60 variations (20 positions x 3 alternates in each position) in which the original nucleotide is substituted with any of the 3 alternate nucleotides. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit the expression of survivin mRNA.

Oligomeric Compounds In the context of the present invention, the term "oligomeric compound" refers to a polymeric structure capable of hybridizing to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimics and chimeric combinations thereof. The oligomeric compounds are routinely prepared in a linear fashion but may be attached or otherwise prepared to be circular and may also include branching. The oligomeric compounds may include double-stranded constructs such as, for example, two hybridized strands to form double-stranded or single-stranded compounds with sufficient self-complementarity to allow hybridization and formation of a fully or partially double-stranded compound. In one embodiment of the invention, the double-stranded antisense compounds encompass those of short RNA interference (ssRNA). As used herein, the term "siRNA" is defined as a double-stranded compound having a first and second strand and comprising a complementary central portion between the first and second strand and terminal portions that are optionally complementary between the first and second strands and second strands or with the target mRNA. Each strand may be from about 8 to about 80 nucleobases in length, 10 to 50 nucleobases in length, 12 to 30 nucleobases in length, 12 to 24 nucleobases in length or 19 to 23 nucleobases in length. The central complementary portion may be from 8 to about 80 nucleobases in length, 10 to 50 nucleobases in length, 12 to 30 nucleobases in length, 12 to 24 nucleobases in length or 19 to 23 nucleobases in length. The terminal portions can be from 1 to 6 nucleobases in length. The siRNAs may also have no terminal portion. The two strands of an siRNA can be ligated internally leaving the 3 'or 5' ends free or can be ligated to form a continuous hairpin structure. The fork structure may contain a drapery at the 5 'or 3' end producing an extension of a single strand character. In one embodiment of the invention, the double-stranded antisense compounds are canonical siRNAs. As used herein, the term "canonical siRNA" is defined as a double stranded oligomeric compound having a first strand and a second strand, each strand being 21 nucleobases in length with strands that are complementary to 19 nucleobases and have at each 3 'end of each strand of the deoxythymidine dimer (dTdT) which in the double-stranded compound acts with a 3' overhang. In another embodiment, the double-stranded antisense compounds are siRNA with blunt tips. As used herein, the term "siRNA with blunt-ended ends" is defined as an siRNA having no terminal hangings. This is at least one end of the double-stranded compound has blunt tips. SiRNAs, whether canonical or blunt-ended, act to produce RNAse ds enzymes and activate the recruitment or activation of the antisense RNAi mechanism. In a further embodiment, single-stranded RNAi compounds (siRNA) acting by means of the antisense RNAi mechanism are contemplated.

Additional modifications can be made to the double-stranded compounds and can include conjugated groups attached to one of the terminations, selected nucleobase positions, sugar positions or one of the nucleoside linkages. Alternatively, the two strands can be ligated by means of a non-nucleic acid portion or linker group. When formed from only one strand, dsRNA can take the form of a self-complementary hairpin molecule that bends back on itself to form a duplex. Thus the dsRNAs can be completely or partially double stranded. When they are formed from two strands, a single strand that takes the form of a self-complementary hairpin molecule, folded back on itself to form a duplex, the two strands (or single-strand duplex forming regions) are complementary strands of RNA that form base pairs in a Watson-Crick way. In general, an oligomeric compound comprises a column of monomeric subunits linked to ligation groups wherein each bound monomeric subunit binds directly or indirectly to a heterocyclic base portion. The oligomeric compounds may also include monomeric subunits that do not bind to a heterocyclic base portion whereby non-basic sites are provided. Any of the repeating units that generate an oligomeric compound can be modified resulting in a variety of portions including hemomers, spacing monomers and chimeras. As is known in the art, a nucleoside comprises a sugar portion attached to a heterocyclic base portion. The two most common classes of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides which also include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2 ', 3' or 5 'hydroxyl portion of the sugar giving the most common internucleoside binding 5,3' or the not so common internucleoside binding 2 ', 5'. In the formation of oligonucleotides, the phosphate groups are covalently bound to sugar portions of adjacent nucleosides. The respective ends can be joined to form a circular structure by hybridization or by the formation of a covalent bond. In addition, the linear compounds can have a complementarity of internal base cores and therefore can be folded in a manner so as to produce a fully or partially double-stranded compound. Within the oligonucleotides, the phosphate groups are commonly referred to as forming the nucleoside binding or in conjunction with the sugar ring form the column of the oligonucleotide. The normal ligature between nucleosides comprising the RNA and DNA column is a 3 'to 5' phosphodiester binding. However, open linear structures are generally desirable. In the context of this invention, the term "oligonucleotide" refers to an oligomer or a polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or imitations thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent linkages between nucleosides, as well as chemically modified oligonucleotide or oligonucleotide analogs having one or more naturally occurring portions which function in a similar manner. Such modified or substituted oligonucleotides are suitable over naturally occurring forms, due to desirable properties such as for example improved cellular uptake, improved affinity for a nucleic acid target and improved nuclease stability. In the context of the present invention, the term "oligonucleoside" refers to a sequence of nucleosides that are linked by ligatures between nucleosides that do not have phosphorus atoms. Ligatures between nucleosides of this type include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic ligatures or one or more short chain heterocyclic linkages. These ligatures between nucleosides include, but are not limited to, siloxane, sulfide, sulfoxide, sulfone, acetyl, formacetyl, thioformacetyl, methylene, formacetyl, thioformacetyl, alkene, sulfamate.; methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide and others having mixed N, O, S and CH2 component parts. Representative patents of the United States that teach the preparation of the above oligonucleosides include, but are not limited to, EUA. : 5,034,506; 5, 166.315; 5, 185.444; ,214, 134 5,216, 141; 5,235,033 5,264,562; 5,264,564; 5,405; 938; 5,434,257 5,466,677; 5,470,967 5,489,677; 5,541, 307; 5,561, 225; 5,596,086 5,602,240; 5,610,289 5,602,240; 5,608,046; 5,610,289; 5,618,704 5,623,070; 5,663,070 5,663,312; 5,633,360; 5,677,437; 5,792,608 5,646,269 and 5,677,439 each of which is incorporated herein by reference. Also included in the present invention are oligomeric antisense compounds including antisense oligonucleotides, outer guide sequence oligonucleotides (EGS), alternating splicers, and other oligomeric compounds which hybridize to at least a portion of the target nucleic acid. As such, these oligomeric antisense compounds can be introduced in the form of single stranded, double stranded circular oligomeric hairpin compounds and can contain structural elements such as protuberances, mismatches or internal or terminal loops. In general, nucleic acids (including oligonucleotides) can be described as "DNA-like" (ie, they have 2'-deoxy sugars and generally T-bases more than U) or "RNA-type" (having sugars modified at 2 'or of 2'-hydroxyl and generally U bases more than T bases). Once they are introduced into a system, the oligomeric compounds of the invention can produce the action of one or more enzymes or structural proteins, to effect modification of the target nucleic acid.

The oligomeric compounds according to this invention may comprise from about 8 to about 80 nucleobases (that is from about 8 to about 80 bound nucleobases and / or monomeric subunits). One of ordinary skill in the art will appreciate that the invention encompasses oligomeric compounds of 8, 9, 1 0, 1 1, 12, 13, 14, 15, 16, 17, 18, 1 9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 nucleobases in length. In one embodiment, the oligomeric compounds of the invention are from 10 to 50 nucleobases in length. Someone having ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobases in length. In another embodiment, the oligomeric compounds of the invention are 12 to 30 nucleobases in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length. In a further embodiment, the oligomeric compounds of the invention have from 12 to 24 nucleobases in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleobases in length. In another embodiment, the oligomeric compounds of the invention are from 19 to 23 nucleobases in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 1 9, 20, 21, 22 or 23 nucleobases in length. A particular length for oligomeric compounds is from about 12 to about 30 nucleobases. Another particular length is from about 12 to about 24 nucleobases. A particularly suitable additional length is from about 19 to about 23 nucleobases.

Chimeric oligomeric compounds. It is not necessary for all positions in an oligomeric compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated into a single oligomeric compound or even a single monomeric subunit such as a nucleoside within a compound oligomeric The present invention also includes oligomeric compounds that are chimeric oligomeric compounds. The "chimeric" or "chimeric" oligomeric compounds in the context of this invention are oligomeric compounds that contain 2 or more chemically different regions, each made of at least one monomer unit that is, a nucleotide in the case of an oligomer based on nucleic acid.

The chimeric oligomeric compounds typically contain at least one modified region so as to confer improved resistance to nuclease degradation, improved cellular uptake, charge alteration and / or improved binding affinity for the target nucleic acid. A further region of the oligomeric compound can serve as a substrate for the enzymes that can unfold RNA-DNA or the RNA: RNA hybrids. By way of example, RNase H is a cellular endonuclease that unfolds the RNA strand of an RNA: RNA duplex. Therefore the activation of RNase H results in the cleavage of an RNA target, thereby greatly improving the efficiency of the inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, as compared to for example the phosphorothioate deoxy oligonucleotides which hybridize to the same target region. The cleavage of the RNA target can be detected routinely by gel electrophoresis and, if necessary, by associated nucleic acid hybridization techniques known in the art. Similar observations are made for chimeras that form RNA: RNA hybrids and are substrates for dsRNases. The chimeric oligomeric compounds of the invention can be formed as structures composed of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and / or oligonucleotide mimics as described above. Routinely used chimeric compounds include, but are not limited to hybrids, hemomers, spacing monomers, inverted spacing monomers, and block monomers wherein the various point and / or region modifications are selected from units of the DNA and RNA type. modified or native, and / or mimetic type subunits such as for example closed nucleic acids (LNA) (encompassing ENA ™ as described below), peptide nucleic acids (PNA), morpholinos and others. These are described below. Representative patents of the United States that teach the preparation of such hybrid structures include, but are not limited to, US: 5,013,830; 5, 149.797; 5,220,007; 5,256,775; 5,366,878; 5,403.71 1; 5,491, 133; 5,565,350; 5,632,065; 5,652,355; 5,652,356; and 5,700,922 each of which is incorporated herein by reference in its entirety.

Oligomer Imitations Another group of the oligomeric compounds for purposes of the present invention include oligonucleotide mimics. The term imitation as applied to oligonucleotides, is intended to include oligomeric compounds wherein the furanose ring or the furanose ring and the internucleotide ligation is replaced with novel groups, the replacement of furanose alone is also referred to in the art as being a sugar substitute. The heterocyclic base portion or a modified heterocyclic base portion is maintained by hybridization with a suitable target nucleic acid.

One such oligomeric compound, an oligonucleotide mimic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). PNA has favorable hybridization properties, high biological stability and are electrostatically neutral molecules. In a recent study, PNAs were used to correct aberrant splicing in a transgenic mouse model (Sazani et al., Nat. Biotechnol., 2002, 20, 1228-1233). In oligomeric PNA compounds, the sugar structure of an oligonucleotide is replaced with an amide-containing column, in particular an aminoethylglycine column. The nucleobases are directly or indirectly bonded (-C (= (O) -CH2 as shown below) to the aza nitrogen atoms of the amide portion of the column Representative United States patents teaching the preparation of oligomeric compounds of PNAs include, but are not limited to, US: 5,539,082; 5,714,331 and 5,719,262 each of which is incorporated herein by reference.PNAs can be obtained commercially from Applied Biosystems (Foster City, CA, USA). have made several modifications to the basic column of PNA since it was introduced in 1991 by Nielsen et al. (Nielsen et al., Science, 1991, 254, 1497-1 500). The basic structure is shown below: wherein Bx is a heterocyclic base portion; T4 is hydrogen, an amino protecting group, -C (O) R5, substituted or unsubstituted CiC-io alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, alkylsulfonyl, aryisulfonyl, a functional group chemical, a reporter group, a conjugated group, an α- amino acid D or L linked via the α-carboxyl group or optionally through the α-carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from the amino acids D, L or D and L mixed linked through the carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; T5 is -OH, -N (Z1) Z2, R5, α-amino acids D or L linked via the a-amino group or optionally through the α-amino group when the amino acid is lysine or ornithine or a peptide derived from amino acids D, L or D and L mixed ligated through an amino group, a chemical functional group, a reporter group or a conjugated group; Z-? is hydrogen, C 1 -C 6 alkyl, or an amino protecting group; Z2 is hydrogen, C-C6 alkyl, or an amino protecting group, -C (= O) - (CH2) nJ-Z3, an a-amino acid D or L linked via the a-carboxyl group or optionally through of the group? -amino when the amino acid is aspartic acid or glutamic acid or a peptide derived from amino acids D, L or D and L mixed ligated through a carboxyl group; Z3 is hydrogen, an amino-protecting group, -alkyl C -? - C6, -C (= O) -CH3, benzyl, benzoyl, or - (CH2) n-N (H) Z1; each j is O, S or NH; R5 is a carbonyl protecting group; and n is from 7 to 79. Another class of oligonucleotide mimic that has been studied is based on a morpholino linked units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring.

Several linking groups have been reported that bind the monomer units of morpholino to a morpholino nucleic acid. A class of linking groups has been selected to give a nonionic oligomeric compound. Non-ionic morpholino-based oligomeric compounds are less likely to have undesirable interactions with cellular proteins. Morpholino-based oligomeric compounds are nonionic imitations of oligonucleotides that are less likely to form undesirable interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41 (14), 4503-451 0). Oligomeric compounds based on morpholino have been studied in zebrafish embryos (see, Genesis, volume 30, edition 3, 200 and Heasman, J., Dev. Biol., 2002, 243, 209-214). Additional studies of oligomeric compounds based on morpholino have also been reported (see, Nasevicius et al., Nat. Genet., 2000, 26, 216-220; and Lacerra et al., Proc. Nati. Acad Sci., 2000, 97). , 9591 t9596). Morpholino-based oligomeric compounds are described in U.S. Patent 5,034,506 issued July 23, 1991. The morpholino class of oligomeric compounds has been prepared by having a variety of different linking groups that bind to the monomeric subunits. Morpholino nucleic acids having a variety of different linking groups (L2) which bind to the monomeric subunits have been prepared. The basic formula is shown below: wherein: Ti is hydrogen, hydroxyl, a protected hydroxyl, a linked nucleoside compound or a linked oligomer; T5 is hydrogen, or a phosphate, phosphate derivative, a linked nucleoside compound or a linked oligomeric compound; and L2 is a linking group which can vary from chiral to non-chiral from charged to neutral (US Patent 5, 166,315 describes ligatures including -O-P (= O) (N (CH3) 2) -0; U.S. Patent 5,034,506 describes intermorpholino ligatures that are non-chiral such as for example: -S (= O) -X- wherein X is NH, NCH3, O, S, or CH2; -C (= Y) -0- where Y is O or S; -S (= O) (OH) -CH2-; -S (= O) (OH) -N (R) -CH2- wherein R is H or CH3; and US Pat. No. 5,145,444 describes chiral intermorpholino ligatures containing phosphorus such as for example -P (= O) (-X) -O- wherein X is F, CH2R, S-CH2R or NR ^ and R, Ri and R2 is H, CH3, or some other portion that does not interfere with the specific hydrogen bond of the base and n is from 7 to about 79. An additional oligonucleotide mimic class is referred to as cyclohexenyl nucleic acids (CeNA) . The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexyl ring. The phosphoramidite monomers protected with CeNA DMT have been prepared and used for the synthesis of oligomeric compounds following a classical phosphoramidite chemistry. The oligonucleotide compounds of fully modified and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see, Wang et al., J. Am. Chem., Soc, 2000, 122, 8595-8602). In general, the incorporation of CeNA monomers into a DNA strand increases its stability from a DNA / RNA hybrid. CeNA oligoadenylates form complexes with RNA and DNA complements with stability similar to native complexes. The study of the structures that incorporate CeNA in natural nucleic acid structures is demonstrated by NMR and circular dichroism to advance with an adaptation of simple conformation. Additionally, the incorporation of CeNA into a sequence targeting RNA was stable for serum and can activate the E. Coli RNase resulting in the cleavage of the target RNA strand. The general formula of CeNA is shown below: wherein each Bx is a heterocyclic base portion; L3 is a bond between cyclohexenyl such as for example a phosphodiester or a phosphorothioate linkage; Ti is hydrogen, hydroxyl, a protected hydroxyl, a linked nucleoside compound or a linked oligomeric compound; T2. is hydrogen, or a phosphate, phosphate derivative, a linked nucleoside compound or a linked oligomeric compound. Another kind of oligonucleotide mimic (anhydrohexitol nucleic acid) can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, Bioorg, Med. Chem Lett., 1 999, 9, 1563-1566) and would have the general formula: each of Bx is a heterocyclic base portion; L is an inter-anhydrohexitol ligation such as, for example, a phosphodiester or a phosphorothioate linkage; Ti is hydrogen, hydroxyl, a protected hydroxyl, a linked nucleoside compound or a linked oligomeric compound; T2 is hydrogen, or a phosphate, phosphate derivative, a linked nucleoside compound or a linked oligomeric compound. A further modification includes bicyclic sugar moieties such as "Enucleated Nucleic Acids" (LNAs) in which the 2'-hydroxyl group of the ribosyl sugar ring is linked to the 4'-carbon atom of the sugar ring with which is formed in the ligation of 2'-C, 4'-oxymethylene to form the bicyclic portion of sugar (reviewed in Elayadi et al., Curr Opinion I nvens, Drugs, 2001, 2, 558-561; Braasch et al. ., Chem. Biol., 2001, 8, 1-7, and Orum et al., Curr, Mol. Ther. Opinion, 2001, 3,239-243, see also US Patents 6,268,490 and 6,670,461). The ligation can be a group (-CH2-) x that bypasses the oxygen atom 2 'and the carbon atom 4' where if x = 1 the term LNA is used, if x = 2 the term ENA ™ is used ( Singh et al., Chem. Commun., 1998, 4, 455-456; ENA ™: Morita et al., Bioorganic Medical Chemistry, 2003 1 1, 221-1-2226). Thus, "ENA ™" is a non-limiting example of an LNA. LNA and other bicyclic sugar analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm = +3 to + 10C), stability towards 3 'exonucleolytic degradation and good solubility properties. The LNAs are commercially available from ProLigo (Paris, France and Boulder, CO EUA). The basic structure of an LNA that has a simple ligature CH2 in the bicyclic ring system is shown below. It is merely illustrative of one type of LNA. wherein each of Ti and T2 is independently hydrogen, a hydroxyl protecting group, a linked nucleoside, or a linked oligomeric compound and each Zi, is a nucleoside binding group such as for example phosphodiester or phosphorothioate. An isomer of LNA that has also been studied is alpha-L-LNA that has been shown to have superior stability against a 3'-exonuclease (Friden et al., Nucleic Acid Research, 2003, 21 6365-6372). The alpha-L-LNAs were incorporated into antisense spacing monomers and chimeras that exhibit potent antisense activity. The structure of alpha-L-LNA is shown below: Another similar portion of bicyclic sugar that has been prepared and studied has the bridge that goes from the 3'-hydroxyl group by means of a single methylene group to the carbon 4'-atom of the sugar ring, whereby a 3-hydroxy bond is formed. '-C4-C-oxymethylene (see US patent 6,043,060). The conformations of the LNAs determined by 2D NMR spectra, has shown that the closed orientation of the LNA nucleotides, both in the single-stranded and in the duplex LNA, limits the phosphate column in such a way as to introduce the population of the N-type conformation (Patersen et al., J. Mol. Recognit, 2000, 13, 44-53). These conformations are associated with improved stacking of the nucleobase (Wengel et al., Nucleoside Nucleotides, 1999, 18, 1365-1370). LNA has been shown to form unbeatably stable duplexes of LNA: LNA (Koshkin et al., J. Am. Chem. Soc, 1998, 120, 13252-13253). The hybridization of LNA: LNA is shown to be the largest thermally stable nucleic acid-type duplex system and the mimic character of the RNA of the LNA is established at the duplex level. The introduction of three (3) monomers of LNA (T or A) significantly increased the melting points (Tm = + 15 / + 1 1) towards the DNA complements. The universality of LNA-mediated hybridization has been enhanced by the formation of LNA duplex: LNA unbeatably stable. The mimicking of LNA RNA is reflected with respect to the N-type conformational restriction of the monomers and the secondary structure of the LNA: RNA duplex. LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities. The circular dichroism (CD) spectra show that the duplexes that are involved in the completely modified LNA (sp. LNA: LNA) resemble a duplex RNA-RNA, in a form A. The nuclear magnetic resonance (NMR) test of an LNA duplex: LNA confirmed the 3'-endo conformation of the LNA monomer. The recognition of double-stranded DNA has also been shown to suggest the invasion of the strand by LNA. Studies of mismatched sequences show that the LNAs obey the Watson-Crick base pairing rules with a generally improved selectivity compared to the corresponding unmodified reference strands. DN / LNA chimeras have been shown to efficiently inhibit gene expression when targeting a region diversity (5 'untranslated region, region of the start codon or coding region) within the luciferase RNA (Braasch et al. , Nucleic Acids Research, 2002, 30, 5160-5167).

The novel types of oligomeric LNA compounds as well as LNAs are useful in a wide range of therapeutic diagnostic applications. Among these are antisense applications, PCR applications, strand displacement oligomers, substrates for nucleic acid polymerases, and generally as nucleotide-based drugs. Potent non-toxic antisense oligonucleotides containing LNA have been described (Wahlestedt et al., Nati, Acid, Sci. U.S.A., 2000, 97, 5633-5638). The authors have shown that LNAs confer various desirable properties to antisense compounds. The LNA / DNA copolymers did not readily degrade in blood serum and cell extracts. The LNA / DNA copolymers showed a potent antisense activity in assay systems as diverse as the receptor coupled to the G protein signaling in living rat brain and the detection of reporter genes in Escherichia coli. Lipofectin-mediated efficient delivery of LNA has also been achieved in living human breast cancer cells. Successful additional in vivo studies involving LNAs have shown the disappearance of rat delta opioid receptor without toxicity (Wahlestedt et al., Proc. Nati, Acad. Sci., 2000, 97, 5633-5638) and in another study showed a blockage of translation of the large subunit of RNA II polymerase (Fluiter et al., Acid Res., 2003, 31, 953-962). The synthesis and preparation of the monomers of LNA adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil together with their oligomerization and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54 , 3607-3630). The LNAs and the preparation thereof are also described in WO 98/339352 and 99/14226. The first LNA analogs, LNA phosphorothioate and 2'-thio-LNA, have also been prepared (Kumar et al., Bioorg, Med. Chem. Lett., 1 998, 8, 221 9-2222). The preparation of the enucleated nucleoside analogs containing oligodeoxyribonucleotide duplexes as substrates for the nucleic acid polymerases have also been described (Wengel et al., PCT International Application WO 03/020739, and WO 99/14226). Additionally, the synthesis of 2'-amino-LNA, an oligonucleotide analogue of high affinity restricted in the novel conformation together with an extension has been described in the art (Singh et al., J. Org Chem., 1998, 63, 10035 -1 0039). In addition, the 2'-amino- and 2'-methylamino LNAs have been prepared, and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported. Another imitation of oligonucleotide related to the present invention that has been prepared and studied is the threose nucleic acid. This imitation oligonucleotide is based on the threose nucleosides instead of the ribose nucleosides and has the general structure shown below: The initial interest in (3'2 ') - alpha-L-nucleic acid (TNA) addresses the question of whether a DNA polymerase would exist that would copy the TNA. It was found that certain DNA polymerases can copy limited extensions of a TNA template (reported in C & EN / January 13, 2003). In another study, it was determined that TNA can do pairing of Watson-Crick antiparallel bases with complementary oligonucleotides of DNA, RNA, and TNA (Chaput et al., Am. Chem. Soc, 2003, 125, 856-857). . In one study, the (3'-2 ') - alpha-L-threo nucleic acid was prepared and compared with the 2' and 3 'amidate analogs (Wu et al., Organic Letters, 2002, 4 (8), 1279-1282). The amidate analogues were shown to bind to RNA and DNA with a force compatible to that of RNA / DNA. Additional oligonucleotide mimics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown) (See Steffens et al., Helv. Chim. Acta, 1 997, 80, 2426-2439; Steffens et al., J. Am. Chem. Soc, 1999, 121, 3249-3255; Rennenberg et al. , J. Am. Chem. Soc, 2002, 124, 5993-6002 and Rennenberg et al., Nucleic acids res. , 2002, 30, 2751-2757). These modified nucleoside analogs have been oligomerized using the phosphoramidite method and the resulting oligomeric compounds containing the tricyclic nucleoside analogs have demonstrated increasing thermal stabilities (Tm) when they hybridize to DNA, RNA and themselves. Oligomeric compounds containing bicyclic nucleoside analogs have shown thermal stabilities that approach those of the DNA duplexes. Another class of oligonucleotide mimics is referred to as the phosphonomonoester nucleic acids which incorporate a phosphorus group in the column. This kind of oligonucleotide mimicry is reported to have useful physical and biological and pharmacological properties in the areas of inhibition of gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for acid detection Nucleic and auxiliary for use in molecular biology. The general formula (for definitions of Markush variables see: U.S. Patents 5,874,553 and 6, 127,346 which are incorporated herein by reference in their entirety) is shown below.

Additional imitations of oligonucleotides related to the present invention have been prepared in which a cyclobutyl ring replaces the naturally occurring furanosyl ring.

Modified ligatures between nucleosides. Specific examples of the oligomeric antisense compounds useful in this invention include oligonucleotides that contain ligatures between modified nucleosides for example that do not occur naturally. As defined in this specification, oligonucleotides having modified ligatures between nucleosides include ligatures between nucleosides that retain a phosphorus atom and ligatures between nucleosides that do not have a phosphorus atom. For the purposes of this specification and as sometimes referred to in the art, modified oligonucleotides that do not have a phosphorus atom in their column between nucleosides can also be considered to be oligonucleotides. Modified oligonucleotide columns containing a phosphorus atom therein include for example phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and phosphonates. chirals, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkyl phosphotriesters, phosphonoacetate and thiophosphonoacetate (see Sheehan et al., Nucleic Acids Research, 2003, 31 (14), 4109-41 18 and Dellinger et al. ai., J. Am. Chem. Soc, 2003, 125, 940-950), selenophosphates and boronophosphates having normal 3'-5 'ligations, analogs linked in 2'-5' of these, and those having a polarity inverted where one or more ligatures between nucleotides is 3 'to 3', 5 'to 5' or the ligature 2 'to 2'. A ligature between modified nucleosides containing phosphorus is the ligature between nucleosides of phosphorothioate which is ligated in a 3'-5 'linkage. Oligonucleotides having an inverted polarity comprise a simple 3 'to 3' linkage in the 3 'nucleotide ligation more than 3' that is, a simple inverted nucleoside residue that may not be basic (the nucleobase is missing or has a place in it). hydroxyl group). Also included are various salts, mixed salts and free acid forms. N3'-P5'-phosphoramidates have been reported to show a high affinity towards a complementary RNA strand and nuclease resistance (Gryaznov et al., J. Am. Chem. Soc, 1 994, 16, 3143-3144 ). The N3'-P5'-phosphoramidates have been studied with some in vivo success to specifically monitor the expression of the c-myc gene (Skorski et al., Proc. Nati, Acad. Sci., 1997, 94, 3966-3971; Faira et al., Nat. Biotechnol., 2001, 19, 40-44). Representative United States patents teaching the preparation of the foregoing phosphorus-containing ligatures include, but are not limited to, US patents: 3,687,808; 4,469,863 4,476,301; 5,023,243 5, 177, 196; 5,188,897; 5,264,423; 5,276,019 5,278,302; 5,286,717 5,321, 131; 5,399,676; 5,405,939; 5,453,496 5,455,233; 5,466,677 5,476,925; 5,519, 126; 5,536,821; ,541, 306; 5.550, 1 1 1; 5,563,253, 5,571, 799; 5,587,361; 5, 194.599; ,565,555; 5,527,899; 5,721, 218; 5,672,697 and 5,625,050 each of which is incorporated herein by reference. In some embodiments of the invention, the oligomeric compounds having one or more ligatures between phosphorothioate nucleosides and / or a particular heteroatom -CH2-NH-O-CH2-, -CH2-N (CH3) -O-CH2- ( known as methylene (methylimino) or MMI column), -CH2-ON (CH3) -CH2, -CH2-N (CH3) -N (CH3) -CH2 and -ON (CH3) -CH2-CH2- (wherein the ligature between native phosphodiester nucleotides is represented as -OP (= O) (OH) -O-CH2-). Ligatures between nucleosides of the MMI type is described in the aforementioned US Patent 5,489,677. Ligatures between amide nucleosides are described in the aforementioned U.S. Patent 5,602,240.

Modified oligonucleotide columns that do not include a phosphorus atom therein have columns that are formed by ligatures between short chain alkyl or cycloalkyl nucleosides, ligatures between alkyl or cycloalkyl nucleosides and mixed heteroatom, or one or more heteroatomic nucleoside linkages or heterocyclics of short chain. These include those that have morpholino ligatures (formed in part from the sugar portion of a nucleoside); columns of siloxane, sulfur, sulphoxide and sulfone columns; formacetyl and thioformacetyl columns; methylene, formacetyl and thioformacetyl columns; riboacetyl columns; columns containing alkene; sulfamate columns; methyleneimino and methylenehydrazino columns; sulfonate and sulfonamide columns; amide columns and others that have mixed parts of N, O, S and CH2 components. Representative patents of the United States that teach the preparation of oligonucleosides include, but are not limited to: 5,034,506; 5, 166.315; 5, 185.444; 5,214, 134; 5,216, 141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541, 307; 5,561, 225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5.61 8.704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439 each of which is incorporated herein by reference.

Modified sugars. The oligomeric compounds of the invention may also contain one or more sugar portions otherwise modified or substituted. The related sugar and ribosyl portions are routinely modified at any reactive position not involved in the ligation. Thus, a suitable position for a sugar substituent group is the 2 'position which is not commonly used in the native ligature between 3' to 5 'nucleosides. Other suitable positions are the 3 'and 5' terminations. The sugar positions 3 'are open to modification when the bond between 2 adjacent sugar units is a 2', 5 'link. Sugar substituent groups include: OH; F; O, S or N-alkyl; O, S, or N-alkenyl; O, S or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be C- alkyl. up to C10 substituted or unsubstituted or C2 to C10 alkenyl and alkynyl. Particularly suitable are O ((CH2) nO) mCH3 l O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2 and O (CH2) nON ((CH2) nCH3) 2, where n and m are from 1 to about 10. Other suitable oligonucleotides comprise a sugar substituent group selected from: alkyl d to C-lower io, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH , SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkyl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleavage group, a reporter group, a intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide and the other substituents have similar properties. A modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE (Martin et al., Helv. Chim. Acta, 1995, 78, 486 -504) that is, an alkoxyalkoxy group Additional modifications include 2'-dimethylaminooxyethoxy, this is a group O (CH2) 2ON (CH3) 2 also known as 2'-DMAOE, as described in the examples below, 2 ' -dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), that is 2'-O- (CH2) 2-O- (CH2) 2N (CH3) 2 and N-methylacetamide (also referred to as NMA, 2'-O-CH2-C (= O) -N (H) CH3). Other sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-OCH2CH2CH2NH2), alkyl (-CH2-CH = CH2), -O-alio (-O-CH2-CH = CH2) and fluorine (F) The 2'-sugar substituent groups can be in the arabino position (above) or the ribo position (below) A 2'-arabino modification is 2'-F (see: Loe et al., Biochemistry, 2002, 41, 3457-3467). Similar modifications can also be made at other positions in the oligomeric compound, particularly the 3 'position of the sugar in the nucleoside at the 3' terminus or in the 2'-5 'linked oligonucleotides and the 5' position of the 5 'terminal nucleotide. Oligomeric compounds may also have sugar mimics such as cyclobutyl portions in place of pentofuranosyl sugar. Representative patents of the United States that teach the preparation of such modified sugar structures include, but are not limited to, US patents: 4,981, 957; 5,118,800; 5,319,080 5,359,044 ,393,878; 5,446, 1 37; 5,466,786; 5,514,785; 5,519, 1 34 5,567.81 1 5,576,427; 5,591, 722; 5,597,909; 5,610,300; 5,627,053 5,639,873 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,700,920 and 6,147,200 each of which is incorporated herein by reference in its entirety. Additional representative sugar substituent groups include groups of the formula la or: wherein: Rb is O, S or NH; Rd is a simple link, O, S or C (= O); Re is d-C10 alkyl) N (Rk) (Rm), N (Rk) (R "), N = C (Rp) (Rq), N = C (Rp) (Rt) or has the formula I 1; ma R p and R q are each independently hydrogen or d-C 10 alkyl; Rt is -Rx-Ry; each of Rs, Rt, Ru and Rv is independently hydrogen, C (O) Rw, substituted or unsubstituted C-10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, alkylsulfonyl, aryisulfonyl , a chemical functional group or a conjugated group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; or optionally, Ru and Rv, together form a phthalimido moiety with the nitrogen atom to which they are bound; Rw is independently, substituted or unsubstituted d-C10 alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2- (tpmethylsilyl) -ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, isobutyryl, phenyl or aryl; Rk is hydrogen, a nitrogen protecting group or Rx-Rg; Rx is a bond or a linked portion; Ry is a chemical functional group, a group conjugated a solid support medium; each of Rm and Rn is, independently H, a nitrogen protecting group, substituted or unsubstituted d-C10 alkyl, substituted or unsubstituted C2-do alkenyl, substituted or unsubstituted C2-C10 alkynyl, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl; NH3 +, N (RU) (RV) > guanidino and acyl where the acyl is an amide acid or an ester; or Rk and Rm, together, are a nitrogen protecting group, are together in a ring structure that optionally includes an additional heteroatom selected from N and O is a chemical functional group; each of Rz is independently H, alkyl d-C8, haloalkyl d-C, C (= NH) N (H) RU, C (= O) N (H) Ru or OC (= O) N (H) Ru; Rf, Rg and Rh comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein the heteroatoms are selected from oxygen , nitrogen and sulfur and wherein the ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic; Rj is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl has 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms , N (Rk) (Rm) ORk, halo, SRk or CN; ma is 1 to about 10; each of mb, is independently 0 or 1; me is 0 or an integer from 1 to 10; md is an integer from 1 to 10; it is from 0, 1 or 2; and with the proviso that when I am 0, md is greater than 1.

Representative substituent groups of Formula I are described in U.S. Patent No. 6, 172,209, entitled "Closed 2'-Oxyetoxy Oligonucleotides", which are incorporated herein by reference in their entirety. Representative cyclic substituent groups of the Formula II is described in U.S. Patent No. 6,271, 358 entitled "2 'Oligomeric Compounds Directed by RNA Which Are Pre-Organized Conformationally" incorporated herein by reference in its entirety. Sugar substituent groups include O ((CH2) nO) mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2 and O (CH2) nON ((CH2) nCH3)) 2, where n and m are from 1 to about 10. The representative guanidino substituent groups shown in formula 11 are described in the US Pat. US No. 6,593,466 entitled "Functionalized Oligomers", filed July 7, 1999, which is incorporated herein by reference in its entirety. Representative acetamido substituent groups are described in US Patent No. 6,147,200 which is incorporated herein by reference in its entirety. Representative dimethylaminoethyloxyethyl substituent groups are described in International Publication No. WO00 / 08044895, entitled "Oligomeric 2'-O-Dimethylaminoethyloxyethyl Compounds" which is incorporated herein by reference in its entirety. The oligomeric compounds of the invention may also comprise 2 or more of the same or chemically different modifications in the ligation between nucleosides and sugar, base, in any combination. The term "chemically distinct" as used herein, means different chemical entities either completely or partially different. For example, an oligomeric compound can comprise a 2'-fluoro and 2'-MOE modification. These 2 modifications are considered to be chemically different entities located within the same molecule. Modified nucleobases / nucleobases that occur naturally Oligomeric compounds can also include modifications or substitutions of nucleobases (often referred to in the art simply as the base portion or heterocyclic base portion). As used herein, the unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the bases pyrimidine thymine (T), cytosine (C) and uracil (U). Modified nucleobases also referred to herein as heterocyclic base portions include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other derivatives alkyl adenine and guanine, 2-propyl such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, -propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C = C-CH 3) uracil and cytosine and other alkynyl derivatives of the bases of pyrimidine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other substituted adenines 8 and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other substituted uracils and cytosines, 7-methylguanine and 7-methyl adenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Heterocyclic base portions may also include those in which the purine or pyrimidine base is replaced with other heterocycles for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those described in U.S. Patent No. 3,687,808 those described in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. I. , ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte CEIME, International Edition, 1991, 30, 613, and those described by Sanghvi, Y.S. , Chapter 1 5, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., ed. , CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include substituted pyrimidines, 6-azapyrimidines and substituted N-2, N-6 and O-6 purines including 2-aminopropyladenine, 5-propynylaurate and 5-propynylcytosine. Substitutions of 5-methylcytosine have been shown to increase the stability of the nucleic acid duplex by 0.6-1.2 ° C (Sanghvi, Y.S. , Crooke, S.T. and Lebleu, B., eds. , Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are currently suitable substitutions of bases, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. The oligomeric compounds of the present invention may also include heterocyclic polycyclic compounds in place of one or more heterocyclic base portions. Various tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to an objective strand. The most studied modifications are directed to guanosines, so they have been called fasteners G or cytidine analogs. Many of these polycyclic heterocyclic compounds have the general formula: Representative cytosine analogs that link 3 hydrogens with a guanosine in a second strand includes 1,3-diazafenoxazin-2-one (R10 = O, Rn-R14 = H) (Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846), 1,3-diazaphenothiazain-2-one (R? 0 = S, Rn-R14 = H), (Lin, K.-Y., Jones, RJ, Matteucci, MJ Am Chem Soc. 1995, 1 17, 3873-3874) and 6,7,8,9-tetrafluoro-1,3-diazafenoxazin-2-one (R10 = O, Rn-R14 = F) (Wang, J.; Lin , K.-Y., Matteucci, M. Tetrahedron Lett., 1998, 39, 8385-8388). These modifications of bases which are shown to hybridize with the complementary guanine are incorporated into the oligonucleotides and the latter is also shown to hybridize with the adenine and to improve the thermal stability of the helix through prolonged stacking interactions (see also Patent Application. of US entitled "Nucleic Acids of Modified Peptides" filed May 24, 2002, serial number 10 / 155,920, and the U.S. patent application entitled "Chimeric Oligonucleotides Resistant to Nucleases" filed May 24, 2002, number of Series 10 / 013,295, both of which are hereby incorporated by reference in their entirety Additional helix stabilizing properties have been observed when a cytosine substitute / analog has an aminoethoxy moiety attached to scaffold 1,3-diazafenoxazine- Rigid 2-one (R10 = O, Rn = -O- (CH2) 2-NH2, R-.2-? 4 = H) (Lin, K.-Y.; Matteucci, MJ Am. Chem. Soc. 1998 , 120, 8531-8532) Linkage studies demonstrated that a simple incorporation can improve the binding affinity of a model oligonucleotide with its complementary target DNA or RNA with a? Tm of up to 18 ° relative to 5-methyl cytosine (dC5mT ) which is the highest known affinity improvement for a simple modification, until now. On the other hand, the gain in helical stability does not compromise the specificity of the oligonucleotides. The Tm data indicate even greater discrimination between the unmatched and perfectly matched sequences compared to dC5me- It was suggested that the amino group with lateral connection serves as an additional hydrogen bond donor to interact with the Hoogsteen front nominally on a 06 complementary guanine with which 4 hydrogen bonds are formed. This means that the improved affinity of the fastener G is mediated by the combination of prolonged base stacks and an additional specific hydrogen bond. Additional tricyclic heterocyclic compounds and methods of uses thereof which are related to the present invention are disclosed in U.S. Patent 6,028, 183 and U.S. Patent 6,007,992, the contents of both are hereby incorporated in their entirety. The improved binding affinity of the phenoxazine derivatives together with their non-compromised sequence specificity makes them valuable analogs of nucleobases for the development of more potent antisense-based drugs. In fact promising data have been derived from in vitro experiments demonstrating that phenoxazine substitutions containing heptanucleotides that can activate RNaseH, improving cellular uptake and show improved antisense activity (Lin, KY, Matteucci, MJ Am. Chem. Soc. 1998, 120, 8531-8532). The improvement in activity was even more pronounced in the case of fastener G, as a simple substitution was shown to significantly improve the in vitro potency of the 20-mer oligomers of 2'-deoxyphosphorothioate (Flanagan WM; Wolf, JJ; Olson, P. Grant, D., Lin, K.-YM, Wagner, RW, Matteucci, M. Proc. Nati, Acad. Sci. USA, 1999, 96, 3513-3518). However, to optimize the design of the oligonucleotides and to better understand the impact of these heterocyclic modifications on biological activity, it is important to evaluate their effect on the nuclease stability of the oligomers. Additional modified polycyclic heterocyclic compounds useful as heterocyclic bases are disclosed in but not limited to, US Patent 3,687,808 noted above as well as documents 4,845,205; 5, 130,302; 5, 134.066; 5, 175.273; 5,367,066; 5,432,272; 5,434,257; 5,457, 187; 5,459,255; 5,484,908; 5,502, 177; 5,525.71 1; 5,552,540; 5,587,469; 5,594, 121; 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096 and 5,681, 941 and U.S. Patent Application Serial No. 09 / 996,292 filed on November 28, 2001, some of which are incorporated herein by reference. Conjugates Oligomeric compounds used in the compositions of the present invention can also be modified to have one or more portions or conjugates to improve the activity, cellular distribution or cellular absorption of the resulting oligomeric compounds. In one embodiment, such modified oligomeric compounds are prepared by covalently attaching conjugates to functional groups such as hydroxyl or amino groups. Conjugated groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that improve the pharmacodynamic properties of oligomers and groups that improve the pharmacokinetic properties of oligomers. Typical conjugated groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acredine, fluorescein, rhodamines, coumarins and dyes such as Cy3 and Alexa. Groups that improve pharmacodynamic properties in the context of this invention include groups that improve the uptake of oligomers, improve resistance to oligomer degradation, and / or strengthen specific sequence hybridization with RNA. Groups that improve pharmacokinetic properties in the context of this invention include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugated groups are described in International Patent Application PCT / US92 / 09196, filed on October 23, 1992, the full disclosure of which is incorporated herein by reference. Portions of conjugates include, but are not limited to, lipid portions such as a portion of cholesterol (Letsinger et al., Proc. Nati, Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al. al., Bioorg, Med. Chem. Let., 1994, 4, 1053-1060), a thioether for example, hexyl-S-tritylthio (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306 -309; Manoharan et al., Bioorg, Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucí Acids Res., 1992, 20, 533-538), an aliphatic chain for example dodecanediol or undecyl residue (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al. ., Biochimie, 1993, 75, 49-54), a phospholipid for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-gIicero-3-H-phosphonate (Manoharan et al. ., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucí Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene chain. len glycol (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or a portion of octadecylamine or hexylamino-carbonyl-oxycholesterol (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). The oligomeric compounds of the invention can also be conjugated to active drug substances for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) - propanoprofen, carprofen, dansilsarcosine, acid 2,3 , 5-triiodobenzoic acid, flufenamic acid, folic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. The oligonucleotide drug conjugates and their preparation are described in United States Patent Application 09/334, 130 (filed June 15, 1999) which is incorporated herein by reference in its entirety. Representative patents of the United States that teach the preparation of such oligonucleotide conjugates include, but are not limited to, 4,828,979; 4,948,882 5,218, 105,525,465; 5,541, 313; 5,545,730; 5,552,538; 5,578,717 5,580,731 5,580,731; 5,591, 584; 5, 109, 124; 5,180,802; 5,138,045 5,414,077 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044 4,605,735 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263 4,876,335 4,904,582; 4,958,013; 5,082, 830; 5, 1, 12,963; 5,214,136 5,082,830 5,122,963; 5,214, 136; 5,245,022; 5,254,469; 5,258,506 5,262,536 5,272,250; 5,292,873; 5,317,098; 5,371, 241; 5,391, 723 5,416,203, 5,451, 463; 5,510,475; 5,512,667; 5,514,785; 5,565,552 5,567,810 5,574, 142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,928 and 5,688,941 each of which is incorporated herein by reference. Oligomeric compounds used in the compositions of the present invention can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of the single-stranded oligomeric compounds or to one or more of the 3 'or 5' ends. of the single-stranded or double-stranded compound to improve properties such as, for example, the stability of the nuclease. Closing structures are included in the stabilizing groups. By "closure structure or terminal closure portion" means chemical modifications that have been incorporated in the termination of the oligonucleotides (see for example Wincott et al., WO 97/26270, which is incorporated herein by reference). These terminal modifications protect oligomeric compounds having terminal nucleic acid molecules from exonuclease degradation and can aid in delivery and / or localization within a cell. The closure may be present at the 5 'end (5' end) or at the 3 'end (3' end) or may be present at both endings. The closure structure is not to be confused with the "5 'closing inverted methylguanosine" present at the 5' end of the native mRNA molecules. In the non-limiting examples, the 5 'closure includes an inverted non-basic residue (portion), a 4', 5'-methylene nucleotide; 1 - (beta-D-eritrofuranosi! O) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide; 1, 5-anhydrohexitol nucleotide; L nucleotides; alpha nucleotides; nucleotide of modified base; Phosphorodithioate binding; threo-pentafuranosyl nucleotide; 3 ', 4'-dry acyclic nucleotide; 3,4-dihydroxybutyl acyclic nucleotide; 3,5-dihydroxypentyl acyclic nucleotide, inverted portion of nucleotide 3'-3 '; non-basic portion inverted 3'-3 '; inverted nucleotide portion 3'-2 '; inverted non-basic portion 3'-2 '; 1, 4- phosphate butanediol; 3'-phosphoramidate; hexyl phosphate; aminohexyl phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodiotioate; or portions of bridged or non-bridged methylphosphonate (for further details see Wincott et al., International PCT Application No. WO 97/36270 which is incorporated herein by reference). The 3 'closing structures of the present invention include for example the 4', 5'-methylene nucleotide; nucleotide of 1 - (beta-D-etitrofuranosyl); 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; 1,3-diamino-2-propyI phosphate; 3-aminopropyI phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1, 5-anhydrohexitol nucleotide; nucleotide L; alpha nucleotide; nucleotide of modified base; phosphorodithioate; threo-pentafuranosyl nucleotide; 3 ', 4'-dry acyclic nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, inverted portion of nucleotide 5'-5 '; non-basic portion inverted 5'-5 '; 5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate; d'amino; 5'-phosphoramidate with bridging or without bridging, phosphorothioate and / or phosphorodithioate, methylphosphonate with bridging or without bridging or 5'-mercapto moieties (for further details see Beaucage and Tyer, 1993, Tetrahedro 49, 1925 which is incorporated herein) as reference). In addition, the 3 'and 5' stabilizing groups that can be used to close one or both ends of an oligomeric compound to impart nuclease stability include those described in WO 03/004602 published January 16, 2003.

Modifications 3'-Endo The terms used to describe the conformational geometry of homoduplex nucleic acids are Form A for RNA and Form B for DNA. The respective conformational geometry for the RNA and DNA duplexes was determined from an X-ray diffraction analysis of nucleic acid fibers (Arnott and Hukins, Biochem, Biophys, Res. Comm., 1970, 47, 1504). In general, the RNA: DNA duplexes are more stable and have higher melting temperatures (Tm) than the DNA'.DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, NY. Lesnik et al., Biochemistry, 1995, 34, 10807-1 0815; Conté et al., Nucleic Acids Res., 1 997, 25, 2627-2634). The increasing stability of RNA has been attributed to various structural features, most notably the improved base stacking interactions resulting from an A-shaped geometry (Seale et al., Nucleic Acids Res., 1993, 21, 2051-2056). . The presence of the 2 'hydroxyl in RNA, inclines the sugar towards the C3' endo fold, this is also designated as the Northern fold that causes the duplex to favor the geometry in the form of A. In addition, the 2 'hydroxyl groups of the RNA can form a network of water-mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al., Biochemistry, 1 996, 35, 8489-8494). On the other hand, deoxynucleic acids prefer a C2'-endo sugar fold, this is also known as the Southern fold, which is believed to impart a less stable geometry in the form of B (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, NY). As used herein, the B-shaped geometry includes the C2'-endo fold and the O4'-endo fold. This is consistent with Berger, et al. , Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that when considering the furanose conformations that give rise to the B-shaped duplexes, consideration should be given to the contribution of the O4'-endo fold. Hybrid DNA: RNA duplexes are usually less stable than pure RNA: RNA duplexes and depending on their sequence can be more or less stable than DNA: DNA duplexes (Searle et al., Nucleic Acids Res. 1 993, 21, 2051-2056). The structure of a hybrid duplex is intermediate between the geometries of form A and B which can result in poor stacking interactions (Lañe et al., Eur. J. Biochem., 1993, 215, 297-306; Fedoroff et al. , J. Mol. Biol .., 1 993, 233, 509-523; González et al., Biochemistry, 1995, 34, 4969-4982; Horton et al., J. Mol. Biol., 1 996, 264 , 521-533). The stability of the duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense mechanisms including RNAse H, RNAi or some mechanisms that require the binding of an oligomeric compound to an RNA target strand. In the case of effective antisense inhibition of the mRNA, it requires that the antisense compound have a sufficiently high affinity for binding to the mRNA. Otherwise, the desired interaction between the oligomeric antisense compound and the target strand of mRNA will occur infrequently which results in decreased efficacy. A method routinely used to modify sugar folding is the substitution of sugar at the 2 'position with a substituent group that influences the sugar geometry. The influence on the conformation of the ring depends on the nature of the substituent at the 2 'position. Different substituents have been studied to determine their effect on sugar folding. For example, 2 'halogens have been studied which show that the fluoro 2' derivative shows the largest population (65%) of the C3'-endo form, and the 2 'iodine shows the lowest population (7%). The populations of adenosine (2'-OH) against deoxyadenosine (2'-H) are 36% and 19% respectively. Additionally, the effect of the 2'-fluoro group of the adenosine dimers (2'-deoxy-2'-fluoroadenosine-2'-deoxy-2'-fluoro-adenosine) is further correlated with the stabilization of the stacked conformation. As expected, the relative duplex stability can be improved by the replacement of the 2'-OH groups with 2'-F groups with which the C3'-endo population increases. It is assumed that the highly polar nature of the 2'-F bond and the extreme preference for the C3'-endo fold formation can stabilize the stacked conformation in a duplex of form A. the data of UV hypochromicity, circular dichroism and 1 H NMR also indicate that the degree of stacking decreases when the electronegativity of the halo substituent decreases. Additionally, the spherical volume at the 2 'position of the sugar portion is better accommodated in a duplex of form A than in a duplex of form B. Thus, a 2' substituent on the 3 'end of a dinucleoside monophosphate is believed to be that exerts diverse effects in the conformation of stacking: steric repulsion, preference of furanosa folds, electrostatic repulsion, hydrophobic attraction and capacity of hydrogen bonding. These substituent effects are believed to be determined by the molecular size, electronegativity and hydrophobic capacity of the substituent. The melting temperatures of the complementary strands are also increased with the 2 'substituted adenosine diphosphates. It is not clear whether the 3'-endo preference of the conformation or the presence of the substituent is responsible for the increased bond. However, a greater overlap of adjacent bases (stacking) can be achieved with the 3'-endo conformation. In one aspect of the present invention, oligomeric compounds include nucleosides synthetically modified to induce a conformation of 3'-endo sugar. A nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3'-endo sugar conformation. These modified nucleosides are used to mimic the RNA-like nucleosides so that the particular properties of an oligomeric compound can be improved while maintaining the desirable 3'-endo conformational geometry. There is an apparent preference for an RNA type duplex (A-shape helix, predominantly 3'-endo) as a requirement (eg, trigger) of the RNA interference machinery that is supported in part by the fact that the duplexes Compounds of the 2'-deoxy-2'-F nucleosides appear efficient in firing an RNAi response in the C. elegans system. Properties that are enhanced by the use of more stable 3'-endo nucleosides include, but are not limited to modulation of pharmacokinetic properties through protein link modification, protein quenching ratio, absorption and clearance; modulation of nuclease stability as well as chemical stability; modulation of the binding affinity and the specificity of the oligomer (affinity and specificity for enzymes as well as for the complementary sequences); and an improved efficiency of RNA cleavage. The present invention provides oligomeric compounds that can act as RNAi path triggers that have one or more modified nucleosides in such a form to favor conformation of the C3'-endo type. Shaping scheme 3'- • eni do / Northern Influence on the conformation of the nucleoside is influenced by various factors including substitution at the 2 ', 3' or 4 'positions of the pentofuranosyl sugar. Electronegative substituents generally prefer axial positions, while sterically demanding substituents generally prefer equatorial positions (Principies of Nucleic Adic Structure, Wolfgang Sanger, 1984, Springer-Verlag). The modification of the 2 'position to favor the 3'-endo conformation can be achieved while maintaining the 2'-OH as a recognition element (Gallo et al., Tetrahedro (2001), 57, 5707-5713. O'kuru et al., J. Org. Chem., (1997), 62 (6), 1754-1759 and Tang et al., J. Org. Chem. (1 999), 64, 747-754). Alternatively, the 3'-endo conformation preference can be achieved by the removal of 2'-OH as exemplified by the 2'-deoxy-2'F nucleosides (Kawasaki et al., J. Med. Chem. (1993 ), 36, 831-841), which adopts the 3'-endo conformation that positions the electronegative fluorine atom in the axial position. Other modifications of the ribose ring for example the substitution at the 4 'position to give the modified 4'-F nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry Letters (1995), 5, 1455-1460 and Owen et al., J. Org. Chem. (1976), 41, 3010-3017), or for example the modification to produce nucleoside analogues of methanocarba (Jacobson et al., J. Med. Chem Lett (2000), 43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry Letters (2001), 1 1, 1 333-1337) also induce preference for 3'-endo conformation. Along similar lines, the oligomeric compounds that trigger an RNAi response could be composed of one or more modified nucleosides in such a way that the conformation is closed in a conformation of type C3'-endo, that is, enucleated nucleic acid (LNA). , Singh et al., Chem. Common. (1998), 4, 455-456), and ethylene bridged nucleic acids (ENA ™, Morita et al., Bioorganic &Medicinal Chemistry Letters (2002), 12, 73 -76). The preferred conformation of the modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and CD measurements. Thus, the modifications predicted to induce the RNA-like conformations, the duplex geometry of form A in an oligomeric context are selected for use in the modified oligonucleotides of the present invention. The synthesis of several modified nucleosides related to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1 -3, ed. Leroy B. Townsend, 1988, Plenum press and the examples section below) . In one aspect, the present invention is directed to oligomeric compounds that are prepared by having improved properties compared to native RNA against nucleic acid targets. In designing the improved oligomeric compounds, a target is identified and an oligomeric compound having an effective length and sequence that is complementary to a portion of the target sequence is selected. Each nucleoside of the selected sequence is screened for possible improvement modifications. One modification would be the replacement of one or more RNA nucleosides with nucleosides having the same 3'-endo conformational geometry, but also, an improved property. Such modifications can improve the chemical and nuclease stability relative to the native RNA while at the same time they are more economical and easier to synthesize and / or incorporate into an oligonucleotide. The sequence of the selected oligomeric compound can be further divided into regions and the nucleosides of each region evaluated to improve modifications that may be the result of the chimeric configuration. Consideration is also given to the 5 'and 3' terminations since they are often advantageous modifications that can be made to one or more of the terminal nucleosides. The oligomeric compounds of the present invention can include at least one 5'-modified phosphate group on a single strand or on at least one phosphate at the 5'-position of a double strand sequence or sequences. Additional modifications such as ligatures between nucleosides are also considered., conjugated groups, substitute sugars or bases, the substitution of one or more nucleosides with the nucleoside mimics, and any other modifications that may improve the affinity of the selected sequences for their intended purpose. A synthetic modification at 2 'which imparts improved resistance to the nuclease and a very high binding affinity to the nucleotides is the 2-methoxyethoxy (2'-MOE, 2, -OCH2CH2OCH3) side chain (Baker et al., J. Biol. Chem., 1997, 272, 1 1944-12000). One of the immediate advantages of the 2'-MOE substitution is the improvement in binding affinity, which is greater than in many similar 2 'modifications such as O-methyl, O-propyl and O-aminopropyl. Oligomers having the 2'-O-methoxyethoxy substituent have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78, 486 -504; Altmann et al. , Chimia, 1 996, 50, 168-176; Altmann et al. , Biochem. Soc. Trans. , 1 996, 24, 630-637; and Altmann et al. , Nucleosides Nucleotides, 1997, 16, 917-926). In relation to DNA, oligomers having the 2'-MOE modifications display improved RNA affinity and superior nuclease resistance. Chimeric oligomers having 2'-MOE substituents on the wing nucleosides and an internal region of deoxyphosphorothioate nucleotides (also referred to as spaced oligomers or spacing monomers) have demonstrated an effective reduction in tumor growth in animal models to low doses The oligomers substituted in 2'-MOE have also shown outstanding promise as antisense compounds in various disease states. One such oligomer substituted by MOE is approved for the treatment of CMV retinitis. Most 2'-MOE substituents display a gauche conformation around the C-C bond of the ethyl linker. However, in 2 cases a trans conformation around the C-C bond is observed. The matrix interactions in the crystal include the packing of the duplexes against each other, by means of their smaller channels. Therefore for some residues, the conformation of the 2'-O substituent is affected by the contacts to an adjacent duplex.

In general, variations in the conformation of the substituents (for example g + og "around the CC bonds) creates a range of interactions between the substituents, both between strands through a minor channel and intrahebras. the substituents from 2 residues are in a van der Waals contact through the minor channel, similarly, a close contact between the substituent atoms occurs from two adjacent intrahebric residues.The crystal structures previously determined in the duplexes of A-DNA were for those that incorporate isolated 2'-O-methyl residues T In the above-mentioned crystal structure for the 2'-MOE substituents, a preserved hydration pattern for the 2'-MOE residues has been observed. A simple molecule of water is observed located between 02 ', 03' and the methoxy oxygen atom of the substituent that forms contacts with all 3 between 2.9 and 3.4 A. In addition, the oxygen atoms of the substituents are involved in various other hydrogen bonding contacts. For example, the methoxy oxygen atom of a 2'-O substituent in particular forms a hydrogen bond for N3 of an adenosine from the opposite strand by means of a water bridging molecule. In various cases, a water molecule is trapped between the oxygen atoms 02 ', 03' and OC 'of the modified nucleosides. 2'-MOE substituents with the trans conformation around the C-C bond of the ethylene glycol linker are associated with close contacts between OC 'and N2 of a guanosine from an opposite strand and mediated by water between OC' and N3 (G). When combined with the thermodynamic data available for duplexes containing modified 2'-MOE strands, this crystal structure allows further detailed analysis of the stability of the structure of other modifications. In extending the crystallographic structure studies, molecular modeling experiments were carried out to study an additionally improved binding affinity of the oligonucleotides having 2'-O modifications. Computer simulations were carried out on the compounds of SEQ ID NO: 10, which have 2'-O modifications located in each of the nucleosides of the oligonucleotide. Simulations were carried out with the oligonucleotide in aqueous solutions using the AMBER force field method (Cornell et al., J. Am. Chem. Soc, 1995, 1 17, 5179-5197)) (modeling software package from UCSF, San Francisco, CA). Calculations were performed on an SGI indigo2 machine (Silicon Graphics, Mountain View, CA). Another substituent group of 2 'sugar which gives a conformational geometry of the 3'-endo sugar is the 2'-OMe group. The 2 'substitution of guanosine, cytidine and dinucleoside uridine of phosphates with the 2'-OMe group shows improved stacking effects with respect to the corresponding native species (2'-OH) leading to the conclusion that the sugar is adopting a conformation C3'-endo. In this case, it is believed that the attractive hydrophobic strengths of the methyl group tend to overcome the destabilizing effects of its spherical volume. The ability of the oligonucleotides to bind to their complementary target strands is compared by determining the melting temperature (Tm) of the hybridization complex of the oligonucleotide and its complementary strand. The melting temperature (Tm), a physical property characteristic of double helices, denotes the temperature (in degrees centigrade) at which the 50% helical forms (hybridized) are present against the curl forms (without hybridising). Tm is measured by using the UV spectrum to determine the formation and cleavage (fusion) of the hybridization complex. The stacking of bases that occurs during hybridization is accompanied by a reduction in UV absorption (hypochromicity). Consequently, a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the links between the strands. Freir and Altmann, Nucleic Acids Research, (1997) 25: 4429-4443, have previously published a study on the influence of structural modifications of oligonucleotides on the stability of their duplexes with the target RNA. In this study, the authors reviewed a series of oligonucleotides containing more than 200 different modifications that had been synthesized and evaluated for their hybridization affinity and Tm. The sugar modifications studied included substitutions at the 2 'sugar position, 3' substitution, 4 'oxygen replacement, the use of bicyclic sugars and 4-membered ring replacements. Various modifications of nucleobases were also studied, including substitutions at position 5 or 6 of thymine, modifications of the pyrimidine heterocycle and modifications of the purine heterocycle. Modified ligatures between nucleosides were also studied including ligatures between phosphorus-free, phosphorus-containing and neutral nucleosides. By increasing the percentage of C3'-endo sugars in a modified oligonucleotide directed to an RNA target strand, it should pre-organize this strand for binding to the RNA. Of the various sugar modifications that have been reported and studied in the literature, the incorporation of electronegative substituents such as a 2'-fluoro or 2'-alkoxy rotates the sugar conformation towards the conformation of the 3 'endo (northern) fold . This preorganizes an oligonucleotide incorporating such modifications to have an A-shaped conformational geometry. This A-shaped conformation results in an improved binding affinity of the oligonucleotide to an RNA target strand. In addition for the 2 'substituents containing a portion of ethylene glycol, a gauche interaction between the oxygen atoms around the O-C-C-O torsion of the side chain may have a stabilizing effect on the duplex (Freier ibid). Such gauche interactions have been observed experimentally for several years (Wolfe et al., Acc. Chem. Res., 1972, 5, 102; Abe et al. , J. Am. Chem. Soc, 1976, 98, 468). This gauche effect can result in a configuration of the side chain that is favorable for duplex formation. The exact nature of this stabilizing configuration has not yet been explained. Although not wishing to be bound by the theory, it may be that the retention of the O-C-C-O torsion in a simple gauche configuration, rather than a more random distribution observed in an alkyl side chain, provides an entropic advantage for duplex formation. Representative 2'-substituent groups cognate with the present invention that give conformational properties in the form of A (3'-endo) to the resulting duplexes include 2'-O-alkyl, 2'-O-substituted and 2'-alkyl substituent groups. -Fluoro. Suitable for the substituent groups are various alkyl and aryl ethers and thioethers, amines and monoalkyl and substituted dialkyl amines. It is further intended that multiple modifications may be made to one or more of the oligomeric compounds of the invention at multiple sites of one or more monomer subunits (nucleosides are suitable) and / or nucleoside linkages to improve properties such as but not limited to to the activity in a select application. The ring structures of the invention for inclusion as a 2'-O modification include cyclohexyl, cyclopentyl and phenyl rings as well as heterocyclic rings having spatial imprints similar to cyclohexyl, cyclopentyl and phenyl rings. The 2'-O substituent groups of the invention include, but are not limited to, 2'-O- (trans-2-methoxy-cyclohexyl), 2'-O- (trans-2-methoxy-cyclopentyl), 2'-O- (trans 2-ureido cyclohexyl) and 2'-O- (trans 2-methoxyphenyl).

Defined Chemicals Unless otherwise defined herein, alkyl means d-C12, d-C8 or d-C6, branched or straight chain aliphatic hydrocarbyl (where possible). Unless defined otherwise herein, heteroalkyl means C? -C12, d-C8 or d-C6, branched or straight chain aliphatic hydrocarbyl (where possible) containing at least one, or about 1 to about 3, heteroatoms in the chain, including the terminal portion of the chain. Heteroatoms include N, O and S. Unless defined otherwise herein, cycloalkyl means C3-C12, C3-C8 or C3-C6, aliphatic hydrocarbyl ring. Unless defined otherwise herein, alkenyl means C2-C12, C2-C8 or C2-C6 alkenyl, which may be a branched or linear hydrocarbyl portion (where possible), which contains at least one bond double carbon-carbon. Unless defined otherwise herein, alkynyl means C2-C12, C2-C8 or C2-C6 alkynyl, which may be a branched or linear hydrocarbyl portion (where possible), which contains at least one bond triple carbon-carbon. Unless defined otherwise herein, heterocycloalkyl means the portion of the ring containing at least three members in the ring, at least one of which is carbon, and of which 1, 2 or 3 members in the ring They are different from carbon. The number of carbon atoms can vary from 1 to about 12, from 1 to about 6, and the total number of members in the ring can vary from 3 to about 15, or from about 3 to about 8. The heteroatoms in the ring are N, O and S. The heterocycloalkyl groups include morpholino, thiomorpholino, piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl, homomorpholino, homothiomorpholino, pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl and tetrahydroisothiazolyl. Unless defined otherwise herein, aryl means any structure in the hydrocarbon ring that contains at least one aryl ring. The aryl rings have from 6 to 20 carbons in the ring. Aryl rings also include phenyl, naphthyl, anthracenyl and phenanthrenyl. Unless defined otherwise herein, hetaryl means the portion in the ring that contains at least one completely unsaturated ring, the ring consisting of carbon and non-carbon atoms. The system in the ring can contain around 1 to around 4 rings. The number of carbon atoms can vary from 1 to about 12, or from 1 to about 6, and the total number of members in the ring can vary from 3 to about 15, or from about 3 to about 8. The heteroatoms in the ring are N, O and S. The hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc. Unless defined otherwise herein, wherein a portion is defined as a portion of the compound, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl), etc. , each of the sub-portions is as defined herein. Unless otherwise defined herein, an electron withdrawing group is a group such as the cyano or isocyanate group that removes the electronic charge from the carbon to which it binds. Other note electron withdrawing groups include those whose electronegativity exceeds those of carbon, for example halogen, nitro or substituted phenyl in the ortho or para position with one or more cyano, isothiocyanate, nitro or halo groups. Unless defined otherwise in the present, the terms halogen and halo have their ordinary meanings. The halo (halogen) substituents are F, Cl, Br and I. The optional substituents mentioned above are unless otherwise defined herein, suitable substituents depending on the desired properties. Halogen (F, Cl, Br, I), alkyl, alkenyl and alkynyl, NO2, NH3 (substituted or unsubstituted portions, acid portions (eg -CO2H, -OSO3H2, etc.), heterocycloalkyl portions, hetaryl portions are included , aryl portions, etc. In all of the above formulas, the tick (~) indicates a bond to an oxygen or sulfur of the 5'-phosphate The phosphate protecting groups include those described in U.S. Patent No. 5,760,209; US 5,614,621, US 6,051, 699, US 6,020,475, US 6,326,478, US 6, 169, 177, EU 6, 121, 437, US 6,465,628 each of which is expressly incorporated herein by reference in its entirety.

Synthesis of Oligomers Oligomerization of modified and unmodified nucleosides is carried out according to the procedures of the literature for DNA synthesis (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA (Scaringe, Methods (2001), 23, 206-217, Gait et al., Applications of Chemically synthesized RNA RNA: Protein Interactions, Ed Smith (1998), 1-36, Gallo et al., Tetrahedron (2001). ), 57, 5707-5713) as appropriate. In addition, the specific protocols for the synthesis of oligomeric compounds of the invention are illustrated in the examples below. The oligomeric compounds used in accordance with this invention can be conveniently and routinely made through the well-known technique of solid phase synthesis. The equipment for such synthesis is sold by several vendors including for example Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art can be used additionally or alternatively. It is well known to use similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives. The oligomeric compounds of the invention can also be mixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of the compounds, such as, for example, liposomes, molecules directed to the receptor, oral, rectal, topical or other formulations to aid in absorption, distribution and / or assimilation. Representative patents of the United States that teach the preparation of such aid formulations for absorption, distribution and / or assimilation include, but are not limited to, U.S. Patents 5, 108,921; 5,354,844; 5,416,016; 5,459, 127; 5,521, 291; 5,543, 158; 5,547,932; 5,583,020; 5,591, 721; 4,426,330; 4,534,899; 5,0133,556; 5, 108,921; 5,213,804; 5,227, 170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5.543, 152; 5,556,948; 5,580,575 and 5,595,756 each of which is incorporated herein by reference.

Salts, prodrugs and bioequivalents: The oligomeric compounds of the invention encompass any salts, esters or salts of such pharmaceutically acceptable esters, or any other compound in which, when administered to an animal including a human, can provide (directly or indirectly) the biologically active metabolite or residue thereof. Thus, for example, the description is also directed to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such drugs and other bioequivalents. The term "prodrug" indicates a therapeutic agent that will be prepared in an inactive or less active form that is converted to an active form (ie, drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and conditions. In particular, versions of the prodrug of the oligonucleotides of the invention are prepared as SATE derivatives ((S-acetyl-2-thioethyl) phosphate) according to the methods described in WO 93/24510 for Gosselin et al. , published on December 9, 1993 or in WO 94/26764 for Imbach et al. The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention, that is, salts that retain the desired biological activity of the parent compound and do not impart undesirable toxic effects thereto. The pharmaceutically acceptable basic addition salts are formed with metals or amines such as alkali metals or alkaline earth metals or organic amines. Examples of the metals used as cations are sodium, potassium, magnesium, calcium and the like. Examples of suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, dietanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine and procaine (see, for example, Berge et al. , "Pharmaceutical Salt", J. Of Pharma Sci., 1997, 66, 1-19). The base addition salts of the acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in a conventional manner. The free acid form can be regenerated by contacting the salt form as an acid and isolating the free acid in a conventional manner. The free acid forms differ from their respective salt forms in some way in certain physical properties such as solubility in polar solvents, but are otherwise equivalent to their respective free acid for purposes of the present invention. As used herein, a "pharmaceutical addition salt" includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include acid, organic or inorganic salts of the amines. Acid salts are chlorohydrates, acetates, salicylates, nitrates and phosphates. Other pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of organic and inorganic acids such as for example with inorganic acids such as for example hydrochloric acid, hydrobromic acid, sulfonic acid or phosphoric acid; with organic acids carboxylic, sulphonic, sulfo or phospho or substituted sulfamic acids N, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxyleleic acid, methylmaleic acid, fumaric acid, mellic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid; and with amino acids such as the 20 alpha amino acids involved in the synthesis of proteins in nature for example glutamic acid or aspartic acid and also phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, ethan-1, 2- acid disulfonic acid, benzenesulfonic acid, 4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1, 5-disulfonic acid, 2 or 3-phosphoglycerate, glucose-6-phosphate, N-cyclohexylsulfamic acid (with the formation of cyclamates), or with other acidic organic compounds, such as ascorbic acid. The pharmaceutically acceptable salts of the compounds can also be prepared with a pharmaceutically acceptable cation. Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkali, alkaline earth, ammonium and quaternary ammonium cations. Acid carbonates or carbonates are also possible. For oligonucleotides, examples of the pharmaceutically acceptable salts include, but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines, such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with organic acids such as for example acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid , alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine and iodine. In one embodiment, the double-stranded oligomeric compounds are provided as sodium salts. As used herein, the term "patient" refers to a mammal suffering from one or more disorders associated with the expression or overexpression of survivin. It will be understood that the most suitable patient is a human. It is also understood that this invention relates specifically to the inhibition of the expression or overexpression of survivin in mammals. It is recognized that one skilled in the art can affect the disorders associated with the expression or overexpression of survivin, by treating a patient currently suffering from the disorders with an effective amount of the compound of the present invention. Thus, the terms "treatment" and "treat" are intended to refer to all processes where there may be an interruption, slow progress, suspension, control or stop the progress of the disorders described here, but not necessarily indicate an elimination total of all symptoms. As used herein, the term "effective amount" or "therapeutically effective amount" of a compound of the present invention refers to an amount that is effective in the treatment or prevention of the disorders described herein. The oligomeric compounds of the present invention can be used for diagnosis, therapeutics, prophylaxis and as reagents and research kits. For therapeutics, a patient such as a human suspected of having a disease or disorder that can be treated by modulating the expression of survivin is treated by administering antisense compounds according to this invention. The compounds of the invention can be used in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier. The use of the antisense compounds and methods of the invention can also be useful prophylactically for example, to prevent or delay infection, inflammation or tumor formation. The present invention also includes compositions and formulations that include oligomeric compounds of the invention. The pharmaceutical compositions of the present invention can be administered in various ways depending on whether it is a desired local or systemic treatment and the area to be treated. Administration can be topical (including ophthalmic and mucous membranes, including vaginal and rectal supply), pulmonary eg by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal, intradermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection, drip or infusion; or intracranial for example intrathecal or intraventricular administration. Oligonucleotides with at least one modification of 2'-O-methoxyethyl are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, in powders or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous medium, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersion aid or binders may also be desirable. Compositions for oral administration also include pulse delivery compositions and bioadhesive compositions as described in copending European Patent Application Serial No. 09 / 944,493, filed August 22, 2001, and 09 / 935,316 filed August 22, 2001. 2001, the full descriptions of which are incorporated herein by reference. Oral administration for the treatment of disorders is described herein. However, oral administration is not the only route. For example, the intravenous route may be desirable as a matter of convenience or to avoid potential complications related to oral administration. When a compound of the present invention is administered through the intravenous route, an intravenous bolus or slow infusion may be desirable. Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may contain buffer solutions, diluents and other suitable additives such as but not limited to penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers and excipients. The pharmaceutical compositions and / or formulations comprising the oligomeric compounds of the present invention may also include penetration enhancers in order to improve the food supply of the oligonucleotides. Penetration enhancers can be classified as belonging to one of five broad categories that is, fatty acids, bile salts, chelating agents, surfactants and non-surfactants (Lee et al., Critical Reviews in Therapeutics Drug Carrier Systems, 1991, 8, 91 -192; Muranishi, Critical Reviews in Therapeutic Durg Carrier Systems, 1 990, 7: 1, 1-33). One or more enhancers of the penetration of one or more of these broad categories can be included. Various fatty acids and their derivatives that act as penetration enhancers include for example oleic acid, lauric acid (C12), capric acid (C10), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, recinleate, monoolein (a type of 1 -monoleoyl-rac-glycerol), dilaurin, caprylic acid, ariquidonic acid, glycerol 1 -monocaprate, 1 -dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, mono and di-glycerides and pharmaceutically acceptable salts of it (ie, oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc. (Lee et al., Critical Reviews in Therapeutic Durgs Carrier Systems, 1991, 8: 2, 91 -192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7: 1, 1 -33 El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654.) Examples of some fatty acids are sodium caprate and laurate. of sodium, used simply or in combination at concentrations 0.5 to 5%. Various bile natural salts and their synthetic derivatives act as enhancers of penetration. Thus, the term "bile salt" includes any of the naturally occurring components of bile as well as any of its synthetic derivatives. Examples of bile salts are chenodeoxycholic acid (CDCA) and / or ursodeoxycholic acid (UDCA), generally used at concentrations of 0.5 to 2%.

Complex formulations comprising one or more penetration enhancers can be used. For example, bile salts can be used in combination with fatty acids to make complex formulations. Suitable combinations include CDCA combined with sodium caprate or sodium laurate (generally 0.5 to 5%). Chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate, (EDTA), citric acid, salicylates (eg, sodium salicylate, 5-methoxysaicylate and homovanilate), N-acyl collagen derivatives, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 8: 2, 92-192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7: 1, 1 -33; Buur et al., J. Control Reí., 1 990, 14, 43-51). Chelating agents have the additional advantage of also serving as DNase inhibitors. Surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-ethyl ether (Lee et al., Critical Reviews in Therapeutic Durg Carrier Systems, 1991, 8: 2, 92-191); and perfluorochemical emulsions such as FC-43 (Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252-257). Non-surfactants include, for example, unsaturated cyclic ureas, 1-alkyl derivatives and 1-alkenylazacycloalkane (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 8: 2, 92-191); and non-spheroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626). A "pharmaceutically acceptable carrier" (excipient) is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert carrier for delivering one or more nucleic acids to an animal. The pharmaceutically acceptable carrier can be liquid or solid and is selected with the planned administration form in mind in order to supply the desired volume, consistency, etc. when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutically acceptable carriers include, but are not limited to, binding agents (eg, pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (for example, lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium acid phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrated (e.g., starch, sodium starch glycolate, etc.); or wetting agents (e.g., sodium lauryl sulfate, etc.). Oral sustained release delivery systems and / or enteric coatings for orally administering dosage forms are described in U.S. Patent 4,704,259; 4,556,552; 4,309,406 and 4,309,404. The compositions of the present invention may additionally contain other adjunct components that are conventionally found in pharmaceutical compositions at their established levels of use in the art. Thus for example the compositions may contain additional compatible pharmaceutically active materials such as for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in the physical formulation of various dosage forms of the composition of the present invention, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials when added should not unduly interfere with the biological activities of the components of the compositions of the invention. Regardless of the method by which the oligomeric compounds of the invention are introduced into a patient, colloidal dispersion systems can be used as delivery vehicles to improve the in vivo stability of the compounds and / or to direct the compounds to a particular organ, tissue or cell type. Colloidal dispersion systems include, but are not limited to, complexes of macromolecules, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, liposomes, and lipid: oligonucleotide complexes of uncharacterized structure. A colloidal dispersion system is a plurality of liposomes. Liposomes are microscopic spheres that have an aqueous core surrounded by one or more outer layers made of lipids arranged in a bilayer configuration (see generally, Chonn et al., Current Op. Biotech., 1995, 6, 698-708). Certain embodiments of the invention provide liposomes and other compositions with one or more other chemotherapeutic agents which function by a mechanism that is not antisense. Examples of such chemotherapeutic agents include, but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esububicin, bleomycin, mafosfamide, ifosfamide, cytosine, arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin, C, actinomycin, D , mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphaian, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea , deoxicoformycin, 4-hydroxyperoxy cyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FudR), methotrexate (MTX), colchicine, taxol; vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin, carboplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, p. 1206-1228, Berkow et al., Eds. , Rahway, NJ. When used with the compounds of the invention, such chemotherapeutic agents can be used individually (e.g., 5-FU and oligonucleotides), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide). ), or in combination with one or more other chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs include, but are not limited to, non-spheroidal anti-inflammatory drugs and corticosteroids and antiviral drugs, including but not limited to ribivirine, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al. , eds. , 1987, Rahway, N.J. , pages 2499-2506 and 46-49, respectively). Other chemotherapeutic agents that are not antisense are also within the scope of the invention. Two or more combined compounds can be used together or sequentially. The formulation of the therapeutic compositions and their subsequent administration is believed to be within the experience of those in the art. The dosage depends on the severity and the response of the disease state to be treated, with the course of treatment ranging from several days to several months, or until the cure is made or a decrease in the disease state is achieved. Optimal dosing schedules can be calculated from measurements of the accumulation of the drug in the patient's body. People of ordinary experience can easily determine optimal dosages, dosing methodologies and repetition rates. Optimum doses may vary depending on the relative potency of the individual oligonucleotides, and can be estimated generally based on the ECs or found to be effective in animal models in vitro and in vivo. In general, the dose is from 0.01 μg to 1 00 g per kg of body weight and can be given once or more per day, weekly, monthly or annually. Persons of ordinary skill in the art can easily estimate the repetition rates for dosing based on measured residence times and drug concentrations in body fluids or tissues. After successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent recurrence of the disease state where the oligonucleotide is administered, at maintenance doses ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, weekly, monthly, or annually. For double-stranded compounds, the dose must be calculated to account for an increasing load of nucleic acid from the second strand (as with compounds comprising 2 separate strands) in the additional length of the nucleic acid (as with single strands). self-complementary that have double-stranded regions). Double-stranded compounds can be introduced into the cells in several different ways. For example, double-stranded compounds can be administered by microinjection; bombardment by microparticles covered by double-stranded compounds; soaking of cells in a solution of double-stranded compounds, electroporation of cells in the presence of double-stranded compounds, liposome-mediated delivery of double-stranded compounds, chemical-mediated transfection such as calcium phosphate, cationic lipids, etc. . , viral infection, transformation and the like. Double-stranded compounds can be introduced together with compounds that improve the absorption of RNA by cells, stabilize the combined strands in their base pairs or otherwise increase the inhibition of the polynucleotide target sequence function. In the case of a cell culture or tissue explant, the cells are conveniently incubated in a solution containing the double-stranded compounds or subjected to a lipid-mediated transformation. The determination of the optimal amounts of double-stranded compounds to be administered to human or animal patients for the prevention or treatment of pathologies associated with the expression or overexpression of survivin, as well as methods of administration of pharmaceutical or therapeutic compositions comprising such oligonucleotides of Double strand is within the experience of those in the pharmaceutical art. The dosage of a human or animal patient depends on the nature of the symptom, condition or disease, the nature of the infected cell or tissue, the patient's condition, body weight, general health, sex, diet, time duration, route of administration; relations of absorption, distribution, metabolism and excretion of double-stranded compounds, combination with other drugs, severity of the pathology and the response of the disease state to be treated. The amount of double-stranded compounds administered also depends on the nature of the target polynucleotide sequence or region thereof, and the nature of the double-stranded compounds and can be easily optimized to obtain the desired level of effectiveness. The course of treatment can last from several days to several weeks or several months, or until a cure is made or an acceptable decrease or prevention of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of the accumulation of the drug in the patient's body in conjunction with the effectiveness of the treatment. People of ordinary experience can easily determine optimal dosages, dosing methodologies and repetition rates. Although the embodiments of the invention have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.

EXAMPLES Example 1: Nucleoside phosphoramidites for synthesis of oligonucleotide deoxy and 2'-alkoxy amidites The 2'-deoxy and 2'-methoxy beta-cyanoethyldiisopropyl phosphoramidites were purchased from commercial sources (eg, Chemgenes, Needham, MA or Glen Research, Inc. Sterling, VA). Other 2'-O-alkoxy nucleoside substituted amidites were prepared as described in the patent E.U.A. 5,506,351, incorporated herein by reference. For oligonucleotides synthesized using 2'-alkoxy amidites, the standard cycle for unmodified oligonucleotides was used, except for the wait step after pulse administration of tetrazole and the base is increased up to 360 seconds. Oligonucleotides containing 5-methyl-2'-deoxycytidine (5-Me-C) nucleotides were synthesized according to published methods (Sanghvi, et al., Nucleic Acids Research, 1993, 21, 3197-3203) using commercial phosphoramidites available (Glen Research, Sterling VA or ChemGenes, Needham, MA). 2'-Fluoro amiditas 2'-Fluorodeoxiadenosina amiditas The 2'-fluoro oligonucleotides were synthesized as previously described (Kawasaki, et al., J Med. Chem., 1 993, 36, 831-841) and E. U.A. 5,670,633, incorporated herein by reference. Briefly, the protected N6-benzoyl-2'-deoxy-2'-fluoroadenosine nucleoside was synthesized using 9-beta-D-arabinofuranosyladenine commercially available as a starting material and by modified literature procedures, hence the 2 'atom -alpha-fluoro is introduced by an SN2 displacement of a 2'-beta-trityl group. In this manner, N6-benzoyl-9-beta-D-arabinofuranosyladenine is selectively protected in a moderate yield as the 3 ', 5'-ditetrahydropyranyl (THP) intermediate. The deprotection of the THP and N6-benzoyl groups is carried out using standard methodologies and standard methods are used to obtain the intermediates 5'-dimethoxytrityl- (DMT) and 5'-DMT-3'-phosphoramide. 2'-Fluorodeoxyguanosine The synthesis of 2'-deoxy-2'-fluoroguanosine is carried out using tetraisopropyldisiloxane (TPDS) protected by 9-beta-D-arabinofuranosylguanine as the starting material, and the conversion to the intermediate diisobutyrylarabino furanosylguanosine. The deprotection of the TPDS group is followed by the protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosilguanina. The selective O-deacylation and the triflation is followed by the treatment of the crude product with fluoride, then the deprotection of the THP groups. Standard methodologies are used to obtain the 5'-DMT- and 5'-DMT-3'-phosphoramidites. 2'-Fluorouridine The synthesis of 2'-deoxy-2'-fluorouridine was carried out by the modification of a literature procedure in which 2,2'-anhydro-1-beta-D-arabinofuranosiluration was treated with piperidine- 70% hydrogen fluoride. The standard procedures are used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites. 2'-Fluorodeoxycytidine 2'-deoxy-2'-fluorocytidine was synthesized by amination of 2'-deoxy-2'-fluorouridine, followed by selective protection to give N4-benzoyl-2'-deoxy-2 '-fluorocytidine. The standard procedures are used to obtain the 5'-DMT and 5'-DMT-3'phosphoramidites. 2'-O- (2-methoxyethyl) modified amidites The 2'-O-methoxyethyl-substituted nucleoside amidites were prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Seta, 1995, 78, 486 -504. 2,2'-Anhydr (1 - (beta-D-arabinofuranosyl) -5-methyluridine) 5-Methyluridine (ribosiltimine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenylcarbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL). The mixture was heated to reflux, with stirring, allowing the developed carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was drained in diethyl ether (2.5 L)with agitation. The product formed a rubber. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). The solution was emptied into fresh ether (2.5 L) to provide a rigid gum (60 ° C to 1 mm Hg for 24 h) to give a solid that was milled to a light tan powder (57 g, 85% crude yield). ). The NMR spectrum was consistent with the structure, contaminated with phenol as its sodium salt (ca. 5%). The material was used as is for further reactions (or can be purified by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid, mp 222-4 ° C). 2'-O-Methoxyethyl-5-methyluridine The 2,2'-anhydro-5-methyluridine (195 g, 0.81 M), tris (2-methoxyethyl) borate (231 g, 0.98 M) and 2-methoxyethanol (1. 2 L) were added to a 2 L stainless steel pressure vessel and placed in an oil bath previously heated to 160 ° C. After heating for 48 hours at 55-160 ° C, the vessel was opened and the solution was evaporated to dryness and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate was evaporated. The residue (280 g) was dissolved in CH 3 CN (600 mL) and evaporated. A column of silica gel (3 kg) was packed in CH2Cl2 / Acetone / MeOH (20: 5: 3) containing 0.5% Et3NH. The residue was dissolved in CH2Cl2 (250 mL) and absorbed onto silica (150 g) before loading onto the column. The product was eluted with the packaged solvent to give 160 g (63%) of the product. The additional material is obtained by reworking the impure fractions. 2'-0-Methoxyethyl-5'-0-dimethoxytrityl-5-methyluridine The 2'-O-methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and the residue dried was dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture was stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction was stirred for an additional hour. The methanol (170 mL) was then added to stop the reaction. The HPLC showed the presence of approximately 70% of the product. The solvent was evaporated and triturated with CH3CN (200 mL). The residue was dissolved in CHCl3 (1.5 L) and extracted with 2x500 mL of saturated NaHCO3 and 2x500 mL of saturated NaCl. The organic phase was dried over Na2SO, filtered and evaporated. 275 g of the residue are obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc / Hexane / Acetone (5: 5: 1) containing 0.5% Et3NH). The pure fractions were evaporated to give 164 g of the product. Approximately 20 additional g are obtained from the impure fractions to give a total yield of 183 g (57%). 3'-O-Acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrit-5-methyluridine The 2'-O-methoxyethyl-5'-O-dimethoxytriti-5-methyluridine (106 g, 0. 167 M), DMF / pyridine (750 mL of a 3: 1 mixture prepared from 562 mL of DMF and 88 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) were combined and stirred at room temperature for 24 hours. hours. The reaction was observed by ccd by first turning off the ccd sample with the addition of MeOH. After completion of the reaction, as judged by ccd, the MeOH (50 mL) was added and the mixture was evaporated at 35 ° C. The residue was dissolved in CHCl3 (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl. The aqueous layers were again extracted with 200 mL of CHCI3. The combined organics were dried with sodium sulfate and evaporated to give 122 g of the residue (about 90% of the product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc / Hexane (4: 1). The pure product fractions were evaporated to provide 96 g (84%). An additional 1.5 g of the last fractions was recovered. 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methyl-4-triazoleuridine A first solution was prepared by dissolving 3'-O-acetyl 2'-O-methoxyethyl-5 ' -O-dimethoxytritiI-5-methyluridine (96 g, 0.144 M) in CH3CN (700 mL) and set aside. Triethylamine (1 89 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L), cooled to -5 ° C and stirred for 0.5 hour using a dome agitator. POCI3 was added dropwise, over a period of 30 minutes, to keep the stirred solution at 0-10 ° C, and the resulting mixture was stirred for an additional 2 hours. The first solution was added dropwise, over a period of 45 minutes, to the last solution. The resulting reaction mixture was stored overnight in a cold room. The salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1 x 300 mL of NaHCO3 and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound. 2'-O-MethoxyethyI-5'-O-dimethoxytrityl-5-methylcytidine A solution of 3'-O-acetyl-2'-O-methoxyethyl-5'-O-dimethoxytipyl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH 4 OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2x200 mL). The residue was dissolved in MeOH (300 mL) was transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH3 gas was added and the vessel was heated to 100 ° C for 2 hours (the ccd showed complete conversion). The contents of the vessel were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.

N4-Benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine The 2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) was dissolved in DMF (800 mL) and the benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, the ccd showed that the reaction was approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHCl3 (700 mL) and extracted with saturated NaHCO3 (2x300 mL) and saturated NaCl (2x300 mL), dried over MgSO4 and evaporated to give the residue (96 g). The residue was processed by chromatography on a 1.5 kg silica column using EtOAc / Hexane (1: 1) containing 0.5% Et3NH as the eluent solvent. The pure product fractions were evaporated to give 90 g (90% >) of the title compound.

N 4-Benzoyl-2'-0-methoxyethyl-5'-0-dimethoxytrityl-5-methylcytidine-3'-amidite N 4 -benzoyl-2'-O-methoxyethyl-5'-O-dimethoxytrityl-5-methylcytidine (74 g, 0.1 0 M) was dissolved in CH 2 Cl 2 (1 L). Tetrazol diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra (iso-propyl) phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (the ccd showed that the reaction was 95% complete). The reaction mixture was extracted with saturated NaHCO3 (1 x 300 mL) and saturated NaCl (3x300 mL). The aqueous washings were again extracted with CH2Cl2 (300 mL), and the extracts were combined, dried over MgSO4 and concentrated.

The obtained residue was processed by chromatography on a 1.5 kg silica column using EtOAc / Hexane (3: 1) as the eluent solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound. 2 '- (Aminooxyethyl) nucleoside amidites and 2' - (dimethylaminooxyethyl) nucleoside amidites The aminooxyethyl and dimethylaminoxyethyl amidites were prepared as per the methods of US Pat. No. 6, 127,533 which is incorporated herein by reference.

Example 2: Synthesis of Oligonucleotides Substituted or unsubstituted phosphodiester (P = O) oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with iodine oxidation. The phosphorothioates (P = S) were synthesized as by the phosphodiester oligonucleotides except that the standard oxidation bottle was replaced by 0.2 M solution of 3H-1,2-benzodithiol-3-one 1,1-dioxide in acetonitrile for the tiation in stages of the phosphite ligands. The wait-to-tiation stage is increased up to 68 seconds and continues through the capping stage. After splitting the CPG column and deblocking in concentrated ammonium hydroxide at 55 ° C (18 hours), the oligonucleotides were purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M solution of NaCl. The phosphinate oligonucleotides were prepared as described in US Pat. ,508,270, incorporated herein by reference. The alkyl phosphonate oligonucleotides were prepared as described in the U.A. 4, 469,863, incorporated herein by reference. The 3'-deoxy-3'-methylene phosphonate oligonucleotides were prepared as described in the Patents E.U.A. Nos. 5,610,289 or 5,625,050, incorporated herein by reference. Phosphoramidite oligonucleotides were prepared as described in US Pat. 5,256,775 or Patent E.U.A. 5,366,878, incorporated herein by reference. The alkyl phosphonothioate oligonucleotides were prepared as described in published PCT applications PCT / US94 / 00902 and PCT / US93 / 06976 (published as WO 94/17093 and WO 94/02499, respectively), incorporated herein by reference. The 3'-deoxy-3'-amino phosphoramidate oligonucleotides were prepared as described in Patent E.U.A. 5,476,925, incorporated herein by reference. The phosphotriester oligonucleotides were prepared as described in the U.A. 5,023,243, incorporated herein by reference. The borane phosphate oligonucleotides were prepared as described in US Patents U.A. 5, 130,302 and 5, 177, 198, both incorporated herein by reference. The compositions of 4-ribonucleoside and 2'-deoxy-4'-ribonucleoside can be made by the method taught by Naka et al. , J. Am. Chem. Soc. 122: 7233-7243, 2000 and Patent E.U.A. No. 5,639,873, which is incorporated herein by reference in its entirety.

Example 3: Synthesis of Oligonucleosides The oligonucleosides linked to methylenemethylimino, also identified as oligonucleosides linked to MMI, oligogonosides linked to methylenedimethylhydrazo, also identified as oligonucleosides linked to MDH, and oligonucleosides linked to methylenecarbonylamino, also identified as oligonucleosides linked to amide-3, and oligonucleosides linked to methyleneaminocarbonyl, also identified as oligonucleosides linked to amide-4, as well as mixed backing compounds having, for example, alternative ligatures MMI and P = O or P = S were prepared as described in the US Patents 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are incorporated herein by reference. The oligomeric compounds of the invention can also comprise mixed ligations in which any number of two or more types of ligatures are present in any order and at any position within the oligomeric compound, for example the 5 'half of the compound comprises phosphorothioate ligands and the 3 'half comprises phosphodiester ligatures. These are referred to as mixed phosphorothioate and phosphodiester bonds. Formacetal and thioformacetal-linked oligonucleosides were prepared as described in US Patents U.A. 5,264,562 and 5,264,564, incorporated herein by reference. The ollgonucleosides linked to ethylene oxide were prepared as described in the patent E.U.A. 5,223,618, incorporated herein by reference.

Example 4: Synthesis of PNA Peptide nucleic acids (PNAs) were prepared according to any of the various methods referred to in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They can also be prepared in accordance with US Patents U.A. 5,539,082, 5,700,922, and 5,719,262; incorporated herein by reference. Example 5: Synthesis of Chimeric Oligonucleotides The chimeric oligonucleotides, oligonucleosides or mixture of oligonucleotides / oligonucleosides of the invention can be of several different types. These include a first type wherein the "hollow" segment of the bound nucleosides is placed between the 5 'and 3' open segments of the linked nucleosides and a second type of "open end" where the "hollow" segment is located at the term either 3 'or 5' of the oligomeric compound. Oligonucleotides of the first type are also known in the art as "spacing monomers" or spaced oligonucleotides. Oligonucleotides of the second type are also known in the art as "hemomers" or "open dimers". The double-stranded compounds of the invention can be of various types including, but not limited to, siRNAs, canonical siRNAs, blunt-ended siRNAs or hairpins. The single-stranded compounds of the invention that externise the antisense RNAi mechanism are also within the scope of the invention. These include, but are not limited to, ssRNAi and antisense RNA (asRNA). (2'-O-Me) - (2'-deoxy) - (2'-O-Me) chimeric phosphorothioate oligonucleotides Chimeric oligonucleotides having segments of 2'-O-alkyl phosphorothioate and 2'-deoxy phosphorothioate oligonucleotide are synthesized using an automated DNA synthesizer from Applied Biosystems Model 380B, as above. The oligonucleotides are synthesized using the automated synthesizer and 2'-deoxy-5'-dimethoxytrityl-3'-O-phosphoramidite for the DNA portion and 5'-dimethoxytrityl-2'-O-methyl-3'-O-phosphoramidite for the nucleotides modified with 2'-MOE. The standard synthesis cycle is modified by increasing the waiting stage after administering the tetrazole and the base up to 600 seconds repeated four times for RNA and twice for 2'-O-methyl. The fully protected oligonucleotide is cleaved from the support and the phosphate group is deprotected in 3: 1 ammonia / ethanol at room temperature overnight then lyophilized to dryness. The treatment in methanolic ammonia for 24 hours at room temperature is then given to deprotect the entire base, and the sample is lyophilized again until dry. The pellet is resuspended in 1 M TBAF in THF for 24 hours at room temperature to deprotect the 2 'positions. The reaction is then quenched with 1 M TEAA and the sample is then reduced to 1 / _ of its volume by rotoevaporation before desalting in an exclusion column of size G25. The recovered oligo is then analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and mass spectrometry. (2'-O- (2-Methoxyethyl)) - (2'-deoxy) - (2'-O- (methoxyethyl)) chimeric phosphorothioate oligonucleotides The (2'-O- (2-methoxyethyl)) - (2 ') -deoxy) - (- 2'-O- (methoxyethyl)) chimeric phosphorothioate oligonucleotides were prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide, with the substitution of 2'-O- (methoxyethyl) amidites by the 2'-O-methyl amidites. (2'-O- (2-Methoxyethyl) phosphodiester) - (2'-deoxyphosphorothioate) - (2'-O- (2-Methoxyethyl) Phosphodiester) quinic oligonucleotides (2'-O- (2-methoxyethyl) phosphodiester) - (2'-deoxy phosphorothioate) - (2'-O- (methoxyethyl) phosphodiester) chimeric oligonucleotides were prepared as per the above procedure for the 2'-O-methyl chimeric oligonucleotide with the substitution of 2'-O- (methoxyethyl) amidites by the 2'-O-methyl amidites, oxidation with iodine to generate internucleotide phosphodiester linkages with the open portions of the chimeric structures and sulphidation using 1,1-dioxide of 3, H-1,2 benzodithiol-3 ona (Beaucage Reagent) to generate the internucleotide phosphorothioate ligations for the center space Other chimeric oligonucleotides, chimeric oligonucleosides and mixture of chimeric oligonucleotides / oligonucleosides are synthesized in accordance with EU Patent No. 5,623,065, incorporated herein by reference .

RNA synthesis In general, the synthesis chemistry of RNA is based on the selective incorporation of several protective groups in strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups include silyl ethers. In particular, bulky silyl ethers are used to protect the 5'-hydroxyl in combination with an orthoester protecting group unstable to the acid in the 2'-hydroxyl. This set of protecting groups is then used with standard solid phase synthesis technology. It is important to remove the unstable orthoester protecting group to the acid after all other synthetic steps. On the other hand, the early use of the silyl protecting groups during the synthesis ensures easy removal when desired, without undesired deprotection of the 2'-hydroxyl.

Following this procedure for the protection sequence of the 5'-hydroxyl in combination with the protection of the 2'-hydroxyl by protective groups that are differentially removed and chemically differentially unstable, the RNA oligonucleotides were synthesized. The RNA oligonucleotides were synthesized in a stepwise manner. Each nucleotide is sequentially added (3 'to 5' direction) to an oligonucleotide linked to a solid support. The first nucleoside at the 3 'end of the chain is covalently linked to the solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and the activator are added, coupling the second base at the 5 'end of the first nucleoside. The support is washed and any of the 5'-hydroxy groups are capped with acetic anhydride to provide 5'-acetyl moieties. The ligature is then oxidized to the more stable and finally desired ligature P (V). At the end of the nucleotide addition cycle, the 5'-silyl group is split with fluoride. The cycle is repeated for each subsequent nucleotide. After synthesis, the methyl protecting groups in the phosphates are split in 30 'minutes using disodium trihydrate-2-carbamoyl-2-cyanoethylene-1,1-dithiolate (S2Na2) 1 M in DMF. The deprotection solution is washed from the oligonucleotide bound to the solid support using water. The support is then treated with 40% methylamine in water for 10 minutes at 55 ° C. This releases the RNA oligonucleotides in the solution, de-protects the exocyclic amines, and modifies the 2 'groups. Oligonucleotides can be analyzed by anion exchange HPLC in this step. The 2'-orthoester groups are the last protective groups to be removed. The orthoester protecting group of ethylene glycol monoacetate developed by Dharmacon Research, Inc. (Lafayette, CO), is an example of a useful orthoester protecting group having the following important properties. It is stable to the conditions of synthesis of nucleoside phosphoramidite and synthesis of oligonucleotides. However, after the synthesis of oligonucleotides, the oligonucleotide is treated with methylamine which not only unfolds the oligonucleotide from the solid support, but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents in the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more unstable to acid catalyzed hydrolysis. Specifically, the splitting ratio is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester must possess sufficient stability in order to be compatible with the oligonucleotide synthesis and still, when subsequently modified, allow the deprotection to be carried out under relatively mild aqueous conditions compatible with the RNA oligonucleotide product. final. Additionally, RNA synthesis methods are well known in the art (Scaringe, S.A. Ph. D. Thesis, University of Colorado, 1996; Scaringe, S.A., et al. , J. Am. Chem. Soc, 1998, 120, 1 1820-1 1821; Matteucci, M.D. and Caruthers, M.H. J Am. Chem. Soc, 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett. , 1981, 22, 1859-1862; Dahl, B. J., et al. , Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al. , Tetrahedron Lett. , 1994, 25, 431 1-4314; Wincott, F. et al. , Nucleic Acids Res., 1 995, 23, 2677-2684; Griffin, B. E., et al. , Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al. , Tetrahedron, 1967, 23, 2315-2331). The RNA antisense compounds (RNA oligonucleotides, either single- or double-stranded) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc. (Lafayette, CO). Once synthesized, complementary antisense RNA compounds can then be combined in their base pairs by methods known in the art to form double-stranded antisense compounds (in duplexes). For example, duplexes can be formed by combining 30 μl of each of the strands of RNA oligonucleotides (50uM RNA oligonucleotide solution) and 15 μl of combination buffer at their base pairs 5X (potassium acetate 1 00 mM , HEPES-KOH 3mM pH 7.4, 2mM magnesium acetate) followed by heating for 1 minute at 90 ° C, then 1 hour at 37 ° C. The resulting duplex antisense compounds can be used in kits, assays, exclusion separations, or other methods to investigate the role of the target nucleic acid, or for diagnostic or therapeutic purposes.

Example 6: Oligonucleotide Isolated After splitting of the controlled pore glass column (Applied Biosystems) and unblocked in concentrated ammonium hydroxide at 55 ° C for 18 hours, the oligonucleotides or oligonucleosides are purified by precipitation twice from NaCl 0.5M with 2.5 volumes of ethanol. The synthesized oligonucleotides are analyzed by polyacrylamide gel electrophoresis in denatured gels and judged to be at least 85% full-length material. The relative amounts of phosphorothioate and phosphodiester ligatures obtained in the synthesis are periodically reviewed by 31P nuclear magnetic resonance spectroscopy, and for some study oligonucleotides are purified by HPLC, as described by Chiang et al. , J. Biol. Chem. 1991, 266, 18162-18171. The results obtained with the material purified by CLAR are similar to those obtained with material not purified by CLAR.

Example 7: Oligonucleotide synthesis - 96-well plate format The oligonucleotides were synthesized by solid phase phosphoramidate P (III) chemistry in an automated synthesizer capable of assembling 96 sequences simultaneously in a standard 96-well format. Internucleotide phosphodiester ligatures are provided by oxidation with aqueous iodine. Internucleotide phosphorothioate ligatures are generated by sulfurizing using 1.1, 3, H-1,2-benzodithiol-3-one dioxide (Beaucage Reagent) in anhydrous acetonitrile. The beta-cyanoethyldiisopropyl phosphoramidites protected by standard base are purchased from commercial vendors (eg, PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). The non-standard nucleosides are synthesized as per literature methods or known patents. They are used as beta-cyanoethyldiisopropyl phosphoramidites protected by base. The oligonucleotides are cleaved from the support and deprotected with concentrated NH OH at elevated temperature (55-60 ° C) for 12-16 hours and the released product is then dried in vacuo. The dried product is then resuspended in sterile water to provide a master plate from which all test and analytical plate samples are then diluted using robotic pipettes.

Example 8: Oligonucleotide analysis - 96 well plate format The oligonucleotide concentration in each well was evaluated by diluting the samples and by UV absorption spectroscopy. The full-length integrity of the individual products is evaluated by capillary electrophoresis (CE) either in the 96-well format (Beckman P / ACEJ MDQ) or, for individually prepared samples, in a commercial CE device (eg, Beckman P / ACEJ 5000, ABI 270). The base and backing composition is confirmed by mass analysis of the compounds using electro-mass mass spectroscopy. All test test plates are diluted from the master plate using simple and multi-channel robotic pipettes. The plates were judged to be acceptable if at least 85% of the compounds in the plate are at least 85% full length.

Example 9: Cell culture and treatment of oligonucleotides The effect of the antisense compounds on the expression of the target nucleic acid can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be determined routinely using, for example, PCR or Northern blot analysis. The following types of cells are provided for illustrative purposes, but other types of cells can be used routinely.

MCF7: The MCF-7 human breast carcinoma cell line is obtained from the American Type Culture Collection (Manassas, VA). MCF-7 cells are routinely cultured in low DMEM glucose (Invitrogen Life Technologies, Carisbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carisbad, CA). Cells are routinely passaged by trypsinization and dilution when they reach about 90% confluency. Cells are seeded in 96-well plates (Falcon-Primary # 3872) at a density of about 7000 cells / well for use in RT-PCT analysis. For Northern blotting technique or other assays, cells can be seeded in 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

HeLa cells: The HeLa epithelial carcinoma cell line is obtained from the American Tissue Type Culture Collection (Manassas, VA). HeLa cells are routinely cultured in high glucose DMEM (Invitrogen Corporation, Carisbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Corporation, Carisbad, CA). Cells are routinely passaged by trypsinization and dilution when they reach approximately 90% confluency. Cells are seeded in 24-well plates (Falcon-Primary # 3846) at a density of approximately 50,000 cells / well or in 96-well plates at a density of approximately 5,000 cells / well for use in RT-PCR analysis. For Northern blotting technique or other assays, the cells are harvested when they reach approximately 90% confluency.

U-87 MG cells: The U-87 MG cell line of human glioblastoma is obtained from the American Type Culture Collection (Manassas, VA). U-87 MG cells are cultured in DMEM (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carisbad, CA) and antibiotics. The cells are routinely passaged by trypsinization and dilution when they reach the appropriate confluence. The cells are seeded in 96-well plates (Falcon-Primary # 3872) at a density of about 10,000 cells / well for use in the RT-PCR analysis. For Northern blotting technique or other assays, the cells can be seeded in 1 00 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.

HUVEC cells: HUVECs are obtained from ATCC and routinely grown in EBM (Clonetics Corp, Walkersille, MD) supplemented with SingleQuots supplements. Cells are routinely passaged by trypsinization and dilution when they reach 90% confluence and are maintained for up to 15 passes. For cell growth in 96-well plates (10,000 cells / well), the wells are washed once with 200 μL of reduced serum medium with OPTI-MEM-1 ™ (Gibco BRL) and then treated with 130 μL of OPTI -MEM-1 ™ containing 12 μg / mL of LIPOFECTIN ™ (Gibco BRL) and the desired double-stranded compounds at a final concentration of 25 nM. After 5 hours of treatment, the medium is replaced with fresh medium. The cells were harvested 16 hours after the treatment of dsRNA, at which time the RNA was isolated and the target reduction was measured by RT-PCT.

Treatment with oligomeric compounds: When the cells reach 80% confluence, they are treated with oligonucleotide. For cells growing in 96-well plates, the wells are washed once with 200 μL of serum medium reduced with OPTI-MEMJ-1 (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 containing 3.75 μg / mL LIPOFECTINJ (Gibco BRL) and the desired oligonucleotide at a final concentration of 150 nM. For the dsRNA compounds, 2 x 130 μL of OPTI-MEM-1 is used. After 4 hours of treatment, the medium was replaced with fresh medium. The cells were harvested 16 hours after the oligonucleotide treatment. The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration of a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells, the positive control RNAse H oligonucleotide is ISIS 13920, TCCGTCATCGCTCCTCAGGG, SEQ ID NO: 1, a 2'-O-methoxyethyl (2'-O-methoxyethyl) spacing monomer shown in bold) with a phosphorothioate backing which it goes to human H-ras. For mouse or rat cells, the positive control oligonucleotide is ISIS 15770, ATGCATTCTGCCCCCAAGGA, SEQ ID NO: 2, a 2'-O-methoxyethyl (2'-O-methoxyethyl) spacing monomer shown in bold) with a backing of phosphorothioate targeting c-raf from both mouse and rat. The concentration of positive control oligonucleotides resulting in an 80% inhibition of H-ras mRNA (for ISIS 13920) or c-raf (for ISIS 15770) is then used as the exclusion separation concentration for new oligonucleotides in subsequent experiments for such a cell line. If 80% inhibition is not reached, the lowest concentration of positive control oligonucleotide resulting in 60% inhibition of H-ras or c-raf mRNA is then used as the separation concentration by exclusion of the oligonucleotide in subsequent experiments for such a cell line. If 60% inhibition is not reached, such a particular cell line is considered to be unsuitable for oligonucleotide transfection experiments.

Example 10: Survivin Expression Oligonucleotide Inhibition Analysis The antisense modulation of survivin expression can be evaluated in a variety of ways known in the art. For example, survivin mRNA levels can be quantified by, for example, Northern blot technique analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is currently preferred. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. RNA isolation methods are taught in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 1, pp. 4.1 .1 -4.2.9 and 4.5.1 -4.5.3, John Wiley & Sons, Inc., 1993. Analysis of Northern immunoblot technique is routine in the art and is taught in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1 -4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently performed using the commercially available ABI PRISM 7700 sequence detection system, available from PE-Applied Biosystems, Foster City, CA and used in accordance with the instructions of maker. Other PCR methods are also known in the art. The survivin protein levels can be quantified in a variety of ways well known in the art, such as immunoprecipitation, western blotting (immunoblot), ELISA or fluorescence activated cell sorting (FACS) analysis. Antibodies directed to survivin can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Ml), or they can be prepared by means of conventional antibody generation methods. Methods for the preparation of polyclonal antiserum are taught in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 2, pp. 1 1 .12.1 -1 1 .12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 2, pp. 1 1 .4.1 -1 1 .1 1 .5, John Wiley & Sons, Inc., 1997. Immunoprecipitation methods are standard in the art and can be found in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 2, pp. 1 0.16.1 -10.16.1 1, John Wiley & Sons, Inc., 1998. Analysis of Western immunoblotting technique (immunoblotting) is standard in the art and can be found in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1 - 10.8.21, John Wiley & Sons, Inc., 1 997. Immunosorbent assays linked to the enzyme (ELISA) are standard in the art and can be found in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 2, pp. 1 1 .2.1 - 11.2.22, John Wiley & Sons, Inc., 1991.

Example 11: Poly (A) + mRNA Isolated Poly (A) + mRNA was isolated in accordance with Miura et al. , Clin. Chem., 1 996, 42, 1758-1764. Other methods for poly (A) + mRNA isolate are taught in, for example, Ausubel, F. M. et al. , Current Protocols in Molecular Biology, Volume 1, pp. 4.5.1 -4.5.3, John Wiley & Sons, Inc., 1993. Briefly, for cells growing in 96-well plates, the growth medium is removed from the cells and each well is washed with 200 μL of cold PBS. 60 μL of lysis buffer was added (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadil-ribonucleoside complex) to each well, the plate is shaken gently and then incubated at room temperature for five minutes. 55 μL of lysate is transferred to 96-well plates coated with Oligo d (T) (AGCT Inc., Irvine CA). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was immunoblotted on paper towels to remove the excess wash buffer and then air dried for 5 minutes. 60 μL of elution buffer (5 mM Tris-HCl pH 7.6), previously heated to 70 ° C was added to each well, the plate was incubated on a plate heated at 90 ° C for 5 minutes, and the eluate was transferred. then to a fresh 96-well plate. Cells growing in 100 mm plates or another standard can be treated similarly, using appropriate volumes of all solutions.

Example 12: Total RNA Isolate Total mRNA was isolated using a RNEASY 96 kit and buffer solutions purchased from Qiagen, Inc. (Valencia, CA) following the procedures recommended by the manufacturer. Briefly, for cells growing in 96-well plates, the growth medium is removed from the cells and each well is washed with 200 μL of cold PBS. 100 μL of RLT buffer is added to each well and the plate is shaken vigorously for 20 seconds. Then 100 μL of 70% ethanol are added to each well and the contents are mixed by pipetting three times up and down. The samples are then transferred to the RNEASY 96-well plate linked to a QIAVAC manifold equipped with a waste collection tray and linked to a vacuum source. The vacuum is applied for 15 seconds. 1 mL of RW1 buffer was added to each well of the RNEASY 96 plate and the vacuum was applied again for 15 seconds. 1 mL of RPE buffer is then added to each well of the RNEASY 96 plate and the vacuum is applied for a period of 15 seconds. The RPE buffer was then repeated and the vacuum was applied for an additional 10 minutes. The plate was then removed from the QIAVAC manifold and dried by immunoblotting on paper towels. The plate was replaced with a QIAVAC manifold equipped with a collection tube grid containing 1 .2 mL collection tubes. The RNA is then eluted by pipetting 60 μL of water into each well, incubated 1 minute, and then applying the vacuum for 30 seconds. The elution step is repeated with an additional 60μL of water. Example 13: Real-time quantitative PCR analysis of survivin mRNA levels Quantification of survivin mRNA levels is determined by quantitative real-time PCR using the ABI PRISM 7700 sequence detection system (PE-Applied Biosystems, Foster City , CA) according to the manufacturer's instructions. This is a fluorescent, non-gel-based, closed-tube detection system that allows high-throughput quantification of the polymerase chain reaction (PCR) products in real time.

In contrast to the standard PCR, in which the amplification products are quantified after the PCR has been completed, the products in the quantitative real-time PCR are quantified when they accumulate. This is done by including in the PCR reaction an oligonucleotide probe that combines in its base pairs specifically between the forward and reverse PCR primers, and contains two fluorescent pigments. A reporter pigment (e.g., JOE or FAM, obtained either from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) is bonded to the 5 'end of the probe and a quencher pigment (e.g. , TAMRA, obtained either from Operon Technologies Inc., Alameda, CA or PE-Applied Biosystems, Foster City, CA) is linked to the 3 'end of the probe. When the probe and the pigments are intact, the reporter pigment emission is turned off by the proximity of quencher pigment 3 '. During amplification, the combination in its base pairs of the probe to the target sequence creates a substrate that can be split by the 5'-exonuclease activity of the Taq polymerase. During the extension phase of the PCR amplification cycle, the cleavage of the probe by Taq polymerase releases the reporter pigment from the rest of the probe (and therefore from the quenching portion) and generates a fluorescent signal specific to the sequence. With each cycle, additional reporter pigment molecules are unfolded from their respective probes, and the fluorescence intensity is monitored at regular intervals (six seconds) by laser optics incorporated in the ABI PRISM 7700 sequence detection system. In each assay, a series of parallel reactions containing serial dilutions of mRNA from the untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of the test samples. PCR reagents were obtained from PE-Applied Biosystems, Foster City, CA. The RT-PCR reactions are carried out by adding 25 μL of PCR cocktail (buffer solution A 1 x TAQMAN, 5.5 mM MgCl2, 300 μM of each of dATP, dCTP and dGTP, 600 μM of dUTP, 100 nM of each of forward primer, reverse primer, and probe, 20 Units of RNAse inhibitor, 1.25 AMPLITAQ GOLD unit, and 12.5 MuLV reverse transcriptase units) to 96-well plates containing 25 μL of poly (A) mRNA solution. The RT of the reaction was carried out by incubation for 30 minutes at 48 ° C. After 10 minutes of incubation at 95 ° C to activate the AMPLITAQ GOLD, 40 cycles of a two-step PCR protocol were carried out: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes ( combination in its base / extension pairs). Probes and primers for human survivin are designed to hybridize to a human survivin sequence, using the published sequence information) GenBank accession number U75285, incorporated herein as SEQ ID NO: 3). For human survivin the PCR primers were: forward primer: AAGGACCACCGCATCTCTACA (SEQ ID NO: 4) reverse primer: CCAAGTCTGGCTCGTTCTCAGT (SEQ ID NO: 5) and the PCR probe was: FAM-CGAGGCTGGCTTCATCCACTGCC-TAMRA (SEQ ID NO: 6) where FAM (PE-Applied Biosystems, Foster City, CA) is the fluorescent pigment reporter) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quenching pigment. For human GAPDH the PCR primers were: forward primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 7) reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 8) and the PCR probe was: 5 'JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3' (SEQ ID NO: 9) where JOE (PE-Applied Biosystems, Foster City, CA) is the fluorescent pigment reporter) and TAMRA (PE-Applied Biosystems, Foster City, CA) is the quenching pigment.

Example 14: Analysis of western immunoblot technique of survivin protein levels Western blot analysis is carried out using standard methods. The cells are harvested 16-20 hours after the treatment of the oligonucleotide, washed once with PBS, suspended in Laemmli buffer (100 μl / well), boiled 5 minutes and loaded on a 16% SDS-PAGE gel. . The gels are run for 1.5 hours at 150 V, and are transferred to the membrane by Western immunoblotting. The appropriate primary antibody directed to survivin is used, with a radiolabelled or fluorescently labeled antibody secondarily directed against the primary antibody species. The bands are visualized using a PHOSPHORIMAGER ™ (Molecular Dynamics, Sunnyvale, CA).

Example 15: Design and separation by exclusion of double-stranded antisense compounds (siRNA) directed to survivin In accordance with the present invention, a series of double-stranded oligomeric compounds (siRNA) comprising the antisense compounds of the present invention and their complements they can be designed to target survivin. The nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide directed to survivin as described herein. The ends of the strands can be modified by the addition of one or more natural or modified nucleobases to form a drapery. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to any terminal. For example, in one embodiment, both threads of the dsRNA duplexes may be complementary to the central core, each having plugs in one or both terminals. For example, a duplex comprising an antisense strand having the sequence: CGAGAGGCGGACGGGACCG (SEQ ID NO: 10) and having a two nucleobase deoxythymidine (dT) envelope will have the following structure: cgagaggcggacgggaccgTT Antisense (SEQ ID NO: 1 1) TTgctctccgcctgccctggc Complementary (SEQ ID NO: 12) As shown, this double-stranded compound represents the canonical siRNA. In another embodiment, the duplex comprising an antisense strand having the same sequence CGAGAGGCGGACGGGACCG (SEQ ID NO: 10) can be prepared with blunt ends (no single-strand drapery) as shown: cgagaggcggacgggaccg Antisense (SEQ ID NO: 10) Complementary gctctccgcctgccctggc (SEQ ID NO: 13) As shown, this strand compound double represents the blunt-ended siRNA. The strands of RNA of the duplex can be synthesized by methods described herein or purchased from Dharmacon Research Inc., (Lafayette, CO). Once synthesized, the complementary strands are combined in their base pairs. The single strands are processed in aliquots and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15 uL of a 5X solution of combination buffer at its base pairs. The final concentration of the buffer solutions is 1 00 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90 ° C and then centrifuged for 15 seconds. The tube is allowed to stand for 1 hour at 37 ° C at which time the dsRNA duplexes are used in the experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored in frozen (-20 ° C) and freeze-thaws up to 5 times.

Once prepared, the antisense duplex compounds (siRNA) are evaluated for their ability to modulate the expression of survivin in accordance with the protocols described herein.

Cell Culture Conditions, Determination of IC50 Values for in vitro dsRNA The IC50 values in vitro for dsRNAs of the present invention can be determined by contacting in vitro varying concentrations of the dsRNAs and appropriate cell lines, tissues, or organs exhibiting pathologies associated with the expression or overexpression of survivin, and to determine the quantitative effects of these dsRNA at such concentrations in parameters that include, but are not limited to, several steps, steps, or aspects of the pathology or pathogenesis of survivin. Representative parameters that can be studied include, for example, translation of survivin mRNAs or survivin protein synthesis; effect on surrounding markers; or any other parameter that indicates the therapeutic effectiveness of the potential dsRNA that can be conveniently measured in vitro. Given the state of the art, it would be possible for someone of ordinary experience to either adapt the assays based on currently existing cells, or to develop completely novel in vitro assays, to determine the IC50 values for the dsRNAs described herein without undue experimentation.

Western blot techniques: For analysis of western blotting technique, the cells form plates in 1 cm tissue culture dishes (Falcon, # 3003) at a density of 7.5X105 cells / dish. For the RT-PCR analysis, 96 well plates (Corning Incorporated, # 3596) with 1X104 cells / well are placed. The lipofectin transfection reagent (GIBCO / Invitrogen) is used at a concentration of 3ul / ml medium of OPTIMEM reduced serum (Gibco / lnvitrogen) / 100nM siRNA duplex. The reagent is incubated with OPTIMEM medium for 30 minutes before the addition of siRNA. The desired amount of siRNA is added and mixed. Additional 1: 1 dilutions are made in OPTIMEM. The cells are washed twice with saline buffered in 1 X phosphate and then treated with the siRNA / Lipofectin mixture in OPTIMEM. After an incubation period of 4 hours, the OPTIMEM medium is replaced with complete growth medium. The cells are harvested after an additional 16-20 hours for Western technique or RT-PCR analysis. At the end of the incubation period, the culture medium is removed and the cells are washed twice with PBS. The cells are lysed in RIPA buffer (20 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM NaCl, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, and 1% Nonidet P40) plus inhibitor tablets. Complete ™ protease (Roche, # 1836153) and 1 mM sodium orthovanadate (Sigma) by directly adding buffer solution to the plate. Those used were collected by scraping, transferring to microfuge tubes and freeing the cell strands by centrifugation at 14,000 rpm for 30 minutes at 4 ° C. Protein concentrations are determined using BCA protein assay reagents (Pierce). Total cellular protein is subjected to SDS-PAGE and transferred into Immobilon-P membranes (Millipore, # IPVH091). The membranes are probed with primary antibodies for survivin (R & D Systems, # AF886) and for β-Actin (Sigma, # A5441). Anti-rabbit Ig antibodies, and anti-mouse Ig linked to horseradish peroxidase, (Pharmacia) are used as secondary antibodies. Antigen-antibody complexes are visualized by membrane incubation in SuperSigmal West Pico chemiluminescent reagents (Pierce) for 5 minutes followed by capture of the chemiluminescence using the Fluor-S imaging device (Biorad) equipped with the cold CCD camera. The protein bands of interest for each sample are quantified using the Quantity One software (Biorad). The percent inhibition for each of the samples is calculated by comparing the survivin / Actin protein ratio for the untreated control. The IC50 is derived from the non-linear regression analysis of the percentage of inhibition data using the GraphPad Prism software (GraphPad Software). RNA isolate: Total RNA was isolated using the RNeasy® 96 kit in accordance with the recommended protocol (Qiagen). Briefly, the cells are washed with 200 ul of PBS after removing the growth medium. After washing, 100 μl of RTL buffer is added, the plate is shaken vigorously for about 20 seconds. Each well is filled with 100 μl of 70% ethanol and mixed by pipetting up and down three times. The samples are then applied to the wells of the RNeasy 96 plate placed in the upper QIAvac base of the QIAVAC 96 manifold, which is linked to the vacuum source. The vacuum is applied for 30 seconds or until the transfer is complete. To each well, add 80 μl of incubation mixture DNase I (20 mM Tris-HCl, pH 8.4, 2 mM MgCl2, 50 mM KCl and 225 Units / ml DNase I from Invitrogen) and incubate at room temperature for 30 minutes. The buffer solution RW1 (1 ml / well) is added and the vacuum is applied for 30 seconds. The RPE buffer (1 ml / well) is added to each well and the vacuum is applied for 30 seconds. The stages of washing with buffer RW1 and RPE1 are repeated once more. The plate is then removed from the collector and grouped dry on paper towels. The plate is placed back on the QIAVAC manifold and the vacuum is applied for 10 minutes. To elute the RNA, 30 μl of RNase-free water are added directly onto the . membrane of each well, incubate for 1 minute and apply vacuum for 30 seconds. In order to maximize recovery of total RNA, the elution step is repeated with an additional 30 μl / well of RNase-free water.

Quantification of survival: The quantification of survivin and GAPDH levels of mRNA is determined by quantitative RT-PCR in real time using the ABI PRISM® 7900 sequence detection system (Applied Biosystems). RT-PCR reactions are carried out by adding 15 ul of TaqMan one-step PCR master mix reagents (Applied Biosystems, # 4309169) (containing 100 nM of each of the forward primer and reverse primer, and 200 nM probe) to 96-well plates with 10 μl of total RNA. For human survivin, the forward PCR primer is: 5'GCACCACTTCCAGGGTTTATTC3 '(SEQ ID NO: 186), and the reverse primer is: 5 CTCCTTTCCTAAGACATTGCTAAGG3' (SEQ ID NO: 187). The TaqMan Survivin probe used is 5 '(FAM) TGGTGCCACCAGCCTTCCTGTG3' (SEQ ID NO.188) (Biosearch Technologies, Inc.). This primer-probe assembly, designated for SEQ ID No. 14, is used for all experiments in Examples 15 through to the end. For human GAPDH, the TaqMan GAPDH control reagent kit (Applied Biosystems, # 402869) is used. The percent inhibition for each sample is calculated by purchasing the survivin / GAPDH mRNA ratio for the survivin / GAPDH mRNA sample from the untreated control. The IC50 is derived from the non-linear regression analysis of the percentage of inhibition data using the GraphPad Prism software (GraphPad Software).

Example 16: Design of phenotypic assays and in vivo studies for the use of survivin inhibitors Phenotypic assays Once the active oligomeric compounds that direct survivin have been identified by the methods described herein, the compounds are further investigated in one or more phenotypic assays, each of which measures predicted endpoints of efficacy in the treatment of a particular disease state or condition. Trials, kits and phenotypic reagents for use are well known in the art and are used herein to investigate the role and / or association of survivin in health and disease. Representative phenotypic assays, which can be purchased from any of the commercial vendors, including those to determine cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, OR; PerkinElmer, Boston, MA), protein-based assays that include Enzymatic assays (Panvera, LLC, Madison, WL, BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor , Ml), triglyceride accumulation (Sigma-Aldrich, St. Louis, MO), angiogenesis assays, tube formation assays, cytosine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ). In a non-limiting example, cells determined to be appropriate for a particular phenotypic assay (ie, MCF-7 cells selected from breast cancer studies, adipocytes for obesity studies) are treated with survivin inhibitors identified from the studies in in vitro as well as control compounds at optimal concentrations that are determined by the methods described above. At the end of the treatment period, the treated and untreated cells are analyzed by one or more specific methods by the assay to determine results and phenotypic endpoints. The phenotypic endpoints include changes in cell morphology over time or dose of treatment as well as changes in the levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Cell-state measurements that include pH, cell cycle stage, absorption or excretion of biological indicators by cells are also endpoints of interest. Analyzes of the cell genotype (measured as the expression of one or more of the cell's genes) after treatment are also used as an indicator of the efficacy or potency of survivin inhibitors. The distinctive genes, or those genes that are suspected to be associated with a disease state, condition, or specific phenotype, are measured in both treated and untreated cells.

Example 17: Modulation of the expression of human survivin by double-stranded RNA (dsRNA) In accordance with the present invention, a series of double-stranded oligomeric compounds comprising the antisense compounds of the present invention and their complements thereof are designed to direct survivin mRNA. The sense strand of the dsRNA is designed and synthesized as the reverse complement of the antisense strand, a list of which is shown in Table 1. The oligomeric compounds are evaluated in HeLa cells. The culture methods used for HeLa cells are found, for example, at www.atcc.org. For cell growths in 96-well plates, the cells are washed once with 200 μL of serum medium reduced with OPTI-MEM-1 ™ (Gibco BRL) and then treated with 130 μL of OPTI-MEM-1 ™ which contains 12 μg / mL of LIPOFECTIN ™ (Gibco BRL) and the desired dsRNA at a final concentration of 25 nM. After 5 hours of treatment, the medium is replaced with fresh medium. The cells are harvested 16 hours after treatment with dsRNA, at which time the RNA is isolated and the directed reduction is measured by RT-PCR as described above. The antisense sequences of the oligomeric dsRNA compounds are shown in Table 1. Prior to the treatment of HeLa cells, the dsRNA oligomers are generated by combining in their base pairs the antisense and sense strands according to the method summarized in Example 16. The target sites are indicated by the first nucleotide number ( 5 'majority), as given in the reference sequence source (Genbank accession number NM_001 168.1, incorporated herein as SEQ ID NO: 14), to which the antisense strand of the dsRNA oligonucleotide is linked. All compounds in Table 1 are dsRNA, 20 nucleotides in length with the antisense strand listed first (upper strand) in the 5 'to 3' orientation, and the second listed sense strand (bottom strand), also in the 5-y direction. 'to 3'. All nucleosides are ribose and the back-up ligations are phosphate (P = O). "Target site" refers to the 5 'position of the target region in the survivin mRNA to which the antisense strand is directed. As such, these compounds are blunt-ended siRNA. The data are obtained by quantitative real-time PCR as described herein. HeLa cells are treated with double-stranded oligomeric compounds (antisense strand compounds hybridized to their corresponding sense strands) that direct human survivin mRNA.

Table 1 Inhibition of human survivin mRNA levels by oligomeric dsRNA compounds All dsRNA compounds except ISIS 339046, 339047, 339053, 339065, 339068 and 339072 demonstrate more than 45% inhibition of survivin expression. In a dose response experiment, HeLa cells are treated with 1.1, 3.3, 10 and 30 nM of the indicated oligonucleotide mixed with 3 ug / mL of LIPOFECTIN per 100 nM of oligonucleotide as described by other examples herein . The untreated cells serve as controls. After 16 hours of treatment, the RNA is prepared from the cells for subsequent real-time PCR analysis.

The levels of mRNA expression of human survivin are quantified by real-time PCR and the amounts of target genes are normalized using Ribogreen as described in other examples herein. The data are averages of two experiments and are shown in Table 2. The identity of the two strands of the duplex are shown separated by an underline, with the antisense strand shown first (antisense strand sense).

Table 2 Inhibition of mRNA levels of human survivin by oligomeric dsRNA compounds: dose response.

As shown in Table 2, the tested compounds inhibit the expression of human survivin mRNA in HeLa cells in a concentration dependent manner.

Example 18: Modulation of human survivin expression by double-stranded RNA (dsRNA) with an d-phosphate cap In accordance with the present invention, a series of double-stranded oligomeric compounds comprising the antisense compounds shown in the Table 1 (ISIS 339045-339073), each modified with a 5 'terminal phosphate group, and the complements thereof, were designed to direct survivin mRNA. The corresponding dsRNA compounds are ISIS 341201 -341229 (Table 3). The sense strand of the dsRNA is designed and synthesized as the complement of the antisense strand, a list of which is shown in Table 2. The oligomeric compounds are evaluated in HeLa cells. The culture methods used for HeLa cells are found, for example, at www.atcc.org. For cell growth in 96-well plates, the wells are washed once with 200 μL of reduced serum medium in OPTI-MEM-1 ™ (Gibco BRL) and then treated with 130 μL of OPTI-EM-1 ™ which contains 12 μg / mL LIPOFECTIN ™ (Gibco BRL) and the desired dsRNA at a final concentration of 25 nM. After 5 hours of treatment, the medium is replaced with fresh medium. The cells are harvested 16 hours after treatment with dsRNA, at which time the RNA is isolated and the target reduction is measured by RT-PCR. The oligomeric dsRNA compounds are shown in Table 3. Prior to the treatment of HeLa cells, the dsRNA oligomers are generated by combining the antisense and sense strands in accordance with the method summarized in Example 17 in their base pairs. Target sites are indicated by the first nucleotide number (5 'majority), as given in the reference sequence source (Genbank accession number NM_001 168.1, incorporated herein as SEQ ID NO: 14), to which the antisense strand of the oligonucleotide dsRNA is ligated. All compounds in Table 3 are oligoribonucleotides, 20 nucleotides in length with the antisense strand shown first, and the second sense strand shown, both in the 5 'to 3' direction. The compounds in Table 3 have phosphate backings (P = O) and also comprise a terminal 5 'phosphate cap in each strand. The compounds in Table 3 are blunt-ended siRNA. The data is obtained by quantitative real-time PCR as described in the other examples herein. HeLa cells are treated with double-stranded oligomeric compounds that direct human survivin mRNA.

Table 3 Inhibition of human survivin mRNA levels by dsRNA oligomeric compounds with a 5 'phosphate closure All dsRNA compounds except ISIS 341203, 341209, 341221, 341224 and 341225 demonstrate more than 40% inhibition of survivin expression. These data suggest that in certain target sites, the double-stranded compounds with a 5 'phosphate exhibit greater potency to inhibit the expression of survivin (compare Tables 1 and 3).

Example 19: Comparison of siRNA constructs targeting the same survivin mRNA site: dose response In accordance with the present invention, the effects of altering the sequence of ISIS 339048 on the inhibition of human survivin mRNA were investigated. HeLa cells. ISIS 343867 (5'-UUUGAAAAUGUUGAUCUCC-3 ': SEQ ID NO: 81) is the antisense strand for blunt-ended siRNA linked to the same site in survivin mRNA as ISIS 339048, the difference being that ISIS 343867 is a compound 19 -mer that lacks the 5 'terminal adenine residue of ISIS 339048. ISIS 341881 (UUUGAAAAUGUUGAUCUCCTT; SEQ ID NO: 82) is the antisense strand for a canonical siRNA linked to the same site in survivin mRNA as ISIS 339048, the difference being that ISIS 341881 contains a dTdT (deoxythymidine-deoxythymidine) at the 3 'end ( "hanging dTdT"). ISIS 343868 has the sequence 5'-GGAGAUCAACAUUUUCAAA-3 '(SEQ ID NO: 83), and is the sense strand corresponding to ISIS 343867. ISIS 341 880 (SEQ ID NO: 84) is the corresponding strand corresponding to ISIS 341881. The constructs are shown in Table 4 with the antisense strand shown first followed by the sense strand, both in 5 'to 3' orientation. The sequences of the survivin siRNA constructs are shown in Table 4, and the results of dose response are shown in Table 5.

Table 4 RNAi constructs tested in dose response experiments in HeLa cells for inhibition of mRNA expression of human survivin Table 5 Inhibition of mRNA levels of human survivin by siRNA oligomeric compounds that direct the same site of survivin mRNA: dose response As shown in Table 5, the tested compounds inhibit the expression of human survivin mRNA in HeLa cells in a dose-dependent manner. ISIS 343867 and ISIS 341881 are more effective in inhibiting mRNA levels of survivin in all but the lower doses, which indicate that the 19-atom blunt-ended ATNsi or 21-canonical siRNA with a dTdT modification in the 3 'ending may be advantageous modifications of ISIS 339048, the blunt-ended 20-mer siRNA. The IC50 (nM) values of these three compounds are as follows: blunt-ended siRNA (20-mer) 339048_339078, 0.28 nM; Blunt end siRNA (19-mer) 343867_343868, 0.19 nM and canonical siRNA 341881_341880, 0.15 nM. IC5o is defined as the concentration of oligomeric compound that results in a 50% inhibition of mRNA (or protein) expression compared to an untreated control. From these data, canonical siRNA and blunt-ended siRNA (19-mer) both perform significantly better than blunt siRNA (20-mer).

Additional blunt constructs targeting human survivin: modified compounds: A series of siRNA compounds directing human survivin (GenBank Accession No. NM_01 168.1, SEQ ID NO: 14) are designed and shown in Table 6 in the orientation 5 'to 3'. TABLE 6 siRNA Compounds targeted to human survivin The modifications to the sequences in Table 6 are as follows: ISIS 346272: all ribose, all ligatures P = O ISIS 346279-346281, 346286, 346287: all ligatures P = S ISIS 346282-346284, 346289 and 346290: alternatively ligatures P = O / P = S, starting with P = O ISIS 346291, 346292, 346294, 346295 and 346296: alternatively ligatures P = S / P = O; starting with P = S ISIS 348310: all ribose with Column P = O ISIS 352505: 2'-O-methylribose in positions 5, 8, 11, 14 and 17-19.

Column P = O ISIS 352506: 2'-O-methylribose in positions 6, 7, 10, 11 and 17-19. Column P = O ISIS 352507: 2'-O-methylribose at positions 1, 3, 5, 7, 9, 1 1, 13, , 17 and 1 9. Column P = O. ISIS 352508: 2'-MOE at positions 5, 8, 1 1 and 14; 2'-O-metiI in the position 17-19. Column P = O ISIS 352509: 2'-MOE in positions 4, 9 and 18. Column P = O. ISIS 35251 0: 2'-MOE in positions 1, 3, 5, 7, 9, 1 1, 13, 15, 17 and 19. Column P = O ISIS 35251 1: 2'-MOE in positions 2, 4, 6, 8, 10, 12, 14, 16, and 18.

Column P = O ISIS 352512: 2'-O-methyl in each position, Column P = O. ISIS 352513: 2'-O-methyl in positions 2-1 8. Column P = O. ISIS 352514: 2'-MOE in positions 2, 4, 6, 8, 10, 12, 14, 16, and 1 8, Column P = O ISIS 352515: 2'-O-methylribose at positions 15-1 9. Column P = O. ISIS 352516: P = S binder in bonds 1 -7, P = O binder in binder 8-1 8. ISIS 353537: 4'-thioribose in positions 1 -3 and 17-19, Column P = O ISIS 353538: 4'tioribose in positions 3, 9, 12 and 17-19, Column P = O.

ISIS 353539: 4'-thioribose at positions 1 -3, 9 and 12; 2'-O-methylribose at positions 17-19, Column P = O. ISIS 353540: 4'-thioribose at positions 1 -3; 2'-O-methylribose at positions 17-19, Column P = O. ISIS 355710: 2'-ara-fluoro-2'-deoxyribose at positions 1-5; 2'-O-methylribose at positions 15-19, Column P = O. ISIS 355711: 2'-ara-fluoro-2'-deoxyribose at positions 1 -5, 8, 9 and 12-16; 2'-O-methylribose in positions 6, 7, 10, 1 1 and 17-19, Column P = O ISIS 355712: LNA at positions 5, 8, 11, 14, 2'-O-methyl at 17-19.

Column P = O ISIS 355713: alternative 2'-O-methylribose / 2'-ara-fluoro-2'-deoxyribose, starting with 2'OMe in position 1. Column P = O ISIS 355714: 2'-O-methylribosa / 2'-ara-fluoro-2'-deoxyribose alternative, starting with 2'-ara-fluoro at position 1. Column P = O ISIS 355715: LNA in positions 4, 9, 18. Column P = O. ISIS 355716: LNA in positions 1, 2, 6, 1 1, 20. Column P = O.

Example 20: Modulation of human survivin expression by single-stranded RNAi compounds A series of single-stranded oligomeric compounds (RNAs) is evolved for its ability to inhibit human survivin in endothelial cells of the human umbilical vein (HUVEC). The cultivation methods used for the HUVEC can be found, for example, at www.atcc.org.

The sequences for the oligomeric compounds of RNAs are shown in Table 7. The target sites are indicated by the first nucleotide number (5 'in the majority), as given in the reference sequence source (accession no. Genbank NM_001 168.1, incorporated herein by reference to SEQ ID NO: 14), to which the RNANA oligonucleotide is linked. All compounds in Table 7 are oligoribonucleotides, 20 nucleotides in length have the phosphorothioate backbones through and a terminal phosphate at the 5p end, and all are described in the 5 'to 3' direction. The data is obtained by quantitative real-time PCR as described in other examples herein.

Table 7 Inhibition of mRNA levels of human survivin by oligomeric RNAA compounds As shown in Table 7, all RNAse compounds demonstrate at least 44% inhibition of survivin expression.

Example 21: Inhibition of survivin mRNA expression in HeLa cells using dsRNA constructs for human survivin Several dsRNA constructs were tested on HeLa cells as described above using the human survivin primer probe set (SEQ IDs 186-188) to determine the effect of PS substitution on ISIS 343867 19-mer (SEQ ID NO: 81), 339048 20-mer (SEQ ID NO: 23), and the effect of 2'-O-methyl chemistries ( 2'-OMe), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE) and 4'-thio (4'-S). The results are shown in Tables 8 and 9. The first ISIS number is the antisense strand, and the second ISIS number is the sense strand.

Table 8 Inhibition of human survivin mRNA levels by blunt siRNA algometric compounds: effect of PS substitution in 19-mer These data illustrate that the 19-mer blunt-phosphodiester siRNA is more effective in inhibiting the expression of survivin and has an IC50 ten times smaller than its 20-mer counterpart (comparison lines A and B). Additionally, its increased potency, as measured by IC50, is lost when the back-up ligatures are replaced by complete phosphorothioate ligations. However, the target reduction remains (comparison lines A and C). It is also shown that the re-introduction of phosphodiester bonds in the antisense strand in an alternative register results in the recovery of efficacy, as measured by the reduced IC50 values, but not at the level of the complete P = O Column (e.g. , comparison lines D and H). Finally, the alternative phosphodiester / phosphorothioate ligatures in each strand when they are in the opposite register (P = O in an opposite strand P = S in the other) have the greatest effect on IC50 values and expression levels, which results in values that are better than the optimal native construct (comparison lines I and A).

Table 9 Inhibition of human survivin mRNA levels by blunt-end siRNA oligomeric compounds: effect of PS substitution in 20-mer These data suggest that, in contrast to the 19-mers, the blunt-end 20-mers have a higher tolerance for the phosphorothioate backup modifications in both strands with full 20-mer IC50 values P = S being comparable with 20- grouper with P = 0 complete in both strands (comparison lines B and C). However, both 20-mer constructs fail APRA to perform the 1C50 observed with the 19-mer (comparison lines B and C up to line A). Surprisingly, the presence of ligatures Nternucleoside alternatives in opposite registers (P = O in a strand opposite to P = S in the other) is able to reduce the IC50 to that seen with the native P = O 19-mer construct (comparison lines I and A ).

Effects of chemical modifications to sugar A series of blunt-ended siRNA is designed to investigate the effect of sugar modifications on the ability of double-stranded compounds to inhibit the expression of human survivin mRNA. The study was performed on HeLa cells as described in other examples herein and mRNA levels are determined by RT-PCR. Modifications to the compounds were as follows: ISIS 35251 1 comprising 2'-O-methyl modifications (underlined) at positions 2, 4, 6, 8, 10, 12, 14, 16 and 18. ISIS 352512 comprising 2'-O-methyl modifications (underlined) at each 2 'site.

ISIS 355714 comprising modifications of 2'-fluoro (in NEGRITE) at positions 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19; and 2'-O-methyl modifications at positions 2, 4, 6, 8, 10, 12, 14, 16 and 18. ISIS 352514 comprising alternative modifications of 2'-MOE at positions 2, 4, 6, 8, 10, 12, 14, 16 and 18. All other compounds are native RNA compounds. The results are shown in Table 10.

Table 10 Inhibition of mRNA levels of human survivin by oligomeric siRNA compounds: effect of sugar modifications These data suggest that double-stranded compounds containing alternative portions of 2'F and 2'OMe are optimal constructs for the inhibition of human survivin expression. Example 22: Dose response experiments in HeLa cells using dsRNA constructs for human survivin In a dose response experiment, heLa cells are treated with 0.02, 0.2, 2.0 and 20.0 nM of the indicated dsRNA oligonucleotide mixed with μg / mL of LIPOFECTIN per 100 nM of oligonucleotide as described by the other examples herein. The untreated cells serve as controls. After 16 hours of treatment, the RNA is prepared from the cells by subsequent real-time PCR analysis. The levels of mRNA expression of human survivin are quantified by real-time PCR and the target gene amounts are normalized using Ribogreen as described in other examples herein. The data are averages of two experiments shown in Table 11. The Isis number of the antisense strand is shown first, followed by the Isis number of the sense strand (antisense_ sense).

Table 11 Inhibition of human survivin mRNA levels by oligomeric dsRNA compounds: dose response As shown in Table 11, many of the dsRNA compounds inhibit the expression of human survivin mRNA in HeLa cells in a dose-dependent manner.

Example 23: Dose response experiments in HeLa cells using dsRNA constructs for human survivin In a dose response experiment, HeLa cells are treated with 0.014, 0.04, 0.12, 0.37, 1.1, 3.33, 10 and 30 nM of the indicated dsRNA oligonucleotide mixed with 3 μg / mL of LIPOFECTIN per 100 nM of oligonucleotide as described by the other examples herein. The untreated cells serve as controls. After 16 hours of treatment, the RNA is prepared from the cells by subsequent real-time PCR analysis. The levels of mRNA expression of human survivin are quantified by real-time PCR and the target gene amounts are normalized using Ribogreen as described in other examples herein. The data are averages of two experiments shown in Table 12. The Isis number of the antisense strand is shown first, followed by the Isis number of the sense strand (antisense_ sense).

Table 12 Inhibition of mRNA levels of human survivin by oligomeric dsRNA compounds: dose response As shown in Table 12, most dsRNA compounds inhibit the expression of human survivin mRNA in HeLa cells in a dose-dependent manner.

Example 24: Survival dose-dependent inhibition of survivin mRNA in U-87 MG cells Double-stranded compounds were tested for their ability to inhibit mRNA expression of human survivin in U-87 MG cells using the methods described above . Several dsRNA constructs targeting human survivin were tested at concentrations of 0.0019 nM, 0.0096 nM, 0.048 nM, 0.24 nM, 1.2 nM, 6.0 nM, 30.0 nM and 150.0 nM. The results are summarized in Table 13. The Isis number of the antisense strand is shown first, followed by the Isis number of the sense strand (antisense_ sense).

Table 13 Dose-dependent inhibition of mRNA expression of human survivin with dsRNA compounds As shown in Table 13, most dsRNA compounds inhibit the expression of human survivin mRNA in U-87 MG cells in a dose-dependent manner.

Example 25: Inhibition of survivin by canonical siRNA oligonucleotides A series of canonical siRNAs were designed to direct human survivin. Each of the survivin-specific dsRNA sequences and described below contain two deoxythymidine nucleotides at the 3 'terminal end of each strand of the RNA oligonucleotide duplex (not shown). Briefly, the duplex formation and purification of gene-specific siRNAs is performed by Dharmacon Research Inc. in the Table, "Position" refers to the position of the gene to which the antisense strand of the dsRNA is linked.

Each sequence in the table is listed so that the antisense strand (upper strand) is written in the 5 'to 3' direction; its complementary sense strand (bottom strand) is also written in the 5 'to 3' direction.

Table 14 Canonical siRNA oligonucleotides designed to target human survivin 15 20 10 15 20 Compounds U17, U20, U23, U36, U48, and U54, when tested for survivin mRNA inhibition using the above-described RT-PCR and quantitative Western assays, exhibit an IC50 of less than 100 nM. Compound U 17 exhibits potent activity in both quantitative RT-PCR analysis and Western analysis, and is therefore especially preferred for the indications described herein.

Example 26: IC50 values of additional double-stranded compounds directing human survivin. Tables 15 and 16 summarize the IC50 values using various dsRNAs that are made using the methods described herein. The tested constructs comprise the antisense strand in the 5'-3 'orientation, and the sense strand in the 5' to 3 'orientation. In Table 15, "D" is the dose response (mRNA levels) and "W" is the Western immunoblot technique. All internucleoside ligations are phosphodiester unless otherwise noted by a lowercase "s" indicating a phosphorothioate linkage.

Table 15 IC50 data for dsRNA constructs directed to human survivin fifteen twenty Table 16 IC50 values for dsRNA for human survivin Example 27: Measurement of antitumor activity in a human glioblastoma xenograft tumor model One or more of the oligomeric compounds described herein, including dsRNA compounds, were tested for antitumor activity in an animal model known in the art. Two such animal models are (1) human glioblastoma xenograft tumor model U-87MG (Kiaris H, Schally AV, Varga JL, Antagonists of growth hormone-releasing hormone inhibit the growth of U-87MG human glioblastoma in nude mice Neoplasia 2000 May-June; 2 (3): 242-50), and (2) a human melanoma xenograft tumor model YUSAC-2 (Grossman D, Kim PJ, Schechner JS, Altieri DC, Inhibition of melanoma tumor growth in vivo by survivin targeting Proc Nati Acad Sci USA, 2001 January 16; 98 (2): 635-40). A total of 10 CD1 nu / nu mice (Charles River) were used for each group. For the implant, tumor cells are trypsinized, washed in PBS and resuspended in PBS at 6 X 10 7 cells / ml (U-87MG) and at 4 X 1 07 cells / ml (YUSAC-2) in DMEM. Just before the implant, the animals are irradiated (450 TBl) and the cells are mixed in Matrigel (1: 1). A total of 6 X 106 (U-87MG) and 4 X 106 (YUSAC-2) tumor cells in a volume of 0.2 ml are injected subcutaneously (s.c.) on the left flank. Treatment with the oligomeric test compound (dissolved in 0.9% NaCl, injection grade), or an unequal control oligonucleotide (dissolved in 0.9% NaCl) or vehicle (0.9% NaCl) was initiated 3 days after tumor implantation. The compounds are administered intraperitoneally (ip) and intravenously (iv) for studies U-87MG and YUSAC-2 respectively in a volume of 0.2 ml every other day for a total of about 12 doses for the U-87MG study and about 13 dose for the YUSAC-2 study. The length and width of the tumor are measured twice a week, and the volume of the tumor is calculated using the formula: Tumor volume = (L X W2) X 0.536. Tumor volumes are pooled against the days after tumor implanon for each treatment group. Treatment with one or more of the oligomeric compounds retards the growth of melanoma tumor and human glioblastoma when compared to tumor-bearing animals treated with vehicle or 25 mg / kg of unequal control oligonucleotide.

Example 28: Stability of alternative 2'-O-methyl / 2'-fluoro siRNA constructs in mouse plasma The intact duplex RNA was analyzed from the diluted mouse plasma using an extraction and capillary electrophoresis method similar to that previously described (Leeds, JM, et al., 1996, Anal. Biochem., 235, 36-43; Geary, RS, et al., 1999, Anal. Biochem., 274, 241- 248. Mouse plasma treated with heparin, from Balb / c female mice 3-6 months old (Charles River Labs) was thawed from -80 ° C and diluted to 25% (v / v) with phosphate buffered saline (140 mM NaCl, 3 mM KCl, 2 mM potassium phosphate, 10 mM sodium phosphate) Approximately 10 nmol of siRNA previously combined in its base pairs, at a concentration of 100 μM, was added to the plasma at 25% and incubated at 37 ° C for 0, 15, 30, 45, 60, 120, 180, 240, 360, and 420 minutes.The aliquots were removed at the indicated time, treated with EDTA to a concentration fi of 2 mM, and placed on ice at 0 ° C until analyzed by capillary gel electrophoresis (Beckman P / ACE MDQ-UV with DNA capillary tube eCap). The area of the siRNA duplex peak was measured and used to calculate the percentage of remaining intact siRNA. Adesonine triphosphate (ATP) was added at a concentration of 2.5 mM to each injection as an internal calibration standard. A zero time point is taken by diluting the siRNA in phosphate buffered saline followed by capillary electrophoresis. The percentage of intact siRNA was grouped against time, which allows the calculation of a pseudo half-life of the first order. The results are shown in Table 18. Table 17 Stability of blunt end siRNA constructs of 2'-O-methyl / 2'-fluoro in mouse plasma ISIS 353538, the antisense strand contains 4'tio modifications at positions 3, 8, 1 1, 17-19 and pairs with the RNA strand sense that is unmodified. ISIS 355713, the antisense strand contains 2'Omethyl / 2'F modifications alternative to sugar and pairs with a sense strand having alternative 2'F / 2'Omethyl modifications. Alternate modifications are in the opposite register with the antisense strand being modified with 2'Ome in position 1 while the sense strand is modified with 2'F in position 1. It is evident that the 2'-O-methyl / 2'-fluoro construct remains relatively unchanged and is stable in the serum. Various modifications of the invention, in addition to those described herein, will be apparent to those of experience in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.

Claims (71)

1. CLAIMS 1. A double-stranded compound having a first strand and a second strand characterized in that: the first strand is complementary to the nucleic acid molecule encoding human survivin (SEQ ID 14); said second strand is complementary to the first strand; said first and second strands are each 8-80 nucleobases in length; and the double-stranded compound inhibits the expression of human survivin.
2. 2. The double-stranded compound according to claim 1, characterized in that one or both of the strands is 10-50 nucleobases in length.
3. 3. The double-stranded compound according to claim 1, characterized in that one or both of the strands is 12-30 nucleobases in length.
4. 4. The double-stranded compound according to claim 1, characterized in that one or both of the strands is 12-24 nucleobases in length.
5. 5. The double-stranded compound according to claim 1, characterized in that one or both of the strands is 19-23 nucleobases in length.
6. 6. The double-stranded compound according to any of claims 1-5, characterized in that the complementarity between the first strand and the nucleic acid molecule encoding human survivin is at least 70%.
7. 7. The double-stranded compound according to any of claims 1-5, characterized in that the complementarity between the first strand and the nucleic acid molecule encoding human survivin is at least 80%.
8. The double-stranded compound according to any of claims 1-5, characterized in that the complementarity between the first strand and the nucleic acid molecule encoding human survivin is at least 90%.
9. 9. The double-stranded compound according to any of claims 1-5, characterized in that the complementarity between the first strand and the nucleic acid molecule encoding human survivin is at least 95%.
10. 10. The double-stranded compound according to claim 1, characterized in that the first strand is linked to the second strand. eleven .
11. The double-stranded compound according to claim 10, characterized in that the ligation is covalent.
12. 12. The double-stranded compound according to claim 10, characterized in that the ligation is by means of a nucleic acid linker.
13. The double-stranded composite according to claim 10, characterized in that the two strands are self-complementary and form a fork structure.
14. The double-stranded compound according to claim 5, which is an siRNA, characterized in that said siRNA comprises a complementary central portion between the first and second strands and the terminal portions that are optionally complementary between the first and second strands.
15. 15. The siRNA according to claim 14, characterized in that the terminal portions are curtains of 1-6 nucleobases in length located either at the 3 'or 5' terminal of each strand.
16. 16. The siRNA according to claim 14 which is a canonical siRNA, characterized in that the central complementary portion between the first and second strands is 19 nucleobases in length and the terminal portions consist of 3 'overlays of dTdT.
17. 17. The canonical siRNA according to claim 16, characterized in that it comprises the compounds U17, U20, U23, U36, U48 or U54.
18. 1 8. The canonical siRNA according to claim 17, characterized in that it comprises the compound U 17.
19. 19. The double-stranded compound according to claim 5, characterized in that it is a blunt siRNA.
20. 20. The blunt siRNA according to claim 19, characterized in that it is directed to the 3'UTR of human survivin (SEQ ID NO: 14). twenty-one .
21. The compound according to any of claims 1-14, characterized in that it is chemically modified.
22. 22. The compound according to claim 21, characterized in that the chemical modification is to the sugar, nucieobase, or internucleoside binding.
23. 23. The compound in accordance with the claim 22, characterized in that the modification to sugar is a 2 'modification.
24. 24. The compound in accordance with the claim 23, characterized in that the modification to the 2 'sugar is selected from the group consisting of a modification 2'-O-methoxyethyl (2'-MOE), 2'-O-methyl, enucleated nucleic acid (LNA) or 2'-fluoro .
25. 25. The compound according to the claim 23, characterized in that the modification 2 'is a 2'-O-methoxyethyl (2'-MOE).
26. 26. The compound in accordance with the claim 23, characterized in that the modification 2 'is a 2'-O-methyl.
27. 27. The compound in accordance with the claim 23, characterized in that the modification 2 'is 2'-F.
28. 28. The compound in accordance with the claim 23, characterized in that the 2 'modification of the sugar results in a bicyclic sugar.
29. 29. The compound in accordance with the claim 28, characterized in that the bicyclic modification is an enclosed nucleic acid (LNA).
30. 30. The compound in accordance with the claim 22, characterized in that the modification to sugar is 4'tio.
31. 31 The compound according to claim 21, characterized in that it comprises two or more chemically distinct sugar modifications.
32. 32. The compound in accordance with the claim 22, characterized in that it comprises a chemically modified nucleobase.
33. 33. The compound according to claim 32, characterized in that the modified nucleobase is 5-methylcytidine.
34. 34. The compound according to claim 22, characterized in that it comprises at least one modification of internucleoside binding.
35. 35. The compound according to claim 34, characterized in that it comprises ligatures of phosphorothioate and internucleoside phosphorodiester alternatives.
36. 36. The compound according to claim 21, characterized in that it comprises mixed phosphorothioate and phosphodiester bonds.
37. 37. The compound according to claim 21, characterized in that it is a conjugate.
38. 38. The compound according to claim 1, characterized in that it comprises one or more modifications selected from the group consisting of ligatures of phosphorothioate, 2'-fluoro, 2'-O-methyl and 4'-thio.
39. 39. The blunt-ended siRNA according to claim 19, characterized in that it is 19 nucleobases in length.
40. 40. The blunt-ended siRNA according to claim 39 having alternative internucleoside PO / PS ligatures in each strand, characterized in that the ligatures are in the opposite register.
41. 41 The blunt-ended siRNA according to claim 39, having alternative internucleoside PO / PS ligatures in each strand, characterized in that the ligatures are in identical register.
42. 42. The blunt-ended siRNA according to claim 19, characterized in that it is 20 nucleobases in length.
43. 43. The blunt-ended siRNA according to claim 42 having alternative internucleoside PO / PS ligatures in each strand, characterized in that the ligatures are in the opposite register.
44. 44. The blunt-ended siRNA according to claim 42 having alternative internucleoside PO / PS ligatures in each strand, characterized in that the ligatures are in identical register.
45. 45. The blunt-ended siRNA according to claim 19, characterized in that it is 21 nucleobases in length.
46. 46. The blunt-ended siRNA according to claim 19, characterized in that it is 22 nucleobases in length.
47. 47. The blunt-ended siRNA according to claim 19, characterized in that it is 23 nucleobases in length.
48. 48. The siRNA according to claim 15, characterized in that the terminal hanging portion is in one of the terminals 5 'of the strands.
49. 49. The siRNA according to claim 15, characterized in that the terminal hanging portion is in one of the terminals 3 'of one of the strands.
50. 50. The siRNA in accordance with claim 14, characterized in that the central complementary portion is 19 nucleobases in length.
51. 51 The siRNA according to claim 14, characterized in that the central complementary portion is 20 nucleobases in length.
52. 52. The siRNA according to claim 14, characterized in that the central complementary portion is 21 nucleobases in length.
53. 53. The siRNA according to claim 14, characterized in that the central complementary portion is 22 nucleobases in length.
54. 54. The siRNA according to claim 14, characterized in that the central complementary portion is 23 nucleobases in length.
55. 55. A pharmaceutical composition, characterized in that it comprises the compound according to any of claims 1-54 and a pharmaceutically acceptable carrier or diluent.
56. 56. A pharmaceutically acceptable salt characterized in that it is of any of the compounds according to any of claims 1-54.
57. 57. The pharmaceutically acceptable salt according to claim 56, characterized in that it is a sodium salt.
58. 58. The double-stranded compound according to claim 1, characterized in that it has an IC50 of no greater than 1 nM.
59. 59. The double-stranded compound according to claim 1, characterized in that it has an IC50 of no greater than 2 nM.
60. 60. The double-stranded compound according to claim 1, characterized in that it has a 1C50 not greater than 5 nM.
61. 61 A method for the modification of the nucleic acid encoding human survivin (SEQ ID NO: 14), characterized in that it comprises contacting the nucleic acid molecule encoding human survivin with the compound according to any of claims 1-54. nucleic acid molecule encoding human survivin is thereby modified.
62. 62. The method according to claim 61, wherein the modification is characterized in that it unfolds the nucleic acid molecule encoding human survivin.
63. 63. A method for inhibiting the expression of survivin in cells or tissues, characterized in that it comprises contacting the cells or tissues with the compound according to any of claims 1-54.
64. 64. A method for treating a condition associated with the expression or overexpression of survivin, characterized in that it comprises administering to an animal, particularly a human, an effective amount of a compound according to any of claims 1-54.
65. 65. The method according to claim 64, characterized in that the condition is cancer.
66. 66. The method according to claim 65, characterized in that the cancer is selected from the group consisting of hepatocellular cancer, breast cancer, colon cancer, prostate cancer, lung cancer, bladder cancer, ovarian cancer, cancer renal, glioblastoma, pancreatic cancer and non-Hodgkin's lymphoma.
67. 67. A single-stranded RNAi oligonucleotide of 8 to 80 nucleobases in length, characterized in that it hybridizes specifically to the nucleic acid molecule encoding human survivin (SEQ ID NO: 14) and inhibits the expression of the nucleic acid molecule encoding human survivin by acting through the antisense mechanism of RNAi.
68. 68. The single-stranded RNAi oligonucleotide according to claim 67, characterized in that it is from 19 to 23 nucleobases in length.
69. 69. The single-stranded RNAi oligonucleotide according to claim 68, characterized in that it is an antisense RNA.
70. 70. The single-stranded RNAi oligonucleotide according to claim 67, characterized in that it is chemically modified.
71. 71 The single-stranded RNAi oligonucleotide according to claim 70, characterized in that the modification is to the nucleobase, sugar or internucleoside binding.