MXPA04010983A - Nucleoside derivatives for treating hepatitis c virus infection. - Google Patents

Abstract

Disclosed are compounds, compositions and methods for treating hepatitis C virus infections.

Description

NUCLEOSID DERIVATIVES TO TREAT INFECTIONS FOR HEPATITIS C VIRUSES FIELD OF THE INVENTION 5 This invention concerns the field of pharmaceutical chemistry, in particular to compounds, compositions and methods for treating infections by the hepatitis C virus. BACKGROUND OF THE INVENTION The hepatitis C virus (HCV) causes a harmful infection in the liver that can lead to cirrhosis, liver failure or liver cancer, and eventually death. HCV is a enveloping virus that contains a positive single-stranded RNA genome of approximately 9.4 kb, and has a virion size of 30-60 nm1. HCV is the main causative agent for different hepatitis A, hepatitis different from the \ B, sporadic and post transfusion. HCV infection is insidious in a high proportion of chronically infected (and infectious) carriers who for many years have no clinical symptoms. 25, HCV is difficult to treat and it is estimated that there are five hundred million people infected worldwide. No effective immunization is currently available, and hepatitis C can only be controlled by other preventive measures such as improving hygiene and sanitary conditions and interrupting the route of transmission. Currently, the only acceptable treatment for chronic hepatitis C is with interferon (IFN-or) and this requires at least six months of treatment and / or ribavirin, which can inhibit viral replication in infected cells and also * improve function hepatic in some people. IFN-a belongs to a small deinrote family that naturally occurs with characteristic biological effects such as antiviral, antihumoral and immunoregulatory activities, which is produced and secreted by most of the nucleated cells of animals in response to several diseases, in particular viral infections. IFN-a is an important regulator of growth and differentiation that affects cellular communication and immune control. The treatment of HCV with the inferred, however, has limited long-term efficiency with a response speed of approximately 25. In addition, the treatment of HCV with interferon has been frequently associated with adverse side effects such as fatigue, fever, chills, headaches, myalgias, arthralgias, light alopecia, psychiatric effects and associated disorders, autoimmune phenomena and associated disorders and thyroid malfunction. Ribavirin (1- ß-ribofuranosyl-1- 1, 2,4-triazole-3-carboxamide), an inhibitor of inosine 5 '-monophosphate dehydrogenase (IMPDH), improves the efficiency of IFN-a in the treatment of HCV. Despite the introduction of ribavirin, more than 50% of patients do not eliminate the virus with the current standard therapy of interferon-alpha (IFN-a) and ribavirin. For now, standard chronic hepatitis C therapy has been changed to the combination of PEG-IFN plus ribavirin. However, many patients still have significant side effects, primarily related to ribavirin. Ribavirin causes significant hemolysis in 10% to 20% of patients treated at the currently recommended doses, and the drug is both teratogenic and embryotoxic. Other procedures have been taken to combat the. virus. They include, for example, the application of antisense oligonucleotides or ribozymes to inhibit the replication of HCV. In addition, low molecular weight compounds that directly inhibit HCV proteins and interfere with viral replication are considered attractive strategies for controlling HCV infection. The NS3 / 4A serine protease, the ribonucleic acid (RNA) helicase, the RNA-dependent RNA polymerase are considered as potential targets for new drugs2,3.

Devos et al4 describe purine derivatives and pyrimidine nucleosides and their use as inhibitors of HCV RNA replication. Sommadossi, and collaborators5 describe modified 1 ', 2' or 3 'nucleosides and their use to treat a host infected with HCV. Carroll, et al44'45, both of which published after the presentation of the current application, describe nucleosides as inhibitors of the viral RNA polymerase dependent on. RNA The applicants do not intend to cover any compound specifically described in these applications. Given the fact of the worldwide epidemic level of HCV, there is a strong need for new effective drugs for the treatment of HCV. The present invention provides nucleoside derivatives for treating HCV infections.

SUMMARY OF THE INVENTION This invention is directed towards new compounds that are useful in the treatment of HCV in mammals. Specifically, the compounds of this invention are represented by the following formulas la, Ib and Ic. the Ib wherein R and R1 are independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl provided that R and R1 are not both hydrogen; R2 is selected from the group consisting of: alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, acylamino, guanidino, amidino, thioacylamino, hydroxy, alkoxy, substituted alkoxy, halo, nitro, thioalkyl , aryl, substituted aryl, heteroaryl, substituted heteroaryl, -NR3R4, wherein R3 and R "are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclics, substituted heterocyclics and wherein R3 and R4 are joined to form, together with the nitrogen atom to which it is linked, a heterocyclic, substituted heterocyclic, heteroaryl, or substituted heteroaryl, -NR5NR3R4, wherein R3 and R4 are as defined above and R5 is selected from the group consisting of hydrogen and uilo, W, is selected from the group consisting of: hydrogen, phosphate (including monophosphate, diphosphate, triphosphate or a stabilized phosphate prodrug), phosphonate, acyl, alkyl, sulfonate ester selected from the group consisting of alkyl esters, substituted alkyl esters , alkenyl esters, substituted alkenyl esters, aryl esters, substituted aryl ethers, heteroaryl esters, substituted heteroaryl esters, heterocyclic esters and substituted heterocyclic esters, a lipid, an amino acid, a carbohydrate, a peptide, and cholesterol; X, is selected from the group consisting of: hydrogen, halo, alkyl, substituted alkyl, and -NR3R4, wherein R3 and R4 are as previously identified; And, it is selected from the group consisting of: hydrogen, halo, hydroxy, alkylthio -NR3R4, where R3 and R4 are as defined above; Z, is selected from the group consisting of: hydrogen, halo, hydroxy, alkyl, azido, and -NR3R4, wherein R3 and R4 are as defined above -NR5NR3R4, wherein R3, R4 and R5 are as previously identified; and wherein T is selected from the group consisting of a) 1- and 3-deazapurines of the following formulas: purine nucleosides of the following formula c) benzimidazole nucleosides of the following formula: d) pyrrolopyridine 5-nucleosides of the following formula: e) 4-pyrimidopyridone analogues sangivamycin of the following formula: f) 2-pyrimidopyridone analogues sangivamycin of the following formula: g) analogs of 4-pyrimidopyridone sangivamycin following formula: h) pyrimidopyridine analogues of the following formula: i) pyrimido-tetrahydropyridines of the following formula: j) furanopyrimidines (& tetrahydro furanopyrimidines) of the following formula: pyrazolopyrimidines of the following formula 1) pyrolopyrimidines of the following formula: m) triazolopyrimidines of the following formula: n) pteridines of the following formula: o) C-pyridine nucleosides of the following formula: p) C pyrazotriazine C-nucleosides of the following formula: s) a basis of the following formula: a basis of the following formula a basis of the following formula a basis of the following formula a basis of the following formula a basis of the following formula a basis of the following formula and wherein additionally one of the bonds characterized by is a double bond and the other is a single bond provided that, when the between N and one carbon in the ring is a double bond, then p is 0 and when between Q and a carbon of the ring is a double bond, then p is 1; each p is independently 0 or 1; each n is independently 0 or an integer from 1 to 4; each n * is independently 0 or an integer from 1 to 2; L is selected from the group consisting of hydrogen, halo, alkyl, substituted alkyl. Amino, substituted amino, azido, and nitro; Q, is selected from the group consisting of hydrogen, halo, = 0, -OR11, = N-R11, -NHR11, = S, -SR11, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic; M, is selected from the group consisting of = 0, = N-R11, y = S; And, it is as defined above; R10 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocyclic and substituted heterocyclic, alkylthioether, substituted alkylthioether, aryl, substituted aryl, heteroaryl, and substituted heteroaryl, provided that when T is ), s), v), w) or x), then R10 is not hydrogen; each R11 and R12 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocyclics, substituted heterocyclics, amino, substituted amino, alkylthioether, substituted alkylthioether, aryl, substituted aryl, heteroaryl, and substituted heteroaryl; each R20 is independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroaryl, substituted heteroaryl, acylamino, guanidino, amidino, thioacylamino , alkoxy, substituted alkoxy, alkylthio, i nitro, halo, hydroxy, -NR3R4 wherein R3 and R4 are as defined above, -NR5NR3R4, wherein R3, R4 and R5 are as defined above; Each R21 and R22 are independently selected from the group consisting of: -NR3R4 where R3 and R4 are as defined above, and -NR5NR3R4, where R3, R4 and R5 are as defined above, -C (0) NR3R4, where R3 and R 4 are as defined above, and -C (O) NR 5 NR 3 R 4, wherein R 3, R 4 and R 5 are as defined above; and pharmaceutically acceptable salts thereof; with the proviso that 1) for a compound of formula la, when Z is Y is hydrogen, halo, hydroxy, azido, or NR3R4, where R3 and R4 are independently H, or alkyl; Y is hydrogen or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; then R2 is not alkyl, alkoxy, halo, hydroxy, CF3, or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; 2) for a compound of formula la, when Z is hydrogen, halo, hydroxy, azido, or NR3R4, where R3 and R4 are independently H, or alkyl; And it is hydrogen, halo, hydroxy, or alkylthio; then R2 is not alkyl, substituted alkyl, wherein the substituted alkyl is substituted with hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate, or phosphonate, whether protected or unprotected, halo, hydroxy, alkoxy, thioalkyl, or -NR3R4, wherein R3 and R4 are independently hydrogen, alkyl or alkyl substituted with hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, acid phosphonic, phosphate, or phosphonate, whether protected or unprotected; 3) for a compound of formula Ib, when X is hydrogen, halo, alkyl, CF3 or -NR3R4 where R3 is hydrogen and R4 is alkyl, then R2 is not alkyl, alkoxy, halo, hydroxy, CF3, or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; and 4) for a compound of formula Ib, R2 is not halo, alkoxy, hydroxy, thioalkyl, or -NR3R4 (wherein R3 and R4 are independently hydrogen, alkyl or alkyl substituted by hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate, or phosphonate, whether protected or unprotected). and further, provided that the compound of Formula la, Ib or Ic is not a) 2-hydroxymethyl-. 5- (6-phenyl-purin-9-yl) -tetrahydro-furan-3, 4-diol; or b) 2-hydroxymethyl-5- (6-thiophen-3-yl-purin-9-yl) -tetrahydrofuran-3, 4-diol. In a preferred embodiment R1, it is selected from the group consisting of -CH3, -CF3 / -CH = CH2, and -CCH, more preferably CH3. In another preferred embodiment when T is a base of formula a) then T is a 3-deazapurine. This invention is further directed to a compound of Formula II: wherein R and R1 are independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, halogen, azido, amino, and substituted amino; provided that R and R1 are not both hydrogen; Y2 is CH2, N, S, SO, or S02; N, together with -C (H) by Y2 form a substituted heterocyclic, heterocyclic, heteroaryl or substituted heteroaryl group wherein each of the heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl groups is optionally fused to form a bi-ring system mu? fused (preferably not more than 5 fused rings) with one or more ring structures selected from the group consisting of the cycloalkyl, cycloalkenyl, heterocyclic, aryl and heteroaryl groups which, in turn, each of the ring structures is optionally substituted with 1 to 4 substituents selected from the group consisting of hydroxyl, halo, alkoxy, substituted alkoxy, Lioalkyl, substituted thioalkyl, aryl, heteroaryl, heterocyclic, nitro, cyano, carboxyl, carboxyl ester, alkyl, substituted alkyl, alkenyl, substituted alkenyl , alkynyl, substituted alkynyl, amino, and substituted amino; b is an integer equal to 0 or 1; A, B, D, and E are independently selected from the group consisting of > N, > CH, > C-CN, > C-N02, > C-alkyl, > C-substituted alkyl, > C-NHCONH2, > C-CONR15R16, > C-COOR15, > C-hydroxy, > C-alkoxy, > C-amino, > C-alkylamino, > C-dialkylamino, > C-halogen, > C- { 1, 3-oxazol-2-yl), > C- (1, 3-thiazole-2-yl) and > C- (imidazole-2-yl); F, is selected from > N, > C-CN, > C-N02, > C-alkyl, > C-substituted alkyl, > C-NHCONH2, > C-CO R15R16, > C-COOR15, > C-alkoxy, > C- (1, 3-oxazol-2-yl), > C- (1, 3-thiazol-2-yl), > C- (imidazol-2-yl), and > CY, 'wherein Y is selected from the group consisting of hydrogen, halo, hydroxy, alkylthioether, and -NR3R4 where R3 and R4 are independently selected from the group consisting of hydrogen, hydroxy, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl , substituted alkynyl, alkoxy, substituted alkoxy, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and wherein R3 and R4 are joined together to form, together with the nitrogen atom bonded thereto, a heterocyclic group, provided that only one of R3 and R4 are hydroxy, alkoxy, or substituted alkoxy; R15 and R16 are independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, and R15 and R16 together with the atom to which they are attached can form a cycloalkyl , substituted cycloalkyl, heterocycloalkyl, substituted heterocycloalkyl, heteroaryl, or substituted heteroaryl; W, is selected from the group consisting of: hydrogen, phosphate (including monophosphate, diphosphate, triphosphate, or stabilized phosphate prodrug), phosphonate, acyl, alkyl, sulfonate ester selected from the group consisting of alkyl esters, substituted alkyl esters, alkenyl esters, substituted alkenyl esters, aryl esters, substituted aryl esters, heteroaryl esters, substituted heteroaryl esters, heterocyclic esters, and substituted heterocyclic esters, a lipid, an amino acid, a carbohydrate, a peptide, and cholesterol and pharmaceutically acceptable salts thereof . In a preferred embodiment, the compounds of formula II are represented by formula IIA: IIA Where R and R1 are independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, halogen, azido, amino, and substituted amino; provided that R and R1 are not both hydrogen; Y2 is C¾, N, S, SO, or S02; N together with -C (H) be Y2 form a heterocyclic, substituted heterocyclic, heteroaryl or substituted heteroaryl group, wherein each of the heterocyclic, substituted heterocyclic, heteroaryl, or substituted heteroaryl groups is optionally fused to form a bi-ring system or multi-fused (preferably not more than 5 fused rings) with one or more ring structures selected from the group consisting of the cycloalkyl, cycloalkenyl, heterocyclic, aryl and heteroaryl groups, which in turn, each of the ring structures is optionally substituted with 1 to 4 substituents selected from the group consisting of hydroxyl, halo, alkoxy, substituted alkoxy, thioalkyl, substituted thioalkyl, aryl, heteroaryl, heterocyclic, nitro, cyano, carboxyl, carboxylic esters, alkyl, substituted alkyl, alkenyl, alkenyl substituted, alkynyl, substituted alkynyl, amino and substituted amino; b is an integer equal to 0 or 1; W, is selected from the group consisting of: hydrogen, phosphate (including monophosphate, diphosphate, triphosphate or stabilized phosphate prodrug), phosphonate, acyl, alkyl, sulfonate ester selected from the group consisting of alkyl esters, substituted alkyl esters, alkenyl esters , substituted alkenyl esters, aryl esters, substituted aryl esters, heteroaryl esters, substituted heteroaryl esters, heterocyclic esters and substituted heterocyclic esters, a lipid, an amino acid, a carbohydrate, a peptide, and cholesterol; And, it is selected from the group consisting of: hydrogen, halo, hydroxy, alkylthioether, -NR3R4, wherein R3 and R4 are independently selected from the group consisting of hydrogen, hydroxy, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, alkynyl substituted, alkoxy, substituted alkoxy, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic, and wherein R3 and R4 are joined together to form, together with the nitrogen atom bonded thereto, a heterocyclic group, provided that only one of R3 and R4 is hydroxy, alkoxy, or substituted alkoxy; Z, is selected from the group consisting of: hydrogen, halo, hydroxy,. alkyl, zido, and -NR3R4, wherein R3 and R4 are independently selected from the group consisting of hydrogen, hydroxy, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl, alkoxy, substituted alkoxy, aryl, substituted aryl, heteroaryl , substituted heterocyclic, heterocyclic, substituted heterocyclic and wherein R3 and R4 are joined to form, together with the nitrogen atom bonded thereto, a heterocyclic group, provided that one of R3 and R4 are hydroxy, alkoxy, or substituted alkoxy; and pharmaceutically acceptable salts thereof. Compounds included in the scope of this invention include, for example, those set forth below (including pharmaceutically acceptable salts thereof). 25 25 \ 25 25 25 25 25 This invention is also directed to pharmaceutical compositions comprising a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound of Formula Ia, Ib, Ic, II, IIA, III, or IV or mixtures of one or more of said compounds. This invention is still further directed to methods for treating HCV in mammals said methods comprise administering to a mammal diagnosed with HCV or at risk of develo HCV, a pharmaceutical composition comprising a pharmaceutically acceptable diluent and an effective amount of a compound of Formula la. Ib, Ic, II, IIA, III, or IV or mixtures of one or more of said compounds. yet another of its aspects of the method this invention is directed to a method for preparing the compounds of formula III: W III where R, R1, R3, R4, W, X, Y and Z are defined above, said method comprises: (a) oxidizing a compound of formula IV IV wherein R6 is selected from the group consisting of alkyl and aryl; (b) oxidizing the thio group to a sulfoxide or sulfone; and contacting the oxidized compound prepared in (b) above with at least one stoichiometric equivalent of HNR3R4 under conditions that result in the formation of a compound of formula II wherein R3 and R4 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl , alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl, substituted heterocyclic, heterocyclic, substituted heterocyclic and where R3 and R4 are joined together to form, together with the nitrogen atom bonded thereto, a heterocyclic group.

DESCRIPTION OF ALLADA OF THE INVENTION The invention is directed towards compounds, compositions and methods for treating infections by the hepatitis C virus. However, before describing this invention in detail the following terms will be defined first: Definitions As used in present "alkyl" refers to alkyl groups having from 1 to 10 carbon atoms, preferably from 1 to 5 carbon atoms and more preferably 1 to 3 carbon atoms. This term is exemplified by groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-pentyl and the like. "Substituted alkyl" refers to an alkyl group having from 1 to 3, and preferably 1 to 2, substituents selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic. "Alkoxy" refers to the group "alkyl-O-" which includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy. N-butoxy, t-butoxy, sec-butoxy, n-pentoxy and the like. "Alkoxy substituted" refers to the group "alkyl-O-substituted". "Acyl", refers to the groups HC (O) -, alkyl) -, alkyl-C (O) -substituted, alkenyl-C (0) alkenyl-C (0) -substituted, alkynyl-C (0) - , alkynyl-C (0) -aubatituido, cycloalkyl-C (0) -, cycloalkyl-C (0) -substituted, aryl-C (O) -, aryl-C (O) -substituted, heteroaryl-C (O) - heteroaryl-C (O) -substituted, heterocyclic-C (0) - and heterocyclic-C (0) -substituted, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic are as defined herein. "Acylamino" refers to the group -C (0) NRR wherein each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and wherein each R is joined to form together with the nitrogen atom a heterocyclic or substituted heterocyclic ring wherein alkyl, substituted alkyl, alkenyl , substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic are as defined above. "Acyloxy" refers to the alkyl-C (O) 0-, (0) 0-substituted alkyl, C (O) 0-, C (0) -alkenyl-C (O) alkenyl, alkynyl-C (O O-, 0 (0) -substituted (C) -alkynyl, aryl-C (0) 0-, substituted (0) -aryl aryl, cycloalkyl-C (O) 0-, (0) 0-substituted cycloalkyl, heteroaryl -C (0) O-, heteroaryl-C (0) O-, heteroaryl-C (0) O-substituted, and (O) O-substituted heterocyclic wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl , substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic are as defined above. "Alkenyl" ,. refers to the alkenyl group, preferably having from 2 to 6 carbon atoms, and more preferably from 2 to 4 carbon atoms and having at least 1 and preferably from 1-2 sites of alkenyl unsaturation. "Substituted alkenyl" refers to alkenyl groups having from 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic. "Alkynyl" refers to the alkynyl group, preferably having from 2 to 6 carbon atoms and more preferably 2 to 3 carbon atoms and having at least 1 and preferably 1-2 sites of alkynyl unsaturation. "Substituted alkynyl" refers to alkynyl groups having from 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic. "Amino" refers to the group _NH2. "Substituted amino" refers to the group -NRH where R and H are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, heterocyclic substituted and where R and R are joined together with the nitrogen bonded thereto to form a substituted heterocyclic or heterocyclic group provided that R and R are not both hydrogen. When R is hydrogen and R is alkyl, the substituted amino group is sometimes referred to as alkylamino. When R and R are alkyl, the substituted amino group is sometimes referred to herein as dialkylamino. "Amidino" refers to groups with the formula -C (= NR '' ') NR' R ", where R ', R" and R "' are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and where R 'and R "are joined together with the nitrogen bonded thereto to form a group heterocyclic, substituted heterocyclic, heteroaryl, or heteroaryl. replaced. The term amidino also refers to inverted amidino structures of the formula: where R "" is an alkyl group. or substituted alkyl, as defined above and R '"and R' are as defined above. "Guanidino" refers to groups with the formula -NHC (= NR '' ') NR' R ", where 'R', R" and R "'are as defined above for amidino." Aminoacyl "refers to to the groups -NRC (O) alkyl, -NRC (O) substituted alkyl, -NRC (O) cycloalkyl, -NRC (O) substituted cycloalkyl, -NRC (O) alkenyl, -NRC (O) substituted alkenyl, -NRG (O) alkynyl, -NRC (O) substituted alkynyl, -NRC (O) aryl, -NRC (0) substituted aryl, -NRC (O) heteroaryl, -NRC (O) substituted heteroaryl, -NRC (O) heterocyclic, and -NRC (O) substituted heterocyclic wherein R is hydrogen or alkyl and wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic · Are as defined herein "Aryl" or "Ar" refers to a monovalent aromatic carboxyl group of 6 to 14 carbon atoms having a single ring (eg, phenyl) or multiple condensed rings (eg, naphthyl or anthranil), said fused rings may or may not be aromatic (eg, 2-benzoxazolinone, 2H-1, 4-benzoxazin-3 (4H) - ona- 7- ilo, and the like). Preferred aryls include phenyl and naphthyl. "Substituted aryl" refers to aryl groups that are substituted with from 1 to 3 substituents, and preferably 1 to 2 substituents, selected from the group consisting of hydroxy, acyl, acylamino, acyloxy, alkyl, substituted alkyl, alkoxy, alkoxy substituted, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryl, aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, carboxyl, carboxylic esters, cyano, thiol, thioalkyl, substituted thioalkyl, thioaryl, substituted thioaryl, thioheteroaryl, substituted thioheteroaryl, thiocycloalkyl, substituted thiocycloalkyl, thioheterocyclic, substituted thioheterocyclic, cycloalkyl, substituted cycloalkyl, halo, nitro, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic, heteroaryloxy, substituted heteroaryloxy, heterocyclyloxy, substituted heterocyclyloxy.

"Aryloxy" refers to the aryl-O- group which includes, by way of example, phenoxy, naphthoxy, and the like. "Substituted aryloxy" refers to aryl-O-substituted groups. "Aryloxyaryl" refers to the -aryl-O-aryl group. "Substituted aryloxyaryl" refers to aryloxyaryl groups substituted with from 1 to 3 substituents on either one or both aryl rings as defined above for substituted aryl. "Carboxyl" refers to -COOH or salts thereof. "Carboxylic esters" refer to the groups -C (O) O-alkyl, -C (0) 0-substituted alkyl, C (0) Oaryl, and C (0) 0 substituted aryl wherein alkyl, substituted alkyl, aryl- and substituted aryl are as defined above. "Cycloalkyl" refers to cyclic alkyl groups of 3 to 10 carbon atoms having single or multiple cyclic rings including, by way of example, adamantyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like. "Cycloalkenyl", refers to cyclic alkenyl groups from 4 to 10 carbon atoms having single or multiple cyclic rings and additionally having at least 1 and preferably from 1 to 2 internal sites of ethylenic unsaturation (C = C). "Substituted cycloalkyl" and "substituted cycloalkenyl", refers to a cycloalkyl or cycloalkenyl group, having from 1 to 5 substituents selected from the group consisting of oxo (= 0), thioxo (= S), alkoxy, substituted alkoxy,. acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aryl, substituted aryl, aryloxy, substituted aryloxy, cyano, hydroxyl, nitro carboxyl, carboxylic esters, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic. "Cycloalkoxy" refers to O-cycloalkyl groups. "Substituted cycloalkoxy" refers to -0-substituted cycloalkyl groups. "Halo" or "halogen" refers to fluorine, chlorine, bromine and iodine and is preferably fluorine or chlorine. "Heteroaryl" ,. refers to an aromatic group from 1 to 15 carbon atoms, preferably from 1 to 10 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur in the ring. Said heteroaryl groups may have a single ring (for example, pyridyl or furyl) or condensed multiple rings (for example, indolizinyl or benzothienyl). Preferred heteroaryls include pyridyl, pyrrolyl, indolyl, thiophenyl, and furyl. "Substituted heteroaryl" refers to heteroaryl groups that are substituted with from 1 to 3 substituents selected from the same group of substituents defined for substituted ryl. "Heteroaryloxy" refers to the group -O-heteroaryl and "substituted heteroaryloxy" refers to the -O-substituted heteroaryl group. "Heterocycle" or "heterocyclic", refers to a saturated or unsaturated group having a single ring or • condensed multiple rings, from 1 to 10 carbon atoms and from 1 to 40 heteroatoms selected from the group consisting of nitrogen, sulfur or oxygen in the ring, wherein, in fused ring systems, one or more of the rings may be aryl or heteroaryl. "Substituted heterocyclic" refers to heterocyclic groups that are substituted with from 1 to 3 of the same substituents as defined for substituted cycloalkyl. Examples of heterocycles and heteroaryls include, but are not limited to, azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindol, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalizine, naphthylpyridine. , quinoxaline, quinazoline, cinoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1, 2, 3, 4- tetrahydro -isoquinoline, 4, 5, 6, 7-tetrahydrobenzo [b] thiophene, thiazole, thiazolidine, thiophene, benzo [b] thiophene, morpholinyl, thiomorpholinyl (also referred to as thiamorpholinyl), piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like. "Heterocyclyloxy" refers to the group -0-heterocyclic and "substituted heterocyclyloxy" refers to the -O-substituted heterocyclic group. "Phosphate" refers to the groups -0P (0) (0H) 2 (monophosphate), -0P (0) (OH) OP (0) (OH) 2 (diphosphate) and OP (O) (OH) OP (O) (OH) OP (0) (OH) 2 (triphosphate) or salts thereof including partial salts thereof. "Phosphonate" refers to the groups -OP (OR) (OH) or -OP (OR) (OR) or salts thereof including partial salts thereof. "Tiol" refers to the group -SH..

"Thioalkyl" or "alkylthioether" or "thioalkoxy", refers to the group -S-alkyl. "Substituted thioalkyl" or "substituted alkylthioether" or "substituted thioalkoxy", refers to the alkyl group S-susbtituido - "Thiocycloalkyl", refers to the groups -S-cycloalkyl and "substituted thiocycloalkyl", refers to the cycloalkyl group -S -substituted. "Thioaryl", refers to the group -S-aryl and "substituted thioaryl", refers to the aryl -S-substituted group. "Thioheteroaryl" refers to the group -S-heteroaryl and "substituted thioheteroaryl" refers to the -S-substituted heteroaryl group. "Thioheterocyclic" refers to the group -S-heterocyclic and "substituted thioheterocyclic" refers to the -S-substituted heterocyclic group. The term "amino acid" refers to amino acids of the formula H2NCH (R7) COOH where R7 is alkyl, substituted alkyl or aryl. Preferably, the amino acid is one of the twenty. L amino acids as they are found naturally. The term "carbohydrate" refers to oligosaccharides comprising from 2 to 20 saccharide units. The particular saccharide units employed are not critical and include, by way of example, all synthetic and natural derivatives of glucose, galactose, N-acetylglucosamine, N-acetylgalactosamine, fucose, sialic acid, and the like. In addition to being in its pyranose form, all the saccharide units described herein are in the D form except the fucose which is in the L form. The term "" lipid "is a recognized term in the art defined, for example, by Lehninger, Biochemistry, 1970, on pages 189 et seq .. Which is incorporated herein by reference in its entirety The term "peptide" refers to polymers of amino acids comprising from about 2 to about 20 amino acid units, preferably from about 1 to about 10, more preferably from about 2 to about 5. The term "stabilized phosphate prodrug" refers to mono-, di- and tri- phosphate groups having one or more of the hydroxyl groups suspended in the same converted in an alkoxy, substituted alkoxy, an aryloxy or a substituted aryloxy group, "pharmaceutically acceptable salts", refers to pharmaceutically acceptable salts of a compound, said salts are derived from a variety of counter organic and inorganic ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic and inorganic acids, such as hydrochloric, hydrobromic, tartrate, mesylate, acetate, maleate, oxalate and the like. It is understood that in all substituted groups defined above, polymers are successful in defining substituents with additional substituents by themselves (eg, substituted aryl having a substituted aryl group as a substituent which is itself substituted with a substituted aryl group, etc. ) are not intended for inclusion in this. In such cases, the maximum number_of said substituents is three. This means that each of the above definitions is restricted to a limitation that, for example, the substituted aryl groups are limited to substituted aryl- (substituted aryl) -substituted aryl-. Similarly, it is understood that the above definitions are not intended to include non-permitted substitution patterns (eg, methyl substituted with fluoro groups or an alpha hydroxyl group in the ethylenic or acetylenic unsaturation). Such impermissible substitution patterns are well known to those skilled in the art.

General Synthetic Methods The compounds of this invention can be prepared by various methods known in the art of organic chemistry in general and of synthesis of nucleotide and nucleoside analogs in particular. The initial materials for the synthesis are either readily available from commercial sources or are known or can be prepared by means of techniques known in the art. General reviews of the preparation of nucleoside or nucleotide analogs are included in the following: Michelson A.M. "The Chemistry of Nucleosides and Nucleotides", Academic Press, New York, 1963. Goodman L. "Basic Principles in Nucleic Chemistry", Academic Press, New York, 1974, vol. 1, Ch. 2. "Synthetic Procedures in Nucleic Acid Chemistry", Eds. Zorbach W. &; Tipson R., Wiley, New York, 1973, vol. 1 & 2. The synthesis of carboxylic nucleosides has been reviewed by Agrofoglio et al. (Tetrahedron, 1994, 50, 10611). The compounds of the present invention can be prepared using methods set forth in U.S. Provisional Application. with Serial Number 60 / 378,624, incorporated herein by reference in its entirety.

The available strategies for the synthesis of compounds of this invention include: A. General Synthesis of 2'-C-Branched Nucleosides The 2'-O-branched ribonucleosides of the following structures: Ib where R1, R2, W, X, Y and Z are as defined above, can be prepared by one of the following general methods. 1. Convergent procedure: glycosylation of the Nucleobase with Appropriately Modified Sugar The key to the initial material of this process is a sugar appropriately substituted with 2'-OH and 2'-H with the appropriate displaceable group, for example an acyl group or a chlorine, bromine, fluorine or iodine. Sugar can be purchased or can be prepared by any known means that includes standard epimerization, substitution, oxidation and reduction techniques. For example, 1, 3, 5-tri- O-benzoyl-OÍ-D-ribofuranose (Pfanstiel Laboratories, Inc.) can be used. The substituted sugar can then be oxidized with the appropriate oxidizing agent in a compatible solvent at a suitable temperature to produce the 2 'modified sugar. Possible oxidizing agents are, for example, the Dess-Martin per-iodine reagent, Ac20 + DCC in DMSO, Swern oxidation (DMSO, oxalyl chloride, triethylamine), Jones reagent (a mixture of chromic acid and sulfuric acid). ), Collins reagent (Cr (VI) dipyridine oxide, Corey reagent (pyridinium chlorochromate), pyridinium dichromate, potassium permanganate, MnC> 2, ruthenium tetroxide, phase transfer catalysts such as chromic acid or permanganate supported on a polymer, Cl2_pyridine, ammonium molybdate-H202, NaBr02-CA, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (t-butoxide aluminum with another ketone) and N-bromosuccinimide The coupling of a nucleophilic organometallic carbon, such as a Grignard reagent, an organolithium, dialkyl lithium or R1-SiMe3 in TBAF with the ketone with the appropriate non-protic solvent at a suitable temperature gives, produces the 2'-alkylated sugar. For example, R1MgBr / TiCl4 or R ^ gBr / CeCls, can be used as described in Wolfe et al. 1997, J. Org. C em. 62: 1754-1759. The alkylated sugar may optionally be protected with a suitable protecting group, preferably with an acyl group, substituted alkyl or silyl, by methods well known to those skilled in the art, as set forth in Green et al. Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991. The optionally protected sugar can then be coupled to the purine base or pyrimidine by methods well known to those skilled in the art, as discussed by Townsend Chemistry of Nucleosides and Nucleotides, Plenum Press, 1994. For example, a The acylated sugar can be coupled to a silylated base with a Lewis acid, such as tin tetrachloride, titanium tetrachloride or trimethylsilyltriflate in the appropriate solvent at a suitable temperature. Alternatively, a sugar-halo can be coupled to a silylated base in the presence of trimethylsilyltriflate. Reaction Scheme 1 below describes the alternative synthesis of a protected sugar which is useful for coupling to bases wherein the connection to the base is a carbon atom instead of a nitrogen atom.

Diagram of Reaction 1: Alternative Synthesis and Coupling of a Sugar The formation of sugar a in Reaction Scheme 1, above, is accomplished as described in Mandal, S. B., et al., Synth. Commun., 1993, 9, page 1239, starting from commercial D-ribose. The protection of the hydroxyl groups to form sugar b is described in Witty, D.R., et al., Tet. Lett., 1990, 31, page 4787. The sugars c and d are prepared using the method of Ning, J. et al., Carbohydr. Res., 2001, 330, page 165, and methods described herein. R, in the Sugar e can be hydrogen / alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl and substituted alkynyl. Particularly preferred R groups are methyl, trifluoromethyl, alkenyl and alkynyl. The sugar e is prepared using a modification of the Grignard reaction with RMgBr or other suitable organometallic as described herein (without the need for titanium / cerium). Finally the halogenated sugar used in the subsequent coupling reaction is prepared using the same protection method that was used in making sugar b, above. Halogenation is described in Seela17. Subsequently, any of the described nucleosides can be deprotected by methods well known to those skilled in the art, as Greene and co-workers Protective Groups in Organic Synthesis, Jon Wiley & amp;; Sons, Second Edition, 1991. In a particular embodiment, the 2'-C-branched ribonucleoside is desired. 2. Linear Procedure: Modification of a pre-formed nucleoside. The key starting material for this process is a nucleoside appropriately substituted with a 2'-OH and 2'-H. The nucleoside can be purchased or can be prepared by any of the known means including standard coupling techniques. The nucleoside can be optionally protected with suitable protecting groups, preferably with acyl groups, substituted alkyl or silyl, by methods known to those skilled in the art, as set forth by Green et al., Protective Groups in Organic Chemistry, John iley & Sons, Second Edition, 1991. The properly protected nucleoside can then be oxidized with the appropriate oxidizing agent in a compatible solvent at a suitable temperature to produce the 2'-modified sugar. Possible oxidizing agents are, for example, the Dess-Martin periodate reagent, Ac20 + DCC in DMSO, the oxidation of Swern (DMSO, oxalyl chloride, triethylamine), Jones' reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (Cr (VI) dipyridine oxide), Corey reagent (pyridinium chlorochromate), pyridinium dichromate, acid dichromate, potassium permanganate, ruthenium tetroxide Mn02, phase transfer catalysts such as acid chromic or permanganate supported. on a polymer, Cl2 ~ pyridine, H2C > 2-ammonium molybdate, NaBr02-CAN, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum t-butoxide with another ketone) and N- Bromosuccinimide The coupling of a nucleophilic organometallic carbon, such as a Grignard reagent, an organolithium, dialkyl copper lithium or R1-SiMe3 in TBAF with the ketone with the appropriate non-protic solvent at a suitable temperature, yields the appropriate substituted nucleoside. Subsequently, the cleoside can be deprotected by methods well known to those skilled in the art, as Greene and co-workers Protective Groups in Organic Synthesis, John Wiley & amp; Sons, Second Edition, 1991 '. In a particular embodiment, the 2'-C-branched ribonucleoside is desired. In another embodiment of the invention, the L-enantiomer is desired. Accordingly, the L-enantiomers can be corresponding to the compounds of the invention can be prepared following the same general methods mentioned above, starting with the corresponding L-sugar or the L-enantiomeric nucleoside as starting material. B. General Synthesis of 3 '-C-Branched Ribonucleoside 3' -C-Branched Nucrosides of the following structure: Ib where R, R2, W, X, Y and Z are as defined above, can be prepared by one of the following general methods: 1. Convergent Procedure: Glycosylation of the nucleobase with an appropriately modified sugar The initial material for this process is a sugar suitably substituted with a 3 '-OH and 3'-H, with the appropriate displaceable group, for example an acyl group, methoxy group, or a chloro, bromo, fluoro, iodo. Sugar can be purchased or can be prepared by any known means including standard epimerization, substitution, oxidation and reduction techniques. The substituted sugar can then be oxidized with the appropriate oxidizing agent in a compatible solvent at a suitable temperature to produce the 3-modified sugar. Possible oxidizing agents are, for example, Dess-Martin periodate reagent, Jones reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (Cr (VI) dipyridine oxide, Corey's reagent ( pyridinium), pyridinium dichromate, acid dichromate, potassium permanganate, Mn02, ruthenium tetroxide, phase transfer catalysts such as chromic acid or permanganate supported on a polymer, Cl2-pyridine, H202- ammonium molybdate, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum t-butoxide with another ketone) and N-bromosuccinimide, then the coupling of a nucleophilic organometallic carbon, such as the Grignard reagent, an organolithium, dialkyl copper or R-SiMe3 in BAF with the ketone with the appropriate non-protic solvent at a suitable temperature, produces the 3'-C-branched sugar, for example, RMgBr / TiCl4 or RM gBr / CeCl3 can be used as described in Olfe et al. 1997. J. Org. Chem. 62: 1754-1759. The 3'-C-branched sugar can optionally be protected with a suitable protecting group, preferably with an acyl or silyl group, by methods well known to those skilled in the art, as Greene and co-workers show Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991.

The optionally protected sugar can then be coupled to the base by methods well known to those skilled in the art, as discussed by Townsend Chemistry of Nucleosides and Nucleotides, Plenum Press, 1994. For example, an acylated sugar can be coupled to a silylated base with a Lewis acid, such as tin tetrachloride, titanium tetrachloride or trimethylsilyltriflate in the appropriate solvent at a suitable temperature. Alternatively, a sugar-halo can be coupled to a silylated base in the presence of trimethylsilyltriflate. Subsequently, the nucleoside can be deprotected by methods well known to those skilled in the art, as Greene and co-workers Protective Groups in Organic Synthesis, John iley & amp;; Sons, Second Edition, 1991. In a particular embodiment, the branched 3'-C ribonucleoside is desired. Alternatively, deoxyribonucleoside is desired. To obtain these nucleosides, the ribonucleoside formed can optionally be protected by methods well known to those skilled in the art, as Greene et al., Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991, 1991, and then the 2 '-OH can be reduced with a suitable reducing agent. Optionally, the 2'-hydroxyl can be activated to facilitate the reduction;that is, via Barton's reduction. 2. Linear Procedure: Modification of a pre-formed nucleoside The key initial material for this process is a nucleoside appropriately substituted with a 3 '-OH and 3'-H. The nucleoside can be purchased or can be prepared by any of the known means including standard coupling techniques. The nucleoside can optionally be protected with suitable protecting groups, preferably with acyl or silyl groups, by methods well known to those skilled in the art, as Greene and co-workers Protective Groups in Organic Synthesis, John Wiley & amp; Sons, Second Edition, 1991. The appropriately protected nucleoside can then be oxidized with the appropriate oxidizing agent in a compatible solvent at a suitable temperature to produce the 3'-modified sugar. Possible oxidizing agents are, for example, the Dess-Martin periodate reagent, Jones reagent (a mixture of chromic acid and sulfuric acid), Collins reagent (Cr (VI) dipyridine oxide), Corey reagent (chlorochromate). of pyridinium), pyridinium dichromate, acid dichromate, potassium permanganate, ruthenium tetroxide, Mn02, phase transfer catalysts such as chromic acid or permanganate supported on a polymer, Cl2-pyridine, H202-ammonium molybdate, NaBrC ^ - CAN, NaOCl in HOAc, copper chromite, copper oxide, Raney nickel, palladium acetate, Meerwin-Pondorf-Verley reagent (aluminum t-butoxide with another ketone) and N-bromosuccinimide. Subsequently, the nucleoside can be deprotected by methods well known to those skilled in the art, as Greene and co-workers Protective Groups in Organic Synthesis, John Wiley & amp; Sons, Second Edition, 1991. In a particular embodiment, the 3'-C-branched ribonucleoside. Alternatively, deoxyribonucleoside is desired. To obtain these nucleosides, the ribonucleoside formed can optionally be protected by methods well known to those skilled in the art, as Greene et al., Protective Groups in Organic Synthesis, John Wiley & Sons, Second Edition, 1991, and then the 2 'OH can be reduced with a suitable reducing agent. Optionally, the 2'-hydroxyl can be activated to facilitate the reduction; that is, via the reduction of Barton. In other embodiments of the invention, the L-enantiomers are desired. Accordingly, the L-enantiomers may be corresponding to the compounds of the invention, they may be prepared following the same general methods as mentioned above, starting with the corresponding L-sugar or the L-enantiomer nucleoside as starting material. C. General Synthesis of Bases Purine of Formula and Bases Pyrimidine of Formula Ib. The purine bases of formula I-Iva and the pyrimidine bases of formula I-IVb for the above condensation reactions can be obtained commercially or can be prepared by methods known in the art. The purine base preparation of formula I-IVa is reviewed by G. Shaw in "Comprehensive Heterocyclic Chemistry", Pergamon Press, Vol. 5, chapter 4.09, p. 449 and "Comprehensive Heterocyclic Chemistry II" Pergamon Press, Vol. 7, chapter 7.11, p. 397. The preparation of pyrimidine bases of formula I-Ivb is reviewed by Brown D. "The Chemistry of Heterocyclic Compounds - The Pyrimidines" 1962 and Supplement 1, 1970, John Wiley & Sons, New York-, by Brown D. in "Comprehensive Heterocyclic Chemistry", Pergamon Press Vol. 7, chapter 4.09, page 499 and by K. Unheim and T. Benneche in "Comprehensive Heterocyclic Chemistry II" Pergamon Press Vol. 6 chapter 6.02, page 93. For example, the appropriate purine base of formula I-IVa can be prepared from the corresponding purine, wherein the 2, 6 or 8 position of the purine base is substituted with a displaceable group such as halogen or sulfonate. Purine precursors that have displaceable groups are commercially available, for example, 6-chloropurine (Aldrich Chemical Company), 2,6-dichloropurine (Aldrich Chemical Company), 2-chloro-6-aminopurine (Aldrich Chemical Company), 8-bromoadenine (Sigma-Aldrich Company Limited) or obtained by means of methods known in the art. For example purines 2- and 6-substituted chlorines can be prepared by chlorination of the corresponding 2 and 6-hydroxypurines respectively by the use of greasing agents such as phosphorus oxychloride (Bakuni et al., Indian J. Chem., Sect. , 23, 1286; LaMontagne et al J. Heterocycl. Chem. 1983, 20, 295) although the introduction of a bromine in the 8-position of purines can be achieved by direct bromination using brominating agents such as, for example, bromine (Mano et al., Chem. Pharm. Bull 1983, 31, 3454 ) or N-bromosuccinimide (Kelley et al Heterocycl, Chem. 1990, 27, 1505). The purines where the 6-substituent is alkoxy, aryloxy, SH, alkylthio, arylthio, alkylamino, cycloalkylamino, saturated cyclic amino, nitrogen-linked heteroaromatics, hydroxylamino, alkoxylamino, hydrazine, alkylhydrazino, can be prepared by treatment of the corresponding 6-halopurine with alkoxides, thiols, amines, nitrogen-containing heterocycles, hydroxylamines and appropriate hydrazines, (eg, Chae et al., J. Med. Chem., 1994, 37, 342; Niebch and Schneider, Z. Naturforsch, B. Anorg. Org. Chem. Biochem. Biophys., Biol. 1972, 27, 675; Ontagne et al., Heterocycl. Chem. 1983, 20, 295; Estep et al. J. Med. Chem. 1995, 38, 2582). Similarly, 2-substituted purines can be prepared from the corresponding 2-halopurines, for example, purines wherein the 2-substituted is alkoxy, aryloxy, Sh, alkylthio, arylthio or NR3R4 can be prepared from the corresponding 2-halopurine by means of the treatment with alkoxides, thiols or amines (for example Barlin and Fenn, Aust. J. Chem. 1983, 36, 633; Nugiel et al., J. Org. Chem., 1997, 62, 201). Similarly, the 8-substituted purines can be prepared from the corresponding 8-halopurines. For example purines where the 8-substituent is alkoxy, aryloxy, SH, alkylthio, arylthio or NR3R4 can be prepared by means of the treatment of the corresponding 8-bromopurine with the appropriate alkoxides, thiols or amines (Xing et al., Tetrahedron Lett., 1990 , 31, 5849; Mano et al, Chem. Pharm. Bull 1983, 31, 3454). Where the 2-, 6-, 8-substituent is a cyclic amine moiety, the purine can be prepared from the 6-aminopurine by reaction with an appropriate dialkylating agent such as dihaloalkane. In some cases where the 6-substituent is a nitrogen-containing heteroaromatically bound through the nitrogen atom, the purine can be prepared from the 6-aminopurine by ring of the reaction with a dicarbonyl compound or a reactive derivative thereof. an acetal. For example, 6- (1H-pyrrol-1-yl) -, 1H-purine can be prepared from a 6-chloropurine by reaction with 2,5-dimethoxytetrahydrofuran as described in Estep et al. J. Med. Chem. 1995, 38, 2582. D. General Synthesis of purines 6- aril (heteroaryl) / alkyl-substituted and 4-aryl (heteroaryl) / alkyl-substituted pyrimidines The synthesis of 6-aryl (heteroaryl) / alkyl-substituted purines and of 4-aryl (heteroaryl) / alkyl-substituted pyrimidines, is shown in the Reaction Scheme 2.

Reaction Scheme 2 341 commercial is converted to the 2'-methyl-ribose derivative 342 as described in Wolfe et al., J. Org. Chem., 1997, 62, 754. 6-Bromopurine 2'-methylriboside (343) is prepared using the procedure for the synthesis of 6-chloropurine described in Wolfe, et al., J. Org. Chem., 1997, 62, 1754. Substituted purine 2'-methyltribosides 6- aromatic 344 were synthesized using the protocols reported by Hocke et al., J. Med. Chem., 2000, 43, 1817 with commercially available boric acids (RM in the Reaction Scheme 2). Purine 2'-methylribosides 6- alkyl substituted 344 are synthesized using the modifications of the protocols reported by Bergstrom and Reday, Tet. Lett., 1982, 23, 4191. 2- aminopurine 2'-aromatic-substituted 6-methyltribosides 345 are synthesized using modified protocols reported by Lakshman et al., Org. Lett., 2002, 4, 1479 with commercially available boric acids R-B (OH) 2 in Reaction Scheme 2). 2-Aminopurines 2'-methylribosides 6- alkyl substituted 345 are synthesized using modifications of the protocol reported by Bergstrom and Reday, Tet. Lett., 1982, 23, 4191. Similarly, but using the appropriate pyrimidine bases, the 4-aryl (heteroaryl) / alkyl-substituted pyrimidines 348 are synthesized. In accordance with this protocol, the following nucleosides were prepared.

No. Structure Name 9- (2 * -C-methyl-p-D-r¡bofuranosl) -6 Ú - (thiophen-3-yl) -purine 1 HO OH O * 9- (2'-C-methyl-p-D-ribofuranosyl) -6- (thiophen-2-yl) -2-aminopurine 2 HO OH H 9- (2'-C-methyl- -D-ribofuranosyl) - (pyrrol-3-yl) -purine 3 * HO OH 15 25 E. General Synthesis of N6-substituted Adenine and N-Substituted Cytosine The synthesis of 6-aryl (heteroaryl) / alkyl-substituted purines and 4-aryl (heteroaryl) / alkyl-substituted pyrimidines are shown in the Reaction Scheme 3.

?? The synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6-methylthio-purine 49, 9- (2'-C-methyl-β-D-ribofuranosyl) -uridine 347 was carried out, and 9- (2'-C-methyl-β-D-ribofuranosyl) -6-methylthio-adenine 350 as described in R. Harry-O'Kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759. Methylthio-purine is oxidized to methylsulfonyl-purine using the procedure described by Y-Z. Xu, Tetrahedron, 1996, 52, 10737-10750; AND Z. Xu, Q. Zheng, and P. Swann Nucleosides Nucleotides 1995, 14, 929-934. By substitution of the methylsulfonyl and triazolyl groups for amine, protocols similar to protocols reported for deoxynucleosides can be used by P. Srivastava, G. Revankar, R. Robins, and R. Rousseau J. Med. Chem., 1981, 24, 393-398. The synthesis of 4-triazolyluridine and its substitution with amines can be carried out as described for 2'-deoxythymidine by Y.-Z. Xu, Q. Zeng, and P. "Swann J. Org. Chem. 1992, 57, 3839-3845. Purine nucleoside bromination can be carried out as described in J. Gerster et al. J. Org. Chem. 1968, 33, 1070-1073.

No. Structure Name / 9- (2'-C-methy1-β-D-ribofuranosyl) - N6-. { 2-dimethylaminoetyl) -adenine 22 HO OH 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - (2-aminoethyl) adenine 23 HO OH 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - [2- (3 H -indol-3-yl) -ethyl] adenine 24 HO OH 25 25 25 Following the procedures set forth above and the procedures well known in the art, as well as those described by Li et al. 35, derivatives of 2'-C-trifluoromethyl-β-D-ribofuranosyl can be prepared. Following the procedures set forth above, as well as procedures well known in the art, including the procedures set forth by Devos, et al. And Sommadossi5 et al., The following compounds were prepared. 1-deazapurines can be prepared and coupled to ribofuranosyl derivatives as described in Cristalli, and collaborators in J. Med. Chem., 1987, 30 (9) p. 1686 or Seela, F. et al. In Nucleosides Nucleotides, 1998, 17 (4), page 729.

Purine nucleosides can be prepared and can be coupled to ribofuranosyl derivatives using the methods and materials described herein.

Benzimidazole nucleosides can be prepared and can be coupled to ribofuranosyl derivatives as described by Sagi, G., et al., In J. Med. Chem. 1992, 35 (24), 4549. 5-pyrrolopyridine nucleosides can be prepared can be coupled to ribofuranosyl derivatives as described in Tetrahedron 1976, 32, 773.

Analogs of 4-pyrimidopyridone Sangivamycin can be prepared and can be coupled to ribofuranosyl derivatives as described in J. Org. Chem., 1972, 37, 3980, and J. Org. ' Chem., 1977, 42, 997.

Analogs of 2-pyrimidopyridone can be prepared Sangivamycin and can be coupled to ribofuranosyl derivatives as described in J. Org. Chem., 1977, 42, 997.

Analogs of 4-pyrimidopyridone Sangivamycin can be prepared and can be coupled to ribofuranosyl derivatives as described in J. Org. Chem., 1972, 37, 3975.

Pyrimidopyridine analogues can be prepared and can be coupled to the sugar as described in Chem. Pharm. Bull-, 1968, 16, 1076, and J. Org. Chem., 1972, 37, 3975.

Pyrimido-tetrahydropyridines can be prepared and can be coupled to ribofuranosyl derivatives as described in Biorog. Khim., 1979, 5, 1369. Q Furanopyrimidines (& tetrahydro furanopyrimidines) can be prepared and can be coupled to ribofuranosyl derivatives as described in J. Med. Chem., 1983, 26, 661; J. Org. Chem., 1983, 48, 1854; and J. Med. Chem., 1985, 28, 1679.

Pyrazolopyrimidines can be prepared and can be coupled to ribofuranosyl derivatives as described in Chem. Ver., 1981, 114, 1610, and J. Med. Chem., 1983, 26, 1601.

Pyrolopyrimidines can be prepared and can be coupled to ribofuranosyl derivatives as described in Liebigs Ann. Chem., 1983, 1576.

Triazolopyrimidines can be prepared and can be coupled to ribofuranosyl derivatives as described in J. Heterocycl. Chem., 1971, 8, 237, and J. Carbohydr.

Nucleosldes Nucleotides, 1976, 3, 281 Pteridines can be prepared and can be coupled to ribofuranosyl derivatives as described in Nucleosides Nucleotides, 1989, 8, 1345, and Chem. Berich., 1974, 107, 3377.

Pyridine C-nucleosides can be prepared by coupling with ribofuranosyl derivatives to a variety of bases as described in Angew. Chem. Int. Ed. Engl., 1996, 35, 1968, and Helv. Chim. Acta, 1996, 79, 702-709.

Pyrazotriazine C-nucleosides can be prepared by coupling ribofuranosyl derivatives to a variety of bases as described in J. Heterocycl. Chem., 1976, 13, 175; -J. Hetreocycl. Chem., 1976, 13, 1305; J. heterocycl. Chem., 1980, 17, 1435; J. Org. Chem., 1977, 42, 109. 9-deazapurine C-nucleosides can be prepared by coupling ribofuranosyl derivatives to a variety of bases as described in J. Org. Chem., 1977, 42, 109; Chem. Ber., 1968, 101, 41; Tet. Lett., 1981, 21, 1013; J.

Org. Chem., 1967, 32, 1825; J. Heterocycl. Chem., 1978, 15, 353: Tet. Lett., 1981, 22, 25; Tet. Lett., 1986, 27, 815; and J. Med. Chem., 1990, 33, 2750.

Indole nucleosides can be prepared by coupling ribofuranosyl derivatives to a variety of indole bases as described in Yokoyama, M., et al., J. Chem. Soc. Perkin Trans. I, 1996, 2145.

General Use, Testing, and Administration General Use The present invention provides novel compounds possessing antiviral activity, including hepatitis C virus. The compounds of this invention inhibit HCV replication by inhibiting the enzymes involved in replication, including RNA polymerase. dependent on RNA. They can also inhibit other enzymes used in the activity or proliferation of HCV. The compounds of the present invention can also be used as prodrug nucleosides. As such they are captured in the cells and can be phosphorylated intracellularly by triphosphate kinases and then they are polymerase inhibitors (NS5b) and / or act as chain terminators. The compounds of this invention can be used alone or in combination with other compounds to treat viruses. Pharmaceutical compositions and Administration In general, the compounds of this invention will be "administered in an therapeutically effective amount by means of any of the administration modalities for agents having similar general uses." The present amount of the compound of this invention, ie, the active ingredient will depend on numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and manner of administration, and other factors.The drug can be administered more than once a day, preferably once or twice a day Therapeutically effective amounts of compounds of Formula Ia, Ib, Ic, II, IIA, III, or IV, can vary from about 0.05 to 50 mg per kilogram of body weight of the container per day, preferably about 0.01-25 mg / kg / day, more, preferably from about 0.5, to 10 mg / kg / day.Thus, for administration to a 70 kg person, the dosage n would more preferably vary from about 35-70 mg per day. In general, compounds of this invention will be administered as pharmaceutical compositions by any one of the routes: oral, generalized (e.g., transdermal, intranasal, or suppository), or parenteral (e.g., intramuscular, intravenous, or subcutaneous) administration . The preferred manner of administration is oral using a convenient daily dosage regimen that can be adjusted according to the degree of affliction. The compositions may take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions. Another preferred way to administer the compounds of this invention is inhalation. This is an effective method for delivering a therapeutic agent directly to the respiratory tract, in particular for the treatment of diseases such as asthma and the like or related respiratory tract disorders (see U.S. Patent 5,607,915). The selection of the formulation depends on several factors such as the mode of administration of the drug and the bioavailability of the drug substance. To release via inhalation the compound can be formulated as a liquid solution, suspension, propellants or dry powder in aerosol and can be loaded in a suitable dispenser for administration. There are several types of pharmaceutical inhalation devices - nebulizer inhalers, metered dose inhalers (MDI) and dry powder inhalers (DPI). The nebulizer devices produce a high velocity air stream that causes the therapeutic agents (which are formulated in liquid form) to spray as a spray that is conducted into the patient's respiratory tract. MDIs are typically formulations packed with a compressed gas. Upon activation, the device discharges a measured quantity of therapeutic agent by means of compressed gas, thus producing a reliable method of administering a pre-determined amount of agent. The DPIs distribute therapeutic agents in the form of a free-flowing powder that can be dispersed in the patient's inspiratory airstream during respiration through the device. In order to achieve a powder of free affluence, the therapeutic agent is formulated with an excipient such as lactose. A measured amount of the therapeutic agent is stored in the form of a capsule and is distributed with each activation. Recently, pharmaceutical compositions have been developed especially for drugs that show poor bioavailability based on the principle that bioavailability can be increased by increasing the surface area, i.e., decreasing the particle size. For example,, U.S. Pat. No. 4,107,288 discloses a pharmaceutical formulation having size particles in the range from 10 to 10., 000 nm, in which the active material is supported on a crosslinked matrix of macromolecules. The U.S. Patent No. 5,145,684 describes the production of a pharmaceutical formulation in which the drug substance is sprayed to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a formulation pharmaceutical that exhibits remarkably high bioavailability. The compositions generally comprise a compound of Formula Ia, Ib, Ic, II, IIA, III, or IV in combination with at least one pharmaceutically acceptable excipient. Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the compound of Formula Ia, Ib.; Ic, II, IIA, III, or IV. Said excipient can be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to a person skilled in the art. Solid pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, calcium carbonate, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, skimmed milk dehydrated and the like. The liquid and semi-solid carriers can be selected from glycerol, propylene glycol, water, ethanol, and various oils, including those of petroleum, animal, vegetable or synthetic origin, for example, peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols. Compressed gases can be used to disperse a compound of this invention in the form of an aerosol. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc. Other suitable pharmaceutical excipients and their formulation are described in Remington's Pharmaceutical Sciences, edited by E.W. Martin (Mack Publishing Company, 18th ed., 1990). The amount of the compound in a formulation can vary within the total range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent basis (% by weight), from about 01-99.99% by weight of a compound of Formula la, Ib, Ic, II, IIA, III, or IV based on the total formulation, reaching equilibrium with one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80% by weight. Representative pharmaceutical formulations containing a compound of Formula la, Ib, Ic, II, IIA, III or IV are as described below. EXAMPLES In the. Subsequent examples The following abbreviations have the following meanings. If an abbreviation is not defined, it has the generally accepted meaning. % mol = mole percent AcOEt = ethyl acetate μ? = microliters Arg = amino acid residue arginine Boc Py = N-Boc-4-amino-1-methyl pyrrol-2-carboxylic acid Boc = t-butoxycarbonyl Boc-5- Ain - N-Boc-5-Amino-Indole-2- Carboxylic acid Boc-5-Ain-HBA-AMPS = Acid ester (p- Hydroxy benzamide methylpolystyrene) N- Boc-5 - Amino- Indol- 2- Carboxylic BOC- Py- HBA- AMPS Acid ester (p-Hydroxy benzamide methylpolystyrene) N- Boc- 4- Amino- 1-Methyl pyrrol- 2-carboxylic acid Benzotriazole-1-yloxytris- hexafluorophosphate (dimethylamino) phosphonium wide duplet widest broad triplet wide singlet benzyl group protective concentrate dibenzyldene acetone dicyclohexylcarbodiimide 1,2-dichloroethane dichloromethane N, N'-dicyclohexylurea duplet duplet 2- (Dimethylamino) ethylamine Dicarboxylate diisopropyl azo N, Nr diisopropyl carbodiimide diisopropylethylamine 4- N, N-dimethyl amino pyridine dimethylethoxyethane DMF N, N-dimethylformamide DMSO dimethylsulfoxida DP 3- (Dimethylamino) propyl amine DPPA diphenyl phosphoryl azide dp f 1, 1'-bis (diphenylphosphino) ferrocene dt duplet triplet eq. equivalents Et ethyl radical EtOH ethanol Fraoc protective group fluorenyl methoxycarbonyl g gram Gly for amino acid residue glycine h hours HBA-A PS p-hydroxybenzamide-methylpolystyrene HBTU 0- Benzotriazole-1-yl- N, N, N ', N' hexafluorophosphate - tetramethyluronium HPLC high performance liquid chromatography LC / MC liquid chromatography / mass spectroscopy amino acid residue molar lysine millimolar multipleto radical methyl methanol milligram minutes milliliter millimeter millimole monomethoxy trityl (p-anisyl diphenyl methyl) protective group melting point melting point with decomposition spectrum normal mass radical nuclear magnetic resonance spectrum 4- nitrophenyl residue 4-nitro-1-ethyl-1H-pyrrol-2-carboxylic acid Npc (Me) 4-nitro-1-methyl-1H-pyrrole-2-carboxylic acid residue Npc (Pr) 4-nitro-1-propyl-1H-pyrrol-2-carboxylic acid residue Pfp pentafluorophenyl radical Phe phenyl radical Psi pounds per square inch Py 4- amino-1-methyl-1H-pyrrole-2-carboxylic acid residue Pyr pyridine Pzl-Gu- (Boc) 2 N, N'- Bis (tert-butoxycarbonyl) -1H-pyrazole-1-carboxamidine q quartet rpm revolutions per minute Rt retention time rt room temperature s singlet t triplet t-Bu 't-butyl protecting group TEA triethylamine TFA trifluoroacetic acid THF tetrahydrofuran TLC thin layer chromatography Z benzyl oxycarbonyl protective group v / v volume / volume v / v / v volume / volume / volume BSA bistrimethylsilylacetamide TMSOTf trimethylsilyl trifluoromethane sulfonate nm nanometer RP HPLC reverse phase HPLC NBS N-bromosuccinimide NIS. N-iodosuccinimide DI deionized NMP N-methylpyrrolidone PPA polyphosphoric acid Hex hexane DMEM Dulbecco 's Modified Eagle' s Medium When reporting MR data, chemical shifts are given in ppm and coupling constants (J) are given in Hertz (Hz ). All melting points are uncorrected. In the following examples and procedures, the starting materials and reagents are commercially available from Aldrich, Lancaster, Sigma, Specs, TCI, Maybridge Frontier Scientific and Bachem. The term "Aldrich" indicates that the compound or reagent used in the process is commercially available from Aldrich Chemical Company, Inc., Milwaukee, WI 53233 USA; the term "Lancaster" indicates that the compound or reagent is commercially available from Lancaster Synthesis, Inc., NH 03087 USA; the term "Sigma" indicates that the compound or reagent is commercially available from Sigma, St. Louis MO 63178 USA; the term "Maybridge" indicates that the compound or reagent is commercially available from Maybridge Chemical Co. Treviílet, Tintagel, Cornwall PL34 OHW United Kingdom; and the term "TCI" indicates that the compound or reagent is commercially available from TCI America, Portland OR 97203; the term "Frontier Scientific" indicates that the compound or reagent is commercially available from Frontier Scientific, Utah, USA; the term "Specs" indicates that the compound or reagent is commercially available from the Netherlands; and "Bachem" indicates that the compound or reagent is commercially available from Bachem, Torrance, California, USA. In the following examples compounds and intermediates useful for making the compounds of the present invention are exposed. Example 1 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6-bromopurine (41) 9- (2'-C-methyl-β-D-ribofuranosyl) -6-bromopurine (41) ), can be synthesized using the general procedure described in R. Harry-O 'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759. Example 2 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (thiophene-3-yl) -purine (1) Toluene (10) is added. mi) to a flask purged with argon containing 9- (2'-C-methyl-β-D-ribofuranosyl) -6-bromopurine (41) (1 mmol), K2CO3 (200 mg, 1.5 mmol), 3- acid. thiophenorbital (1.5 mmoles) and Pd (PPh3) (59 mg, 0.05 mmoles) and the mixture was stirred under argon at 100 pcs for 8 h. After cooling to room temperature the mixture was evaporated in vacuo and the residue was chromatographed on a column of silica gel. The residue is then taken up in 10 ml of MeOH saturated with NH3 and reacted at 55 ° C for 12 hours in a sealed tube. The reaction was cooled and concentrated in vacuo. The product was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1: 0.5 v / v / v). Example 3 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) - N 2 -isobutyrylguanosine (42) 9- (2'-C-methyl-β-D-ribofuranosyl) - N 2 -isobutyryl - guanosine (42), was synthesized using the general procedure described in R. Harry-O'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759 and isolated by HPLC. Example 4 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -2-amino-6-phenylpurine (4) 9- (2'-C-methyl-β- "D-ribofuranosyl) - N 2 -isobutyrylguanosine (42) (2 ml) was dissolved in dichloromethane (10 ml) under argon and 2,6-di-tert-butyl-4-methylpyridine (3 mmol) was added.The solution was cooled to 0 °. C and trifluoromethanesulfonic anhydride (3 mmol) was added and the reaction was allowed to warm to room temperature.After 12 hours the reaction was concentrated in vacuo and chromatographed on silica gel (ethyl acetate / dichloromethane). dissolved in toluene (10 ml) and then K2CO3 (200 mg, 1.5 mmol), phenylboronic acid (1.5 mmol) and PdPPh3) 4 (59 mg, 0.05 mmol) were added and the mixture was stirred under argon at 100 ° C for 8 hours. After stirring at room temperature, the mixture was evaporated in vacuo and the residue was chromatographed on a column of silica gel.The residue was taken up in 10 ml of MeOH saturated with NH3 and Reacted at 55 ° C for 12 hours in a sealed tube. The reaction was cooled and concentrated in vacuo. The product was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1.0: 0.5 v / v / v). Example 5 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -uracil (43) 9- (2'-C-methyl-β-D-ribofuranosyl) -uracil (43) was synthesized as described in R. Harry-O 'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759. EXAMPLE 6 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -4-thiophen-3-yl-1H-pyrimidin-2-one (17) dissolved 9- (2'-C-methyl-β-D-ribofuranosyl) -uracil (43 (1 mmol) in dichloromethane (10 ml) under argon, and 2,6-di-tert-butyl-4-methylpyridine was added (3 mmol) The solution was cooled to 0 ° C and trifluoromethanesulfonic anhydride (3 mmol) was added and the reaction was allowed to warm to room temperature.After 12 hours, the reaction was concentrated in vacuo and chromatographed on silica gel. silica (ethyl acetate / dichloromethane) The product was dissolved in toluene (10 ml) and then K2CO3 (200 mg, 1.5 mmol), 3-thiophenoric acid (1.5 mmol) and Pd (PPh3) 4 (59 mg, 0.05 immoles) and the mixture was stirred under argon at 100 ° C for 8 hours. at room temperature the mixture was evaporated in vacuo and the residue chromatographed on a column of silica gel. The residue was taken up in 10 ml of saturated NH 3 MeOH and reacted at 55 ° C for 12 hours in a sealed tube. The reaction was cooled and concentrated in vacuo. The product was isolated by column chromatography on silica gel (chloroform / naethanol / ammonia 9: 1: 0.5 v / v / v). Example 7 Synthesis of 1- (2'-C-methyl-β-β-ribofuranosyl) -4-cyclopentyl-1H-pyrimidin-2-one (21) 9- (2'-C-methyl-β-D was dissolved ribofuranosyl) -uracil (43) (1 mmol) in dichloromethane (10 ml) under argon and 2 g., 6-di-tert-butyl-4-methylpyridine (3 mmol). The solution was cooled to 0 ° C? Trifluoromethanesulfonic anhydride (3 mmoles) was added and the reaction was allowed to warm to room temperature. After 12 hours the reaction was concentrated in vacuo and chromatographed on silica gel (ethyl acetate / dichloromethane). The product was dissolved in anhydrous THF (10 mL) and Pd (PPh3) 4 (59 mg, 0.05 mmol) was added under Ar atmosphere. Cyclopentylzinc bromide (1.5 mmol, 0.5 M in THF) was then added and the reaction was stirred at room temperature for 18 hours. The mixture was evaporated in vacuo and the residue was chromatographed on a column of silica gel. The residue was taken up in 10 ml of saturated NH 3 MeOH and reacted at 55 ° C for 12 hours in a sealed tube. The reaction was cooled and concentrated in vacuo. The product was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1: 0.5 v / v / v). Example 8 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6-methylthio-purine (49) 9- (2'-C-methyl-β-D-ribofuranosyl) -6- was synthesized methylthio-purine (49) as described in R. Harry-0 'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759. Example 10 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- f2- (1H-imidazol-4-yl) -ethyl purine (106) Compound 106 was synthesized from histamine and the nucleoside 51 as described in Example 9, step 4. MS 361.45 (M + H) 1 H-NR (DMSO-de): 0.80 (s, 3H, 2'-CH 3), 3.25-3.45 (m, 4H, methylene), 3.53-4.05 (m, 7H, sugar), 5.99 (s, 1H, 1'-H), 7.48 and 9.09 (s, 1H, purine), 8.35 and 8.65 (bs, 0.7H, imidazole). Example 11 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -N6- (2-aminoethyl) adenine (23) The nucleoside (51) (1 mmol) was dissolved in pyridine (5 ml), ethylenediamine (5 mM) and the reaction mixture were added. it was kept overnight at room temperature. The solvent was evaporated; the product (23) was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1: 0.5, v / v / v). Example 12 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- G2- (1H-indol-3-yl) ethyl purine (24) Compound 24 was synthesized from tryptamine and nucleoside 51 as described in Example 9, step 4. MS 410.38 (M + H). "" | H-NR (DMSO-de): 0.76 (s, 3H, 2'-CH3), 2.60-4.10. { m, sugar and methylene), 5.98. { s, 1H, 1 '-?), 6.80 (d, 1H, indole), 7.18 (m, 4H, indole), 8.35 and 8.68 (s, 1H, purine), 9.02 (s, H, NH). Example 13 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- [(pyrrolidin-1-yl) -2-carboxamide] purine (25) Compound 25 was synthesized from L-proline amide and nucleoside 51 as described in Example 9, step 4. MS 380.35 (M + H) | "| H-NMR (DMSO-de): 0.86 (8, 3H, 2'-CH3), 2.25-3.95 ( m, 4H, pyrrolidine), 3.10-4.10 (m, sugar and pyrrolidine), 5.98 (8, 1H, l'-H), 8.35 and 8.68 (8, 1H, purine), 9.25 (8, 1H, amide). EXAMPLE 14 Synthesis of 1- (2 ', 3', 5'-Tri- O-benzoyl-2'-C-methyl-β-D-ribofuranosyl) - uracil (47) was synthesized 1- (2 ', 3' , 5'- Tri- 0-benzoyl-2'-C-methyl-β-D-ribofuranosyl) -uracil (47) as described in R. Harry-0 'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759, Example 15 Synthesis of 1- (2 ', 3', 5'-Tri- O-benzoyl-2'-C-methyl-β-D-ribofuranosyl) - 4- (1, 2, 4-triazol-1-yl) uracil (52) 1, 2, 3-triazole (60 mol) was suspended in dry acetonitrile (70 ml) at 0 ° C. ox was slowly added. Phosphorus chloride (15 mlm) with rapid stirring followed by trickle addition of triethylamine (50 mmol). The reaction mixture was stirred for 30 min at 0 ° C and the nucleoside (47) (15 mmol) was added. In 1 hour the reaction was stopped with 50 ml of saturated sodium bicarbonate solution. The product was extracted with 50 ml of chloroform. The organic extract was washed with 5% sodium bicarbonate solution, water, dried over magnesium sulfate and evaporated. The product was isolated by column chromatography on silica gel (toluene / ethyl acetate). Example 16 Synthesis of 1- '(2'-C-methyl-β-D-ribofuranosyl) -N 4 - (aminocarbonylmethyl) cytidine (26) The nucleoside (52) (1 mmol) 95% pyridine (5 ml) was dissolved , glycine amide (5 mM) was added and the reaction mixture was stored for 16 hours at 55 ° C. The solvent was evaporated. The product (26) was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1: 0.5 v / v / v). Example 17 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -N4- (pyridin-1-ylmethyl) cytidine (27) The nucleoside (52) was dissolved in 95% pyridine (5 ml) , pyridin-1-yl-methylamine (5 mM) was added and the reaction mixture was stored for 16 hours at 55 ° C. The solvent was evaporated. The product (27) was isolated by column chromatography on silica gel (chloroform / methanol / ammonia 9: 1: 0.5 v / v / v). Example 18 Synthesis of 2'-C-methyladenosine (50) 2'-C-methyladenosine (50) was prepared as described in R. Harry-0 'kuru, J. Smith, and M. Wolf J. Org. Chem. 1997, 62, 1754-1759.

Example 19 Synthesis of 2'-C-methyl-8-bromoadenosine (28) Bromine (20 mL) was added to 50 mL of water and stirred vigorously at room temperature for 3 minutes. The nucleoside (50) was suspended in 30 ml of water and Br2-water was added by means of aliquots at a rate such that the yellow color of the reaction mixture disappeared between each addition. The total amount of Br2-water is 45 ml. The solid was collected by filtration and washed carefully with ice water until pH 5.5. The residue was recrystallized from hot water to produce 60% of the objective product. Example 21 Synthesis of 5- ^ '- C-methyl-β-D-ribofuranosyl) - 5H- pyrrolo [3, 2- c | pyridin-4-ylamine (80) The title compound can be prepared by methods similar to those described by Ducrocq6 on pages 779 to 780. Example 22 Synthesis of 4-amino-8- (2'-) amide C-methyl-β-D-ribofuranosyl) -5-oxo-5,8-dihydropyrido [2,3-pyrimidine-6-carboxylic acid (81) The title compound can be prepared by methods. similar to those exhibited in Rizkalla7 on page 3985.

EXAMPLE 23 Synthesis of 2, 4-diamino-6- (2'-C-methyl-β-D-ribofuranosyl) -5-oxo-5,8-dihydropyrido [2,3-dlpyrimidin-6] acid amide - carboxylic (82) The title compound can be prepared by methods similar to those described by Anderson8 page 999. Example 24 Synthesis of 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) amide ) - 7-oxo-7,8-dihydropyrido [2, 3-d] 5-carboxylic acid (83) The title compound can be prepared by methods similar to those described by Anderson8, page 1000. Example 25 Synthesis of 2, 4-diamino-8- (2'-C-methyl-β-D-ribofuranosyl) -7-oxo-7, 8-dihydropyrido-2, 3- d \ pyrimidin-5-carboxylic acid amide (84) The title compound can be prepared by methods similar to those set forth by Anderson8, page 1000. Example 26 Synthesis of 8- '(2'-C-methyl-β-D-ribofuranosyl) -2- acid amide methylsulfanyl-4, 5- dioxo- 3, 4, 5, 8- te rahidrop irido [2, 3-d] pyrimidine-6-carboxylic acid (85) Step 1. Synthesis of 2-methylsulphanyl-4,5-dioxo-3, 4, 5, 8-tetrahydropyridyl ethyl ester [2, 3 - d] pyrimidine-6-carboxylic acid The 4,5-dioxo-3,4,5,8-tetrahydro [2, 3-d] pyrimidine-6-carboxylic acid ethyl ester was synthesized, as described in BH Rizkalla and AD Broom, J. Org. Chem. 1972, 37 (25), 3980-3985. Step 2. Synthesis of the ethyl ester of 8- (3, 4-bis-benzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulphane-4,5- ethyl ester. dioxo- 3, 4, 5, 8-- tetrahydro-pyrido [2, 3-d] pyrimidine-6-carboxylic acid To a suspension of the product from step 1 above (0.2 g, 0.71 mmol) in dry acetonitrile (3.5 ml), BSA (0.385 ml, 1.56 mmol) was added and the mixture refluxed under argon for 30 minutes. The resulting solution was cooled to room temperature and 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-furanose (0.32 g, 0.55 mmol) in dry acetonitrile was added followed immediately by TMSOTf (0.513 ml, 2.84 mmol). The resulting reaction mixture was heated to reflux for 2 hours. The reaction was allowed to cool to room temperature, then concentrated in vacuo to an oily residue. The oily residue was taken up in EtOAc and washed 1 X with saturated NaHCO 3 solution and the aqueous layer re-extracted 2X with EtOAc. The organic fractions were combined, washed with ¾0, brine, and dried over Na2SO4 and concentrated in vacuo. The crude reaction was purified, by chromatography on silica gel using 10% methanol in methyl chloride for elution. Appropriate fractions were pooled, evaporated, and foamed from methylene chloride to give 0.406 g (100%) of the title compound. Step 3. Synthesis of 8- (3,4-Dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulphanyl-4,5-dioxo-3, 4, 5 , 8-tetrahydropyrido [2, 3-d] pyrimidine-6-carboxylic acid The product from Step 2 above (0.2 g, 0.270 mmol) was dissolved in 40 ml of liquid ammonia and stirred at room temperature for 48 hours. The liquid ammonia was allowed to evaporate and the resulting yellow oily residue was purified by HPLC Regulator B 0-20% for 30 min at an expense of 10 ml / min. Regulator A ~ 0.1% triethylammonium acetate in water, Regulator B- triethylammonium acetate in C¾CN. The fractions containing the nucleoside were conjugated and evaporated in vacuo and dried by co-evaporation with absolute ethanol to yield 27 mg (25%) of the desired nucleoside. MS: 397.13 (M-H). ??? - NMR (DMS0-d6): 0.8 (s, 3H, -2'- CH3), 2.5 (s, 3H, -CH3), 3.0-4.0 (m, 4H, sugar), 5.0-5.5 (m, 3H, -OH), 6.7 (s, 1H, l'-H), 7.4 (s, 1H, -Ar), 8-8 and 9.2 (s, 2H, -NH2). Example 27 Synthesis of 8- (2'-C-methyl-β-D-ribofuranosyl) -8H-pyrido [2, 3-d] pyrimidin-2,4-dione (86) The title compound can be prepared by methods similar to those described by Rizkalla9 on page 3979. Example 28 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -1H-pyrido [2, 3- d] pyrimidin-2,4-dione (87) The title compound can be prepared by methods similar to those described by Rizkalla9 on page 3979. Example 29 Synthesis of 8- (2'-C-methyl- β-D-ribofuranosyl) -4-methylsulfanyl-5, 6, 7, 8-tetrahydropyrido [2, 3-d] pyrimidine (88) The title compound can be prepared by methods similar to those set forth in Biorog. Khim., 1979, 5, 1369. EXAMPLE 30 Synthesis of 3- (2'-C-methyl-β-D-ribofuranosyl) -6-methyl-3, 7a-dihydro-1H-furol [2, 3- d \ pyrimidin-2-one (89) The title compound can be prepared by methods similar to those set forth in De Clercq12, page 666. Example 31 Synthesis of 3- (2'-C-methyl-β-D-ribofuranosyl) - 3, 5, 6, 7a- tetrahydro-1H-furo [2, 3- d | pyrimidin-2-one (90) The title compound can be prepared by making appropriate modifications to the methods set forth by Griengl14, page 1680. Example 33 Synthesis of 7- (2 / - C-methyl-β-D-ribofuranosyl) - 4 Methylsulfanyl-7H-pyrrolo [2, 3-pyrimidine (92) The title compound can be prepared by methods similar to those set forth in Seela17, page 1585. EXAMPLE 34 Synthesis of 1- (2'- C- methyl- β-D-ribofuranosyl) -4-methylsulfanyl-1H-pyrrolo [2, 3-d] pyrimidine (93) The title compound can be prepared by means of. methods similar to those described by Seela17, page 1585. EXAMPLE 35 Synthesis of 3- (2'-C-methyl-β-D-ribofuranosyl) -3H- [1, 2, 41 triazol fl, 5 a] pyrimidin- 7 - ona (94) The title compound can be prepared by methods similar to those described in inkley18, page 239.

Example 36 Synthesis of 3-methyl-8- (2'-C-methyl-β-D-ribofuranosyl) -2-methylsulphanyl-3H, 8H-pteridin-4,7-dione (95) The title compound can be prepared by means of methods similar to those reported by Hawkin39, et al., page 2875. EXAMPLE 37 Synthesis of 5- (2'-C-methyl-β-D-ribofuranosyl) pyridin-2-ylamine (96) The title compound can be prepared by coupling the alternative sugar f prepared as described in Reaction Scheme 1, with the base prepared by means of methods similar to those previously described22-23. Example 38 Synthesis of 5- (2'-C-methyl-β-D-ribofuranosyl) -1H-pyridin-2-one (97) The title compound can be prepared by coupling the alternative sugar f, prepared as described in Reaction Scheme 1, with the base prepared as described in Reaction Scheme 1, with the base prepared by means of methods similar to those previously described22-23. Example 39 Synthesis of 8- (2'-C-methyl-β-D-ribofuranosyl) -pyrazolo [1,5-a] [1,, 3,51 triazin-4-ylamine (98) The title compound can be prepared by coupling the alternative sugar f, prepared as described in Reaction Scheme 1, with the base prepared by means of methods similar to those described by Tam25, et al., on page 1307. Other C-nucleotides of pyrazolotriazine can be prepared, for example compounds 99 and 100, using this sugar (f) and other techniques well known in the art24-27. Example 41 Synthesis of 9- (2'-C-trifluoromethyl-β-D-ribo uranosyl) -N6- (2-aminoethyl) adenine (62) The title compound can be prepared by methods similar to those exposed by Li35, and collaborators and methods described herein. Couplings of ribofuranosyl can be coupled. trifluoromethylated to a variety of bases, for example compounds 63, 64, 66 and 67, can be prepared by techniques described herein as well as methods well known in the art. Example 42 Synthesis of 1- (2'-C-ethenyl-β-D-ribofuranosyl) -1H-benzimidazole (73) The title compound can be prepared by methods similar to those set forth in Sagi, 38 and collaborators and methods described in the present. Ethenylated ribofuranosyl derivatives can be coupled to a variety of bases, for example compounds 68-70, can be prepared by means of the techniques described herein as well as methods well known in the art. Example 43 Synthesis of 1- (2'-C-ethenyl-β-D-ribofuranosyl) -1H-benzimidazole (79) The title compound can be prepared by methods similar to those set forth in Sagi 38, et al. And the methods described at the moment. Entanylated ribofuranosyl derivatives can be coupled with a variety of bases, for example the compounds '74-76, can be prepared by means of the techniques described herein as well as the methods known in the art. Example 44 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -4-nitroindole (104) The title compound can be prepared by methods similar to those set forth in Yokoyama43, et al. Other indole nucleosides can be prepared by coupling ribofuranosyl derivatives to an indole variety, for example compounds 105, can be prepared by techniques described herein as well as methods well known in the art43. Example 45 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (azetidin-1-yl) purine (107) Compound 105 was synthesized from azetidine and nucleoside 51 as described in Example 9, Step 4. MS 323.32 (M + H) ^ -NR (DMSO-de): 0.76 (s, 3H, 2'-CH3), 3.25-3.45 (m, 4H, methylene), 3.14 - 4.10 (m , sugar and azetidine), 5.98 (s, 1H, 1"-H), 8.35 and 8.68 (s, 1H, purine) Example 46 Synthesis of 9- (2 ^ - C-methyl-β-D-ribofuranosyl) - 6- (pyrrolidin-1-yl) purine (108) Compound 108 was synthesized from pyrrolidine and nucleoside 51 as described in Example 9, step 4. MS 336.32 (M + H) 1H-MR (DMSO-de): 0.77 (s, 3H, 2'-CH3), 2.00 (m, 4H, pyrrolidine), 3.43-4.14 (m, sugar and pyrrolidine ), 5.98 (s, 1H, l'-H), 8.36 and 8.72 (s, 1H, purine). Example 47 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (piperidin-1-yl) purine (57) Compound 57 was synthesized from pyrrolidine and nucleoside 51 as described in Example 9, Step 4. MS 350.37 (M + H) XH-MR (DMSO-ds): 0.78 (s, 3H, 2'-CH3) # 1.62 (m, 6H, piperidine), 3.43-3.88 (m, sugar and piperidine), 4.01 -4.02 (d, 1H, 3'-H) 5.97 (s, 1H, l'-H), 8.28 and 8.58 (s, 1H, purine). Example 48 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (hydroxylamino) purine (109), 9- (2'-C-methyl-β-D-ribofuranosyl) -hypoxanthine ( 110) Sulfonyl 51 (0.2 mmol) was dissolved in 3 ml of dry ethanol, hydroxylamine solution (prepared as described in PK Chang, J. Med. Chem., 1965, 8, 884) was added (2 mM) and the The mixture was refluxed for 1 hour and then concentrated in vacuo. The residue was dissolved in DMF (5 mL) and purified by 20-100% B HPLC in 30 minutes, flow of 10 mL / min. A- 0.2% triethylammonium acetate in water, B - 0.2% triethylammonium acetate in CH3CN. The fractions containing the mixture of the protected nucleosides 109 and 110, were evaporated, dissolved in MeOH, treated with HCl / eOH for 5 minutes at 0 ° C and the mixture of nucleosides 109 and 110 (3: 1) was precipitated with ether. The mixture was separated by HPLC, 0-20% B in 30 minutes, regulators described above. The corresponding fractions were combined, evaporated, co-evaporated with water (3 x 10 mL), dissolved in methanol (10 mL) and precipitated with ether (35 mL) to yield the white solid. 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - (hydroxylamino) purine (109) MS: 283.19 (M + H), and max 261.5 nm,) 1 H-MR (DMSO-de): 0.68 (8, 3H, 2'-CH3), 3.81-4.04 (m, 2H, 5'-H) 4.07 (t, 1H, '-H), 4.17-4.20 (d, 3 * -H), 6.06 (s) , 1H, 1 '-?), 8.06 and 8.53 (8, 1H, purine). 9- (2'-C-methyl-β-D-ribofuranosyl) -hypoxanthine (110) MS: 298.38 (M + H). 1H-MR (DMSO-de): 1.09. (s, 3H, 2'-CH3), 3.85-4.24 (m, 3H, sugar), 6.16 (s, 1H, l'-H), 8.21 and 8.62 (s, 1H, hypoxanthine). Example 49 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6-methoxyminopurine (111) Compound 111 was synthesized from methoxylamine and nucleoside 51 as described in Example 9, step 4. MS 312.41 (M + H); "" "H-MR (DMSO-de): 0.91 (s, 3H, 2'-CH3), 3.82-4.04 (m, 7H, sugar), 3.95 (s, 0-CH3), 6.01 (s, 1H, 1-H), 8.22 and 8.88 (s, 1H, adenine) Example 50 Synthesis of 9- (2'-C-methyl-β-D-ribo uranosyl) -6-hydrazinopurine (55) Nucleoside 55 was synthesized from the sulfonyl derivative 51 and hydrazine as described in Example 9, Step 4. MS 297.31 (M + H) "" "H-NMR (DMSO-de): 0.80 (s, 3H, 2'-CH3) , 3.80-4.00 (m, 7H, sugar), 6.02 (5, 1H, l'-H), 8.47 and 8.77 (5, 1H, purine). Example 51 Synthesis of 9- (2'-C-methyl-β-D-ribo uranosyl) -6-N-methylhydrazinopurine (112) Nucleoside 112 was synthesized from the sulfonyl derivative 51 and hydrazine as described in Example 9 , step 4. MS 313.72 (M + H) 1 H-MR (DMSO-de): 0.68 (s, 3H, 2'-CH 3), 3.80-4.00 (m, 7H, sugar), 3.88 (s, N-CH 3 ), 5.90 (s, 1H, l'-H), 7.68 and 8.21 (s, 1H, purine). Example 52 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3,6-dihydro-2H-pyridin-1-yl) purine (113) Compound 113 was synthesized from 3,6- dihydropyridine and nucleoside 51 as described in Example 9, step 4. MS 348.32 (M + H) 1 H-NMR (DMSO-de): 0.88 (s, 3H, 2'-CH 3), 3.10-3.40 (m, 6H, CH2-tetrahydropyridine), 3.80-4.00 (m, 7H, sugar), 5.80-5.98 (m, 2H, CH-tetrahydropyridine), 6.01 (s, 1H, 1'-H), 8.23 and 8.48 (s, 1H , purine). Example 53 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3, 4-dihydro-1H-isoquinolin-2-yl) purine (114) Compound 114 was synthesized from 3, 4-dihydroisoquinoline and nucleoside 51 as described in Example 9, step 4. MS 398.53 (M + H) 1 H-NMR (DMSO-dg): 0.88 (s, 3H, 2'-CH 3), 2.25-2. .31 and 2.90-3.00 (m, 2H, methylene), 3.10-3.40 (m, 6H, CH2-tetrahydropyridine), 3.80-4.00 (m, 4H, sugar), 5.20-5.35 (m, 3H, OH-sugar) , 6.01 (s, 1H, l'-H), 7.16-7.25 (m, 4H, becene), 8.27 and 8.53 (s, 1H, purine). Example 54 Preparation of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (1, 3, 4, 9-tetrahydro-beta-carbolin-2-yl) purine (33) The compound was synthesized 33 from 3,4-di-idisoquinoline and nucleoside 51 as described in Example 9, step 4. MS 437.43 (M + H). 1 H-NMR (DMSO-de): 0.89 (s, 3 H, 2'-CH 3), 2.98 (m, 2 H, methylene), 3.40- 4.00 (m, sugar and methylene tetrahydropyridine), 4.05 (d, 3'- H), 6.05 (s, 1H, 1'-H), 6.90-7.05 (m, 2H, aromatic), 7.29-7.40 (m, 2H, aromatic), 8.32 and 8.65 (8, 1H, purine), 10.99 ( 8, 1H, NH). EXAMPLE 55 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrrone f2, 3- di pyrimidine (117) Step 1. Synthesis of 7- (2'-C-methyl- β-D-ribofuranosyl) -4-chloro-pyrrolo [2, 3-d] pyrimidine (141) was prepared as described in WO 02/057287, page 27-30. Step 2. 7- (2'- C- methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrrolo [2, 3-d] pyrimidine (117) Nucleoside 141 (300 mg, 1 mmol) was dissolved in dry ethanol (10 mL), hydroxylamine solution was added (prepared as described by PK Chang, J. Med. Chem., 1965, 8, 884) (10 mM) and the mixture refluxed for 1 hour and then concentrated in vacuo. The residue was purified by HPLC 0-30% B in 30 minutes, flow 30 ml / min. A ~ 0.2% triethylammonium acetate in water, 0.2% triethylammonium acetate in CH3CN. The corresponding fractions were combined, evaporated, coevaporated with water (3 x 10 mL), dissolved in methanol (1 mL) and precipitated with ether (35 mL) to yield 117 as a white solid. Example 56 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-methoxylamino-pyrrolo [2,3-pyrimidine (118) Nucleoside 118 was prepared from nucleoside 141 (Example 55, Step 1) substituting methoxylamine for hydroxylamine. Example 57 Synthesis of 1- (2'-O-methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrazolo [3,4-d] pyrimidine (120) Step 1. Synthesis of 2, 3, 5- tri- O - benzoyl-2'-methyl-1,5-dihydro-pyrazolo [3,4-d] pyrimidin-4-one (142). Nucleoside 142 was synthesized as described in Example 1, by substitution of 6-bromopurine for 1,5-dihydropyridolo [3, 4-d] pyrimidin-4-one Stage 2. Synthesis of 2, 3, 5- tri- O-benzoyl-2'-methyl-4-chloro-pyrazolo [3, 4-d] pyrimidine (143) "Nucleoside 142 in toluene was dissolved; 10 equivalents of SOCl2 were added and the mixture was heated at 50 ° C for 2 hours. The solvents were evaporated in vacuo, the residue was co-evaporated with toluene and purified by flash chromatography on silica gel (toluene-ethyl acetate, 9: 1 v / v). The corresponding fractions were evaporated, dissolved in 10 ml of methanol and 5 ml of NH 4 OH was added. The reaction mixture was stored at room temperature overnight and evaporated. The nucleoside was isolated from the title by HPLC as described in Example 55, Step 2. Step 3. l- (2'-C-methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrazolo [3, 4- d ] pyrimidine (120) Nucleoside 143 was transformed to nucleoside 120 as described in Example 55, Step 2. Example 58 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -4-meoxylamino- pyrazolo [3, 4-pyrimidine (119) Nucleoside 119 was prepared from nucleoside 143 (Example 57, Step 3) by substituting hydroxylamine for methoxylamine. Example 59 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-chloro-4-hydroxylamino-pyrrolo [2, 3-pyrimidine (123) Nucleoside 117 (0.1 mmole) was dissolved in DMF (0.5 ml) and cooled to 0 ° C. N-chlorosuccinimide (NCS) (0.1 mmol) dissolved in DMF (0.5 ml) was then added dropwise and the reaction was stirred for 30 minutes at 0 ° C and 30 minutes at room temperature. The reaction was stopped with methanol (5 mL) and then concentrated. The chromatography column (Si02) with MeOH / DCM yielded 123. EXAMPLE 60 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-bromo-4-hydroxylamino-pyrrolo [2, 3-4 ] pyrimidine (124) Nucleoside 124 was prepared in the same manner as for 123, replacing N-bromosuccinimide (NBS) with NCS. Example 61 Synthesis of 7- (2'-C-methyl-ft-D-ribofuranosyl) -5-methyl-4-hydroxylamino-pyrrolo [2, 3-d] pyrimidine (125) Step 1: Nucleoside 141 was dissolved ( 1 mmol) in DMF (5 mL) and cooled to 0 ° C. NBS (1 mmol) dissolved in DMF was then added dropwise and the reaction was stirred for 30 minutes at room temperature. The reaction was stopped with methanol (50 mL) and then concentrated. Column chromatography (Si02) with MeOH / DCM gave 7-bromo-6-chloro-7-desazapurine riboside. Stage 2: The nucleoside from Stage 1 (0.5 mmol) was dissolved in 10% aqueous dioxane solution (2.5 ml) and potassium carbonate (1.5 mmol) and tetrakis (triphenylphosphine) palladium were added, followed by trimethylboroxin (0.5 mmol). ). The reaction was refluxed for 18 hours, then filtered through Celite and concentrated. Column chromatography (Si02) with MeOH / DCM gave 7-methyl-6-chloro-7-desazapurine riboside. Step 3: Nucleoside 125 was synthesized as described in Example 55, Step 2, using hydroxylamine. EXAMPLE 62 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-ethyl-4-hydroxylamino-pyrrone f2, 3-pyrimidine (128) Step 1: The nucleoside of Example 61 was dissolved, Step 1 (0.1 mmol) in THF (1 mL) and then tetrakis was added. (triphenylphosphine) palladium. To this reaction diethyl zinc was then added and the reaction was heated to reflux for 6 hours. The reaction was stopped with aqueous solution of NH 4 Cl and worked extractive. Column chromatography (Si02) with MeOH / DCM gave 7-ethyl-6-chloro-7-desazapurine riboside. Step 2: Nucleoside 128 was synthesized as described in Example 55, Step 2, using hydroxylamine. Example 63 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-cyano-4-hydroxylamino-pyrrolo [2, 3-pyrimidine < 126) Step 1: The nucleoside of Example 61, Step 1 (0.5 mmol) and THF (5 ml) was dissolved and then tetrakis (triphenylphosphine) palladium was added. To this reaction was then added zinc cyanide and the reaction was heated to reflux for 6 hours. The reaction was stopped with aqueous solution of NH 4 Cl and worked extractive. Column chromatography (Si02) with MeOH / DCM afforded 7-cyano-6-chloro-7-desazapurine riboside. Step 2: Nucleoside 126 was synthesized as described in Example 55, Step 2, using hydroxylamino. Example 64 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrrolo [2, 3-pyrimidin-5-carboxyl amide (127) Step 1: The nucleoside of Example 6, Step 1 (0.5 mmol) in anhydrous ethanol (10 mL) and then saturated with anhydrous HCl. The reaction was stirred at room temperature overnight and then concentrated. The residue was redissolved in ethanol (5 mL) and then water (1 mL) was added and the reaction was stirred for 2 hours. The solution was concentrated and purified by column chromatography (Si02) with MeOH / DCM which gave 7-carboxamide-6-chloro-7-desazapurine riboside. Step 2: Nucleoside 127 was synthesized as described in Example 55, Step 2, using hydroxylamine.

Example 65 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-bromo-4-methoxylamine-pyrrolo [2, 3-d] pyrimidine (129) Nucleoside 129 was synthesized from 118 as described in Example 60. EXAMPLE 66 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-methyl-4-methoxylamino-pyrrolo [2, 3-d] pyrimidine (130) The nucleoside 130 as described in Example 55, Step 2, substituting methoxylamine for hydroxylamine. Example 67 Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -5-cyano-4-methoxylamino-pyrrolo [2, 3-d] pyrimidine (131) The nucleoside of Example 61 was converted, Step 2 to 131, as described in Example 66. Example 69: Synthesis of 7- (2'-C-methyl-β-D-ribofuranosyl) -4-methoxylamino-pyrrolo [2, 3-d] pyrimidin-5-carboxyl amide (132) The nucleoside of Example 63, Step 1, was converted to 132 as described in Example 66.

Example 70 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-bromo-4-hydroxylamino-pyrazolo [3,4-pyrimidine (133) The nucleoside 120 was converted to 133 as described in Example 60. EXAMPLE 71 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-methyl-4-hydroxylamino-pyrazolo f3, 4-pyrimidine (134) The nucleoside 134 was synthesized from 143 using the conditions described in Example 61. Example 72 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-cyano-4-hydroxylamino-pyrazolo f3, 4-pyrimidine (135) Nucleoside 135 was synthesized from 143 using the conditions described in Example 63. Example 73 Synthesis of 1-. { 2'-C-methyl-β-D-ribofuranosyl) -4-hydroxylamino-pyrazolo [3,4-pyrimidine-3-carboxamide (136) Nucleoside 136 was synthesized from 143 using the conditions described in Example 64. Example 74 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-bromo-4-methoxylamino-pyrazolo [3, 4-d] pyrimidine (137) Nucleoside 137 was synthesized from 119 using the conditions described in Example 61. Example 75 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-methyl-4-methoxylamino-pyrazolo [3,4-d] pyrimidine (138) synthesized nucleoside 138 from 143 using the conditions described in Example 61, substituting methoxylamine for hydroxylamine. Example 76 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -3-cyano-4-methoxylamino-pyrazolo [3,4-d] pyrimidine (139) Nucleoside 139 was synthesized from 143 using the conditions described in Example 63, substituting methoxylamine for hydroxylamine. Example 77 Synthesis of 1- (2'-C-methyl-β-D-ribofuranosyl) -4-methoxylamino-pyrazolo [3,4-pyrimidine-3-carboxamide (140) Nucleoside 140 was synthesized, from 143 using the conditions described in Example 64, substituting methoxylamine for hydroxylamine. Example 78 Synthesis of 2'-C-methyl-β-D-ribofuranosyl-6-methylthiopirin (150) Step 1. Synthesis of 2 ', 3', 5'- Tri- 0- benzoyl- 2'- C- methyl-β-D-ribofuranosyl-6-methylthio-purine 6- Methylthiopyrine (1.43 g, 8.6 mmol) was suspended in 100 ml of dry CH 3 CN, bis-trimethylsilylacetamide (BSA) (5 ml, 20 mmol) was added and the mixture was refluxed until a clear solution formed (approximately 30 minutes). 1, 2, 3,5-tetra-0-benzoyl-2'-C-methyl-β-D-ribofuranose (4 g, 6.9 mmol) was added, followed by trimethylsilyl trifluoromethane sulfonate (TMSOTf) (5 mL). The mixture refluxed for 4 hours, the disappearance of the sugar was controlled by means of TLC in ethyl acetate-hexane (1: 1 v / v). The 10% solution of NaHCO 3 was added and the benzoylated nucleoside was extracted with ethyl acetate. The aqueous fraction was extracted with the organic fraction (2 x 30 ml). The combined organic fractions were washed with water, dried over Na 2 SO 4 and evaporated. The nucleoside was isolated by means of column chromatography on silica gel using 5% ethyl acetate in toluene as eluent in 74% yield. MS: 625.72 (M + H); "" "H-NMR (CDCl 3): 1-59 (s, 3H, 2'-CH 3), 2.74 (s, 3H, SCH 3), 4.70-4.80 &5.90-5.00 (m, 3H, H-4 ' and H-5'a, b), 6.23 (d, 1H, H-3 '), 6.80 (s, 1H, .H-1'), 7.25-8.20 (m, 15H, benzoyl), 8.20 &8.80. (s, 2H, purine) Step 2. Synthesis of 2'-C-methyl-β-D-ribofuranosyl-6-methylthio-purine The compound isolated in Step 1 was dissolved in methanol saturated with K 2 CO 3. 20 min, the solvent was evaporated and the title compound was purified by flash chromatography in 10% methanol in chloroform MS: 313.38 (M + H). 1 H-NMR (DMSO-de): 0.89 (s, 3H , 2'-CH3), 2.82 (s, 3H, SCH3), 3.62-4.15 (m, 4H, sugar), 5.23-5.31 (m, 2H, sugar), 5.40 (s, 1H, H-3 '), 6.01 (s, 1H, H-1 '), 8.20 &8.80 (s, 2H, purine) Example 79 Synthesis of 2'-C-methyl-β-D-ribofuranosyl-6-phenyladenine (155) Suspended. 6- phenyl adenine (315 mg, 1.5 mmol) in 20 ml dry CH3CN, BSA (0.4 ml) was added and the mixture refluxed until a solution was formed. n clear (approximately 30 minutes). 1, 2, 3, 5-tetra-0-benzoyl-2'-C-methyl-β-D-ribofuranose was added, followed by trimethylsilyl trifluoromethane sulfonate (0.2 ml). The mixture was refluxed for 4 hours, the disappearance of the sugar was controlled by TLC in ethyl acetate-hexane (1: 1 v / v). 10% NaHC03 solution was added and the benzoylated nucleoside was extracted with ethyl acetate. The aqueous fraction was extracted with the organic fraction (2 x 30 ml). The combined organic fractions were washed with water, dried over Na2SC > 4 and evaporated. The residue was dissolved in 20 mL of NH3 / methanol and left overnight at room temperature. The reaction mixture was concentrated and purified by column chromatography on silica gel using ethyl acetate / isopropanol / water (9: 1: 2, upper phase) as eluent. The title nucleoside was dissolved in methanol and precipitated with ether in 75% yield. MS: 358.51 (M + H); "" "H-NMR (DMSO-de): 0.81 (s, 3H, 2'-CH3), 2.82 (s, 3H, SCH3), 3.80-4.20 (m, 4H, H-4 ', H-5' a, b, HO-5 '), 5.20-5.41 (m, 3H, H-3', HO-2 ', HO-3'), 6.01 (s, 1H, H-l '), 6.90-7.10 ( t, 1H, 4-phenyl), 7.28-7.32 (t, 2H, 3,5-phenyl), 7.90 (d, 2H, 2,6-phenyl), 8.40 &8.62 (s, 2H, purine), 9.90 (s, 1H, NH) Example 80 Synthesis of 2'-C-methyl-β-D-ribofuranosyl-6- (2-dimethylamino-ethylamino) purine Step 1. Synthesis of 9- (5'-O-monomethoxytriphenylmethyl- 2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfuryl) Compound 150 (1.5 g, 5 mmol) was dissolved in 30 ml of dry pyridine, p-anisylchlorodiphenylmethane (7.5 mmol) was added and the The reaction was stored at room temperature for 2 days.The solvent was evaporated and the residue was partitioned between ethyl acetate and water.The organic phase was washed with 10% aqueous solution of NaHCO 3, water, dried with Na 2 SO 4 and evaporated. The crude oil was purified by column chromatography on silica gel using methanol to 5% in chloroform. The fractions containing the title nucleoside were combined, evaporated and freeze-dried from benzene to yield 2.1 g (74%) of nucleoside, the desired product as a white solid foam. MS: 585.96 (M + H), 1 H-NMR (CDC13): 0.99 (s, 3 H, 2'-CH 3), 2.76 (s, 3 H, SCH 3), 3.80 (s, 3 H, CH 3, trifly) 3.50- 3.55. , 4.10- 4.18 & 4.20- 4.30 (m, 4H, sugar), 5.30 (d, 1H, H-3 '), 6.08 (s, 1H, H-1') / 7.20-7.50 (m, 14H, trifly), 8.20 & 8.68 (s, 2H, purine). Stage 2 . Synthesis of 9- (5'-O-monomethoxytriphenylmethyl-2 '- (methyl-ß ^ D-ribofuranosyl) -6- (methylsulfonyl) purine The nucleoside prepared in the above Step 1 (2 g, 3.4 min.) Was dissolved in 5 g. ml of dry acetonitrile, 8.2 ml of 1M solution of 3-chloroperoxybenzoic acid was added and the reaction mixture was kept at room temperature for 1 hour.The reaction mixture was distributed between water and chloroform.The organic fraction was washed with aqueous solution 10% NaHC03, water, dried and evaporated to yield the title compound in 95% yield MS: 617.83 (M + H) Step 3. Synthesis of 9- (2-C-methyl-β- D-ribofuranosyl) -6- (2-dimethylaminoethylamino) purine 9- (5'-O-monomethoxytriphenylmethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine (0.2 mmol) was dissolved. ) in 3 mL of dry acetonitrile and 2-dimethylamino-ethylamine (2 mmol) was added The mixture was refluxed for 1 hour and then concentrated in vacuo. uo was dissolved in DMF (5 ml) and purified by HPLC 20-100% B in 30 minutes, flow of 10 ml / min. A - 0.2% triethylammonium acetate in water, 0.2% triethylammonium acetate in CH3CN. Fractions containing protected 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (2-dimethylamino-ethylamino) purine were evaporated, dissolved in MeOH, treated with HC1 / MeOH for 5 minutes at 0 ° C and the title compound was precipitated with ether. The title product was separated by HPLC, O-20% B in 30 minutes (regulators described above). The corresponding fractions were combined, evaporated, co-evaporated with water (3 x 10 mL), dissolved in methanol (10 mL) and precipitated with ether (35 mL) to yield the title compound as a white solid ( yield: 55% based on 9- (5'-O-monomethoxytri phenylmethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine). MS 338.92 (M + H) 1 H-NMR (DMSO-d 5): 0.78 (s, 3H, 2'-CH 3), 1.62 (m, 6H, piperidine), 2.76-2.88 (s, 9H, methyl-N), 3.25-3.45 (m, 4H, methylene), 3.53-4.10 (m, 7H, sugar), 5.98 (s, 1H, 1'H), 8.35 and 8.65 (s, IH, purine). Example 81 Synthesis of 9 - '<; 2'-C-methyl-β-D-ribofuranosyl) benzimidazole (60) GL0 8795 The title compound was prepared as described above in Example 79 using benzimidazole as the heterocyclic base. MS 267.32 (M + H) "" "H-MR (DMSO-de): 0.81 (s, 3H, 2'-CH3) 3.68-4.20 (m, 4H, sugar), 5.25- 5.30 (m, -2H , sugar), 5.40 (s, 1H, H-3 '), 6.10 (s, 1H, H-1') / 8.87.9.00 &9.10 (3s, 3H, purine) Example 82 Synthesis of 9- (2 - C-methyl-β-D-ribofuranosyl) - 6- (2- (1H-imidazol-4-yl) -ethylamino) purine (156) Compound 156 was synthesized from 2- (2H-imidazol-4-yl) ethylamine and 9- (5'-O-monomethoxytriphenylmethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine as described in Example 80, Step 3. MS 376.78 (M + H ) 'H-NMR (DMSO-d6): 0.80 (s, 3H.2'-CH3), 3.25-3.45 (m.4H, methylene), 3.53-4.05 (m, 7H, sugar) 5.99 (s, 1H , 1'-H), 7.48 and 9.09 (s, 1H, purine), 8.35 and 8.65 (bs 0.7H, imidazole) Example 83 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) - 6- (2-piperidin-1-yl-ethylamino) purine (157) The title compound was synthesized from 2-piperidin-1-yl-ethylamine and 9- (5'-0-monomethoxytriphenylmethyl-2'-C-methyl) - ß- D-ribofur anosyl) -6- (methylsulfonyl) purine as described in Example 80, Step 3. MS 293.58 (M + H); 1 H-NMR (DMSO-d 6): 0.88 (s, 3 H, 2'-CH 3), 1.40 (bs, 2 H, methylene), 1.65-1.82 (m, 4 H, 3.25-3.45 (m, 4 H, methylene), 3.10 -4.15 (m, 10H, sugar &piperidine), 5.99 (s, 1H, 1 · -H), 8.35 (s, 1H, purine), 8.60 (bs, 1.5H, purine &NH) Example 84 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (sky propylamine) purine (158) The title compound was synthesized from cyclopropylamine and 9- (5'-O-monomethoxytriphenylmet il-2 ' -C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine, as described in Example 80, Step 3. MS 322.43 (M + H); 1H-MR (DMSO-d6): 0.88 (s) , 3H, 2'-CH3), 0.21-0.32 (m, 5H, cyclopropane), 3.53-4.05 (m, 7H, sugar), 5.99 (s, 1H, 1 '-?), 8.68 and 8.99 (s, 1H , purine) Example 85 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (cyclopentylamino) purine (159) The title compound was synthesized from cyclopentylamine and 9- (5 ' - O-monomethoxytriphenylmethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine as is described in Example 80, Step 3. MS 350.64 (M + H) 1 H-MR (DMSO-d 6): 0.88 (5, 3H, 2'-CH 3), 1.47-1.65 (m, 9H, cyclopentane), 3.86. -4.86 (m, 7H, sugar), 6.10 (5, 1H, l'-H), 8.47 and 8.79 (5, 1H, purine), 11.5 (5, 1H, NH). Example 86 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (heavenhexylamino) purine (160) The title compound was synthesized from cyclohexylamine and 9- (5'-0-monomethoxytriphenylmethyl- 2). '-C- methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine, as described in Example 80, Step 3. S 364.64 (M + H); ! H-NMR (DMSO-de): 0.86 (s, 3H, 2 '-CH3), 1.30-1.42 (m, 10H, methylene), 2.58-2.62 (m, 1H, methine), 3.86-4.86 (m, 7H, sugar), 6.10 (s, 1H, 1 '-?), 8.24 and 8.98 (s, 1H, purine), 11.5 (s, 1H, NH). Example 87 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (6-fluoro-1,3,3,9-tetrahydro-β-carbolin-2-yl) purine (163) The title compound was synthesized from 6-fluoro-2, 3, 4, 9-tetrahydro-1H-beta-carboline and 9- (5'-0-monomethoxytriphenylmethyl-2'-C-methyl-β-D-ribofuranosyl) - 6- (methylsulfonyl) purine as described in Example 80, Step 3. MS 455.69 (M + H); 1H-MR (DMSO-d6); 0.82 (s, 3H, 2'-CH3), 1.10-1.40 (m, 6H, methylene), 3.00-4.00 (m, 6H, sugar), 4.18-4.21 (d, IH, H-3 '), 6.05 (s, 1H, H-1 *), 6.90-6.95 (m, 1H, indole), 7.30-7.35 (m, 2H, indole), 8.36 & 8.67 (s, 1H, purine), II.5 (s, 1H, NH). Example 88 Synthesis of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3,6-dihydro-2H-pyridin-1-yl) purine (164) The title compound was synthesized from 1 , 2, 3, 6-tetrahydropyridine and 9- (5'-0-moriomethoxytriphenyl-dimethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine as described in Example 80, Step 3. MS 348.49 (M + H); "" "H-NMR (DMSO-de): 0.90 (s, 3H, 2'-CH3), 1.50-1.63 (m, 2H, methine), 2.10-3.20 (m, 6H, tetrahydropyridine), 3180-4.10 ( m.H3H, sugar), 5.20-5.40 (m, 3H, sugar), 6.00 (s, 1H, H-1 '), 8.22 £ 8.55 (s, 1H, purine) Example 89 Synthesis of 1- ( 2'-C-methyl-β-D-ribofuranosyl) -5-aminobenzimidazole and 1- (2'-C-methyl-β-D-ribofuranosyl) -6-aminobenzimidazole GL048950 Step 1. Synthesis of 1- { 2 '- C-methyl-β-D-ribofuranosyl) -5-nitrobenzimidazole and 1- (2'-C-methyl-β-D-ribofuranosyl) -6-nitrobenzimidazole The mixture of nitronucleosides was prepared in 82% yield as described above in Example 79, using 5-nitrobenzimidazole as the heterocyclic base MS: 310.34 (M + H); XH-MR (DMSO-dg): 0.71 &0.72 (s, 3H, 2 '- (¾) | , 3.23-4.00 (m, 4H, sugar), 5.19-5.33 (m, 1H, sugar), 5.41 &5.50 (2s, 1H,? -3 '), 6.05 &6.13 (2s, 1H, H- l '), 7.80-9.00 (4H, benzimidazole) Step 2. Synthesis of 1-' (2'-C-methyl-β-D-ribofu ranosyl) -5-aminobenzimidazole and 1- (2'-C-methyl-β-D-ribofuranosyl) -6-aminobenzimidazole The mixture of the nitronucleosides prepared in the above Step 1 was dissolved in methanol and hydrogenated over Pd / C at 10% at 25 psi for 40 min. The catalyst was filtered and washed thoroughly with methanol, the solution was concentrated and the residue was purified by column chromatography as described in Example 79 to produce the inseparable mixture of the 5- and 6-aminobenzimidazole nucleosides. MS 280.32 (+ H) 1 H-NMR (DMSO-ds): 0.84 & 0.87 (s, 3H, 2'-CH3), 3.23-4.00 (m, 8H, sugar), 5.19-5.33 (m, 4H, sugar), 4.76 & 4.99 (2s, 1H, H-3 '), 5.68 & 5.75 (2s, 1H, H-1 '), 6.49-7.29 (4H, benzimidazole), 8.21 & 8.29 (2s, 1H, NH2). Example 91 Preparation of 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (tetramethylguanidino) purine (178) The title compound was synthesized from tetramethylguanidine and 9- (5'-O-monomethoxytriphenylmethyl) -2'- C-methyl-β-D-ribofuranosyl) -6- (methylsulfonyl) purine as described in Example 80, Step 3.

MS 380.49 (M + H); 1H-NMR (DMSO-de): 0.90 (s, 3H, 2'-CH3), 2.90 (s, 12H, CH3), 3.20-4.15 (m.7H, sugar), 6.00 (s, 1H, H-1) '), 8.48 & 8.85 (8, 1H, purine). Example 92 Synthesis of 2'-C-methyl-β-D-ribofuranosyl-purine-6-carboxamide (208) Step 1. Synthesis of V, 2 ', 3', 5'-tetra-0-benzoyl-2'- C-Methyl-6-carbonitril-purine 9- (5'-O-monomethoxytriphenylmethyl-2'-C-methyl-β-D-ribofuranosyl) -6- (methylsulfañil) purine (Example 80, Step 1) (624) mg, 1 mmol) in 5 ml of dry acetonitrile, 3 ml of a 1M solution of 3-chloroperoxybenzoxy acid was added and the reaction mixture was kept at room temperature for 1 hour. The reaction mixture was distributed between water and. chloroform. The organic fraction was washed with 10% aqueous solution of NaHCO 3, water, dried and evaporated to yield 6-methyl-nucleoside with 95% yield. MS: 657.83 (M + H). The product was dissolved in DMF and NaCN (2 equivalents) was added. The reaction mixture was stirred at room temperature for 2.5 hours to provide a yellow solution. The solvent was evaporated in vacuo to leave a residue, which was divided with chloroform and water. The organic portion was washed with water, 10% solution of NaHCO3 and water again. The chloroform portion was dried and evaporated. The compound was isolated by column chromatography on silica gel using 5% methanol in chloroform for elution. The corresponding fractions were evaporated to produce the desired product (50%) as a foam. MS: 604.78 (M + H), 1 H-NMR (CDC13): 1.85 (5, 3H, 2'-CH 3), 4.75-5.00 (m, 3H, sugar), 6.07-6.09 (d, 1H, H-3 '), 6.81 (5, 1H, H-l'), 7.25-8.20 (m, 15H, benzoyl), 8.60 & amp;; 9.08 (5, 2H, purine).

Step 2. Synthesis of 2'-C-methyl-β-D-ribofuranosyl-purine-6-carboxamide 1 ', 2', 3 ', was dissolved. 5'-tetra-O-benzoyl-2'-C-methyl-6-carbonitrile-purine (105 mg) in a water / methanol / hydrogen peroxide (30%) 1: 1: 0.05 v / v / v mixture ( 20 mi). The solution was adjusted to pH 9 with NH40H. The mixture was heated gently until a clear solution was obtained and then it was kept at room temperature overnight. The reaction mixture was evaporated and the residue was purified by. RP HPLC as previously described ~. The corresponding fractions were evaporated, co-evaporated with water and dried to provide the desired compound in 60% yield.

MS: 310.78 (M + H), ^ "H-NMR (DMSO-d6): 0.82 (s, 3H, 2'-CH3), 3.80-4.16 (m, 4H, sugar), 5.28- 5.35 (m, 3H , sugar), 6.17 (s, 1H, H-1 ') / 8.74 &8.86 (s, 2H, purine) Example 94 Synthesis of 2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro) - furan-2-yl) -2H-fl, 2,4] triazin-3, 5-dione (169) Step 1. Synthesis of 1, 2, 3, 5-tetra-0-benzoyl-2'-C- methyl-β-D-ribofuranose The intermediate of the title was prepared as described hereinabove, Step 2. Synthesis of 2- (3, 4-dibenzoyl-5-benzoylmethyl-3-methyl-tetrahydrofuran-2-yl) ) - 2H- [1, 2, 4] triazin-3, 5-dione 2H- [1, 2, 4] triazin-3, 5-dione (Aldrich) 194.5 mg, 1.72 mmol) was dissolved in anhydrous acetonitrile (6). BSA (0.85 ml, 3.44 mmol) was added via syringe and the reaction was refluxed at 90 ° C. for 45 minutes, then the reaction was allowed to cool to room temperature. O-Benzoyl-2'-C-methyl-β-D-ribofuranose (500 mg, 0.861 mmol is) in anhydrous acetonitrile (6 ml) and added to the reaction mixture. TMSOTf (0.625 ml, 3.44 mmol) was then added to the reaction dropwise via syringe. The reaction mixture is then refluxed at 90 ° C for 2 hours. The mixture was then diluted with EtOAc (200 ml) and washed with 200 ml of saturated NaHCO 3 solution. the organic layer was extracted 2x with 100 ml of EtOAc and the combined organic fractions were washed with brine and dried over magnesium sulfate. The reaction was purified via column chromatography on silica gel (2: 4: 4 EtOAc: DCM: hexane) to yield a white crystalline product (450 mg, 0.79 mmol, 91%). 1H-NMR (CDC13): 8.13 (m, 4H), 8.00 (dd, 2H), 7.63 (dt 2H), 7.50 (m, 5H), 7.35 (t, 2H), 7.29 (5, 1H), 7.11 (5, 1H), 6.04 (dd, 1H), 4.85 (dd, 1H), 4.76 (m, 1H) ), 4.54 (dd, "IH), 1.80 (5, 3H) Step 3. Synthesis of .2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydrofuran-2-yl) -2H [1, 2, 4] triazin-3, 5-dione 35 mg of 2- (3, 4-dibenzoyl-5-benzoylmethyl-3-methyl-tetrahydrofuran-2-yl) -2H [1, 2 , 4] triazine-3, 5-dione in ammonia-saturated methanol (10 ml) The reaction was sealed and stirred for 48 hours.The reaction was concentrated in vacuo to an amorphous solid and then precipitated from methanol and dichloromethane to obtain the product (12 mg, 75% yield) MS 258.12 (MH), XH-NMR (DMSO-de): 7.55 (s, 1H), 5.95 (s, 1H), 5.00 (s, 2H), 4.55 ( s, .1H), 3.80 (t, 1H), 3.65 (dd, 2H), 3.45 (dd, 2H), 1.02 (8, 3H) Example 95 Synthesis of 5- hydroxymethyl-3-methyl-2- (6- thiophen-3-yl-purin-9-yl) tetrahydrofuran-3, 4-diol (1) Step 1. Synthesis of 2- (6-bromo-purin-9-yl) -5-benzoi loxymethyl-3-methyl-tetrahydro-furan-3, 4-oxybenzoyl 6-bromo-9H-purine (Aldrich), 342.3 mg, was dissolved. 1. 72 mmole) in anhydrous acetonitrile (6 ml). BSA syringe (0.85 ml, 3.44 mmol) was added via syringe, and the reaction was refluxed at 90 ° C for 45 minutes. The reaction was then allowed to cool to room temperature. 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose (500 mg, 0.861 mmol) was dissolved in anhydrous acetonitrile (6 ml) and added to the mixture of reaction. The reaction was then added dropwise via syringe, TMSOTf (0.625 ml, 3.44 mmol). The reaction mixture was then refluxed at 90 ° C by 3.5. you pray The mixture was then diluted with EtOAc (100 mL) and washed with 100 mL of saturated bicarbonate solution. The 2x organic layer was extracted with 100 ml of EtOAc and the combined organic fractions were washed with brine and dried over magnesium sulfate. This mixture was then concentrated in vacuo. The reaction was purified via column chromatography on silica gel (charged over 5% EtOAc in DCM, eluted with 10% EtOAc in DCM) to yield a white, off-white solid (500 mg, 0.76 mmol, 87%). ^ "H-NMR (CDC13): 8.75 (s, 1H), 8.40 (s, 1H), 8.12 (dd, 2H), 8.06 (dd, 2H), 8.00 (dd, 2H), 7.65-7.35 (m, 10H), 6.82 (s, 1H), 6.21 (d, 1H), 4.95 (m, 2H), 4.75 (m , 1H), 1.61 (s, 3H). Step 2. 5- Benzoyloxymethyl-3-methyl-2- (6-thiophen-3-yl-purin-9-yl) -tetrahydrofuran-3, 4-oxybenzoyl In a sealed reaction vessel, the following reagents were added. : 2- (6-bromo-purin-9-yl) -5-bnenzoyloxymethyl-3-methyl-tetrahydrofuran-3,4-oxybenzoyl from Step 1 above, (240 mg, 0.365 mmole), 3- acid boric thiophen (Aldrich, 71 mg, 0.548 mmol), potassium carbonate (76 mg, 0.548 mmol), Pd (PPh3) 4 (42.18 mg, 0.0365 mmol). The reagents were then dissolved in anhydrous toluene (9.6 ml) and stirred at 100 ° C overnight. The reaction was diluted with EtOAc (100 mL) and washed 2x with saturated sodium bicarbonate solution (200 mL). The combined organic layers were then washed with brine, dried over sodium sulfate, and concentrated in vacuo. The product was purified via column chromatography on silica gel (1: 3 EtOAc: hexane), and the fractions were concentrated to yield a brown oil (220 mg, 0.33 mmol). Step 3. 5-Hydroxymethyl-3-methyl-2- (6-thiophen-3-yl-purin-9-yl) -tetrahydrofuran-3, 4-diol. 5-Benzoyloxymethyl-3-methyl- 2- was dissolved. (6-thiophen-3-yl-purin-9-yl) -tetrahydrofuran-3, 4-oxybenzoyl, from Step 2 above, (220 mg, 0.33 mmol) in saturated ammonia-methanol (20 ml) and stirred at room temperature overnight. The reaction was then concentrated in vacuo and purified via HPLC (0% acetonitrile in water to 100% acetonitrile for 20 minutes.The product eluted at 10.5 minutes) to yield a yellow oil (92 mg, 0.26 mmol, 79%). ) - MS 349.11 (M + H), ^ "H-NMR (DMSO-d6): 8.90 (dd, 1H), 8.86 (s, 1H), 8.81 (s, 1H), 8.24 (dd, 1H), 7.45 (m, 1H), 6.17 (s, 1H), 4.53 (d, 1H), 4.18 (d, 2H), 3.98 (dd, 1H), 0.96 ( s, 3H). Example 96 Synthesis of 5- hydroxymethyl-3-methyl-2- (6-phenyl-purin-9-yl) -tetrahydrofuran-3, 4-diol (170 Step 1. 5-benzoyloxymethyl-3-methyl- 2- (6- phenyl-purin-9-yl) -tetrahydrofuran-3, 4-oxybenzoyl In a sealed reaction vessel, the following reagents were added: 2- (6-bromo-purin-9-yl) -5- benzoyloxymethyl-3-methyl-tetrahydro-furan-3, 4-oxybenzoyl (prepared as described above) (200 mg, 0.300 mmol), phenyl boronic acid (Aldrich, 54.9 mg, 0.45 mmol), potassium carbonate (63 mg) 0.45 mmole), Pd (PPh3) 4 (23 mg, 0.02 mmole) The reagents were then dissolved in anhydrous toluene (6 ml) and stirred at 100 ° C overnight, then the reaction was diluted with EtOAc (75 mL). mi) and washed 2 × with saturated sodium bicarbonate solution (150 ml) The combined organic layers were washed with brine, dried over sodium sulfate, and concentrated in vacuo. silica gel (1: 4 EtOAc: hexane), and the fractions were concentrated to give a colorless oil (153 mg, 0.23 mmol). Step 2. 5-Hydroxymethyl-3-methyl-2- (6-phenyl-purin-9-yl) -tetrahydrofuran-3, 4-diol. The product from Step 1 above (153 mg, 0.23 mmol) was dissolved. in methanol saturated with ammonia (20 ml) and stirred at room temperature overnight. The reaction was then concentrated in vacuo and purified via HPLC (0% acetonitrile in water to 30% acetonitrile for 20 minutes, the product eluted at 15.3 minutes) to yield a colorless oil (61 mg, 0.18 mmol, 78%). . MS 343.15 (M + H), 1H-MR (DMSO-d6): 8.93 (s, 1H), 8.68 (m, 2H), 8.60 (s, 1H), 7.52 (m, 3H), 6.23 (s, 1H) ), 4.47 (d, 1H), 4.15 (dd, 2H), 3.96 (dd, 1H), 0.85 (s, 3H). Example 97 Synthesis of 5-amino-2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2H- [1,2,4] triazin-3-one (174 ) Y. 5- amino-2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4,5-dihydro-2H-fl, 2,4] triazin- 3- thiona (172) Stage 1. Synthesis of 2- (3, 4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -5-thioxo-4,5-dihydro-2H- [1, 2, 4] triazin-3-one was dissolved 2- (3,4-dibenzoyl-5-benzoylmethyl-3-methyl-tetrahydro-furan-2-yl) -2H- [1, 2, 4] triazin-3, 5-dione (450 mg, 0.79 min) in anhydrous toluene (25 mi). Lawesson's reagent (161 mg, 0.4 mmol) was added and the reaction refluxed at 120 ° C for 4 hours. The reaction was concentrated in vacuo and co-evaporated with dichloromethane, and purified via column chromatography (3: 2: 3 DC: EtOAc: hexane) to yield a yellow oil (160 mg, 0.3 mmol). Step 2. Synthesis of 5-amino-2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydrofuran-2-yl) -2H [1, 2, 4] triazin-3-one The product from Step 1 above was dissolved in saturated ammonia methanol (25 ml) and stirred at room temperature overnight. The reaction was then concentrated in vacuo and purified via column chromatography (1: 9 MeOH: DCM) to yield a white amorphous solid (5.6 mg, 0.02 mmol) MS 259.12 (M + H), ^ -H-NMR (DMSO -d6): 7.49 (S, 1H), 6.08 (s, 1H), 3.79 (d, 1H), 3.7 (d, lH), 3.6 [d, 2H), 3.48 (m, 1H), 0.94 (s, 3H) Step 3: Synthesis of 5- amino-2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4,5-dihydro-2H- [1,2, 4] triazine-3-thione: The title compound was collected as a separate fraction during the purification in Step 2 above. MS 274.09 (MH), XH-NMR (DMSO-d6): 7.73 '(s, lH), 5.91 (8, 1H), 3.81 (dd, 1H), 3.7 (d, 1H), 3.60 (d, 1H) , 3.48 (dd, 1H), 1.03 (8.3H) Example 98 Synthesis of 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-hydroxy-1H- pyridin-2-one <; 177) Step 1. Synthesis of 4- (2,4-dichloro-benzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -2- (4-hydroxy-2-oxo-2H-pyridin) ester 1-yl) -3-methyl-tetrahydro-furan-3-yl benzoic pyridin-2,4-diol (Aldrich, 148 mg, 1.33 min) was dissolved in anhydrous acetonitrile (6 ml). 'BSA (0.66 ml, 2.67 moles) was added via syringe, and the reaction was refluxed at 90 ° C for 45 minutes. The reaction was then cooled to room temperature. 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose (400 mg, 0.666 mmol) was dissolved in anhydrous acetonitrile (6 ml) and added to the reaction mixture. . Excess drop was then added via syringe to the reaction mixture, TMSOTf (0.482 mL, 2.67 mmol). The reaction mixture was then refluxed at 90 ° C for 3.5 hours. The mixture was then diluted with EtOAc (200 mL) and washed with 200 1 of saturated sodium bicarbonate solution. The organic layer was extracted 2x with 200 ml of EtOAc and the combined organic fractions were washed with brine and dried over magnesium sulfate. The mixture was then concentrated in vacuo. The reaction was purified via column chromatography on silica gel (1:19 eOH: DCM) and concentrated in vacuo to yield a colorless liquid (312 mg, 0.82 mmol, 70%). Step 2. Synthesis of 1- [4- (2,4-dichloro-benzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -3-hydroxy-3-methyl-tetrahydrofuran-2-yl] -4 hydroxy-1H-pyridin-2-one The product of Step 1 above (312 mg, 0.46 mmol) was dissolved in saturated methanol of potassium carbonate (4.6 ml) and stirred at room temperature overnight. The mixture was then diluted with EtOAc (100 mL) and washed with 100 mL of saturated bicarbonate solution, then washed with brine and dried over magnesium sulfate. The magnesium sulfate was removed by filtration and the solution was concentrated in vacuo to a white powder (265 mg, 0.46 mmol, 100 ¾). MS 677.96 (M-H). Step 3. Synthesis of 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-hydroxy-1H-pyridin-2-one The product of the Step was dissolved 2 above (265 mg, 0.46 mmol) in DCM (14 ml) and the temperature was reduced to -78 ° C. Boron trichloride (1.0 M in DCM, 4.6 ml, 4.6 mmol) was added dropwise to the reaction. The reaction was stirred at 78 ° C for 2 hours and then warmed to -20 ° C overnight. The reaction was stopped with 1: 1 MeOH: DCM (20 mL) and stirred at -20 ° C for 15 minutes. It was used ??, ?? to neutralize the reaction, and then concentrated in vacuo to a brown solid. The product was purified via column chromatography on silica gel (1: 4 MeOH: DCM) to yield a white powder (99 mg, 0.385 mmol, 84).

MS 256.10 (MH), 1H-NMR (DMSO-d6): 7.86 (d, 1H), 6.06 (s, 1H), 5.86 (dd, 1H), 5.54 (d, 1H), 5.12 (dd, 2H), 5.00 (s, 1H), 3.78 (m, 2H), 3.64 (dd, 2H), 0.86 (s, 3H) Example 99 Synthesis of 2- (2-chloro-6-methoxy-purin-9-yl) -5 - hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-diol Step 1. Synthesis of 2- (2-chloro-6-methoxy-purin-9-yl) -4- (2,4-dichloro-benzyloxy) 5- (2,4-dichloro-benzyloxymethyl) -3-methyl-tetrahydrofuran-3-ol To a solution of 1-methyl-3, 5-bis- (2,4-dichloro-benzyloxy) -2- C-methyl-] - D-ribofuranose (400 mg, 0.8 mmol), in anhydrous dichloromethane (13 ml) at 0 ° C was added HBr (30% by weight in acetic acid, 1 ml), dropwise. The resulting solution was stirred at 0 ° C for 1 hour, then at room temperature for 3 hours, evaporated in vacuo and co-evaporated with anhydrous toluene (3 x 20 mL). Then the oily residue was dissolved in anhydrous acetonitrile (15 ml) and added to a solution of the sodium salt of 2,6-dichloro-9H-purine, prepared by stirring 2-6-dichloro-9H-purine (455 mg. , 2.4 mmol) with sodium hydride (60% in mineral oil, 110 mg) in anhydrous acetonitrile (50 ml) for 4 hours. The combined mixture was stirred for 24 hours, then evaporated to dryness. The residue was diluted with EtOAc (75 ml) and water (75 ml). The aqueous layer was removed and re-extracted with EtOAc (2 x 50 mL). The combined organic fractions were then washed with brine (100 ml) and dried over magnesium sulfate. The reaction was purified by column chromatography on silica gel (1: 1 EtOAc: hexane) to yield an amorphous solid (400 mg, 0.61 mmol) Step 2. 2- (2- chloro-6-methoxy) synthesis purin-9-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol The product of Step-1 above was dissolved in dichloromethane (16 ml) and the temperature was reduced to -78 ° C. . Boron trichloride (1.0 M in DCM, 6.1 ml, 6.1 mmol) was added to the reaction dropwise via syringe. The reaction was stirred at -78 ° C for 2 hours and then warmed to -20 ° C overnight. The reaction was stopped with 1: 1 MeOH: DCM (30 mL) and stirred at -20 ° C for 15 minutes. The solution was neutralized with NH OH and concentrated in vacuo to a foam. The product was purified by column chromatography on silica gel (1: 9 MeOH: DCM) to yield a white solid (161 mg, 0.48 mmol, 79%). MS 331.09 (M + H), ^ H-NMR (DMSO-de): 8.76 (s, 1H), 5.92 (s, 1H), 5.40 (s, 1H), 5.24 (t, 2H), 4.09 (s, 3H), 3.99 (m, '1H), 3.92 (m, 1H), 3.69 (m, 1H), 0.77 (s, 3H). Example 100 Synthesis of 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-oxo-4,7-dihydro-3H-pyrrolo [2, 3-d] pyrimidine-5-carboxamidine (203) Step 1. Synthesis of 5-bromo-7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -3,7-dihydro-pyrrolo [2, 3-d] pyrimidin-4-one 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -3,7-dihydropyrrolo [2] was dissolved. 3- d] pyrimidin-4-one in DMF. NBS was added and the reaction was stirred at room temperature. The finished reaction was then concentrated to a solid, dissolved in EtOAc and washed with water. The organic layer was then washed with brine and dried over sodium sulfate. The solution was then concentrated in vacuo to a solid. Step 2. Synthesis of 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-, yl) -4-oxo-4,7-dihydro-3H-pyrrolo [2, 3 d] pyrimidin-5-carbonitrile The product from Step 2 above was combined with Zn (CN) 2, Pd 2 (dba) 3 / dppf, and zinc powder in DMF. The reaction was refluxed at 120 ° C. The finished reaction was purified by column chromatography on silica gel to give the product as a result. Step 3. Synthesis of 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-oxo-4,7-dihydro-3H-pyrrolo [2, 3-d ] pyrimidine-5-carboxamidine The product from Step 2 above was dissolved in saturated HC1 in ethanol and allowed to stir at room temperature overnight. The reaction was then concentrated to dryness. Stage 4. Synthesis of 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-oxo-4,7-dihydro-3H-pyrrolo [2, 3-d] pyrimidine-5-carboxamide The product of Stage 3 above was dissolved in liquid ammonia and heated in a bomb overnight. The reaction was then concentrated to produce the final product. Example 101 Synthesis of 2- (4-amino-5-furan-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol (204) Step 1. Synthesis of 4-chloro-5-iodo-7H-pyrrolo [2, 3-d] pyrimidine 4- Chloro-7H-pyrrolo [2, 3-d] pyrimidine (TCN) was dissolved in DMF. NIS was added, and the reaction was stirred at room temperature for 1 hour. The reaction was then dissolved in EtOAc, washed with brine, and dried over sodium sulfate. The solution was concentrated until it decreased to produce an orange solid. Step 2. Synthesis of 4-chloro-5-furan-2-yl-7H-pyrrolo [2, 3-d] pyrimidine The product from Step 1 above was dissolved in dioxane, and the following reagents were added: acid 2- boric furan (Aldrich), potassium carbonate, and palladium tetrakis. The reaction vessel was sealed and heated at 100 ° C overnight. The reaction was filtered through celite and purified via HPLC to yield a yellow solid. Step 3. Synthesis of 7- [3, 4- bis- (2,4-dichloro-benzyloxy-5- (2,4-dichlorobenzyloxymethyl) -tetrahydro-furan-2-yl] -4-chloro- 5- furan-2-yl-7H-pyrrolo [2,3-d] pyrimidine To a solution of 1-methyl-3, 5-bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D - ribofuranose in anhydrous dichloromethane at 0 ° C, HBr (30% by weight in acetic acid, 1 ml) was added dropwise. The resulting solution was stirred at 0 ° C for 1 hour, then at room temperature for 3 hours. After evaporation in vacuo and co-evaporation with anhydrous toluene, the oily residue was dissolved in anhydrous acetonitrile and added to a solution of the sodium salt of the product from Step 1 above, which was prepared by stirring with hydride. Sodium (60% in mineral oil) in anhydrous acetonitrile for 4 hours The combined mixture was stirred for 24 hours, then evaporated to dryness The residue was diluted with EtOAc and water The aqueous layer was removed and re-extracted with EtOAc The organic fractions co The blenders were then washed with brine and dried over magnesium sulfate. The reaction was purified by column chromatography on silica gel. Stage 4 Synthesis of 2- (4-chloro-5-furan-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol The product of the Stage 3 above was dissolved in dichloromethane and the temperature was reduced to -78 ° C. Boron trichloride was added dropwise to the reaction. The reaction was stirred at -78 ° C for 2 hours, then at -20 ° C overnight. The reaction was quenched with 1: 1 MeOH: DCM and stirred at -20 ° C for 15 minutes. NH4OH was used to neutralize the reaction, and then concentrated in vacuo to a solid. The product was purified via column chromatography on silica gel. Step 5. Synthesis of 2- (4-amino-5-furan-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol the product of Stage 4 above in liquid ammonia and sealed in a pump. The reaction was stirred at 80 ° C overnight. The solution was concentrated to produce the product. Example 102 Synthesis of 2- (4-amino-5-oxazol-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol (205) Step 1. Synthesis of 4-chloro-5-oxazol-2-yl-7H-pyrrolo [2, 3-d] pyrimidine 4-chloro-5-iodo-7H-pyrrolo [2, 3-d] pyrimidine was dissolved (as prepared 'previously) in THF. To the reaction mixture, tetrakis (triphenylphosphine) of palladium and 2-tributyltin-oxazole (Aldrich) were added. The reaction vessel was sealed and heated at 100 ° C overnight. The compound was purified via column chromatography on silica gel. Step 2. Synthesis of 7- [3, 4- bis- (2, 4- dichloro-benzyloxy- 5- (2, 4- dichlorobenzyloxymethyl) - tetrahydro-furan-2-yl] -4-chloro-5-oxazol-2-yl-7H-pyrrolo [2, 3-d] pyrimidine To a solution of 1-methyl-3, 5- bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D-ribofuranose in anhydrous dichloromethane at 0 ° C, HBr (30% by weight in acetic acid, 1 ml) was added dropwise. drop. The resulting solution was stirred at 0 ° C for 1 hour, then at room temperature for 3 hours, evaporated in vacuo and co-evaporated with anhydrous toluene. The oily residue was dissolved in anhydrous acetonitrile and added to a solution of the sodium salt of the product of Step 1 above, prepared by "stirring it with sodium hydride (60% in mineral oil) in anhydrous acetonitrile for 4 hours. The combined mixture was stirred for 24 hours, then evaporated to dryness The residue was diluted with EtOAc and water The aqueous layer was removed and extracted with EtOAc The combined organic fractions were then washed with brine and dried over sulfate. The reaction was purified by column chromatography over silica gel Step 3. Synthesis of 2- (4-chloro-5-furan-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) ) - 5-hydroxymethyl-tetrahydro-oxazol-3, 4-diol The product from Step 2 above was dissolved in dichloromethane and the temperature was reduced to -78 ° C. Boron trichloride was added dropwise to the reaction. The reaction was stirred at -78 ° C for 2 hours, then at -20 ° C overnight. The reaction was stopped with 1: 1 MeOH: DCM and stirred at -20 ° C for 15 minutes. NHOH was used to neutralize the reaction, and it was then concentrated in vacuo to a solid. The product was purified via column chromatography on silica gel. Step 4. Synthesis of 2- (4-amino-5-furan-2-yl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-oxazol-3, 4-diol The product from Stage 3, it was dissolved in liquid ammonia and sealed in a pump. ' The reaction was stirred at 80 ° C overnight. The solution was concentrated to produce the desired product. EXAMPLE 103 Synthesis of 4-cyclopropylamino-1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -1H-pyrimidin-2-one (206) Step 1. Synthesis of 1 - (3,4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -1H-pyrimidin-2,4-dione 1H-pyrimidin-2,4-dione (Aldrich) was dissolved in acetonitrile anhydrous. BSA was added via syringe and the reaction was refluxed at 90 ° G for 45 minutes. The reaction was allowed to cool to room temperature. 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose was dissolved in anhydrous acetonitrile and anhydrous acetonitrile was added to the reaction mixture. TMSOTf was then added to the reaction mixture dropwise via syringe. The reaction mixture is then refluxed at 90 ° C for 2 hours. The mixture was then diluted with EtOAc and washed with saturated bicarbonate solution. The organic layer was extracted 2x with EtOAc and the combined organic fractions were washed with brine and dried over magnesium sulfate. The reaction was purified via column chromatography on silica gel to produce the desired product. Step 2. Synthesis of 1- (3, 4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-thioxo-3,4-dihydro-1H-pyrimidin-2-one Was dissolved the product from Step 1 above in anhydrous toluene. The Esson reagent was added and the reaction refluxed at 120 ° C for 4 hours. The reaction was then concentrated in vacuo and co-evaporated with dichloromethane, and purified via column chromatography to produce the product. Step 3. Synthesis of 4-cyclopropylamino-1- (3,4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -1H-pyrimidin-2-one The product of Step 2 was dissolved previous in anhydrous ethanol. Cyclopropylamine (Aldrich) was added, and the reaction was refluxed overnight. The reaction was concentrated in vacuo and purified via column chromatography to produce the product. Step 4. Synthesis of 3- cyclopropylamino- 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -1H-pyrimidin-2-one The product of Step 3 above was dissolved in methanol saturated with ammonia and stirred at room temperature all night. The reaction was then concentrated in vacuo and purified via column chromatography on silica gel. EXAMPLE 104 Synthesis of 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-hydrazino-3, 4-dihydro-1H-pyrimidin-2-one (207) Step 1. Synthesis of 1- (3, 4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-hydrazino-3, 4-dihydro-1H-pyrimidin-2-one To a Solution of 1- (3,4-dibenzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-thioxo-3,4-dihydro-1H-pyrimidin-2-one in water was added hydrazine (35% by weight solution in water). The reaction was refluxed overnight, then concentrated and purified via column chromatography on silica gel.

Step 2. Synthesis of 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4-hydrazino-3, 4-dihydro-1H-pyrimidin-2-one The product from Step 1 above was dissolved in methanol saturated with ammonia and stirred at room temperature overnight. The reaction was then concentrated in vacuo and purified via column chromatography on silica gel to produce the desired product. Example 106 Synthesis of 8- (3,4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4,5-dioxo-3, 4, 5, 8-tetrahydro- pyrido [2, 3-d] pyrimidine-6-carboxylic acid (161) 8- (3, 4-bis-benzoyloxy-5-benzoyloxymethyl-3-methyl-tetrahydro-furan-2-yl) ethyl ester was obtained. 2- methylsulphane-4,5-dioxo-3,4,4,8-tetrahydropyrido [2,3-d] pyrimidine-6-carboxylic acid (0.2 g, 0.270 mmol) in 30 ml of ethanol and nickel Raney (0.55 g wet heavy and pre-treated with DI water, followed by ethanol and the suspension heated to reflux for 24 hours.) An additional 1.8 grams of Raney nickel (wet and pre-treated weighed as above) was added and the reaction reflux for an additional 24 hours.The suspension was filtered hot and the Raney nickel was washed with hot ethanol.The filtrate was concentrated in vacuo and 1 ml of DMSO was added to dissolve the nucleoside, then diluted with methanol saturine. The reaction was allowed to stir at room temperature overnight, then concentrated in vacuo and separated by 0-20% HPLC of Regulator B for 30 minutes at an expense of 10 ml / min. Regulator A- 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. The fractions containing the nucleoside were combined and evaporated and dried by co-evaporation with absolute ethanol to yield 7 mg (10%) of the desired nucleoside. MS: 351.16 (M-H). '' 1H-NMR (DMSO-de): 0.8 (s, 3H, 2 '- (¾), 3.0-4.0 (m, 4H, sugar), 5.0-5.5 (m, 3H, OH), 6.7 (s, 1H, l'-H), 7.6 (s, 1H, -Ar), 8.4 (s, 1H, -Ar), 9.0 and 9.2 (s, 2H, H2) Example 107 Synthesis of 4- amino-8- ( 3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulphane-8H-pyrido f2, 3- dj pyrimidin-7-one (165) Step 1. Synthesis of 4-amino-2-methylsulphanyl-8H-pyrido [2, 3-d] pyrimidin-7-one. 4-Amino-2-methylsulphane-8H-pyrido [2, 3-d] pyrimidin-7-one was synthesized as described in GL Anderson and SG Richardson J. Hetrocycl Chem. 1985, 22, 1735-1737. Step 2. 4. amino-8- [4- (2,4-dichlorobenzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -3-hydroxy-3-methyl-tetrahydro-furan-2-yl] -2-methylsulphane-8H- pyrido [2, 3-d] pyrimidin-7-one To a solution of 1-methyl-3, 5-bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D-ribofuranose (0.5 g, 1.0 mmol) in dry methylene chloride (15 ml) cooled to 0 ° C, HBr (30% by weight in acetic acid, 1.25 ml, 6.27 mmol) was added dropwise. The mixture was left stirring at 0 ° C for 1 hour, then allowed to warm to room temperature and stirred for an additional 2 hours. The resulting translucent brown solution was concentrated in vacuo and co-evaporated with dry toluene (3 x 15 mL) resulting in a brown oil. The oil was taken up in DMF (8 ml) and added to the sodium salt solution of 4-amino-2-methylsulfanyl-8H-pyrido [2, 3-d] pyrimidin-7-one, generated in situ by stirring the same (0.624 g, 3.0 mmol) in DMF (40 ml) with NaH (60% dispersion in mineral oil, 0.132 g, 3.3 mmol) at room temperature for 3 hours). The resulting reaction was allowed to stir at room temperature for 24 hours, then concentrated in vacuo. The crude product was purified by column chromatography on silica gel using 5% methanol in methylene chloride as the eluent. The appropriate fractions were combined, concentrated in vacuo, to give 340 mg (51%) of a yellow oil. Step 3. Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulfanyl-8H-pyrido [2, 3- d] pyrimidin-7-one. To a solution of the product of Step 2 above (0.34 g, 0.506 mmol) in methylene chloride (16 mL) cooled to -78 ° C in a dry ice / acetone bath, BCI3 (1 M in methylene chloride) was added. , 5.0 mi, 5.0 immoles) drop by drop. The solution was stirred at -78 ° C for 1.5 hours, then at -20 ° C for 20 hours. The reaction was placed in an ice bath and neutralized with the addition of aqueous ammonia and stirred at room temperature for 10 minutes. The resulting boron salts were washed with methylene chloride and concentrated in vacuo. The residue was taken up in DMSO (3 mL) and diluted with H20 (2 mL) and the product isolated by isocratic HPLC of 15% B for 30 minutes at the expense of 10 mL / min. Regulator A - 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. The fractions containing the nucleoside were combined, concentrated in vacuo. The residue was then precipitated with methylene chloride and decanted to give 20 mg (8%) of the desired nucleoside. MS: 355.12 (M + H). "" "H-NMR (DMSO-dg): 0.9 (m, 3H, 2'-CH3), 2.5 (m, 3H, -CH3), 3.5-4.2 (m, 4H, sugar), 5.0-5.5 (m , 3H, -OH), 6.3 (d, 1H, -Ar), 7.1 (s, 1H, l'-H), 7.8 (s, 2H, -NH2), 8.0 (d, 1H, -Ar). 108 Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -8H-pyrido-2, 3-d] pyrimidin-7-one (182 ) Step 1. Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -8H-pyrido [2, 3-d] pyrimidin-7 - ona To a solution of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulphane-8H-pyrido [2, 3-d] pyrimidin-7-one (15 mg, 0.042 mmol) in EtOH (20 mL) was added Raney's nickel (1.0 g) weighed wet and pre-treated with DI water, followed by ethanol, and the suspension was heated to reflux for 20 minutes. The suspension was filtered hot and the Raney nickel was washed with hot ethanol.The filtrate was concentrated in vacuo.The crude reaction was dissolved in DMSO (2 mL) and diluted with H20 (3 mL) and purified by isocratic HPLC with 13% B for 30 minutes at the expense of 10 mL / min. Regulator A - 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. The fractions containing the combined nucleoside were concentrated in vacuo. The residue was then precipitated with methylene chloride and decanted to give 2.5 mg (15%) of the desired nucleoside. MS: 309.12 (M + H). Example 109 Synthesis of 2- (6-amino-8-methyl-purin-9-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol Step 1. Synthesis of 8-methyl-9H-purin- 6- ilamine 4-5,6-Triaminopyridine sulfate (3.0 g, 13.4 mmol) and acetamide (1.0 g, 16.9 mmol) were added to a 25 ml autoclave bomb and heated at 240 ° C for 6 hours. The crude product was then boiled in H20 for 1 hour and filtered through a small pad of Celite. The filtrate was concentrated and purified by HPLC with 0-10% Regulator B for 30 minutes at an expense of 10 ml / min. Regulator A - 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. The appropriate fractions were combined and concentrated in vacuo to give 225 mg (11%) of the title compound. MS: 150.08 (M + H). Step 2. Synthesis of N, N-dimethyl-N '- (8-methyl-9H-purin-6-yl) -formamidine To a suspension of the product from Step 1 above (225 mg, 1.51 mmol) in MeOH (14 mi) and methylene chloride (7 mL) was added N'N'-dimethylformamide dimethyl acetal (0.8 mL, 4.52 mmol) and the mixture was heated to reflux for 24 hours. The resulting yellow solution was concentrated in vacuo to a yellow oil. This oil was co-evaporated with methylene chloride (2 x 15 mL) and retained under high vacuum for 2 hours. The crude product was used directly in Step 3, without further purification. Step 3. Synthesis of benzoyl-protected 2- (6-amino-8-methyl-purin-9-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol) To a solution of the product from Step 2 above (1.51 mmol) in 1,2-dichloromethane (10 mL) was added BSA (0.8 mL, 3.322 mmol) and heated to reflux for 1.5 hours under argon. The solution was allowed to cool slightly and 2, 3, 5-benzoate-1-β-D-ribofuranose acetate (0.601 g, 1.37 mmol) dissolved in 1,2-dichloromethane (10 ml) was added, followed immediately by TMSOTf ( 1 ml, 5.48 mmol). The reaction was heated to reflux for 24 hours, then 0.5 ml of additional TMSOTf was added, and the reaction was refluxed for an additional 48 hours. The reaction was cooled to room temperature, diluted with methylene chloride, washed with saturated NaHCO3 solution (1 x 75 mL). The aqueous layer was back extracted with methylene chloride (2 x 50 mL) and the combined organic layers were washed with H20 (1 x 75 mL), brine (1 x 70 mL), then dried over Na2SC > 4 and concentrated in vacuo. The crude product was purified by column chromatography on silica gel Using 5 me methanol in methylene chloride as the eluent. The appropriate fractions were combined, concentrated in vacuo to give the desired compound.

MS: 649.21 (M + H). Step 4. Synthesis of 2- (6-amino-8-methyl-purin-9-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol The compound of Step 3 was dissolved in 7 M ammonia in MeOH (30 ml) and stirred at room temperature for 24 hours. The reaction was concentrated and the residue was taken up in DMSO (1 ml) and water (4 ml) and purified by HPLC with 0-10% regulator B for 30 minutes at an expense of 10 ml / min. Regulator A - 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. The appropriate fractions were combined and concentrated in vacuo to give 60 mg (16% of Step 3) of the desired compound. MS: 282.09 (M + H) "" "H-NMR (CD30D): 2.6 (s, 3H, -CH3, 3.6-5.0 (m, 5H, sugar), 5.9 (d, 1H, l'-H), 8.1 (s, 1H, -Ar) Example 110 Synthesis of 2- (6-amino-8-methyl-purin-9-yl) -5- hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol Step 1. Synthesis of 2- (6-amino-8-methyl-purin-9-yl) -5'-hydroxymethyl-3-methyl-tetrahydrofuran-3,4-diol protected with 2,3,5-tribenzoyl To a solution of N, N-dimethyl-N '- (8-methyl-9H-purin-6-yl) -formamidine (1.71 moles) (the crude product of Step 2, in Example 109), in 1, 2-dichloroethane 10 ml, BSA (1.0 ml, 4.05 mmol) was added and the mixture was refluxed for 1.5 hours under argon.The solution was allowed to cool slightly and 1, 2, 3, 5-tetra-O-benzoyl- was added. 2'- C-Methyl-β-D-ribofuranose (0.750 g, 1.29 mmol) dissolved in 1,2-dichloroethane (10 mL), followed immediately by TMSOTf (1.5 mL, 8.3 mmol) The reaction was heated to reflux by 24 hours The reaction was conducted at room temperature It was diluted with methylene chloride, washed with saturated NaHCC solution >; 3 (1 x 75 mi). The aqueous layer was back-extracted with methylene chloride (2 x 50 mL) and the combined organic layers were washed with H20 (1 x 75 mL), brine (1 x 70 mL), then dried over Na2SO < and they concentrated in the vacuum. The crude product was purified by column chromatography on silica gel using 5% methanol in methylene chloride as the eluent. The appropriate fractions were combined, concentrated in vacuo to give the title compound. Step 2. 2- (6-Amino-8-methyl-purin-9-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol The compound of Step 1 above was dissolved in ammonia. M in MeOH (30 mL) and stirred at room temperature for 24 hours. The reaction was concentrated and the residue was taken up in DMSO (1 ml) and water (4 ml) and purified by HPLC with 0-10% regulator B for 30 minutes at an expense of 10 ml / min. Regulator A - 0.1% triethylammonium acetate in water, Regulator B - 0.1% triethylammonium acetate in CH3CN. Appropriate fractions were combined and concentrated in vacuo to give 60 mg (16%, from Step 1) of the desired compound. MS: 296.13 (M + H). lH-NMR (CD3OD): 1.05 (s, 3H, -CH3), 2.6 (s, 3H, -CH3), 3.6-4.2 (m, 4H, sugar), 6.1 (s, 1H, l'-H), 8.7 (s, 1H, -Ar). Example 111 Synthesis of 2- [6-amino-8- (γ-methyl-hydrazino) -purin-9-yl] -5-hydroxymethyl-tetrahydro-furan-3, 4-diol (185) To a solution of bromoadenosine (Aldrich, 0.1 g, 0.289 mmol) in DMF. Methyl hydrazine (0.15 mL, 2.89 mmol) was added and the mixture was heated at 85 ° C for 3 hours. The crude product was purified by column chromatography on silica gel using 2.5% methanol in methylene chloride to wash and the product was eluted with 20% methanol. The appropriate fractions were combined, concentrated in vacuo to give 90 mg (100% of the title compound. MS: 312.16 (M + H). 1H-NMR (CD3OD): 1.05 (s, 3H, -CH3), 2.6 (s, 3H, -CH3), 3.6-4.2 (ra, 4H, sugar), 6.1 (s, lH, l'-H), 8.7 (s, 1H, -Ar). . Example 112 Synthesis of 2- (6-amino-8-methoxy-purin-9-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol To a solution of 8-bromoadenosine (Aldrich, 0.1 g, 0.289 mmol ) in MeOH (25 mL) was added sodium methoxide (0.1 g, 1.81 mmol) and the mixture was heated at 85 ° C for 2 hours. The reaction was stopped with Dow-X 500 (H +) resin, filtered and the Dow-X was washed with MeOH (15 mL) followed by 7 M ammonia in methanol (15 mL). The filtrate was concentrated and purified by column chromatography on silica gel using 20% methanol in methylene as eluent. Appropriate fractions were combined, concentrated in vacuo to give 81 mg (94%) of the title compound. MS: 298.10 (M + H) ^ | H-NMR (DMSO-de): 4.1 (s, 3H, -CH3) 3.4-4.2.4.85 (m, SH, sugar), 5.1-5.5 (m, 3H, - OH), 5.7 (d, 1H, l'-H), 7.0 (s, 2H, -NH2) 8.0 (s, 1H, -Ar). Example 113 Synthesis of 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -3,7-dihydro-pyrrolo [2, 3-d] pyrimidin-4-one ( 188) To a solution of 2- (4-amino-pyrrolo [2,3-djpyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-diol (0.09 g, 0.321 mmol) in MP (2 mL) and acetonitrile (2 mL) was added chloroacetaldehyde (50% solution in H20, 40 μ ?, 0.321 mmol) and the mixture was heated at 50 ° C for 24 hours. The reaction was concentrated in vacuo, diluted with ¾0 and purified by isocratic HPLC, 2% Regulator B for 30 minutes at an expense of 20 ml / min. Regulator A - 0.1% trifluoroacetic acid in water. Regulator B- trifluoroacetic acid at 0.1 ¾ in CH3-CN. Appropriate fractions were combined and concentrated in vacuo to give 53 mg (59%) of the title compound. MS: 282.10 (M + H). 1H-1SIMR (DMSO-de): 0.65 (s, 3H, 2'-CH3), 3.5-4.0 (m, 4H, sugar), 6.1 (s, 1H, l'-H), 6.5 (d, 1H, -Ar), 7.5 (d, 1H, -Ar) 7.9 (s, 1H, -Ar), 11.95, (s, 1H, -NH). EXAMPLE 114 Synthesis of 6-amino-9- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -7,9-dihydro-purin-8-one (173). Step 1. Synthesis of the ester 5- [8-bromo-6- (2,2,2-trifluoroacetylamino) -purin-9-yl] -4-methyl-3, 4-bis- (2, 2, 2 trifluoroacetoxy) - tetrahydrofuran-2-ylmethyl trifluoroacetic acid To a suspension of 8-bromoadenosine (Aldrich, 1.0 g, 2.89 mmol) in dry methylene chloride (14.5 ml) was added trifluoroacetic anhydride (10 ml, 57.8 g. mmoles) and stirred for 4 hours. The clear solution was concentrated in vacuo and co-evaporated with dry methylene chloride (3 x 15 mL) and foamed to give 2 g (100%) of the desired compound which was used directly without further purification in Step 2. Step 2 Synthesis of 6-amino-9- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -7,9-dihydro-purin-8-one To a solution of the product of Step 1 above (1.05 g, 1.45 mmol) in dry acetonitrile (in a pre-dried flask cooled under argon) was added Cul (13.7 mg, 0.725 mmol), TEA (3.67 mL, 0.4 M), palladium tetrakis (83 mg, 5 mol%), and trimethylsilyl acetylene (0.4 ml, 2.90 mmol). The mixture was heated at 80 ° C for 20 hours, cooled, passed through a plug of celite and concentrated in vacuo to an oil. The crude product was purified by column chromatography on silica gel using a 1: 1.6: 4 ratio of EtOAc: MeOH: CH2Cl2 as the eluent. Appropriate fractions were combined, concentrated in vacuo to an oil, which was precipitated with alcohol / ether to give 250 mg (61) of the title compound. MS: 284.11 (M + H). 1 H-NMR (DMSO-dg): 3.2-4.2, 4.85 (m, 5H, sugar), 5.0-5.3 (m, 3H, -OH), 5.7 (d, 1H, l'-H), 6.6 (s, 2H, -NH2), 8.0 (s, 1H, -Ar), 10.4 (s, 1H, -NH). Example 115 Synthesis of 2-hydroxymethi-5- (1,3-, 5,6-tetraaza-as-indacen-6-yl) -tetrahydrofuran-3, 4-diol (186) To a solution of Tubercidin (Sigma) , 0.03 g, 0.113 mol) in DMF (2 mL) was added chloroacetaldehyde (14 mL, 0.226 mmol) and heated at 50 ° C for 20 hours. The reaction was concentrated in vacuo and. it was purified by column chromatography on silica gel using 20% methanol in methylene as eluent. The appropriate fractions were combined, concentrated in vacuo to give 30 mg (94%) of the title compound. MS: 291.12 (M + H). 1H-NMR (CD30D): 3.7-4.6 (m, 5H, sugar), 6.25 (d, 1H, l'-H), 6.85 (d, 1H, - Ar), 7.45 (d, 1H, -Ar), 7.6 (d, 1H, -Ar), 7.9 (d, 1H, -Ar), 8.95 (s, 1H, -Ar). Example 116 Synthesis of 5- hydroxymethyl-3-methyl-2- (1,3-, 5,6-tetraaza-as-indacen-6-yl) -tetrahydrofuran-3, 4-diol (166) To a solution of 2- (4-Amino-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-diol (0.7 g, 0.25 mmol) in DMF (12 ml) , chloroacetaldehyde (50% solution in H20, 35 μ ?, 0.275 mmol) was added in aliquots of 7.0 μ? every 4 hours during the course of 20 hours. After the final addition, the mixture was stirred for 2 hours, then concentrated in vacuo and purified by column chromatography on silica gel using 20% methanol in methylene as eluent. The appropriate fractions were combined, concentrated in vacuo to give 71 mg (94%) of the title compound. MS: 305.11 (M + H). 1H-NMR (CD30D): 0.8 (s, 3H, 2'-CH), 3.7-4.2 (m, 4H, sugar), 6.4 (s, 1H, l'-H), 6.85 (d, 1H, -Ar ), 7.45 (d, 1H, -Ar), 7.7 (d, 1H, -Ar), 7.9 (d, 1H, -Ar), 8.95 (s, 1H, -Ar). · Example 117 Synthesis of 2- (4-amino-6-methyl-pyrrolo [2, 3-pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol (219) Step 1. Synthesis give 6-methyl-7H-pyrrolo [2, 3-d] pyrimidin-4-ylamine,. N'N'-dimethylformamide dimethyl acetal (1 equiv.) was added to 2,6-diamino pyrimidine in DMF and was heated to 80 ° C. The resulting mono-protected compound is purified and converted to the hydrazine with NaN02, HC1 6N, O ° C, then SnCl2-2H20. Acetone and TEA were added to the hydrazine in EtOH and refluxed. The resulting hydrazone was heated in the presence of PPA to form the desired product. Step 2. Synthesis of 2- (4-amino-6-methyl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-tetrahydro-furan-3, 4-diol The title compound was prepared as described in Steps 2 and 3 of Example 107 using β-D-1- 0-methyl-2, 3, 5, - tri (2,4-dichlorobenzyl) -ribofuranose and the compound of Step 1 above. Example 118 Synthesis of 2- (4-amino-6-methyl-pyrrolo [2, 3-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (220) The product of Step 1 of Example 117 is silylated and condensed with 1-methyl-3,5-bis- (2,4-dichlorobenzyloxy) -2-C-methyl-] - D-ribofuranose as described in Steps 2 and 3 of Example 107. Example 119: Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulphane-7-oxoamide 7,8-dihydro-pteridin-6-carboxylic acid (230) Step 1. Synthesis of 4-amino-2-methylsul anyl-7-oxo-7,8-dihydro-pteridin-6-carboxylic acid ethyl ester The ester 4-Amino-7-oxo-7,8-dihydro-pteridine-6-carboxylic acid ethyl ester was synthesized as described in M. Ott and W. Pfleiderer Chem. Ver. 1974, 107, 339-361. Step 2. Synthesis of 4-amino-8 - "(3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2-methylsulfanyl-7-oxo-7amide, 8- dihydro-pteridin-6-carboxylic acid The product from Step 1 above was silylated and condensed with 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose (See Example 26, steps 2 and 3) to provide the title compound Example 120 Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydrofuran-2-amide - il) - 7-oxo-7,8-dihydro-pteridin-6-carboxylic acid amide of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydrofuran 2- il) -2-methylsulfanyl- 7- oxo- 7, 8-dihydropperidine-6-carboxylic acid is treated with Raney nickel (see Example 108, Step 1) to give the title compound. Example 121 Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -5-oxo-5, 8-dihydropyridoamide 2, 3-d] pyrimidine-6-carboxylic acid (225) Step 1. Synthesis of ethyl 4-chloro-5-oxo-5,8-dihydropyrido [2, 3-d] pyrimidin-6-ethyl ester carboxylic acid 2-methylsulphanyl-4,5-dioxo-3, 4, 5, 8-tetrahydropyrido [2, 3-d] pyrimidine-6-carboxylic acid ethyl ester is treated with Raney nickel to remove the thiomethyl group . The resulting compound was refluxed in P0C13. Step 2. Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -5-oxo-5, 8-dihydropyride [2, 3-d] pyrimidine-6-carboxylic acid The product from Step 1 above was silylated and condensed with 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D- ribofuranose and treated with liquid ammonia (See Example 26, Steps 2 and 3). Example 122 Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -8H-pyrido-2, 3-d] pyrimidin-5-one ( 226) Step 1. Synthesis of 4-chloro-8H-pyrido [2, 3-d] pyrimidin-5-one The 4-chloro-5-oxo-5,8-dihydropyrido [2-ethyl] ethyl ester was saponified , 3- d] pyrimidine-6-carboxylic acid and then decarboxylated by heating in quinoline in the presence of copper to give the title compound. Step 2. Synthesis of 4-amino-8- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -8H-pyrido [2, 3-d] pyrimidin-5-one The product of Step 1 above was silylated and condensed with 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose and treated with liquid ammonia (See Example 26, Stages 2 and 3). Example 123 Synthesis of 2- <; 2,4-dichloro-5H-pyrrolo f3, 4- d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (183) Step 1. Synthesis of 4- (2,4-dichloro-benzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -2- (4,6-dichloro-imidazo [4, 5 c] pyridin-1-yl) -3-methyl- tetrahydro-furan-3-ol. 4,6-Dichloroimidazo [4, 5-c] pyridine was synthesized as described in RJ Rousseau and RK Robins, J. Heterocycl. Chem. 1965, 2, 196-201. To a solution of 4, 6- dichloroimidazo [4,5- c] pyridine (400 mg, 2.1 mmol) in 30 ml of anhydrous acetonitrile under argon, sodium hydride (60%, 93.2 mg, 2.3 mmol) was added at room temperature. The solution was left stirring for 4 hours. To a solution of 1-methyl-3,5-bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D-ribofuranose (350.6 mg, 0.7 mmol) in 15 ml of anhydrous dichloromethane under argon at 0 ° C, 6 eq. were added dropwise. of 30% HBr in acetic acid. The solution was left stirring at 0 ° C for 1 hour and then at room temperature for 3 hours. The solution was then evaporated in vacuo and co-evaporated with toluene. The residue was dissolved in 10 ml of anhydrous acetonitrile and added to the solution of the sodium salt, prepared above. The combined mixture was stirred at room temperature for 24 hours, and then evaporated to dryness. The residue was dissolved in ethyl acetate, and washed with water. The water was extracted three times with ethyl acetate. The combined organic extracts were washed with brine and dried with anhydrous sodium sulfate. The solvent was removed in vacuo. Column chromatography was used for the final purification to give 252 mg (0.386 mmol, 54.6%) of 4- (2,4-dichloro-benzyloxy) -5- (2, 4-dichloro-benzyloxymethyl) -2- (4,6) - dichloroimidazo [4, 5 c] pyridin-1-yl) -3-methyl-tetrahydrofuran-3-ol. Stage 2. Synthesis of 2- (2, 4- dichloro- 5H- pyrrolo [3, 2- d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-diol The product from Step 1 above (252 mg, 0.39 mmol) was dissolved in dichloromethane (10 ml) and the temperature was reduced to -78 ° C. Boron trichloride (1.0 M in dichloromethane, 3.9 ml, 3.9 mmol) was added dropwise to the reaction. The reaction was stirred at -78 ° C for 2 hours and then warmed to -20 ° C overnight. The reaction was stopped with 1: 1 methanol: dichloromethane (20 mL) and stirred at -20 ° C for 15 minutes. NH40H was used to neutralize the reaction, and then concentrated in vacuo to provide a solid. The product was purified via column chromatography on silica gel to yield a white compound (60 mg). MS 334.08, 336.08 (+ H), 1H-NMR (CD30D): 8.90 (s, 1H), 7.87 (s, 1H), 5.97 (s, 1H), 4.02-4.07 (m, 3H), 3.84-3.89 (m, 1H), 0.88 (s, 3H). Example 124 Synthesis of 2- (4-amino-2-chloro-5H-pyrrolo [3, 2-6V] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3-phenyl-4-diol (187 ) 2- (2,4-dichloro-5H-pyrrolo [3, 2-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3,4-diol (183) (40 mg ) was evaporated in a metal pump and the pump was cooled to -80 ° C (acetone bath / dry ice). Ammonia was condensed from a gas tank (5 ml), until the exit needle showed splashing and the pump was sealed. The reaction was then heated to 135 ° C for 2 days. Evaporation and TLC showed an almost complete reaction. One column (chloroform: methanol, 5: 1) gave 20 mg of product. MS 315.08 (M + H), 1 H-NMR (CD3OD): 8.53 (5, 1H), 6.99 (5, 1H), 5.83 (s, 1H), 5.54 (d, 1H), 4.02-4.09 (m, 3H ), 3.84-3.89 (m, 1H), 0.88 (5, 3H). Example 125 Synthesis of 2- (4-amino-5H-pyrrolo [3, 2-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (201) was dissolved Compound 187 (40 mg) in a 1: 1 mixture of ethyl acetate and methanol and 100 mg of 10% Pd / C, as well as 2 ml of aqueous 1N sodium hydroxide solution were added. Hydrogenation at 40 psi for 3 hours gave product, which was evaporated and then purified via column chromatography on silica gel (2: 1, chloroform: methanol) to give 24 mg of the pure title compound. MS 281.11 (M + H) ', 1H-MR (CD3OD): 8.60 (8, 1H), 7.70 (d, 1H), 6.99 (d, 1H), 5.91 (8, 1H), 4.02-4.09 (m, 3H), 3.84-3.89 (m, 1H), 0.88 (5, 3H).

Example 126 Synthesis of 4-chloro-7-fluoro-1- (2'-C-methyl-β-D-ribofuranosyl) imidazo [4, 5 c | pyridine (213) Step 1. Synthesis of 2- (4-chloro-7-fluoro-imidazo [4, 5 c] pyridin-1-yl) -4- (2,4-dichloro-benzyloxy) -5- ( 2,4-dichlorobenzyloxymethyl) -3-methyl-tetrahydro-furan-3-ol. 4- Chloro-7-fluoroimidazo [4, 5 c] pyridine was synthesized as described in M.-C. Liu et al, Nucleosides & amp;; Nucleic Acids 2001, 20 (12), 1975-2000. To a solution of 1-methyl-3,5-bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D-ribofuranose in anhydrous dichloromethane at 0 ° C was added HBr (30% by weight in acetic acid, 1 ml), dropwise. The resulting solution was stirred at 0 ° C for 1 hour, then at room temperature for 3 hours, evaporated in vacuo and co-evaporated with anhydrous toluene. The oily residue was dissolved in anhydrous acetonitrile and added to a solution of the sodium salt of 4-chloro-7-fluoroimidazo [5-c] pyridine, prepared by stirring 4-chloro-7-fluoroimidazo [4, 5]. c] pyridine with sodium hydride (60% in mineral oil) in anhydrous acetonitrile for 4 hours. The combined mixture was stirred for 24 hours, then evaporated to dryness. The residue was diluted with ethyl acetate and water. The aqueous layer was removed and re-extracted with ethyl acetate.

The combined organic fractions were then washed with brine and dried over magnesium sulfate. The reaction was purified by column chromatography on silica gel to give the title compound. Step 2. Synthesis of 4-chloro-7-fluoro-1- (2'-C-methyl-β-D-ribofuranosyl) imidazo [4, 5 c] pyridine. The product from Step 1 above was dissolved in dichloromethane and the temperature was reduced to -78 ° C. Boron trichloride (1.0 M in dichloromethane) was added dropwise to the reaction. The reaction was stirred at -78 ° C for 2 hours and then warmed to -20 ° C overnight. The reaction was stopped with 1: 1, methanol: dichloromethane and stirred at -20 ° C for 15 minutes. NH40H was used to neutralize the reaction, and then concentrated in vacuo. The product was purified via column chromatography on silica gel to give the title compound. EXAMPLE 127 Synthesis of 4-amino-7-fluoro-1- (2'-C-methyl-β-D-ribofuranosyl) imidazo [4,5-cpirimidine (214) A suspension of Compound 213 in anhydrous hydrazine was refluxed for 1 hour. hour. The reaction mixture was then evaporated in vacuo to dryness and the residue was co-evaporated with ethanol and deoxygenated water. The crude intermediate was then dissolved in deoxygenated water, the Raney nickel catalyst was added and the mixture refluxed with stirring under hydrogen for 8 hours. The reaction mixture was filtered through Celite while heating, and the catalyst was washed with hot water. The filtrate was evaporated to dryness and purified via column chromatography to give the title compound. Example 128 Synthesis of 2- (4-amino-5H-pyrrolof3,2-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (215) Step 1. 3 , 4- bis- (2,4-dichloro-benzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -2-methoxy-3-methyl-tetrahydrofuran 2. 3 g of methyl-3 , 5- bis- (2,4-dichloro-benzyloxy) -2-C-methyl-β-D-ribofuranose in 25 ml of DMF. To this solution was added NaH and heated to 60 ° C. After the hydrogen evolution decreased, 2,4-dichlorobenzyl chloride was added dropwise at 40 ° C. The mixture was stirred for another 16 hours, then 5 ml of methanol was added. Column chromatography (9: 1, ethyl acetate / hexane) gave 1.77 g of product. Step 2. 3, 4- bis (2,4-dichloro-benzyloxy) -5- (2,4-dichlorobenzyloxymethyl) -3-methyl-dihydro-furan-2-one The product of Step 1 above was dissolved (1.42 g) in 40 ml of dioxane. To this solution, 40 ml of 4N HC1 was added and heated to 100 ° C. After 16 hours, the solution was brought to pH 11 with NaHCC > 3 (saturated solution) and extracted with EtOAc (3 x 100 mL). The combined organic fractions were dried with Na 2 SO 4 and evaporated. The crude mixture was dissolved in 15 ml of dry methylene chloride and 1466 g (1466 eq.) Of Dess Matin periodinane were added. After stirring for 1 day the mixture was poured into 40 ml of saturated NaHCO 3 solution containing 9 g of NaHSC. Extraction with EtOAc (3 x 100 mL), drying of the organic layers and column chromatography (19: 1 Hex / EtOAc) gave 0.72 g of product. Step 3. N'- (7-bromo-5H-pyrrolo [3, 2-d] pyrimidin-4-yl) -N, N-dimethyl-formamidine 5H-pyrrolo [3, 2-d] pyrimidin-4 was synthesized. -amylamine as described in Montgomery and Hewsoi, J. Org. Chem., 1965, 30, 1528-1531. 5H-pyrrolo [3,2-d] pyrimidin-4-ylamine was dissolved in methylene chloride and cooled to 0 ° C. To this solution was added via funnel of addition bromine in methylene chloride. After the reaction was finished, as can be seen via TLC, it was extracted with EtOAc, dried with sodium sulfate and purified via column chromatography. The product was dissolved in DMF and 1.2 eq. of DMFdimetilacetal. The reaction mixture was heated to 80 ° C until the reaction was finished by TLC, evaporated, and chromatographed to give the title compound. Step 4. 2- (4-amino-5H-pyrrolo [3, 2- d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-dio! To a solution of the product of Step 3 above in THF was added at -75 ° C of n-BuLi. After 1 hour at 75 ° C a lactone solution of the product from Step 2 above in THF was added at -75 ° C, stirred for 2 hrs at this temperature and then allowed to warm to 0 ° C during the following 3 hours. Saturated NaHCO 3 solution was added and the mixture was extracted with ether. The organic layer was dried with brine, dried over MgSO4 and concentrated. The residue was dried, dissolved in CH2C12 and triethylsilane and BF3OEt2 were added dropwise at -75 ° C. The reaction mixture was allowed to warm overnight, the reaction was quenched with 1N HC1 and stirred for 1 hour at room temperature. The organic mixture was neutralized with NaOH and extracted with EtOAc. The organic layers were washed with brine, dried over MgSO, concentrated and purified by column chromatography. The resulting compound was dissolved in dichloromethane and the temperature was reduced to -78 ° C. Excess drop, boron trichloride (1.0 M dichloromethane) was added to the reaction. The reaction was stirred at -78 ° C for 2 hours and then warmed to -20 ° C overnight. The reaction was quenched with methanol: dichloromethane 1: 1 and stirred at -20 ° C for 15 minutes. NHOH was used to neutralize the reaction, and then concentrated in vacuo. The product was stirred in ammonia in MeOH overnight. The product was purified via column chromatography on silica gel. Example 129 Synthesis of 4- amino-1- (β-D-ribofuranosyl) imidazo [, 5-c] pyridine (216) 4- Amino-7- fluoro-1- (β-D-ribofuranosyl) imidazo was synthesized [4 , 5- c] pyridine (216) as described in RRJ Rousseau, LB Towsend, and RK Robins, Biochemistry 1966, 5 (2), 756-760. Example 130 Synthesis of 4-chloro-7-fluoro-1- (β-D-ribofuranosyl) imidazof 4, 5-pyridine (217) 4- Chloro-7 was synthesized. Fluorine 1- (ß-D-ribofuranosyl) imidazo [4,5- c] pyridine (217) as described in M.-C. Liu et al. Nucleosides, Nucleotides &; Nucleic Acids 2001, 20 (12), 1975-2000. Example 131 Synthesis of 4- amino-7- fluoro-1- (β-D-ribofuranosyl) imidazo [5- pyridine (218) 4- amino-7- fluoro-1- (β-D-ribofuranosyl) was synthesized imidazo [4, 5 c] pyridine (218) as described in M.-C. Liu et al. Nucleosides, Nucleotides & Nucleic Acids 2001, 20 (12), 1975-2000. Example 132 Synthesis of 5-hydroxymethyl-3-methyl-2- (7-nitro-imidazo [4, 5-b] -pyridin-3-yl) -tetrahydrofuran-3, 4-diol (168) Step 1. Synthesis of 7- nitro-3H-imidazo [4, 5-b] pyridine 7-Nitro-3H-imidazo [4, 5-b] pyridine was synthesized as described in G. Cristalli, P. Franchetti, M. Grifantini, S. Vittori, T. Bordoni and C. Geroni J. Med. Chem. 1987, 30, 1686-1688. Step 2. Synthesis of 5- hydroxymethyl-3-methyl-2- (7-nitroimidazo [4, 5- b] -pyridin-3-yl) -tetrahydro-furan-3, 4-diol protected with 2 ', 3', 5'-trisbenzoyl The product from Step 1 above (131.1 mg, 0.8 mmol) was dissolved in 10 ml of dry acetonitrile. 0.5 ml (2.0 mmol) of N, O-bis (trimethylsilyl) acetamide was added, and the solution was refluxed until it was clear - about 15 min. Then, 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose (ribose X) (290.3 mg, 0.5 mmol) and trimethylsilyl trifluoromethanesulfonate 0.3 ml were added to the solution. , 2.0 mmol). The reaction was refluxed for 1 hour, after which time the reaction was allowed to cool to room temperature and the reaction was stopped by the addition of solid sodium bicarbonate (294 mg). The mixture was then diluted with 60 ml of saturated sodium bicarbonate solution. The product was extracted with chloroform. The organic phase was washed with brine, dried with sodium sulfate and evaporated. The product was a yellow, fatty solid, which was taken immediately for the next stage in crude form. MS: 645.23 / M + Na). Step 3. Synthesis of 5- hydroxymethyl-3-methyl-2- (7-nitro-imidazo [4, 5-b] -pyridin-3-yl) -tetrahydro-furan-3, 4-diol The nucleoside product of Stage 2 above, was dissolved in 100 ml of 7 N ammonia in methanol. The reaction mixture was allowed to stand at 3 ° C overnight. The next day the liquids were removed under vacuum. The resulting crude mixture was purified via column chromatography on silica gel using 10% methanol in chloroform. Fractions containing the title nucleoside were combined and evaporated to give 121.5 mg (49%) of the desired nucleoside. MS: 311.10 (M + H). Example 133 Synthesis of 2- (7-amino-imidazo [, 5-b] pyridin-3-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (61) 5- Hydroxy was dissolved 3-methyl-2- (7-nitro-imidazo [4, 5-b] -pyridin-3-yl) -tetrahydrofuran-3, 4-diol (47.0 mg, 0.15 mmol) in 20 ml of methanol . A portion of palladium on carbon (10%) was added to the solution and the reaction mixture was placed under hydrogen at 50 psi for 0.5 hours. The palladium catalyst was removed by filtration, and the solvent was removed in vacuo. The product was lyophilized from 1,4-dioxane to yield the title nucleoside as a loose powder (34.1 mg, 80%): MS 281.16 (M + H). Example 134 Synthesis of 5- hydroxymethyl-3-methyl-2- (4-nitro-benzoimidazol-1-yl) -tetrahydrofuran-3, 4-diol (175) Step 1. Synthesis of 4-nitro-1H-benzoimidazole 4-Nitro-1H-benzoimidazole was synthesized as described in Sagi, G., et al., J. Med. Chem., .35, 24, 1992, 4549- 4556. Stage 2. Synthesis of 5-hydroxymethyl-3-methyl-2- (4-nitrobenzoimidazol-1-yl) -tetrahydrofuran-3,4-diol protected with 2 ', 3', 5'-trisbenzoyl The product of Step 1 above (130.5 mg, 0.8 mmol) was dissolved in 10 ml of dry acetonitrile. 0.5 ml (2.0 mmol) of N, O-bis (trimethylsilyl) acetamide was added, and the solution was refluxed until clarified - approximately 15 min. Then, 1, 2, 3, 5-tetra-O-benzoyl-2'-C-methyl-β-D-ribofuranose (ribose X) (280.6 mg, 0.5 mmol) and trimethylsilyl trifluoromethanesulfonate (0.3) were added to the solution. my, 2.0 mmol). The reaction was refluxed for 1 hour. After this time the reaction was allowed to cool to room temperature and the reaction was stopped by the addition of solid sodium bicarbonate (294 mg). The mixture was further diluted with 60 ml of saturated sodium bicarbonate solution. The product was extracted with chloroform. The organic phase was washed with brine, dried with sodium sulfate and evaporated. The product was a fatty solid that was immediately taken to the next stage in raw form. MS: 680.20 (M-t-CH3COO). Step 3. Synthesis of 5- hydroxymethyl-3-methyl-2- (4-nitrobenzoimidazol-1-yl) -tetrahydrofuran-3-f 4-diol. The product of Step 2 above was dissolved in 100 ml of 7 N ammonia in methanol. The reaction mixture was allowed to stand at 3 ° C overnight. The next day, the liquids were removed under vacuum. The resulting crude mixture was purified via column chromatography on silica gel using 10% methanol in chloroform. Fractions containing the title nucleoside were combined and evaporated to give 120.2 mg (78%) of the title nucleoside. MS: 368.14 (M + CH3COO). Example 135 Synthesis of 2- (4-amino-benzoimidazol-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (176) The 5-hydroxymethyl-3-methyl- nucleoside was dissolved 2- (4-Nitro-benzoimidazol-1-yl) -tetrahydrofuran-3, 4-diol (59.3 mg, 0.19 mmol), in 20 ml of methanol. A portion of palladium on carbon (10%) was added to the solution and the reaction mixture was placed under hydrogen at 50 psi for 0.5 hours. The palladium catalyst was removed by filtration, and the solvent was removed in vacuo. The product was evaporated from anhydrous ethanol 3 times to yield the title nucleoside as a white powder (47.5 mg, 89%): MS 280.15 (M + H). Example 136 Synthesis of 2- (4-amino-pyrrolo [2, 3-b] pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (179) Step 1. Synthesis of 4-nitro-1H-pyrrolo [2, 3-b] pyridine. 4-Nitro-1H-pyrrolo [2, 3-b] pyridine was synthesized as described in Antonini, I, et al., J. Med. Chem. , 1982, 25, 1261-1264. Step 2. Synthesis of 4- (2,4-dichloro-benzyloxy) -5- (2,4-dichloro-benzyloxymethyl) -3-methyl-2- (4-nitro-pyrrolo [2, 3-b] pyridine- 1-yl) -tetrahydrofuran-3-ol To a solution of the product of Step 1 above (188.9 mg, 1.2 mmol) in 30 ml of anhydrous acetonitrile under argon at room temperature was added sodium hydride. The solution was kept stirring for 4 hours. To a solution of the -D-1-O-methyl-2,3,5-tri (2,4-dichlorobenzyl) -ribofuranose (Y-sugar) (191.5 mg, 0.39 mmol) in 15 ml of anhydrous dichloromethane under argon a 0 ° C 0.46 ml of HBr (30%) was added dropwise. The resulting solution was allowed to stir at 0 ° C for 1 hour and then at room temperature for 3 hours. The solution was allowed to evaporate in vacuo and co-evaporated with toluene. The residue was dissolved in 10 ml of anhydrous acetonitrile and added to the solution of the sodium salt of the product from Step 1 above. The combined mixture was stirred at room temperature for 24 hours, and then evaporated to dryness. The residue was dissolved in EtOAc, and washed with water. The water was extracted 3x with EtOAc. The extracts. The combined organics were washed with brine and dried with Na2SO4. The solvent was removed in vacuo. It was used for the final purification, column chromatography with silica gel using 30% ethyl acetate in hexane. The nucleoside of the title was isolated as a dark brown oil (102.6 mg, 42). MS: 686.04 (M + CH3COO). Step 3. Synthesis of 5-pheidroxymethyl-3-methyl-2- (4-nitropyrrolo [2, 3-b] pyridin-1-tetrahydro-furan-3, 4-diol The product from Step 2 above (102.6 mg, 0.16 mmol) was dissolved in 10 mL of CH2Cl2 under argon, the solution was brought to -78 ° C, and BCI3 (0.164 mL, 1.6 mmol) was added dropwise over 5 minutes. 2.5 hours, at which time the flask was placed in an atmosphere at -20 ° C overnight.After ~20 hours, the reaction flask was allowed to warm to room temperature, and the reaction was stopped with 10 ml of water. methanol: dichloromethane (ratio 1: 1, 0.016 M) The reaction flask was placed back in the room at -20 ° C for 15 minutes, and then brought to alkaline conditions with NHOH at 27. The neutralized crude product evaporated in vacuo, and the product was isolated via column chromatography on silica gel using 10% methanol in chloroform as the running solvent. 37.0 mg (73%) of the title nucleoside. MS: 310.13 (M + H). Step 4. Synthesis of 2- (4-amino-pyrrolo [2, 3-b] pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydrofuran-3, 4-diol The product of the Step 3 above (24.7 mg, 0.08 mmol) was dissolved in 10 ml of ethyl acetate. A portion of palladium on carbon (10%) was added to the mixture, which was placed in a hydrogen atmosphere for 30 minutes. The palladium catalyst was immediately removed by filtration, and the solvent was removed in vacuo. The nucleoside in the title was isolated as a pink solid (20.5 mg, 92%). MS: 280.13 (M + H). Example 137 Synthesis of 2- (4,6-dichloropyrrolo [3, 2- pyridin-1-yl) -5-idroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (210) Step 1. Synthesis of 4, 4,6-dichloro-1H-pyrrolo [3,2-c] pyridine. 4,6-Dichloro-1H-pyrrolo [3, 2-c] pyridine was synthesized as described in Scneller, SW, Hosmane, RS, J. Heterocyclic Chem., 15, 325 (1978). Step 2. Synthesis of 4- (2,4-dichloro-benzyloxy) -5- (2,4-dichloro-benzyloxymethyl) -2- (4,6-dichloro-pyrrolo [3, 2-c] pyridin-1-yl) ) ~ 3-methyl-tetrahydro-furan-3-ol To a solution of the base prepared in Step 1 above (1.01 g, 5.4 moles) in 150 ml of anhydrous acetonitrile under argon at room temperature was added sodium hydride (60 g). %, 260 mg, 6.5 min.). The solution was left stirring for 4 hours. To a solution of 1¡ & - D-1- 0 -methyl- 2, 3, 5- tri (2,4-dichlorobenzyl) -ribofuranose (Y-sugar) (1.11 g, 2.2 mmol) in 75 ml of anhydrous dichloromethane under argon at 0 ° C was added drop by drop 0.86 ml of HBr (30%). The resulting solution was allowed to stir at 0 ° C for 1 hour and then at room temperature for 3 hours. The solution was then evaporated in vacuo and co-evaporated with toluene. The residue was dissolved in 50 ml of anhydrous acetonitrile and added to the solution of the sodium salt of the base prepared in Step 1 above. The combined mixture was stirred at room temperature for 24 hours, and then evaporated to dryness. The residue was dissolved in EtOAc, and washed with water. The water was extracted 3 x with EtOAc. The combined organic extracts were washed with brine and dried with Na 2 SO 4. The solvent was removed in vacuo. Column chromatography with silica gel using 30% ethyl acetate in hexane was used for final purification. The nucleoside of the titer was isolated as a dark brown oil (724.3 mg, 51%). MS: 708.9555 (M + CH3COO) Step 3: Synthesis of 2- (4,6-dichloropyrrolo [3,2-clpyridin-1-yl] -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4 - diol The product from Step 2 above (724.3 mg, 1.11 mmol) was dissolved in 22.5 ml of CH2C12 under argon. The solution was brought to -78 ° C, and added dropwise for 5 min., BC13 (0.98 mL, 1.6 mmol). The solution was left stirring for 2.5 hours, at which time the flask was placed in an atmosphere at -20 ° C overnight. After ~20 hours, the reaction flask was allowed to warm to room temperature, and the reaction was quenched with 70 ml of methanol: dichloromethane (ratio of 1: 1, 0.016 M). The reaction flask was again placed in ambient at -20 ° C for 15 minutes, and brought to alkaline conditions with 27% NH4OH. The neutralized crude product was evaporated in vacuo, and the product was isolated via column chromatography on silica gel using 10% methanol in chloroform as the running solvent. 269.5 mg (73%) of the nucleoside of the isolated titer was isolated. MS: 333.04 (M + H). EXAMPLE 138 Synthesis of 2- (4-amino-6-chloro-pyrrolo, 2-c-pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (211) was placed 2- (4,6-dichloro-pyrrolo [3, 2-c] pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (269.5 mg, 0.81 mmol) in a Metallic reaction pump and dissolved in liquid ammonia. The pump was sealed and the equipment was immersed in an oil bath at 135 ° C for 5 days. After that time, the pump was cooled to 78 ° C, unsealed and the liquid ammonia allowed to evaporate. The crude reaction product was purified via column chromatography on silica gel using 20% methanol in chloroform. The nucleoside of the titer was isolated at 130.0 mg (51). EXAMPLE 139 Synthesis of 2- (4-Amino-pyrrolo [3, 2-c] pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol (212) was dissolved 2- (4-Amino-6-chloro-pyrrolo [3, 2-c] pyridin-1-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol in 20 ml of methanol, which was added a palladium-on-charcoal portion (10%) and 2 ml of sodium hydroxide (1 N) was added. The reaction mixture was placed under hydrogen at 40 psi for 4 hours. Time after which the palladium catalyst was removed by filtration and the solvent was removed in vacuo. The reaction mixture was purified via column chromatography on silica gel using 33% methanol in chloroform as the eluent solvent. Biological Examples Example 1. Anti-Hepatitis C activity Compounds may exhibit antihepatitis C activity by inhibition of HCV polymerase, by inhibition of other enzymes needed in the replication cycle, or by other routes. Numerous trials have been published to evaluate these activities. A general method that evaluates the gross increase of the HCV virus in culture is described in U.S. Pat. No. 5,738,985 of Miles et al. In vitro tests have been reported in Ferrari and collaborators Jnl of Virg., 73: 1649-1654, 1999; Ishii et al., Hepatology, 29: 1227-1235, 1999; Lohmann et al., Jnl of Bio. Chem., 274: 10807-10815, 1999; and Yamashita et al., Jnl. Of Bio. Chem., 273: 15479-15486, 1998. WO 97/12033, registered on September 27, 1996, by Emory University, listing C. Hagedorn and A. Reinoldus as inventors, which claim priority for U.S.S.N. 60 / 004,383, filed September 1995, describes an HCV polymerase assay that can be used to evaluate activity. of the compounds described herein. Another assay of HCV polymerase has been reported by Bartholomeusz, and collaborators, Hepatitis C Virus (HCV) RNA polymerase assay using cloned HCV non structural proteins; Antiviral Therapy 1996: 1 (Supp 4) 18-24. Screenings were described that measured reductions in kinase activity of drugs for HCV in the Párente U.S. No. 6,030,785, to Katze et al., U.S. Pat. No. Delvecchio et al., And U.S. Pat. No. 5,659,795 to Jubin et al. Screenings measuring the protease inhibitory activity of proposed HCV drugs were described in U.S. Pat. No. 5,61,267 of Su and collaborators ,? Attempt U.S. No. 5,739,002 to De Francesco et al., And U.S. Pat. No. 5,597,691 to Houghton et al. Example 2. Replicon assay A cell line, ET (Huh-lucubineo-ET) was used for the screening of compounds of the present invention by means of the RNA-dependent RNA polymerase of HCV. The ET cell line is stably transfected with RNA transcripts that harbor an I389luc-ubi-neo / Ns3-3 '/ ET; Replicon with the firefly luciferase-ubiquitin-neomycin phosphotransferase fusion protein and EMCV-IRES led to polyprotein BS3-5B containing adaptive cell culture mutations (E1202G; T1280I; K1846T) (Krieger et al., 2001, unpublished). Et cells were cultured in DMEM, supplemented with 10% fetal calf serum, 2 mM glutamine, Penicillin | (100, IU / ml) / Streptomycin (100 μg / ml), 1 x non-essential amino acids, and 250 ug / ml of G418 ("Geneticin"). They are available through Life Technologies (Bethesda, MD). The cells were plagued at 0.5-1.0 × 10 4 cells / well in the 96 plates and incubated for 24 hours before adding nucleoside analogues. The compounds were then added to the cells each at 5 and 50 uM. The luciferase activity will be measured 48-72 hours after the addition of a lysis buffer and substrate (Catalog No. E-2661 Globulis regulator and system for Brigth-Glo E2620 Promega luciferase, Madison, WI). The cells should not converge during the test either. The percentage of inhibition of replication was plotted in relation to the control without compound. Under the same conditions, the cytotoxicity of the. compounds using the cell proliferation reagent, WST-1 (Roche, Germany). The compounds showed antiviral activities, but non-significant cytotoxicities will be selected to determine the IC50 and TC50. Example 3. Cloning and Recombinant Expression of HCV-NS5b The coding sequence of the NS5b protein was cloned by PCR method from pFKI389luc / NS3-3 '/ ET as described by Lohmann, V., et al. (1999) Science 285, 110- 113 using the following primers: aggacatggatccgcggggtcgggcacgagacag (SEQ ID NO: 1) aaggctggcatgcactcaatgtcctacacatggac (SEQ ID NO: 2) the cloned fragment is missing from the 21 amino acid residues of C-terminus. The cloned fragment is inserted into an IPTG-inducible expression plasmid that provides a labeled epitope (His) 6 in the carboxy terminus of the protein. The recombinant enzyme is expressed in XL-1 cells and after induction of expression, the protein is purified using affinity chromatography on an NTA-nickel column. The storage condition is 10 mM Tris-HCl pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 20% glycerol at -20 ° C. Example 4. Enzyme assay HCV-NS5b Polymerase activity was assayed by measuring the incorporation of radiolabeled UTP into an RNA product using a poly-A template (1000-10000 nucleotides) and an oligo-U12 primer. Alternatively, a portion of the HCV genome is used as a template and radiolabelled GTP. Typically, the 850 μm assay mixture contains 10 mM Tris-HCl (pH 7.5), 5 mM MgC12, 0.2 mM EDTA, 10 mM KC1, 1 unit / μ? of RNAsin, 1 mM of DTT, 10 uM of each of NTP, alpha- [32 P] -GTP, 10 ng / μ? of the polyA mold and 1 ng / μ? of the oligoU primer. The test compounds were dissolved in water containing 0 to 1% DMSO. Typically, the compounds are tested at concentrations between 1 nM and 100 uM. The reactions were started with enzyme addition and allowed to continue at room temperature or at 30 ° C for 1 to 2 hours. The reactions were stopped with 20 μ? 10 mM EDTA and the reaction mixtures (50 μm) were stained on a DE81 filter disc to capture the radiolabelled RNA products. After washing with 0. 5 mM of a2HPÜ (3 times), water (1 time) and ethanol (1 time) to remove the unincorporated NTP, the discs were dried and the incorporation of radiocativity was determined by means of the counter by scintillation. Formulation Examples The following are representative pharmaceutical formulations containing a compound of the formula la, Ib, Ic, IV, VAT, V or VA. Example 1 Tablet formulation The following ingredients were intimately mixed and compressed into single-cut tablets Ingredient Amount tablet, Compound of this invention 400 Corn starch 50 Croscarmellose sodium 25 Lactose 120 Magnesium stearate 5 Example 2 Formulation for ingredient capsule Quantity per capsule, mg Compound of this invention 200 Lactose, spray-dried 148 Magnesium stearate 2 Example 3 Formulation for suspension The following ingredients were mixed to form a suspension for oral administration Ingredient Amount Compound of this invention 1.0 g Fumaric acid 0.5 g Sodium chloride 2.0 g Methyl paraben 0.15 g Propyl paraben 0.05 g Granulated sugar 25.0 g Sorbitol (70% solution) 13.00 g Veegum K (Vanderbilt Co.) 1.0 g Flavor 0.035 ml Dyes 0.5 mg Styled water c.b.p. 100 mi Example 4 Injectable formulation The following ingredients were mixed to form injectable formulation Ingredient Amount Compound of this invention 0.2 mg-20 mg Sodium acetate buffer 1.0 ml HC1 (1N) or NaOH (1N) c.b.p. adequate pH Water (distilled, sterile) c.b.p. 20 ml Example 5 Formulation for suppositories A suppository of total weight of 2.5 g was prepared by mixing the compound of the invention with itepsol® H-15 (triglycerides of saturated vegetable fatty acids, Riches-Nelson, Inc. New York), and The following composition: Ingredient Quantity Compound of the invention 500 mg Witepsol® H-15 balance References The following publications and patents are cited in this application as number superindices: 1. C in, and collaborators, Med. Assoc, 95 (1): 6-12 (1996) 2. Cornberg, and collaborators, "Hepatitis' C: therapeutic perspectives "Forum (Genova), 1A. { 2) 154-62 (2001) 3. Dymock, et al., Antivir. Chem. Chemother. 11 (2): 79-96 (2000) 4. Devos, et al., International Patent Application Publication No. WO 02/18404 A2, published March 7, 2002. 5. Sommadossi, et al., International Patent Application Publication No. WO 01/90121, published May 23, 2001 6. Ducrocq, C; et al., Tetrahedron, 32: 773 (1976) 7. Rizkalla, B. H .; Broom, A. D. J. Org. Chem. 37 (25): 3980 (1972) 8. Anderson, G. L .; Broom, A. D .; J. Org. Chem., 42 (6): 997 (1977) 9. Riskalla, B. H .; Broom, A. D. J. Org. Chem., 37 (25): 3975 (1972). '10. Furukawa, Y .; Honjo, M., Chem. Pharm. Bull. ', 16 (6): 1076 (1968). 11. Ektova, L. V .; and collaborators; Bioorg. Khim., 5: 1369 (1979). 12. De Clercq, E.; et al., J. Med. Chem., 26 (5): 661 (1983) 13. Robins, M. J .; Barr, P. J. J. Org. Chem., 48 (11): 1854 (1983). 14. Griengl, H. , J. Med. Chem., 28 (11): 1679 (1985). 15. Lichten aler, F. W .; Cuny, E , Chem. Ber., 114: 1610 (1981). 16. Hamilton, H. W .; Bristol, J.A., J. Med. Chem., 26 (11): 1601 (1983). 17. Seela, F.,; Steker, H. , Liebigs Am. C em. P. 1576 (1983). 18. Winkley, M. W .; and collaborators, J. Heterocyclo.

Chem. 8: 237 (1971). 19. Barascut, J. L .; and collaborators, J.Carbohidr. Nucleosides Nucleotides, 3 (5 &6): 281 (1976). 20. Kiriasis, L.; Pfleiderer, W., Nucleosides Nucleotides, 8 (7): 1345 (1989). 21. Schneider, H.-J .; Pfleiderer, W., Chem. Berich., 107: 3377 (1974). 22. Angew. Chem. Int. Ed. Engl. , 35: 1968 (1996) '. 23. Hildbrand, S .; and collaborators, Helv. Chim. Acta, 79: 702 (1996). 24. De Las Heras, F .; and collaborators, J. Heterocycl. Chem., 13: 175 (1976). 25. Tam, S. Y.-K et al., J. Hetrocycl. Chem., 13: 1305 (1976). 26. Chu. C. K.; and collaborators, J. Hetrocycl. Chem., 17: 1435 (1980). 27. De Bernardo, S. Weigele, M., J. Org. Chem., 42 (1): 109 (1977). 28. Saureamid-Reaktionen, L .; Orthoamide, I., Chem. Ber., 101: 41 (1968). 29. Lim, M.-I .; Klein, R. S.; Fox, J. J., Tet. Lett., 21: 1013 (1981). 30. Yamazaki, A; and collaborators, J. Org. Chem .; 32: 1825 (1967). 31. Yamazaki, A .; Okutzu, M., J. Hetrocycl. Chem., 1978, 15: 353 (1978). 32. Lim, M.-I .; Klein, R. S., Tet. Lett., 22:25 (1981). 33. Bhattacharya, B. K.; and collaborators, Tet. Lett., 27 (7): 815 (1986). 34. Grisis, N. S .; et al., J. Med. Chem., 33: 2750 (1990). 35. Li, N.-S .; Tang, X.-Q .; Piccirilli, J.A., Organic Letters, 3 (7): 1025 (2001). 36. Cristalli, G .; et al., J. Med. Chem., 30 (9): 1686 (1987). 37. Seela, F.; and collaborators, Nucelosides Nucleotides, 17 (4): 729 (1998). 38. Sagi, G .; and collaborators, J. Med. Chem. 35 (24): 4549 (1992). 39. Hawkins, M. E.; et al., Nucleic Acids Research, 73 (15): 2872. 40. Mandal, S. B., et al., Synth. Commun .; 9: 1239 (1993). 41. Witty, D.R., and collaborators, Tet. Lett. 31: 4787 (1990). 42. Ning, J. et al., Carbohydr. Res., 330: 165 (2001). 43. Yokoyoma, M., et al., J. Chem. Soc. Perkin Trans. I, 2145 (1996). 44. Carroll SS, et al., International Patent Application Publication No. 0 02057287, published July 25, 2002. 45. Carroll, SS, et al., International Patent Application Publication No. WO 02057425, published July 25, 2002. All prior publications, patents and patent applications are hereby incorporated by reference in their entirety, to the same extent as if each individual patent application, publication or patent was specifically and individually incorporated as a reference.

Claims (9)

NOVELTY OF THE INVENTION Having described the present invention, it is considered as novelty, and therefore the content of the following is claimed as property:

1. A compound of formula la, Ib or Ic the Ib where R and R1 are independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, and substituted alkynyl provided that R and R1 are not both hydrogen; R2, is selected from the group consisting of: alkyl. substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, acylamino, guanidino, amidino, thioacylamino, hydroxy, alkoxy, substituted alkoxy, halo, nitro, thioalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, - NR3R4, wherein R3 and R4 are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and wherein R3 and R4 come together to form, together with the nitrogen atom to which it is linked, a heterocyclic, substituted heterocyclic, heteroaryl, or substituted heteroaryl, -NR5NR3R4, wherein R3 and R4 are as defined above and R5 is selected from the group consists of hydrogen and alkyl, W, is selected from the group consisting of: hydrogen no, phosphate functionality, selected from the group consisting of monophosphate, diphosphate, triphosphate and a stabilized phosphate prodrug, phosphonate, acyl, alkyl, sulfonate ester selected from the group consisting of alkyl esters, substituted alkyl esters, alkenyl esters, alkenyl esters substituted, aryl esters, substituted aryl substituted, heteroaryl esters, substituted heteroaryl esters, heterocyclic esters and substituted heterocyclic esters, a lipid, an amino acid, a carbohydrate, a peptide, and cholesterol; X, is selected from the group consisting of: hydrogen, halo, alkyl, substituted alkyl, and -NR3R4, wherein R3 and R4 are as previously identified; And, it is selected from the group consisting of: hydrogen, halo, hydroxy, alkylthio -NR3R4, where R3 and R4 are as defined above; Z, is selected from the group consisting of: hydrogen, halo, hydroxy, alkyl, azido, and -NR3R4, wherein R3 and R4 are as defined above -NR5NR3R4, wherein R3, R4 and R5 are as previously identified; and wherein T, is selected from the group consisting of a) 3- deazapurines of the following formula: b) purine nucleosides of the following formula c) benzimidazole nucleosides of the following formula: d) 5-pyrrolopyridine nucleosides of the following formula: e) 4-pyrimidopyridone analogues sangivamycin of the following formula: f) 2-pyrimidopyridone analogues sangivamycin of the following formula: g) analogues of 4-pi imidopyridone sangivamycin following formula: h) pyrimidopyridine analogs of the following formula: i) pyrimido-tetrahydropyridines of the following formula: j) furanopyrimidines (& tetrahydro furanopyrimidines) of the following formula: k) pyrazolopyrimidines of the following formula: pyrolopyrimidines of the following formula m) triazolopyrimidines of the following formula: pteridines of the following formula o) C-pyridine nucleosides of the following formula: p) C pyrazotriazine C-nucleosides of the following formula:

Indole nucleosides of the following formula: r) a basis of the following formula: a basis of the following formula a basis of the following formula a basis of the following formula a base of the following formula: a base of the following formula and wherein additionally one of the bonds characterized by is a double bond and the other is a single bond provided that, when the between N and one carbon in the ring is a double bond, then p is 0 and when between Q and a carbon of the ring is a double bond, then p is 1; each p is independently 0 or 1; each n is independently 0 or an integer from 1 to 4; each n * is independently 0 or an integer from 1 to 2;

L is selected from the group consisting of hydrogen, halo, alkyl, substituted alkyl, amino, substituted amino, azido, and nitro; Q, is selected from the group consisting of hydrogen, halo, = 0, -0R11, = N-R1: L, -RH11, = S, -SR11, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic; M, is selected from the group consisting of = 0, = N-R11, y = S; And, it is as defined above; R10 is selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocyclic and substituted heterocyclic, alkylthioether, substituted alkylthioether, aryl, substituted aryl, heteroaryl and substituted heteroaryl, with the proviso that when T is b) , s), v), w) or x), then R10 is not hydrogen; each R11 and R12 is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, heterocyclic, substituted heterocyclic, amino, substituted amino, alkylthioether, substituted alkylthioether, aryl, substituted aryl, heteroaryl, and substituted heteroaryl; each R20 is independently selected from the group consisting of: hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, cycloalkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroaryl, substituted heteroaryl, acylamino, guanidino, amidino, thioacylamino, alkoxy, substituted alkoxy, alkylthio, nitro, halo, hydroxy, -NR3R4 where R3 and R4 are as defined above, -NR5NR3R4, where R3, R4 and R5 are as defined above; each R21 and R22 are independently selected from the group consisting of: -NR3R4 where R3 and R4 are as defined above, and -NR5NR3R4, where R3, R4 and R5 are as defined above, -C (0) NR3R4, where R3 and R4 are as defined above, and -C (0) NR5NR3R4, wherein R3, R4 and R5 are as defined above; and pharmaceutically acceptable salts thereof; with the proviso that 1) for a compound of formula la, when Z is hydrogen, halo, hydroxy, azido, or NR3R4, where R3 and R4 are independently hydrogen, or alkyl; Y is hydrogen or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; then R2 is not alkyl, alkoxy, halo, hydroxy, CF3, 'or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; 2) for a compound of formula la, when Z, is hydrogen, halo, hydroxy, azido, or NR3R4, where R3 and R4 are independently hydrogen, or alkyl; And it is hydrogen, halo, hydroxy, or alkylthio; then R2 is not alkyl, substituted alkyl, wherein the substituted alkyl is substituted with hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate, or phosphonate, whether protected or unprotected, halo, hydroxy, alkoxy, thioalkyl, or -NR3R4, wherein R3 and R4 are independently hydrogen, alkyl or alkyl substituted with hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, acid phosphonic, phosphate, or phosphonate, whether protected or unprotected; 3) for a compound of formula Ib, when X is hydrogen, halo, alkyl, CF3 or -NR3R4 where R3 is hydrogen and R4 is alkyl, then R2 is not alkyl, alkoxy, halo, hydroxy, CF3 / or -NR3R4 where R3 and R4 are independently hydrogen or alkyl; and 4) for a compound of formula Ib, R2 is not halo, alkoxy, hydroxy, thioalkyl, or -NR3R4 (wherein R3 and R4 are independently hydrogen, alkyl or alkyl substituted by hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphate, or phosphonate, whether protected or unprotected). and further, with the proviso that the compound of Formula Ia, Ib or Ic is not a) 2-hydroxymethyl-5- (6-phenyl-purin-9-yl) -tetrahydrofuran-3, 4-diol; or b) 2-hydroxymethyl-5- (6-thiophen-3-yl-purin-9-yl) -tetrahydrofuran-3, 4-diol. 2. A compound according to claim 1, characterized in that R is hydrogen and R1 is methyl. A compound according to claim 1, characterized in that it is selected from the group consisting of: 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (thiophen-3-yl) -purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (thiophen-3-yl) - - 2 - aminopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (pyrrol-3-yl) -purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (phenyl-2-aminopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3-cyanophenyl) ) - purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (pyridin-3-yl) -purine; 9- (2'-C-methyl-β-D-ribofuranosyl) - 6- (benzo [b] -3-yl) -2-aminopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (1H-indol-5-yl) -purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (naphthalen-2-yl) -purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (dibenzofuran-4) - il) -2-aminopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (thiantren-1-yl) -purine; 9- (2'-C-methyl-β-D) - ribofuranosyl) - 6-cyclopropyl-2-aminopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6-ethynyl-purine; 1- (2'-C-methyl-β-D-ribofuranosyl) ) - 4-thiophen-3-yl-1H-pyrimidin-2-one: 1- (2'-C-methyl-β-D-ribofuranosyl) -4-phenyl-1H-pyrimidin-2-one; (2'-C-methyl-β-D-ribofuranosyl) -4-benzo [b] thiophen-2-yl-1H-pyrimidin-2-one 1- (2'-C-methyl-β-D- ribofuran sil) -4-cyclopentyl-1H-pyrimidin-2-one; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - (2-dimethylaminoethyl) adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 5 - (2-aminoethyl) adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -N6- [2- (3H-indol-3-yl) -ethyl] adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- [2-aminocarbonyl- (pyrrolidin-1-ii] -purine; 1- (2'-C-methyl-β-D-ribofuranosyl) - N 4 - (aminocarbonylmethyl) cytidine; 1- (2'-C-methyl-β-D-ribofuranosyl) - N 4 - [(pyridin-1-yl) -methyl] cytidine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - [(adenin-8-yl) -aminoethyl] adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 5 - [(benzene-3,4,5-triol) methyl] adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 5 - [1-aminocarbonyl-2- (3H-indol-3-yl) -ethyl] adenine; 9-. { 2'-C-methyl-β-D-ribofuranosyl) -6- (1,3,4,9-tetrahydro-beta-carbolin-2-yl) purine; 1- (2'-C-methyl-β- 'D-ribofuranosyl) - N 4 - [1-aminocarbonyl-2- (3H-indol-3-yl) -ethyl] cytosine; 1- (2'-C-methyl-β-D-ribofuranosyl) -4- (pentafluorophenyl-hydrazino) -pyrimidin-2-one; 1- (2'-C-methyl-β-D-ribofuranosyl) -4- [4 ^ (3,4-dihydroxy-benzyl) -6,7-dihydroxy-3,4-dihydro-1H-isoquinolin- 2- il] - pyrimidin-2-one; 1- (2'-C-methyl-β-D-ribofuranosyl) - N 4 - [2- (3 H -indol-3-yl) -ethyl] cytosine; 1- (2'-C-methyl-β-D-ribofuranosyl) - N 4 - (2 aminoethyl) cytosine; 1- (2'-C-methyl-β-D-ribofuranosyl) - N 4 - (aminocarbonyl isopropylmethyl) cytidine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N -. { [(3 H -indol-3-yl) -acetic acid] -hydrazide} adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - [2- (5-fluoro-benzimidazol-1-yl) -ethyl] adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6-hydrazino-purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -N6- (2, 2, 3, 3, 3-pentafluoropropyl)-adenine; 9-. { 2'-C-methyl-β-D-ribofuranosyl) -6- (piperidin-1-yl) purine; 1- (2'-C-methyl-β-D-ribofuranosyl) -1H-benzimidazole; 3- (2'-C-methyl-β-D-ribofranosyl) -3H-imidazo [4, 5-b] pyridin-7-ylamine; 9- (2'-C-methyl-β-D-ribofuranosyl) - N 6 - (2-aminoethyl) adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -N6- [2- (3H-indol-3-yl) -ethyl] adenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- [2-aminocarbonyl- (pyrrolidin-1-yl)] - purine; 9- (2'-C-trifluoromethyl-β-D-ribofuranosyl) -guanine; 1- (2 '- "C-trifluoromethyl-β-D-ribofuranosyl) -1H-benzimidazole; 9- (2'-C-ethenyl-β-D-ribofuranosyl) -N6- (2-aminoethyl) adenine; (2'-C- ethenyl-β-D-ribofuranosyl) - N 6 - [2- (3 H -indol-3-yl) -ethyl] adenine; 9- (2'-C-ethenyl-β-D-ribofuranosyl) 6- [2-aminocarbonyl- (pyrrolidin-1-yl)) -purine; 1- (2'-C-ethenyl-β-D-ribofuranosyl) -1H-benzimidazole; 9- (2'-C-ethynyl) - ß- D- ribofuranosyl) - N6- (2-aminoethyl) adenine; 9- (2'-C-ethynyl-β-D-ribofuranosyl) - N6 - [2- (3H-indol-3-yl) -ethyl ] adenine; 9- (2'-C-ethynyl-β-D-ribofuranosyl) -6- [2-aminocarbonyl- (pyrrolidin-1-yl)] - purine; 1- (2'- C- ethynyl-> - D-ribofuranosyl) -1H-benzimidazole; 5- "(2'-C-methyl-β-D-ribofuranosyl) -5H-pyrrolo [3, 2-cjpyridin-4-ylamine; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -5-oxo-5,8-dihydropyrido [2,3-d] pyrimidine-6-carboxylic acid amide; 2, 4-diamino-8- (2'-C-methyl-β-D-ribofuranosyl) -5-oxo-5,6-dihydropyrido [2, 3-d] pyrimidine-6-carboxylic acid amide; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -7-oxo-7,8-dihydro-pyrido [2,3-d] pyrimidine-5-carboxylic acid amide; 2, 4-diamino-8- (2'-C-methyl-β-D-ribofuranosyl) -7-oxo-7,8-dihydropyrido [2,3-d] pyrimidine-5-carboxylic acid amide; 8- (2'-C-methyl-β-D-ribofuranosyl) -2-methylsulphanyl-4,5-dioxo-3,4,5,6-tetrahydropyrido [2,3-d] pyrimidine- acid amide 6- carboxylic; 8- (2'-C-methyl-β-D-ribofuranosyl) -8H-pyrido [2,3-d] pyrimidin-2,4-dione; 1- (2'-C-methyl-β-D-ribofuranosyl) - 1H-pyrido [2,3-d] pyrimidin-2,4-dione; 8- (2'-C-methyl-β-D-ribofuranosyl) -4-methylsulphanyl-, 6,6,7,8-tetrahydro-pyrido. [2,3-d] pyrimidine; 3- . { 2 '- C-methyl-β-D-ribofuranosyl) -6-methyl-3, 7a-dihydro-1H-furo [2,3-d] pyrimidin-2-one; 3- (2'-C-methyl-β-D-ribofuranosyl) -3,5,6,7a-tetrahydro-1H-furo [2,3-d] pyrimidin-2-one; 1- (2'-C-methyl-β-D-ribofuranosyl) -4-methylsulphane-1H-pyrrolo [2,3-d] pyrimidine; 3- (2'-C-methyl-β-D-ribofuranosyl) -3H- [1, 2, 4] triazolo [1,5-a] pyrimidin-7-one; 3- methyl-8- (2'-C-methyl-β-D-ribofuranosyl) -2-methylsulfanyl-3H, 8H-pteridin-4,7-dione; 5- (2'-C-methyl-β-D-ribofuranosyl) -pyridin-2-ylamine; 5- (2'-C-methyl-β-D-ribofuranosyl) -1H-pyridin-2-one; 8 (2 'C-methyl-β-D-ribofuranosyl) -pyrazolo [1,5-a] [1,3,5] triazin-4-ylamine; 8- (2'-C-methyl-β-D-ribofuranosyl) -3H-pyrazolo [1,5-a] [1, 3, 5] triazin-4-one; 2-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -3H-pyrazolo [1,5-a] [1,3,5] triazin-4-one; 1- (2'-C-methyl-β-D-ribofuranosyl) -4-nitroindole; 1- (2'-C-methyl-β-D-ribofuranosyl) -4-aminoindole; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- [2- (1H-imidazol-4-yl) -ethyl] purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (azetidin-1-yl) purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6 (pyrrolidin-1-yl) purine; 2'-C-methyl-β-D-ribofuranosyl-hypoxanthine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6-methylhydrazinopurine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3,6-dihydro-2H-pyridin-1-yl) purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (3,4-dihydro-1H-isoquinolin-2-yl) purine; 2'-C-methyl-β-D-ribofuranosyl-6-methylthio-purine; 2'-C-methyl-β-D-ribofuranosyl-6-phenyladenine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (2- [1H-imidazo-1-yl) -ethylamine) purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (2-piperidin-1-yl-ethylamine) purine; 8- (2'-C-methyl-β-D-ribofuranosyl) -4,5-dioxo-3, 4, 5, 8-tetrahydro-pyrido [2,3-d] pyrimidine-6-carboxylic acid amide; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (6-fluoro- 1, 3, 4, 9-tetrahydro-β-carbolin-2-yl) purine; | ' | 9-. { 2'-C-methyl-β-D-ribofuranosyl) -6- (3,6-dihydro-2H-pyridin-1-yl) purine; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -2-methylsulphane-, 8H-pyrido [2, 3-d] pyrimidin-7-one; 6- (2'-C-methyl-β-D-ribofuranosyl) -1,3a, 5,6-tetraaza-as-indacene; 3- (2'-C-methyl-β-D-ribofuranosyl) -7-nitro-imidazo [4, 5-b] pyridine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6-phenyl-purine; 6-amino-9- (2'-C-methyl-β-D-ribofuranosyl) -7,9-dihydro-purin-8-one; 1- (2'-C-methyl-β-D-ribofuranosyl) -4-nitrobenzimidazole; 1- (4-amino-benzoyrazidazol-1-yl) -2'-C-methyl-β-D-ribofuranose; 1- (2'-C-methyl-β-D-ribofuranosyl) -4-hydroxy-1H-pyridin-2-one; 9- (2'-C-methyl-β-D-ribofuranosyl) -6 (tetramethylguanidino) purine; 1- (4-Amino-pyrrolo [2 # 3-b] pyridin-1-yl) -2'-C-methyl-β-D-ribofuranose; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -8H-pyrido [2,3-d] pyrimidin-7- one; 7- (2'-C-methyl-β-D-ribofuranosyl) -3,7-dihydropyrrolo [2,3-d] pyrimidin-4-one; 1- (2'-C-methyl-β-D-ribofuranosyl) -5-aminobenzimidazole; 1- (2'-C-methyl-β-D-ribofuranosyl) -6-aminobenzimidazole; 1- [6-amino-8- ('-methyl-hydrazino) -purin-9-yl] -2'-C-methyl-β-D-ribofuranose; 1- (1,3a, 5,6-tetraaza-as-induce-6-yl) - ß-D ribofuranose; 1- (4-amino-2- [1, 2,4] triazol-1-yl-irimidin-5-yl) -β-D-ribofuranose; 1- (4-methylamino-2- [1,2,4] triazol-1-yl-pyrimidin-5-yl) -β-D-ribofuranose; 1- [4-methylamino-2- (γ'-methyl-hydrazino) -pyrimidin-5-yl] - ß-D-ribofuranosyl; 1- [4- methylamino- 2-. { '-methyl hydrazino) -pyrimidin-5-yl] - ß-D-ribofuranosyl; 9- (2'-C-methyl-β-D-ribofuranosyl) purin-6-carboxamide; 9- (2'-C-methyl-β-D-ribofuranosyl) -9H-purin-6-carbothioic acid amide; 1- (4,6-dichloro-pyrrolo [3, 2-c] pyridin-1-yl-β-D-ribofiuranosa; 1- (4-amino-6-chloro-pyrrolo [3,2- c] pyridine) l-il) -2'-C-methyl-β-D-ribofuranose; 4-chloro-7-fluoro-1- (2'-C-methyl-β-D-ribofuranosyl) imidazo [4,5-c] pyridine; 4-amino-7-fluoro-1- (2'-C-methyl-β-D-ribofuranosyl) imidazo- [4,5-c] pyridine; 4-chloro-7-fluoro-1- (β - D-ribofuranosyl) imidazo [4,5-c] pyridine, 4-amino-7-fluoro-1- (β-D-ribofuranosyl) imidazo [4,5-c] pyridine, 4-amino-8-amide - (2'-C-methyl-β-D-ribofuranosyl) -7-oxo- 7,8-dihydro-pteridin-6-carboxylic acid;

4-amino-8- (ß-D-ribofuranosyl) -7-oxo-7,8-dihydro-pteridin-6-carboxylic acid amide; 4-amino-8- (ß-D-ribofuranosyl) -5-oxo-5,6-dihydropyrido [2,3-d] pyrimidine-6-carboxylic acid amide; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -5-oxo-5,8-dihydropyrido [2,3-d] pyrimidine-6-carboxylic acid amide; 4-amino-8- (ß-D-ribofuranosyl) -5-oxo-5,8-dihydropyrido [2,3-d] pyrimidine; 4-amino-8- (2'-C-methyl-β-D-ribofuranosyl) -8H-pyrido [2,3-d] pyrimidin-5-one; 4-amino-8- (ß-D-ribofuranosyl) -8H-pteridin-7-one; 4- amino-8- (ß-D-ribofuranosyl) -8H-pyrido [2,3-d] pyrimidin-7-one; 4-amino-8- (ß-D-ribofuranosyl) -2-methylsulfanyl-8H-pyrido [2, 3-d] pyrimidin-7-one; 4-amino-8- (ß-D-ribofuranosyl) -2-methylsulfanyl-7-oxo-7,8-dihydro-pteridin-6-carboxylic acid amide; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (cyclopropylamino) purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (cyclopentylamino) purine; 9- (2'-C-methyl-β-D-ribofuranosyl) -6- (cyclohexylamino) purine; 2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -2H [1,2,4] triazin-3, 5-dione; 5- amino- 2-. { 3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -4,5-dihydro-2H- [1, 2, 4] triazine-3-thione; 5- amino- 2- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydrofuran-2-yl) -2H- [1, 2, 4] triazin-3-one; 7- (3, 4-dihydroxy-5-hydroxymethyl-3-methyl-tetrahydro-furan-2-yl) -3,7-dihydro-pyrrolo [2, 3-d] pyrimidin-4-one; 4- cyclopropylamino- 1- (3, 4-dihydroxy-5-hydroxymethyl-3-methiotetrahydrofuran-2-yl) -1H-pyrimidin-2-one; 2- (4-amino-5H-pyrrolo [3, 2-d] pyrimidin-7-yl) -5-hydroxymethyl-3-methyl-tetrahydro-furan-3, 4-diol; and pharmaceutically acceptable salts thereof. 4. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound or mixture of any one of the compounds according to claim 1.

5. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable diluent and a therapeutically effective amount of a compound or a mixture of any one of the compounds according to claim 2.

6. A pharmaceutical composition characterized in that it comprises a pharmaceutically acceptable diluent and an effective amount Therapeutically of a compound or mixture of any one of the compounds according to claim 3.

7. A method for treating HCV in mammals, characterized in that it comprises administering to a mammal diagnosed with HCV, or at risk of developing HCV, a pharmaceutical composition according to claim 4-

8. A method for treating HCV. in mammals, characterized in that it comprises administering to a mammal diagnosed with HCV, or at risk of developing HCV, a pharmaceutical composition according to claim 5.

9. A method for treating HCV in mammals, characterized in that it comprises administering to a mammal. mammal diagnosed with HCV, or at risk of developing HCV, a pharmaceutical composition according to claim 6.