MXPA04001000A - Cysteine mutants and methods for detecting ligand binding to biological molecules. - Google Patents

Abstract

The present invention relates generally to variants of target biological molecules ("TBMs") and to methods of making and using the same to identify ligands of TBMs. More specifically, the invention relates to individual variant TBMs and sets of variant TBMs, each of which represents a modified version of a protein of interest where a thiol has been introduced at or near a site of interest. Ligands of TBMs are identified in part through the formation of a covalent bond between a potential ligand and a reactive thiol on the TBM.

Description

Published: For tvo-leUer codes and otker abbr viaiions, refer to it "Guid- - vithcna intemational search repon and w be republished ancc Notes on Codes aniAbbreviations" appearing to have started receipc of that repon mng of each regular issve of the PCT Gazeue. - 1 - CISTEINE MUTANTS AND METHODS TO DETECT LINKING UNION A BIOLOGICAL MOLECULES BACKGROUND OF THE INVENTION The drug discovery process usually begins with a massive functional search of compound libraries to identify modest affinity starts (Kd ~ 1 to 10 μ) for subsequent medicinal chemical optimization. However, not all the objectives of interest are susceptible to such an examination. In some cases, a trial that is susceptible to high-throughput screening is not available. In other cases, the target may have multiple binding modes such that such screens are ambiguous and difficult to interpret. In other different cases, the test conditions for a high-throughput screening are such that they are susceptible to errors by the determination process. As a result, alternative methods are needed for ligand discoveries that are not necessarily based on functional assays. The present invention provides such methods. SUMMARY OF THE INVENTION The present invention relates generally to variants of biological target molecules ("TBM") and to methods for making and using Ref. 153468-2 to identify ligands of TBM. More specifically, the invention relates to the individual variant TBMs and sets of TBM variants, each of which represents a modified version of a protein of interest where a thiol has been introduced into or near a site of interest. . The ligands of the TBM are identified, in part, by the formation of a covalent bond between a potential ligand and a reactive thiol in the TBM. DESCRIPTION OF THE FIGURES Figures 1? and IB schematically illustrate one embodiment of the association method wherein the target is a protein and the covalent bond is a disulfide. A protein with thiol is reacted with a plurality of candidate ligands. A candidate ligand is identified that possesses inherent binding affinity for the target and is made into a ligand comprising the identified binding determinant (represented by the circle). Figures 2A and 2B are representative examples of association experiments. Figure 2A is a non-convoluted mass spectrum of the reaction of thymidylate synthase ("TS") with an accumulation of 10 different candidates with little or no binding affinity for TS. Figure 2B is the unconverted mass spectrum of the TS reaction with an accumulation of 10 different candidate ligands when one of the candidate ligands possesses an inherent binding affinity - 3 - to the enzyme. Figures 3A to 3C show three illustrative examples of the distribution pattern of the residues wherein each has been mutated to a cysteine. Figure 3A is an example where the waste is distributed around a single site of interest. The structure is of the HIV core domain integrase with the portion comprising the site of shaded dark gray interest. Figure 3B is an example where the waste is distributed in two sites of interest. The structure is of a human interleukin-1 receptor with the portions comprising the two sites of interest shaded in dark gray. Figure 3C is an example where the residues are distributed across the surface of a protein. The structure is the trimeric structure of human TNF-α. Figures 4A and 4B show the side chain rotamers of cysteines in A) sheets B and B) helices a. DESCRIPTION OF THE PREFERRED MODALITIES The present invention relates generally to variants of the target biological molecules ("TBM", by its abbreviations in English) and with methods to elaborate and to use the same ones to identify ligands of the TBM. Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by those - 4 - ordinarily skilled in the art to which the invention pertains. References such as Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed. , J. Wiley &; Sons (New York, NY 1994), and March, Advanced Organic Chemistry Reactions Mechanisms and Structure th ed. , John • Wiley & Sons (New York, NY 1992), provide a person skilled in the art with a general guide to many of the terms used in the present application. Definitions The definition of the terms used herein include: The term "aliphatic" or "unsubstituted aliphatic" refers to a straight, branched, cyclic or polycyclic hydrocarbon and includes the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl portions and cycloalkynyl. The term "alkyl" or "unsubstituted alkyl" refers to a saturated hydrocarbon. The term "alkenyl" or "unsubstituted alkenyl" refers to a hydrocarbon with at least one carbon-carbon double bond. The term "alkynyl" or "unsubstituted alkynyl" refers to a hydrocarbon with at least one triple carbon-carbon bond. The term "aryl" or "unsubstituted aryl" refers to unsaturated monocyclic or -5-polycyclic portions having at least one aromatic ring. The term includes heteraorils that include one or more heteroatoms within at least one aromatic ring. Illustrative examples of aryl include phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, and the like. The term "substituted" when used to modify a portion, refers to a substituted version of the portion wherein at least one hydrogen atom is substituted with another group including, but not limited to: aliphatic; aryl, alkylaryl, F, Cl, I, Br, -OH; .N02; -CN; -CF3; -CH2CF3, -CH2C1; -CH20H; -CH2CH2OH; -C¾ H2; -CH2S02CH3; -ORx; -C (0) Rx; -COORx; -C (0) N (Rx) 2; -0C (0) Rx; -0C00Rx; -0C. { 0) N (Rx) 2; -N (RX) 2; -S (0) 2Rx and -NRxC (0) Rx wherein, each time Rx occurs, it is independently hydrogen, substituted aliphatic, unsubstituted aliphatic, substituted aryl or unsubstituted aryl. Additionally, substitutions in adjacent groups in a portion together may form a cyclic group. The term "antagonist" is used in its broadest sense and includes any ligand that blocks, inhibits or neutralizes, partially or completely, a biological activity displayed by an objective such as a TBM. In a similar manner, the term "agonist" is used in the broadest sense and includes any ligand that mimics the biological activity shown by an objective, such as a TBM, for example by specifically changing the function or expression of such TBM or the effectiveness or signaling towards such TBM, by which it alters (increases or inhibits) an existing biological activity in advance or activates a new biological activity. The term "ligand" refers to an entity that has a binding affinity measurable by the target. In general, a ligand is said to have a measurable affinity if it binds to the target with a K o or a ¾ less than about 100 mM, preferably less than about 10 mM, and much more preferably less than about 1 mM . In preferred embodiments, the ligand is not a peptide and is a small molecule. A ligand is a small molecule which is smaller than a size of about 200 daltons, usually of a size less than about 1500 daltons. In more preferred embodiments, the small molecule ligand is less than a size of about 1000 daltons, usually less than a size of about 750 daltons, and more commonly less than a size of about 500 daltons. The term "candidate ligand" refers to a compound that possesses or has been modified to possess a reactive group that is capable of forming a covalent bond with -7- a complementary or compatible reactive group on a target. The reactive group in the candidate ligand or target can be marked, for example, with a protective group. The term "polynucleotide" when used in singular or plural, generally refers to any • polyribonucleotide or polydeoxyribonucleotide which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for example, polynucleotides, as defined herein, include, without limitation, single or double stranded DNA, DNA that includes single or double stranded regions, single or double stranded RNA, and RNA that includes single stranded regions or doubles, hybrid molecules comprising DNA and RNA which can be single-stranded or, more commonly, double-stranded or include regions with single and double chains. In addition, the term "polynucleotide" as used herein, refers to triple chain regions consisting of RNA or DNA or both RNA and DNA. The chains in such regions can be from the same molecule or from different molecules. The regions may include all or one or more of the molecules, but more commonly they involve only a region of some of the molecules. One of the molecules of a triple helical region is often an oligonucleotide. The term "polynucleotide" specifically includes DNAs and RNAs that contain one or more 8-modified bases. In this manner, the DNAs or RNAs with major structures modified for stability or for other reasons are "polynucleotides" as intended by the term herein. In addition, RNAs or DNAs comprising uncommon bases such as inosine, or modified bases, such as tritylated bases, are included within the term "polynucleotides", as defined herein. In general, the term "polynucleotide" encompasses all chemically, enzymatically or metabolically modified forms or unmodified polynucleotides as well as the chemical forms of DNA and RNA characteristic of viruses and cells that include simple and complex cells. The phrase "protected thiol" as used herein, refers to a thiol that has reacted with a group or a molecule to form a covalent bond that renders it less reactive and which may be deprotected to regenerate a free thiol. The phrase "reversible covalent bond," as used herein, refers to a covalent bond that has been broken, preferably under conditions that do not denaturate the target. Examples include, without limitation, disulfides, Schiff's bases, thioesters, coordination complexes, boronate esters, and the like. The phrase "reactive group" is a group or chemical moiety that provides a site in which a covalent bond can be made when present with a compatible or complementary reactive group. Illustrative examples are -SH which can react with another -SH or with -SS- to form a disulfide; an -NH2 which can react with an activated -COOH to form an amide; an -NH2 which can be reacted with an aldehyde or ketone to form a Schiff base, and the like. The phrase "reactive nucleophile" as used herein, refers to a nucleophile that is capable of forming a covalent bond with a compatible functional group on another molecule under conditions that do not denaturate or damage the target. The most relevant nucleophiles are thiols, alcohols and amines. Similarly, the phrase "reactive electrophiles," as used herein, refers to an electrophile that is capable of forming a covalent bond with a compatible functional group on another molecule, preferably under conditions that do not denature or impair any another way to the objective. The most pertinent electrophiles are imines, carbonyls, epoxides, aziridines, sulfonates, disulfides, activated esters, activated carbonyls and hemiacetals. The phrase "site of interest" refers to any site on a target to which a ligand can be attached. For example, when the target is an enzyme, the site of interest may include amino acids that make contact with, which are within about 10 Angstroms, (most preferably within about 5 Angstroms) of a bound substrate, inhibitor, activator, cofactor or allosteric modulator of the enzyme. When the enzyme is a protease, the site of interest includes a substrate binding channel from S6 to S6 ', residues involved in catalytic function (eg, the catalytic triad and the oxy-anion hole) and any cofactor (eg metal such as Zn) of the binding site. When the enzyme is a protein kinase, the site of interest includes the substrate binding channel in addition to the ATP binding site. When the enzyme is a dehydrogenase, the site of interest includes the substrate binding region as well as the site occupied by NAD / NADH. When the enzyme is a hydralase such as PDE4, the site of interest includes the residues in contact with cAMP as well as the residues involved in the binding of the catalytic divalent cations. The terms "objectives", "target molecule" and "TM" (for its acronym in English) are used interchangeably and in its broadest sense, and refer to a chemical or biological entity for which the binding of a ligand has an effect on the function of the objective. The target can be a molecule, a portion of a molecule or an aggregate of molecules. The binding of a ligand can be reversible or irreversible. Specific examples of target molecules include polypeptides or proteins such as enzymes and receptors, transcription factors, ligands for receptors such as growth factors and cytokines, immunoglobulins, nuclear proteins, signal transduction components (eg kinases, phosphates). ), | Polynucleotides, carbohydrates, glycoproteins, glycolipids or other macromolecules such as nucleic acid-protein complexes, chromatin or ribosomes, structures containing lipid bilayers such as membranes or membrane-derived structures, such as vesicles. The definition specifically includes the target biological molecules ("TBM") as defined in the following: A "target biological molecule" or "TBM", as used herein, refers to a unique biological molecule a or a plurality of biological molecules capable of forming biologically relevant complexes together for which a small molecule agonist or antagonist has an effect on the function of the TBM In a preferred embodiment, the TBM is a protein or a portion thereof comprising two or more amino acids and which possess or are capable of being modified to possess a reactive group that is capable of forming a covalent bond with a compound having a complementary reactive group Preferred TBMs include: cell surface and soluble receptors and their ligands; steroid receptors; hormones; - 12 - immunoglobulins; coagulation factors; nuclear proteins; transcription factors; signal transduction molecules; cell adhesion molecules, co-stimulatory molecules, chemokines, molecules involved in mediating apoptosis, enzymes and proteins related to the synthesis or degradation of DNA or RNA. Many TBMs are those that precipitate in a receptor-ligand binding interaction and that can be any member of a receptor-ligand pair. Illustrative examples of growth factors and their respective receptors include those for: erythropoietin (EPO), thrombopoietin (TPO), angiopoietin (AG), granulocyte colony stimulating factor (G-CSF), factor macrophage and granulocyte colony stimulator (GM-CSF), epidermal growth factor (EGF), heregulin-a and heregulin-β, vascular endothelial growth factor (VEGF, for its acronym in English), placental growth factor (PLGF), transforming growth factors (TGF-a and TGF-β), nerve growth factor (NGF, for its acronym in English) its acronyms in English), neurotrofinas, fibroblast growth factor (FGF, for its acronym in English), platelet-derived growth factor (PDGF, for its acronym in English), bone morphogenetic protein (BMP, by its acronym in - 13 - English), fact connective tissue growth factor (CTGF), hepatocyte growth factor (HGF), and insulin-like growth factor-1 (IGF-1) . Illustrative examples of hormones and their respective receptors include those for: growth hormone, prolactin, placental lactogen (LPL), insulin, follicle stimulating hormone (FSH), luteinizing hormone (LH, for its acronym in English), and neurokinin-1. Illustrative examples of cytokines and their respective receptors include those for: ciliary neurotrophic factor (CNTF), oncostatin M (OSM, for its acronym in English), TNF-a; CD40L, pluripotent cell factor (CSF, for its acronym in English); interleukin-1, interleukin-2, interleukin-4, interleukin-5, interleukin-6, interleukin-8, interleukin-9, interleukin-13 and interleukin-18. Other TBMs include: cell adhesion molecules such as CD2, CDlla, LFA-1, LFA-3, ICA-5, VCAM-1, VCAM-5 and VLA-4; costimulatory molecules such as CD28, CTLA-4, B7-1; B7-2, ICOS and B7RP-1; chemokines such as RANTES and MlPlb; factors for apoptosis such as APAF-1, p53, bax, bak, bad, bid and c-abl; anti-apoptotic factors such as bcl2, bcl-x (L) and mdm2; transcription modulators such as AP-1 and A? -2; signaling proteins such as TRAF-1, TRAF-2, TRAF-3, TRAF-4, TRAF-5 and TRAF-6; and adapter proteins such as grb2, cbl, shc, nck and crk. Enzymes are another class of preferred TBM and can be classified in numerous ways including: allosteric enzymes, bacterial enzymes (isoleucyl tRNA synthase, peptide deformylase, DNA gyrase and the like); mycotic enzymes (thymidylate synthase and the like); viral enzymes (HIV integrase, HSV protease, hepatitis C helicase, hepatitis C protease, rhinovirus protease and the like), kinases (serine / threonine, tyrosine and double specificity); phosphatases (serine / threonine, and double specificity); and proteases (aspartil, cysteine, metallo and serine proteases). Notable secondary classes of enzymes include: kinases such as Lck, Syk, Zap-70, JAK, FAK, ITK, BTK, EK, MEK, GS-3, Raf, kinase-1 activated by tgf-β (TAK-1) , PAK-1, cdk4, akt, PKC T, IKK ß, IKK-2, PDK, ask, nik, APKAPK, p90rsk. p70s6k and PI3-K (subunits p85 and pllO); phosphatases such as CD45, LAR, RPTP-a, RPTP-μ, Cdc25A, kinase-associated phosphatase, MAP kinase phosphatase-1, PTP-1B, TC-PTP, PTP-PEST, SHP-1 and SHP-2; caspases such as caspases -1, -3, -7, -8, -9 and -11; and cathepsins such as cathepsins B, F, K, L, S and V. Other enzymatic targets include: BACE, TACE, cytosolic phospholipase A2 (cPLA2), PARP, PDE I-VIII, Rac-2, CD26, inosine monophosphate dehydrogenase, 15-lipoxygenase, -15-acetyl CoA carboxylase, adenosylmethionine decarboxylase, dihydrootate dehydrogenase, leukotriene A4 hydrolase and nitric oxide synthase. Variants of TBM The present invention relates generally to variants of biological target molecules ("TBM") and to methods for the preparation and use thereof to identify ligands of TBM. In preferred embodiments, the TBMs are proteins and the variants are cysteine mutants thereof wherein a non-cysteine residue that occurs naturally from a TBM is mutated into a cysteine residue. The non-native cysteine provides a reactive group on the TBM for use in the association. The association is a ligand identification method that is based on the formation of a covalent bond between a reactive group on a target and a complementary reactive group on a potential ligand, and is described in the patent of E.U.A. No. 6,335,155, PCT Publication Numbers WO 00/00823 and O 02/42773, Earlson et al., Proc. Nati Acad. Sci. USA 97: 9367-9372 (2000) and in the patent of E.U.A. serial number 10 / 121,216 entitled METHODS FOR LIGAND DISCOVERY by the inventors Daniel Earlson, Andrew Braisted, and James Wells (corresponding PCT application number US02 / 13061). The resulting covalent complex is termed a target-ligand-16 conjugate. Because a covalent bond is formed at a predetermined site in the target (e.g. a native or non-native cysteine), the stoichiometry and binding site for the ligands that are identified by this method are known. Once formed, the ligand portion of the target-ligand conjugate can be identified using many methods. In the preferred embodiments, mass spectroscopy is used. The target-ligand can be detected directly in the mass spectrometer or it can be fragmented before detection. Alternatively, the ligand can be liberated from the target-ligand conjugate within the mass spectrophotometer and can subsequently be identified. In other embodiments, alternative detection methods are used that include but are not limited to: chromatography, labeled probes (fluorescent, radioactive, etc.), nuclear magnetic resonance ("RM"), surface plasmon resonance (eg, BIACORE) , capillary electrophoresis, X-ray crystallography and the like. In other additional embodiments, functional assays can also be used when binding occurs in an essential area for which the assay is measured. In Figure 1 a schematic representation of an embodiment of the association method is shown wherein the target is a protein and the covalent bond is a -17-disulfide. A protein containing thioi is reacted with a plurality of candidate ligands. In this embodiment, the candidate ligands possess a masked thiol in the form of a disulfide of the formula -SSR1 wherein R 1 is unsubstituted alkyl of 1 to 10 carbon atoms, alkyl of 1 to 10 carbon atoms substituted, unsubstituted aryl or substituted aryl. In some embodiments, R1 is selected to improve the solubility of potential candidate ligands. As shown, a candidate ligand is identified that possesses an inherent binding affinity for the target and a corresponding ligand is produced that does not include in the disulfide portion, which comprises the identified binding determinant (represented by the circle. illustrates two representative association experiments with a target enzyme, E. coli thymidylate synthase, which is contacted with the candidate ligands of the formula wherein Rc, is the variable portion among this accumulated library members and an unsubstituted aliphatic, substituted aliphatic, unsubstituted aryl or substituted aryl. Like all enzymes TS, TS of E. - 18 - coli has an active site cysteine (Cysl46) that can be used for association. Although E. coli TS also includes four other cysteines, these cysteines are buried and have been found not to be reactive in association experiments. For example, in an initial experiment with TS of wild-type E. coli and the mutant C146S (where the cysteine has been mutated at position 146 by serine), when contacted with cystamine H2NCH2CH2S SCH2CH2NH2. The wild type TS enzyme reacts cleanly with an equivalent of cystamine while the TS mutant does not react indicating that the cystamine has reacted with, and is selective for, Cysl46. Figure 2? is a mass spectrum without convolutions of the TS reaction with an accumulated of 10 different candidate ligands with little or no binding affinity for TS. In the absence of any binding interaction, the equilibrium in the disulfide exchange reaction between TS and an individual candidate ligand is to the unmodified enzyme. This is illustrated schematically by the following equation: As expected, the peak corresponding to the unmodified enzyme is one of two most prominent peaks in the spectrum. The other prominent peak is TS when the thiol Cysl 6 has been modified with cysteamine. Although this species is not formed to a significant degree for any individual library member, the peak is due to the cumulative effect of the equilibrium reactions for each member of the library accumulated. When the reaction is carried out in the presence of a thiol-containing reducing agent such as 2-mercaptoethanol, the cysteine in the active site can also be modified with the reducing agent. Because cysteamine and 2-mercaptoethanol have similar molecular weights, their respective disulfide linked TS enzymes are not differentiable under the conditions used in this experiment. The small peaks on the right correspond to separate library members. Notably, none of these peaks is very prominent. Figure 2A is characteristic of a spectrum in which none of the candidate ligands possesses an inherent binding affinity for the target. Figure 2B is the unconverted mass spectrum of the TS reaction with an accumulation of 10 different candidate ligands wherein one of the candidate ligands possesses an inherent binding affinity for the enzyme. As can be seen, the most prominent peak is one corresponding to TS where the thiol of Cysl 6 has been modified with the compound N-tosyl-D-proline. This peak reduces all others including those corresponding to the unmodified enzyme and to TS when the thiol of Cysl46 has been modified with cysteamine. Figure 2B is an example of a mass spectrum -20- where an association has retained a portion possessing a strong inherent binding affinity for the desired site. The representative association experiments of Figure 2 are performed in a TBM that already has a cysteine that occurs naturally at the site of interest (Cysl 6 which is found in the active site of the E. coli TS enzyme). However, because TBMs do not always possess a cysteine that occurs naturally at or near the site of interest, the present invention provides variants of cysteine mutants of TBM as well as methods for their preparation. Therefore, in one aspect of the present invention, there is provided an assembly comprising at least one cysteine mutant of a TBM protein, wherein the non-cysteine residue that occurs naturally at or near the site of interest is mutated to a cysteine residue. In one embodiment, the set comprises a plurality of cysteine mutants of a TBM protein wherein each mutant has a different cysteine residue, which occurs natur, differently, which mutates to a cysteine residue. In another embodiment, the pool comprises at least three cysteine mutants of a TBM protein, wherein each mutant has a different cysteine residue that occurs natur, differently, that has mutated to a cysteine residue. In another additional embodiment, the pool comprises at least 21 - five cysteine mutants of a TBM protein, wherein each mutant has a different cysteine residue that occurs natur, differently, that has mutated to a cysteine residue. In a further embodiment, the pool comprises at least 10 cysteine mutants of a TBM protein, wherein each mutant has a different cysteine residue which occurs natur, differently, which has mutated to a cysteine residue. In another aspect of the present invention, methods are provided for identifying residues that are suitable for mutation in cysteines. In preferred embodiments, a model of an experiment derived three-dimensional structure (e.g. X-ray or three-dimensional MRI) of a TBM is used to help identify residues that are suitable for mutation in cysteines. If a structure of the TBM of interest is not available, then it can be used as a replacement. Once the appropriate residues have been identified using the replacement structure, then methods known in the art are used, such as sequence alignment to identify the corresponding residues in the TBM of interest. In general, the methods described in the following for identifying suitable residues to mutate into cysteines are those that can be used, alone or in any combination with each other. In one method, the conformation of the local main structure of a candidate residue is determined and a search is performed on a database of experiment resolved structures for examples of a disulfide-linked cysteine having a local backbone conformation. equal or similar to the candidate residue. Any combination of atoms of the main structure of residues (N, Cai C and O) can be used to determine the local conformation. The probability that TBM accepts the cysteine mutation will improve as more examples are found in a database of the known disulfide-linked cysteines, in a conformation of the same or similar local main structure. Experiment resolved structures are available from many sources including the Protein Databank ("PDB"), which can be found on the internet at htt: // ww. rcsb. or and the protein structure database which can be found on the internet at http: // www .pcs. com. The lists of high resolution protein chains (grouped by structures that have a certain resolution and R factor) can be used to compile a database of experiment resolved structures found on the internet at http: // www. fccc. edu / research / labs / dunbrack / culledpdb.html. In general, the local environment of a candidate residue includes the candidate residue itself and at least one residue preceding or following the candidate residue in the sequence. It is considered - 23 - that a conformation is the same or similar if the mean square deviation of the root (RMSD ") of the atoms being compared is less than or equal to about 1.0 Angstroms2, more preferably , less than or equal to about 0.75 Angstroms2, and even more preferably less than or equal to about 0.5 Angstroms.2 In one embodiment, the method comprises: a) obtaining a set of coordinates of a three-dimensional structure of a TBM protein that has number of waste; b) selecting a candidate residue i in the three-dimensional structure of the TBM where the candidate residue i is the i th residue where i is a number between 1 and a, and residue i is not a cysteine; c) selecting a residue j in which the residue j is adjacent to the residue i in the sequence; d) determining a candidate reference value where the candidate reference value is a spatial relationship between the remainder i and the remainder j; e) obtaining a database comprising the sets of coordinates of disulfide-containing protein fragments wherein each fragment comprises at least one disulfide-linked cysteine and a first adjacent residue wherein the disulfide-linked cysteine and the first 24 - adjacent residue share the same sequential relationship as residue i and residue j; f) determining a comparative reference value for each fragment in which the comparative reference value is the corresponding spatial relationship between the disulfide-linked cysteine and the first adjacent residue as the candidate reference value is between residue i and j; and g) determining a rating when the rating is a measure of the number of fragments in the database that has a comparative reference value that is the same or similar to the candidate reference value. In another embodiment, the method further comprises: selecting a residue k wherein the residue k is adjacent to the residue i in the sequence and k is not j; and wherein the candidate reference value is a spatial relationship between the residue i, the residue j and the residue k; each fragment comprises at least one disulfide-linked cysteine, a first adjacent residue and a second adjacent residue wherein the disulfide-linked cysteine and the first and second adjacent residues share the same sequence relationship as residue i, residue j and residue k; and the comparative reference value is the corresponding spatial relationship between the disulphide-bound cysteine, the first adjacent residue and the second adjacent residue as the candidate reference value is between the residue i, - 25 - residue j and residue k. In another embodiment, the method comprises: a) obtaining a set of coordinates of a three-dimensional structure of a TB protein having n number of residues; b) selecting a candidate residue i in the three-dimensional structure of the TBM where the candidate residue i is the i th residue where i is a number between 1 and n, and residue i is not a cysteine; c) selecting a residue j and the residue k where the residue j and the residue k are both adjacent in the sequence with respect to residue i; d) determining a candidate reference value where the candidate reference value is a spatial relationship of at least one atom of the main structure from each of the residues i, residue j and residue Je; e) obtaining a database comprising the sets of coordinates of disulfide-containing protein fragments wherein each fragment comprises at least one disulfide-linked cysteine, a first adjacent residue and a second adjacent residue wherein the cysteine attached to disulfide, the first adjacent residue and the second adjacent residue share the same sequential relationship as the residue i, the residue j and the residue k; f) determining a comparative reference value - 26 - for each fragment where the comparative reference value is the corresponding spatial relationship between the disulfide-bound cistern, the first adjacent residue and the second adjacent residue as the candidate reference value is between the residue i, the residue j and the residue k; and g) determining a rating where the rating is a measure of the number of fragments in the database that have a comparative reference value that is the same or similar to the candidate reference value. In another embodiment, the spatial relationship comprises a dihedral angle. In another additional modality, the spatial relationship comprises a pair of angles f? In another embodiment, the spatial relationship comprises a distance between atoms of two residues. An illustrative example of a computer algorithm for identifying disulfide-linked pairs in a database such as the PDB and matching them to a residue that is a candidate for the cysteine mutation is described in example 1. In another method, a site of interest on the TBM is defined and the appropriate residues for cysteine mutation are identified based on the position of the residue from the site of interest. In one embodiment, a suitable residue is a different cysteine residue that is located within the site of interest. In another embodiment, a suitable residue is a different cysteine residue that is within -27- about 5 A from the site of interest. In another additional embodiment, a suitable residue is a different cysteine residue that is located within about 10 Á of the site of interest. For the purposes of these measurements, any different cysteine residue having at least one atom that is within about 5 Á to about 10 Á, respectively from any of the atoms of an amino acid within the site of interest, is a residue suitable to mutate to a cysteine. A TBM may have one or several sites of interest. In some cases, a TBM has a site of interest and the set of residues that are each mutated to a cysteine are grouped around this site of interest. In other cases, a TBM has at least two different sites of interest and the set of residues that are each mimicked to a cysteine are clustered around at least two different sites of interest. In other cases, the TBM does not have a different site of interest or has multiple sites of interest such as the set of residues that are mutated to a cysteine that is dispersed through the protein surface. Figure 3 shows three illustrative examples of the distribution pattern of the residues in which they each mutate to a cysteine. In another method, accessibility to the solvent for each different cysteine residue of a TBM is calculated and used to identify residues suitable for mutation of -28-cysteine. The accessibility of solvent can be calculated using any number of known methods that include standard numerical methods (Lee, B. &; Richards, F. M. J. Mol. Biol 55: 379-400 (1971); Shrake, A. & Rupley, JA J. "Mol. Biol. 79: 351-371 (1973)) and analytical methods (Connolly, ML Science 221_709-713 (1983); Richmond, TJJ Mol. Biol. 178: 63-89 (1984)) In one embodiment, the residues suitable for mutation include residues wherein the combined surface area of the residue atoms is equal to or greater than about 20 A. In another embodiment, the residues suitable for mutation include residues wherein the combined surface area of the residue atoms are equal to or greater than about 30 A. In yet another embodiment, the residues suitable for mutation include residues wherein the combined surface area of the waste atoms is equal to or greater than about 40 ° 2. In another method, the residues suitable for mutation to cysteine are identified by hydrogen bond analysis In one embodiment, a suitable residue is a non-cysteine residue that does not participate in any hydrogen bonding interaction. In another embodiment, a suitable residue is a different residue of cysteine whose side chain does not participate in any hydrogen binding interaction. In another additional embodiment, a suitable residue is a different cysteine residue whose non-29- side chain participates in a hydrogen bonding interaction with a main structure atom. In another method, the residues suitable for cysteine mutation are identified by rotamer analysis. In one embodiment, the method comprises: a) obtaining a three-dimensional structure of a TBM having a number of residues and a site of interest; b) selecting a candidate residue i that is at or near the site of interest where the candidate residue i is the i th residue where i is a number between 1 and n and residue i is not a cysteine; c) generate a set of mutated TBM structures in which each mutated TBM structure has a cistern residue instead of residue i and where the cistern residue is placed in a standard rotamer conformation; and d) evaluate the set of mutated TBM structures. In another embodiment, a standard rotmer cistern conformation comprises a set of cistern rotamers listed by Ponders and Richards as described by Ponder, J. and Richards, F. M. J. Mol. Biol. 193: 775-791 (1987). In another embodiment, a standard rotamer conformation for cysteine comprises an angle ?? which is selected from the group consisting of about 60 °, about 180 ° and about 300 ° and an angle 2 2 selected from the group consisting of about 60 °, about 120 °, about 180 °, about 270 ° and approximately 300 °. In another embodiment, the method further comprises determining whether the remainder i is part of a helix or a β-sheet and then selecting a standard rotamer conformation based on the assigned secondary structure. As shown in Figure 4, a different set of rotamers is preferred based on the secondary structure that is assigned to the cysteine. It is considered that the residue i is part of a helix a if the angles f? of the residuals i-1, i and i + 1 are approximately 300 + 30 ° and 315 + 30 ° respectively and it is considered to be part of a sheet ß if the angles f? of residues i - 1, i and i + l are approximately 240 ^ _ 30 ° and 120 + 30 °. If the residue i is part of a helix a, then the conformation of the standard rotamer for cysteine comprises a pair? 2 which is selected from the group consisting of approximately 180 ° and approximately 50 °; approximately 180 ° and approximately 270 °; and approximately 300 ° and approximately 300 °. In another modality, a set of imitated TB structures are evaluated based on whether a sterile sterile contact has been made. A residue is considered to be a suitable candidate for cysteine mutation if it can be substituted with at least one cysteine rotamer for which unfavorable steric contact is not made. An unfavorable steric contact is defined as interatomic distances that are less than about 80% of the sum of the van der Waals radii of the participating atoms. In a variation, only the atoms of the main structure of TBM are considered for the purposes of determining whether the rotamers make unfavorable contact with the TBM. In another variation, the atoms of the main structure and Cp of the TBM are considered for purposes of determining whether the rotamers establish an unfavorable contact with the TBM. In another modality, the set of mutated TBM structures are evaluated based on a force field calculation. Illustrative force field methods are described, for example, in einer, S. J. et al. J. Comput. Chem. 7: 230,252 (1986); Nemethy, G. et al., J. Phys. Chem. 96: 6472-6484 (1992 (and Brooks, BR et al., J. Comput, Chem. 4: 187-217 (1983).) All conformations minimized. within about 10 kcal / mol, or more preferably within about 5 kcal / mol of the lower energy conformation are considered to be accessible In another embodiment, each mutated TBM structure possesses a cysteine that is topped (which has at the end ) an S-methyl group (the side chain is -CH2SSCH3) instead of residue i, and where the cysteine capped residue is placed in a standard rotamer conformation for cysteine.A residue is considered a suitable candidate for mutation - 32 - cysteine if it can be substituted with at least one rotamer that places the methyl carbon of the S-methyl group closer to the site of interest compared to Cg. In addition to adding one or more cysteines to a site of interest, it may be desirable to suppress one or more tanks that are presented by natural anera (and replace them with alanines, for example) that are located outside the site of interest. These mutants, wherein one or more naturally occurring cysteines are deleted or "deleted" comprises another aspect of the present invention. Various recombinant, chemical, synthetic or other techniques can be used to modify a target so that it possesses the desired amount of free thiol groups that are available for association. Such techniques include, for example, site-directed mutagenesis of the nucleic acid sequence encoding the target polypeptide so that it encodes a polypeptide with a different number of cysteine residues. Site-directed mutagenesis using polymerase chain reaction (PCR) amplification is particularly preferred (see, for example, U.S. Patent No. 4,683,195 issued July 28, 1987, and Current Protocols In Molecular Biology, chapter 15 (Ausubel et al., Ed., 1991) Other techniques of site-directed mutagenesis are also known in the art and are described, for example, in the following publications: Ausubel et al., Supra, - 33 - Chapter 8, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989), Zoller et al., Methods Enzyraol 100: 468-500 (1983), Zoller &Smith, DNA 3: 479-488 (1984), Zoller et al., Nucí Acids Res., 10: 6487 (1987), Brake et al., Proc. Nati, Acad. Sci. USA 81: 4642-4646 (1984) Botstein | et al., Science 229: 1193 (1985), Kunkel et al., Methods Enzymol 154: 367-82 (1987), Adelman et al., DNA 2: 183 (1983), and Carter et al., Nuci Acids Res. 13: 4331 ( 1986). Cassette mutagenesis (Wells et al., Gene, 34: 315

[1985]), and restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317: 415

[1986]). Variants of amino acid sequences with more than one amino acid substitution can be generated in one of several ways. If the amino acids are located close together in the polypeptide chain, they can be mutated simultaneously, using an oligonucleotide that codes for all of the desired amino acid substitutions. However, if the amino acids are located at a distance from each other (for example, separated by more than 10 amino acids), it is more difficult to generate a single oligonucleotide that codes for all the desired changes. Instead, one of two alternative methods can be used. In the first method a separate oligonucleotide is generated for each amino acid to be replaced. The oligonucleotides are then annealed (matured) - 34 - with the single-stranded DNA template simultaneously and the second DNA strand that is synthesized from the template will code for all of the desired amino acid substitutions. The alternative method involves two or more rounds of mutagenesis to produce the mutant that is desired. The invention is further illustrated by the following non-limiting examples. Unless otherwise indicated, all standard molecular biology procedures are performed in accordance with the protocols described in (Molecular Cloning: A Laboratory Manual, volumes 1-3, edited by Sambrook, J., Fritsch, EF, and Maniatis, T., Cold Spring Harbor Laboratory Press, 1989; Current Protocols in Molecular Biology, volumes 1-2, edited by Ausbubel, F. , Brent, R., Kingston, R., Moore, D., Seidman, J.G. Smith, J., and Struhl, K., Wiley Interscience, 1987). EXAMPLE 1 This example provides an illustrative computer algorithm written in FORTRAN to identify disulfide pairs from the PDB that are aligned with potential association mutants. A step description of the program and the source code are described below. First, a user provides the name of the PDB file for the template protein, the fragment residues that match and the relative position of the cistern within said fragment. Preferred values are 1-2-35 - terminal N and C residues relative to the potential mutant site. For example, if the Glu 200 residue of PTP1B is a candidate residue, then the user must specify the fragment from residues 198 to 202 with the cysteine in relative position 3. Second, the program reads the template file, extracts the coordinates of the atoms N, Cai C, O for the residues of the template and determines the values of cp (torsion C'-N-Cc-C) and? (N-Ca-C-N ') for each of the template residues. Third, the program generates a "waste filter" based on the values f /? of template. This filter is used to identify contiguous segments of a test protein that have f /? Values. that they coindise with the template residuals within a coarse tolerance (+ 60 °). The filter also requires that the fragment must contain a cysteine in the appropriate position. In the above PTP1B example, the filter will identify fragments of 5 residues of a test protein that generally coincide with the conformations of the main structure of residues 198-202 of PTP1B and that contain a cysteine in the 3-position. Instead, the rest of the program operates repetitively on a list of test proteins provided by the user that are provided in a simple text file. In one mode, this file contains - 36 - approximately 2500 accumulated PDB chains. For each test structure: a) The program reads the coordinates, determines the sequence and the values cp /? for each residue and identify any contiguous chain that matches the residue filter • specified in step (3). b) The program checks to determine that the cysteine residue in this fragment is participating in a disulfide bond. This is done by a simple search based on distance and angle from the SY atom. Fragments containing unpaired cysteines are rejected. c) For each fragment, the N, Ca, C, 0 atoms of the main structure are superimposed on the corresponding atoms of the template molecule (for example 198-202 of PTP1B). If the structure matches an RMSD within a tolerance specified by the user (usually 0.5- 0.75 A), the overlap coordinates of the fragment together with its disulfide binding partner are written to a file in PDB format. A log file of each "hit" is maintained along with its RMSD value. Successes are observed with a graphic program such as Insight II or PyMOL.

Source code p c parameter (MAX_HITS - 10000) c $ INCLÜDE tk.inc $ INCL0DE tk_function3.iac SINCLÜDE rsm.inc $ INCLDDE ram_functioas. inc c Record / hndl_rec / data_handle, fragment_handle, template_handle Record / atora_rec / AtoraRec Record / res_rec / ReeRec Record / reB_filter / FragtnentFilter (MAX_RMS_ATOMS), TemplateFilter (MAX_RMS_ATOMS) Record / vec / TemplateVecArray, FragmentVecArray, TI, T2 TeraplateVecftrray Dimension (MaX_BMS_ATOMS) , FragmentVecArra (MAX_RMS_ATOMS) ~ c Integer * 4 numTemplateRes, TemplateResList (MAX_HITS), numHitRes, HitResList (MAX_HITS), numTemplateVec, Cyslndex, Framelndex, numSS, SS_1 (MAX_RSS), SS_2 (MAX_RES),. rain_element, max_element, aunares, icnt, jcnt, numFragAtom, FragAtomList (AX_RBS), FragAtomIndex (MAX_RES), irea, jres, lcye, cys_idx, jcys, iatom, jatom, LISTin, PDBout, LOGout, len_name, len_root Real * S temp_min, temp_max, R2 [3i 3), RMS_c toff, RMS_value, RMS_WT (MAX_RES), angle_tol ~ ~ ~ Character listfile ^ BO, full_name * 80, file_path * 80, file_name * 80, file_root * 80, file_ext * 80, structuxe_name * 15 , full_Etr cture_name * 23, first_resnumber * 7, charl * l, char3 * l, tline * 80, token * B0 c LISTin »9 PDBout - 10 LOGout - 11 Framelndex» 1 RMS_CUtOff »0.5 angle_tol« SO. do ires = 1, MAX_RES RMS_WT (ires) - 1.0 end do c c ... Qet témplate information. c write (6, '(/,' 'Enter témplate PDB filename:' ', $)') read (5, 1 (a) ') tline if (.not.readEDBFile (tline, template handle)) then write ( e, · ('' ERROR: ünable to read témplate PDB file * »» ** ") |.}. retum end if if (get_num_total_residueB <template_handle, im_res)) continue c ... get témplate rea due numbers and convert to residue indeces 10 write (S, '(5x,' 'Enter beginning, ending témplate residues:' ', $)') read (S, '(a)') tline if (.not .get_toke (tline, token) ) goto 10 do icnt «.1, num_res if (getResData (teraplate_handle, Framelndex, icnt, ResRec)) continue if (ljust (ResRec. residue_number]) continue if (compstr ResRec.residue_number, token)) then ires - icnt goto 20 end if end do write (S, 1 <"ERROR: ünable to fiad residue", a50) ') token goto 10 20 if (.not.get_tokea (tline, token)) goto 10 do icnt «1, num_res if (getResData (template_haiidle, Framelndex, icnt, ResRec)) continue if (Ijust (ResRec.res idue_number) continue if (compstr (ResRec, residue_number, token)) then jres »icnt goto 30 end if end do write (S, '(" ERROR: Unanle to find residue ".aSO) 1) token goto 10 30 contin é c numTemplateRes - jres - ires + 1 do icnt > 1, numTemplateRes TemplateResList (icnt) - ires + icnt-1 end do if (numTemplateRes .eq. 11 then cys_idx "i else write (6, '(5x, 1' Enter relative position of systeine: '', $) ') read (5, *) cy _idx end if write (6, '(Sx, 1' Enter the RMS cutoff: '' ·, $) ') read (5, *) KMH_cutoff c c ... Collect template residue atoms for fitting (N / CA / C / O). c numTemplateVec = 0 do icnt - 1, numTemplateRes ires «TemplateResList (icnt) if (.not.getAtomOfRes (teraplate_handle, Framelndex, ires, '?', AtomRec)) then write ( 6, "(" ERROR: Dnable to get N of témplate residue * ', i4)') ires cali exit else numTemplateVec | numTemplateVec + 1 TemplateVecArray (numTemplateVec) | AtomRec .vector end if if (.no. GetAtomOf is Íteraplate_handle, Pramelndex , ires, 'CA', AtomRec)) then write (6, '(' 'ERROR: Una le to get CA of témplate residue 1', i4) ')' ires cali exit else numTemplateVec 'numTemplateVec + 1 TemplateVecArray (numTemplateVec) - AtomRec .vector end if if (.not. getAtomOf is (template_handle, Framelndex, ires, 'C, AtomRec)) then - 39 - write (6, '(1' ERROR: Unable to get C of teamplay residue '', i4] ') ires cali exit else nuraTemplateVec = numTemplateVec + 1 TemplateVecArray (numTemplateVec) * AtomRe :: .vector end if if (. not. getAtomOfKea (templafce_handle, Pramelodex, ires,? ', Aton-Rec)) then write (6,' ('' ERROR: Unable to get 0 of témplate residue '1, i4]') ires cali exit else nurnTemplateVec «numTemplateVec + 1 TemplateVecArray (numTetnplateVec) »AtomRec .vector end if end do c c ... Construct residue filter based on iuternal angles from the témplate, c if (.not. initializeResFilter (FragtnentPiÍter, MAX_RMS_ATOMS)) then write (6, '(2X,' 'ERROR: Unable to make res due-filter record' 1) ') cali exit end if FragmentFilter (1). seq_len «numTemplateRes FragmentFilter (1). start_residue »2 do icnt - 1, imTentplateRes ires = TemplateResList (icnt) if (.not.GetResData (template_handle, Framelndex, ires, ResRec)) tnen write (6, 1 ('' ERROR: Unable to get record for residue 1 ' , i4) ') ires cali exit end if FragmentFilter (icnt) .phi_val «ResRec .phi_val FragmentFilter (icnt) .p i_tol« angle_tol FragmentPilter (icnt) .psi_val »ResRec .psi_yal FragmentFilter (icnt) .pei_tol - angle_tol end do FragmentFilter (cys_idx) .residue_nanie »'CYS' if (retumTraj ectory ltemplate_handle)) continue cali getenv (1 SM_PDB_LISTFILE ', listfile) if (listfile.eq.1') then write (S, '(/,'" Enter structure listfile: '', 5 read (5, 'la) ·) listfile end if open (file »listfile, unit» LISTin, status- "old") write (6,' (/, · 'Enter output logfile:' ', $ ) ') read (S,' (a) ') tline open (file «tline, unit» LOGout, status »" unknown ") write (6,' ('' Enter output PDBfile:", S >; ') read (5,' (a) ') tline open (file-tline, unit »PDBout, status» "unknown") .Main loop read (LISTin,' (a) ', en'999) full_name if (£ ull_name (1: 1) -eq. '#') goto 50 - 40 - if (paxse_filename (full_name, file_path, file_name, file_root, file_ext)) continue le.i_.iame - index (file_root, 1 ') - 1 c if (.not.readPDBFile (full_aame, data_haadle)) t ea write [S, 1 I2X, '' «* ü_able to read PDB file'1) ') go to 100 end if c c ... Select only fragments contaioing cysteines . c if (selectResByFilter (data_handle, Framelndex, FragmentFilter, nuraHitRes, HitReaList)) continue if (nuraHitRes .eq. 0) goto 100 c c.Get list of cysteines participating in disulfide bonds. c cali find_disulfide_pairs (data_handle, Framelndex, MAJ_RES, numSS, SS_1, SS_2) if (numSS .eq. 0) goto 10O c c.-Loop through fragmente. Test whether: (a) cys_idx'th residue is participating in a disulfide and c (b) whetner the fragment has an acceptaile RMS overlap with the tem- perate coordinates. c do 90, icnt - 1, numHitRes icys - = EitResList (icat) + · cys_idx - 1 j cys - o do jcnt * i, numss if (SS_1 (jcnt) .eq. icys) then jcys - SS_2 (jcnt) else if (SS_2 (jcnt) .eq. cys) then jcys »SS_l (jcnt) end if end do if (jcys .eq. 0) goto 90 c c ... 3xtract coordinates for RMS test c numFragAtom - 0 do jcnt« 1 , numTemplateRes jres - HitResLis (icnt) + jcnt - 1 if (.not.getAtomOfRes (data_handle, Framelndex, jres, '?', AtomRec)) then write (6, '(' 'ERROR: Onable to get N of fragment residue 1 1, i4) ') jres goto 90 else numFragAtom «numFragAtom + 1 FragAtomList (numFragAtom) - AtomRec. Index end if if (.not.getAtomOfRes (data_handle) Framelndex, jres, 'CA1, AtomRec)) then write 16,' ('' ERROR: Unable to get CA of fragment residue '1, i4)') jres goto 90 else numFragAtom «numFragAtom + 1 FragAtomList (numFragAtom) - AtomRec. Index end if - 41 - if (.not'.getAtomOfRes (data_handle, Framelndex, jres, 'C, AtomRec)) then write (6, 1 (' 'ERROR; Unable co get C of fragment residue '', i4) ') jres goto 90 else numFragAtom - numFragAtom + 1 FragAtomList (numFragAtom) - AtomRec. index end if if (.not.getAtomOf is (data_handle, Framelndex, jree,? ', AtomRec)) then write (S,' ¡'' ERROR: Unable to get O of fragment residue '', i4) ') jres goto 90 else numFragAtom »numFragAtom + 1 FragAtomList (numFragAtom) - AtomRec. index end if do iatom > X, numFragAtom jatom FragAtoraJ-ist (iatom) if (.not.getAtomData (data_handle, Frameladex, jatom, AtomRec)) tiien write (s, 1 ('"ERROR: mu-ble to get record fox fragment • atom 1', is) ') j tom goto 90 else FragmentVecArray (iatom) - AtomRec.vector end if end do end c C ... RMS Fit to template, c cali RMS_FIT (numTemplateVec, TemplateVecArray, FragmentVecArray, RMS WT, RMS_VALUE, ti, t2, X2) ~ t2.X | -1.0 * C2.X t2.y | -1.0 * t2.y t2.z - -1.0 »t2.z if (RMS_VALUE .gt. RMS_CUtoff) goto 90 c c ... Extract remaining atóme for fragment. | C if (.not.getAtcmOfRee (data_handle, Framelndex, icys, 'CB', AtomRec)) then write (6, · ("ERROR: Unanle to get CB of fragment residue '1, i4)') icys goto 90 else numFragAtom = numPragAtom + 1 FragAtomList (numFragAtom) »AtomRec. index end if if (.not.getAtomOf is (data_handle, Framelndex, icys, 'SG', AtomRec) ') then write (S, · [' 'ERROR: Unable to get CB of fragment residue '', i4) ') icys goto 90 else numFragAtom - numFragAtom + 1 FragAtomLis (numFragAtom) »AtomRec .index end i if (.not.getAtomof es (data_.iai.dle, Fxamelndex, jcys,' CA ', AtomP.ec)) then write (E,' ('' ERROR: Unable to get CA of fragment residue '', i4) ') jcys goto 90 else numFragAtom »numFragAtom + 1 FraqJVtomList (numFragAtom) - AtomRec. Index end if if (.aot.getAtoroOf is (data_handle, Framelndex, jcys, 'CB1, AtomRec)) then write (6,' ('' ERROR: Unable to get CB of fragment residue '1, i4> 1) jcys goto 90 else numFragAtom »aumFragAton + 1 FragAtomList (numPragAtom) - AtomRec.index end if if (.not.getAtomofRes. { < i_ta_h.a_dle, Fraraeladex, jcys, 'SG', AtomRec)) then write (6, 1 (1 'ERROR: ünable to get CB of fragmeat residue 11, i4) 1) jcys goto 90 else numFragAtom | numFragAtom + 1 FragAtomliist ( numFragAtom) »AtomRec. index end if cali index_int_array (numFragAtom, FragAtomList, FragAtomlndex) cali reorder_int_array (numFragAtom, FragAtomList, FragAtomlndex) c c ... Construct fragmeat obj eot and apply transformations. c if (getResData (data_handle, 1, icys, ResRec)) continue if (ResRec ChainID.ne.1 ') then first_resnumber - ResRec. ChainID // ResRec. residue_aumber (1: 6) else firat_resnumber = ResRec. residue_number (1: S) end if full_strucfcu.re_naine = file_root (1: len_name) // '_' // £ irBt_resnumber C if (make_trj_from_atom_list (data_handle, INT_0NE, IMT_0NE, numFragAtom, FragAtomList, fragment_handle)) continue cali rsm_translate_frarae (fragment_aandle , HJT_0NE, t2) cali rsm_rotate_frame (frag-ent_handle, INT_0NE, r2) cali rsm_translate_fran > e (fragment_hand-le, IH _0NE, ti) cali append_fragment (fragment_handle, full_structure_name, PDBout, .FALSE.) ~ * Write (LOGout, '(a22, lx, f5.2)') full_6tructuie_name, RMS_value if (returnTrajectory (fragment_handle)) continue c 90 end do 100 if (returnTrajectory (data_handle)) continue goto 50 999 cióse (LISTin) Cióse (PDBout) cióse (LOGout) cali exit end - 43 - EXAMPLE 2 CLONING AND MUTAGENESIS OF HUMAN IL-2 Interleukin-2 (IL-2) (accession number, SWS P01585) is a cytokine with a predominant role in the proliferation of helper-activated T lymphocytes. The mitogenic stimuli or the interaction of the T lymphocyte receptor complex with antigen / CPH complexes in antigen presenting cells causes the synthesis and secretion of IL-2 by activated T lymphocytes, followed by clone expansion of cells specific for the antigen. These effects are known as autocrine effects. In addition, IL-2 may have paracrine effects on the growth and activity of B lymphocytes and cytolytic cells (natural killer (NK, for its acronym in English)). These results are initiated by interaction of IL-2 with receptor on the surface of the T lymphocyte. The breakdown of the IL-2 / IL-2R interaction can suppress the immune function, which has many clinical indications including reverse rejection disease (also known as graft-versus-host disease, GVHD), transplant rejection and autoimmune disorders such as psoriasis, uveitis, rheumatoid arthritis and multiple sclerosis. Structural information is available from mutant C125A [3INK, McKay, D.B. & Brandhuber, B. J., Science 257: 412 (1992)]. - 44 - Cloning of Human IL-2 The numbering of wild-type and mutant IL-2 residues follows the convention of the first amino acid residue (A) for the mature protein which is residue number 1 independently of any sequence, for example met for the known protein in E. coli [see Taniguchi, T., et al., Nature 302: 305-310 (1983) and Devos, R., et al., Nucleic Acids Res. 11: 4307-4323 (1983)]. The DNA sequence encoding human interleukin-2 (IL-2) is isolated from the plasmid pTCGF-11 (ATCC). PCR primers are designed to contain the restriction endonuclease sites Ndel and Xhol for subcloning into a pRSET expression vector (Invitrogen). IL2 GGAATTCCATATGGCACCTACTTCAAGTTCTACAAAGAAAACA IDENTIFICATION SEQUENCE NUMBER: 1 complete IL-2 CCGCTCGAGTCAAGTTAGTGTTGAGATGATGCTTTGACA IDENTIFICATION SEQUENCE NUMBER: 2 inverse Double-chain IL-2 / pRSET is prepared by the following procedure. The PCR product containing the sequence for IL-2 and pRSET is cut with both restriction endonucleases (1 μl of PCR product, 1 μl of each endonuclease, 2 μl of appropriate lOx buffer, 5 μl of water incubated at 37 ° C for 2 hours). The nuclease separation products are isolated from an agarose gel (1% agarose, TAE buffer) and ligated together with DNA-45-T4 ligase (80 ng IL-2 sequence, 160 ng pRSET vector, 4 μ? of 5X ligase buffer [Tris 300 mM, pH 7.5, 50 mM MgCl2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 15 ° C for 1 hour). Are transformed 10 μ? of the ligase reaction mixture in XL1 Blue cells (Stratagene) • (10 μl of reaction mixture, 10 μl of 5X C [0.5 M KC1, 0.15 M CaCl2 and 0.25 MgCl2], 30 μl of water, 50 μ of competent PEG-DMSO cells, incubated at 4 ° C for 20 minutes and at 25 ° C for 10 minutes) and plated on LB / agar plates containing 100 μg / ml ampicillin. After incubation at 37 ° C overnight colonies alone are grown in 5 ml of 2YT medium for 18 hours. The cells are then isolated and double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep kit. Generation of IL-2 Cys Mutations Site-directed mutants of IL-2 are prepared by the single-stranded DNA method (modification of Kunkel, TA, Proc. Nati, Acad. Sci. USA 83: 488-492 (1985 Oligonucleotides are designed to contain the desired mutations and 15-20 bases of flanking sequence The single-chain form of the IL-2 / pRSET plasmid is prepared by transforming the double-stranded plasmid into the CJ236 cell line (1 μ? of double-stranded DNA IL-2 / pRSET, 2 μl of 2x KCM salts, 7 μl of water, 10 μl of competent CJ236 cells PEG-DMSO, incubated at 4 ° C for - 46 - 20 minutes and 25 ° C for 10 minutes; plating is done on LB / agar with 100 pg / ml of ampicillin and incubated at 37 ° C overnight). Single colonies of CJ236 cells are then grown in 50 ml of 2YT medium to the logarithmic middle phase; then add 5 μ? of auxiliary phage VCS (Stratagene) and the mixture is incubated at 37 ° C overnight. Single chain DNA is isolated from the supernatant by phage precipitation (1/5 volume of PEG 8000 20% / 2.5 NaCl, centrifuged at 12K for 15 minutes). The single-stranded DNA is then isolated from the phage using the Qiagen single-stranded DNA kit. Sequencing is identified with a mutation leucine-25 to serine, which is corrected by mutagenesis using the oligonucleotide "S25L". S25L IDENTIFICATION NUMBER TAATTCCATTCAAAATCATCTGTA SEQUENCE: 3 Oligon cleótidos imitagénicos N30C IDENTIFICATION NUMBER GGTGAGTTTGGATTCTTGTAACAATTAATTCCATTCAAAATCATCTG SEQUENCE: 4 SEQUENCE IDENTIFICATION Y31C GGTGAGTTTGGGATTCTTACAATTATTAATTCCATTC NUMBER: 5 SEQUENCE IDENTIFICATION K32C GGTGAGTTTGGGATTACAGTAATTATTAATTCC NUMBER: 6 SEQUENCE IDENTIFICATION N33C CCTGGTGAGTTTGGGACACTTGTAATTATTAATTCC NUMBER: 7 SEQUENCE K35C GCATCCTGGTGAGACAGGGATTCTTGTAATTATTAATTCC - 47 - IDENTIFICATION NUMBER: 8 R38C CTTAAATGTGAGCATACAGGTGAGTTTGGGATTC SEQUENCE IDENTIFICATION NUMBER: 9 F42C GGGCATGTAAAACTTACATGTGAGCATCCTGG SEQUENCE IDENTIFICATION NUMBER: 10 | K 3C CTTGGGCATGTAAAACAAAATGTGAGCATCC SEQUENCE IDENTIFICATION NUMBER: 11 Y45C GGCCTTCTTGGGCATACAAAACTTAAATGTGAGC SEQUENCE IDENTIFICATION NUMBER: 12 E68C CTCAAACCTCTGGAGTGTGTGCTAAATTTAGC SEQUENCE IDENTIFICATION NUMBER: 13 L72C GTTTTTGCTTTGAGCACAATTTAGCACTTCCTCC SEQUENCE IDENTIFICATION NUMBER: 14 N77C CCTGGGTCTTAAGTGAAAACATTTGCTTTGAGCTAAATTTAGC SEQUENCE IDENTIFICATION NUMBER: 15 Y31C 43C GGGCATGTAAAAACAAAATGTGAGCATCCTGGTGAGTTGGGATTCTTACAATTATTAATTCC SEQUENCE IDENTIFICATION NUMBER: 16 There is a double mutant developed further, L72C K43C, using oligonucleotides corresponding to the single mutants K43C and L72C (SEQUENCE IDENTIFICATION NUMBER: 11 and SEQUENCE OF IDENTIFICATION NUMBER: 14, respectively). The site-directed mutagenesis is completed as follows: The mutagenesis oligonucleotides are dissolved in -48- a concentration of 10 OD and are phosphorylated at the 5 'end (2 μl of oligonucleotide, 2 μl of 10 mM ATP, 2 μl 10 × Magnesium chloride Tris-buffer, 1 μ? of 100 mM DTT, 10 μ? of water, 1 μ? of T4 PNK is incubated at 37 ° C for 45 minutes). The phosphorylated oligonucleotides are then annealed to a single-stranded DNA template (2 μl of single-stranded plasmid, 1 μl of oligonucleotide, 1 μl of TM lOx buffer, 6 μl of water, heated to 94 ° C for 2 minutes, at 50 ° C for 5 minutes and cooled to room temperature). The double-stranded DNA is then prepared from the template annealed oligonucleotide (2 μl of 10x TM buffer, 2 μl of 2.5 mM dNTP, 1 μl of 100 mM DTT, 1.5 μl of 10 mM ATP are added, μ? of water, 0.4 μ? of T7 DNA polymerase, 0.6 μ? of DNA ligase T, incubated at room temperature for 2 hours). E.coli (XL1 Blue, Stratagene) is then transformed with the double-stranded DNA (1 μ? Of double-stranded DNA, 10 μ? Of 5 × KCM, 40 μ? Of water, 50 μ? Of DMSO-competent cells; incubated for 20 minutes at 4 ° C, for 10 minutes at room temperature, plated on LB / agar with 100 μg / ml ampicillin and incubated at 37 ° C overnight, using approximately four colonies of each plate to inoculate 5 ml of 2YT containing 100 μg / ml ampicillin These cultures are grown at 37 ° C for 18-24 hours.The plasmids are then isolated from the cultures - 49 - using the Qiagen miniprep equipment. are sequenced to determine which of the clones IL-2 / pRSET contains the desired mutation Sequence primers Direct primer "T7" AATACGACTCACTATAG SEQUENCE OF IDENTIFICATION NUMBER: 17 Reverse primer, "RSET REV" TAGTTATTGCTCAGCGGTGG IDENTIFICATION SEQUENCE NUMBER: 18 Expression of IL-2 Mutants The mutant proteins are expressed as follows: IL-2 / pRSET clones containing the mutations are transformed in BL21 cells DE3 pLysS (Invitrogen) (1 μ? Of double-stranded DNA, 2 μ? Of 5 × KC, 7 μ? Of water, 10 μ? Of DMSO competent cells are incubated for 20 minutes at 4 ° C, 10 minutes at ambient temperature), plated on LB / agar with 100 μg ml of ampicillin and incubated at 37 ° C overnight. Colonies are grown overnight from cultures of 10 ml in 10 ml of 2XT with 100 μg / ml of ampicillin. 100 ml 2YT / ampicillin (100 μg / ml) are inoculated with these cultures overnight and incubated at 37 ° C for 3 hours. This culture is then added to 1.5 L 2YT / ampicillin (100 μg / ml) and incubated until the late logarithmic phase (absorbance at 600 nm -0.8), at which time IPTG is added to a final concentration of 1 mM. The cultures are incubated at 37 ° C-50 ° for another 3 hours and then the cells are pelleted (10K rpm, 10 minutes) and frozen at -20 ° C overnight. The IL-2 mutants are then purified from frozen cell pellets. First the cells are lysed in a microfluidizer (100 ml of Tris EDTA buffer, 3 passes through the microfluidizer [Microfluidics 110S]) and the inclusion bodies are isolated by precipitation (10 Krpm, 10 minutes). After cell lysis, they are saved for analysis by 50 μS SDS-PAGE. of the cellular material. All expressed mutants are determined by gel, but several (e.g., E68C) precipitate upon renaturation. The inclusion bodies are then resuspended in 45 ml of guanidine hydrochloride and centrifuged at 10 Krpm for 10 minutes. The supernatant is added to the renaturation buffer (45 ml of guanidine hydrochloride, 36 ml of Tris, pH 8, 231 mg of cysteamine, 46 mg of cystamine, 234 ml of water) and incubated at room temperature for 3-5 hours . The mixture is then centrifuged at 10 Krpm for 20 minutes and the supernatant dialyzed 4-5 times in 5 volumes of buffer (10 mM ammonium acetate, pH 6, 25 mM NaCl). The protein solution is then filtered through cellulose and injected onto a S Sepharose rapid flow column (2.5 diameter x 14 cm long) at 5 ml / min. The protein is then eluted using a gradient of 0-75% B-buffer, during - 51 - 60 minutes (buffer A: 25 mM NH4OAc, pH 6, 25 mM NaCl, buffer B: 25 mM H40Ac, pH 6, 1 M NaCl). The purified protein is then exchanged into the appropriate buffer for the TETHER assay (usually 100 mM Hepes, pH 7.4). The average yields are 0.5 to 4 mg / 1 of | culture. EXAMPLE 3 CLONING AND MUTAGENESIS OF HUMAN IL-4 IL-4 (accession number S S P05112) is a cytokine that is critical for the early immune response and the allergic response; its interaction with IL-4R is involved in the generation of Th2 cells. IL-4 recruits and activates B lymphocytes that produce IgE (immunoglobulin E), eosinophils and mast cells. These cells in turn label and attack parasites on the skin and mucosal tissues and expel them from the tissues. The role of the interaction of IL-4 / IL-4R in the immunological and allergic responses suggests that the interruption of this interaction can alleviate conditions such as asthma, dermatitis, conjunctivitis and rhinitis. There are crystalline structures of IL-4 in isolation and in complex complexes with a receptor molecule [1HIK, Muller, T. & Buehner, M., J Mol Biol 247: 360-372 (1995); with receptor, 1AR, Hage, T., et al., Cell 97: 271-281 (1999)]. - 52 - Cloning of Human IL-4 The numbering of wild-type and mutant IL-4 residues follows the convention of the first amino acid residue (H) of the mature protein which is residue number 1, independently of any sequence, for example met • for the protein produced in E. coli [Yokota, T., et al., Proc. Nati Acad. Sci. U.S.A. 83: 5894-5898 (1986)]. IL-4 lacks the secretion signal and contains an additional N-terminal methionine that is expressed intracellularly in E. coli from the Sunesis plasmid RSET.IL4. The DNA sequence coding for interleukin-4 (human IL-4) is isolated by PCR from plasmid pcD-hIL-4 (ATCC, accession number 57592) using the PCR primers: IL4 ForRse 5 'GGGTTTCATATGCACAAGTGCGATATCACCTT IDENTIFICATION SEQUENCE NUMBER: 19 IL4 RevRse 5 'CCGCTCGAGTCAGCTCGAACACTTTGAATA IDENTIFICATION SEQUENCE NUMBER: 20 These primers correspond to the extracellular domain of the protein and which are designed to contain the restriction endonuclease sites Ndel and Xhol for subcloning in the vector pRSET (Invitrogen). The PCR reaction is purified on a Qiaquick purification column. PCR (Qiagen). The PCR product containing the IL4 sequence is cut with restriction endonucleases (41 μl of PCR product, 2 μl of each endonuclease, 5 μl of appropriate lOx buffer; it was incubated at 37 ° C for 90 minutes). The pRSET vector is cut with restriction endonuclease (6 DNA, 4 μl of each endonuclease, 10 μl of appropriate lOx buffer, water up to 100 μg, incubated at 37 ° C for 2 hours, 2 μl are added. of CIP and incubated at 37 ° C for 45 minutes). The products of the nuclease separation are isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng of the pRSET vector, 150 ng of the IL4 PCR product, 4 μl of buffer 5x ligase [300 mM Tris, pH 7.5, 50 mM MgCl2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 15 ° C for 1 hour). Are transformed 10 μ? of the ligation reaction in XLl blue cells (Stratagene) (10 μl of reaction mixture, 10 μl of KCM 5x [0.5 M KC1, 0.15 M CaCl 2 and 0.25 M MgCl 2], 30 μl of water, 50 μl. of competent cells in PEG-DMSO, incubated at 4 ° C for 20 minutes, and 25 ° C for 10 minutes), and plated on plates of LB / agar containing 10 μg / ml of ampicillin. After incubation at 37 ° C overnight, the colonies alone are grown in 3 ml of 2YT medium for 18 hours. The cells are then isolated and double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep kit. Generation of cystexin mutations in IL-4 Mutations are generated using, as previously described [Kunkel, T.A., et al., Methods Enzymol 154: 367-82 (1987)]. DNA oligonucleotides are used as shown in the following and are designed to hybridize with the direct strand DNA from the plasmid. Sequences are verified using primers with SEQUENCE IDENTIFICATION NUMBER: 17 SEQUENCE IDENTIFICATION NUMBER and: 18. Mutagenic Oligonucleotides Q8C IDENTIFICATION NUMBER TTGATGATCTCACATAAGGTGA SEQUENCE: 21 SEQUENCE IDENTIFICATION E9C AGTTTTGATGATACACTGTAAGGTGAT NUMBER: 22 SEQUENCE IDENTIFICATION 12C GCTGTTCAAAGTGCAGATGATCTCCTG NUMBER: 23 S16C CTGCTCTGTGAGGCAGTTCAAAGT IDENTIFICATION SEQUENCE NUMBER: 24 37C CAGTTGTGTTACAGGAGGCAGCAAAG IDENTIFICATION SEQUENCE NUMBER: 25 N38C CCTTCTCAGTTGTGCACTTGGAGGC IDENTIFICATION NUMBER SEQUENCE: 26 K42C GCAGAAGGTTTCACACTCAGTTGTG IDENTIFICATION NUMBER SEQUENCE: 27 Q54C GGCTGTAGAAACACCGGAGCACAGTCG IDENTIFICATION NUMBER SEQUENCE: 28 Q78C GAATCGGATCAGACACTTGTGCCTGTG IDENTIFICATION NUMBER SEQUENCE: 29 R81C GCCGTTTCAGGAAGCAGATCAGCTGC SEQUENCE IDENTIFICATION - 55 - NUMBER: 30 R8BC CCTGTCGAGACATTTCAGGAATCG SEQUENCE IDENTIFICATION NUMBER: 31 R88C CCCAGAGGTTGCAGTCGAGCCG SEQUENCE IDENTIFICATION NUMBER: 32 N89C CCCAGAGGCACCTGTCGAGCCG SEQUENCE IDENTIFICATION NUMBER: 33 N97C CACAGGACAGGAACACAAGCCCGCC SEQUENCE IDENTIFICATION NUMBER: 34 K102C CTGGTTGGCTTCACACACAGGACAGG SEQUENCE IDENTIFICATION NUMBER: 35 K117C CTCTCATGATCGTGCATAGCCTTTCC SEQUENCE IDENTIFICATION NUMBER: 36 R21C GAATATTTCTCACACATGATCGTC IDENTIFICATION SEQUENCE NUMBER: 37 Expression of IL-4 Mutants BL21 DE3 cells (Stratagene) are transformed with RSET.IL4 plasmids containing the described cysteine mutations and plated onto LB agar containing 100 μg / ral of ampicillin After growing overnight, fresh individual colonies are used to inoculate a shake flask at 37 ° C overnight with 30 ml of 2YT medium (with 50 pg / ml ampicillin). In the morning, this overnight culture is used to inoculate 1.5 1 of 2YT / ampicillin (50] ig / l), which is further cultured at - 56 - 37 ° C and 200 rpm in an agitation flask with 4.0 toothed bottom 1. When the optical density of the culture a? = 600 reaches 0.8, is induced to produce IL-4 protein by the addition of 1 mM IPTG. After an additional 4 hours of incubation the cultures are harvested, the cells are pelleted by centrifugation at 7Krpm for 10 minutes (K-9 Komposite Rotor) and frozen at -20 ° C. The cell template is then thawed and resuspended in 100 ml of 10 mM Tris, pH 8, 50 mM NaCl and 1 mM EDTA. This solution is kept cold and run through a microfluidizer twice (model 110S Microfluidics Corp., Newton Massachusetts) and centrifuged at 7K rpm for 15 minutes). The pellet containing the inclusion bodies of IL-4 is then resuspended in a 50 ml solution of 5M guanidine hydrochloride, 50 mM Tris, pH 8, 50 mM NaCl, 2.5 mM reduced glutathione and 0.25 mM oxidized glutathione, and incubate for 1 hour at room temperature with gentle shaking. The solution of solubilized protein is then centrifuged at 7.5K rmp for 15 minutes and the supernatant is subjected to filtration at 0.45 i to eliminate insoluble residues. IL-4 is renatured by slowly adding the filtered solution to 9 volumes (450 ml) of 50 mM Tris, pH 8, 50 mM NaCl, 2.5 mM reduced glutathione and 0.25 mM oxidized glutathione over a period of 30 minutes. The resulting solution is further incubated with slow stirring for 3 hours at room temperature and then placed in a dialysis bag of 3000 mwco and exchanged 3 times against 20 1 PBS (phosphate buffered saline) 0.5x. The renatured mutant proteins are then purified using a Hi-S column cartridge (Bio-Rad). After the protein solution is clarified by centrifugation and filtration is loaded onto the column at a flow rate of 5 ml / min. The column is then washed with buffer A (0.5x PBS) for 15-20 minutes and fractions of 7.5 ml of 1.5 minutes are collected over a gradient of 0-100% between buffer A and buffer B (PBS, 1M NaCl). The fractions containing the IL-4 protein, determined by SDS-PAGE and the optical density as 280 n are those that accumulate, are concentrated with a 5K mwco filter and its interchanger is exchanged to PBS. This solution is then subjected to 0.2 μp filtration, frozen in a bath of dry ice and ethanol and stored at -80 ° C. EXAMPLE 4 CLONING AND MUTAGENESIS OF FACTOR TO OF HUMAN TUMOR NECROSIS (TNF-cQ OI factor of tumor necrosis (TNF-OI), (SWS access number P01375) is a cytokine produced mainly by activated macrophages and plays an important role in immune responses that - 58 - include septic shock, inflammation and cachexia. This protein can interact with two receptors, TNF Rl and TNF 2. These two receptors do not share similarities in their intracellular domains, suggesting that they are involved in different signal transduction pathways. A structure of TNF-α is available [1TNF, Eck, M.J., et al., J Biol Chem 264: 17595-17605 (1989)]; TNF-a is an elongated β-sheet and forms a trimer. Mutation of some of the residues between trimer subunits indicates that they are part of a receptor binding site. However, there is no structure of TNF bound to a receptor, until now. Cloning of Human TNF-a The DNA sequence encoding human tumor necrosis factor (TNF) is isolated by PCR from the pUC-Ri-4large plasmid (ATCC # 65947) using PCR primers included in the following which correspond to the extracellular domain of the protein and which are designed to contain Ndel and Xhol restriction endonuclease sites for subcloning in a pRSET vector (Invitrogen). TNF RSET For 51 GGGTTTCATATGGTCCGTTCATCTTCTCGAAC IDENTIFICATION SEQUENCE NUMBER: 38 TNF RSET Rev 5 'CCGCTCGAGTCACAGGGCAATGATCCCAA IDENTIFICATION SEQUENCE NUMBER: 39 The PCR reaction is purified on a Qiaquick PCR-59-purification column (Qiagen). The PCR product containing the TNF sequence is cut with restriction endonucleases (41 μl of PCR product, 2 μl of each endonuclease, 5 μl of appropriate lOx buffer, incubated at 37 ° C for 90 minutes). The pRSET vector is cut with restriction endonuclease (6 μg of DNA, 4 μ of each endonuclease, 10 μl of appropriate lOx buffer, water up to 100 μ?, Incubated at 37 ° C for 2 hours, 2 μm are added) CIP and incubate at 37 ° C for 45 minutes). The products of the nuclease separation are isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng of the pRSET vector, 150 ng of the TNF PCR product, 4 μl of buffer 5x ligase [300 mM Tris, pH 7.5, 50 mM MgCl2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 15 ° C for 1 hour). Are transformed 10 μ? of the ligation reaction in XL1 blue cells (Stratagene) (10 μl of reaction mixture, 10 μl of KCM 5x [0.5 M KC1, 0.15 M CaCl2 and 0.25 M MgCl2], 30 μl of water, 50 μl. of competent cells in PEG-DMSO, incubated at 4 ° C for 20 minutes, and 25 ° C for 10 minutes), and plated on plates of LB / agar containing 100 μg / ml of ampicillin. After incubation at 37 ° C overnight, the colonies alone are grown in 3 ml of 2YT medium for 18 hours. The cells are then isolated and double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep-60-kit. The sequencing of the genes for TNF is carried out using primers having the SEQUENCE OF IDENTIFICATION NUMBER: 17 and "SEQUENCE OF IDENTIFICATION NUMBER 18. Generation of Mutations with Cysteine in TNF-a Mutations are generated using the previously described [Kunkel , TA, et al., Methods Enzymol 154: 367-382 (1987).] The DNA oligonucleotides used are shown below and are designed to hybridize with direct strand DNA from the plasmid. verify using the primers with IDENTIFICATION SEQUENCE NUMBER 17 and IDENTIFICATION SEQUENCE NUMBER 18. Mutagenic Oligonucleotides R32C GAGGGCATTGGCGCAGCGGTTCAGCCAC SEQUENCE OF IDENTIFICATION NUMBER: 40 A33C CAGGAGGGCATTGCACCGGCGGTTCAG SEQUENCE OF IDENTIFICATION NUMBER: 41 N34C GGCCAGGAGGGCACAGGCCCGGCGGTTC SEQUENCE OF IDENTIFICATION NUMBER: 42 R4 C CAGCTGGTTATCACACAGCTCCACGCC SEQUENCE OF IDENTIFICATION NUMBER: 43 Q47C TGGCACCACCAGGCAGTTATCTCTCAG SEQUENCE OF IDENTIFICATION NUMBER: 44 T72C GAGGAGCACATGGCAGGAGGGGCAGCC SEQUENCE OF - 61 - IDENTIFICATION NUMBER: 45 H73C GGTGAGGAGCACACAGGTGGAGGGGCAG SEQUENCE OF IDENTIFICATION NUMBER: 46 L75C GGTGTGGGTGAGGCACACATGGGTGGAG IDENTIFICATION SEQUENCE NUMBER 47 'T77C GCTGATGGTGTGGCAGAGGAGCACATG SEQUENCE OF IDENTIFICATION NUMBER: 48 V91C CAGAGAGGAGGTTGCACTTGGTCTGGTAG SEQUENCE OF IDENTIFICATION NUMBER: 49 N92C GGCAGAGAGGAGGCAGACCTTGGTCTG SEQUENCE OF IDENTIFICATION NUMBER: 50 S95C GCTCTTGATGGCACAGAGGAGGTTGAC SEQUENCE OF IDENTIFICATION NUMBER: 51 E104C CCTCAGCCCCTCTGGGGTGCACCTCTGGCAGGGG IDENTIFICATION SEQUENCE NUMBER: 52 T105C CCTCAGCCCCCTCTGGGCACTCCCTCTGGCAGGGG SEQUENCE IDENTIFICATION NUMBER: 53 E107C GGCCTCAGCCCCGCATGGGGTCTCCCTCTGGC SEQUENCE OF IDENTIFICATION NUMBER: 54 E110C CCAGGGCTTGGCGCAAGCCCCCTCTGGGG SEQUENCE OF IDENTIFICATION NUMBER: 55 Al11C ATACCAGGGCTTGCACTCAGCCCCCTC SEQUENCE OF IDENTIFICATION NUMBER: 56 K112C GGGTAGTTTCTGGCAAATATGGCTTG SEQUENCE OF IDENTIFICATION NUMBER: 57 - 62 - Q125C CACCCTTCTCCAGGCAGAAGACCCCTCC SEQUENCE OF IDENTIFICATION NUMBER: 58 R138C GCTGAGATCAATTGTCCCGACTATCTC SEQUENCE OF IDENTIFICATION NUMBER: 59 E146C GACCTGCCCAGAGCAGGCAAAGTCGAG SEQUENCE OF IDENTIFICATION NUMBER: 60 S147C GTAGACCTGCCCACACTCGGCAAAGTC SEQUENCE OF IDENTIFICATION NUMBER: 61 Expression of TNF-o Mutant Proteins BL21 DE3 cells (Stratagene) are transformed with the RSET TNF plasmids containing the described cysteine mutations and plated on LB agar containing 100 g / ml ampicillin. After overnight growth, fresh individual colonies are used to inoculate a shake flask culture overnight at 37 ° C, with 30 ml of 2YT medium (50 μg / ml ampicillin). In the morning, this overnight culture is used to inoculate 1.5 1 of 2YT / ampicillin (50 pg / ml), which is further cultured at 37 ° C and 200 rpm in a shaking flask with 4.0 toothed bottom. optical density of the crop a? = 550 reaches 0.8, is induced to produce TNF-protein by the addition of 1 mM IPTG. After an additional 4 hours of incubation the cultures are harvested, the cells are pelleted by centrifugation at 7K rpm for 10 minutes (K-9 Komposite Rotor) and frozen at - 63 - -20 ° C. The cell template is then thawed and resuspended in 100 ml of 25 mM ammonium acetate, pH 6, 1 mM DTT and 1 mM EDTA. This solution is kept cold and passed through a microfluidizer twice (model 110S • icrofluidics Corp., Newton Massachusetts), centrifuged at 9K rpm for 15 minutes to remove the insoluble material and further clarified by filtration at 0.45 μp. ? This solution is then loaded onto an S-Sepharose ff column (Bio-Rad) at a flow rate of 5 ml / min. The flow rate is then increased to 7.5 ml / min for the following steps. The column is then washed with buffer A (0.2 M ammonium acetate, pH 6, 1 mM DTT), until the D02ao approaches zero (15-20 minutes) and fractions are collected on a 0-100% gradient in the gradient. 60 minutes between buffer A and buffer B (1M ammonium acetate, pH 6, 1 mM DTT). Fractions containing the TNF-α protein, determined by SDS-PAGE and an optical density at 280 nm, are accumulated and placed in a 3000 mwco dialysis bag and dialyzed overnight at 4 ° C against 4 1 Tris 10 mM, pH 7.5, 10 mM NaCl and 1 mM DTT. The dialyzed protein solution is then clarified by centrifugation at 13.5K rpm for 10 minutes and filtered through a 0.2 μ filter. The mutant proteins are then loaded onto a Q-Sepharose column (Bio-Rad) at a rate of 5 ml / min. The flow rate is increased to 7.5 ml / min for the following stages. The column is then washed with buffer A (10 mM Tris), pH 7.5, 10 mM NaCl, 1 mM DTT) until the D02so approaches zero (15-20 minutes) and the fractions are collected on a gradient of 0-100% in 40 minutes between buffer A and buffer B (10 mM Tris, pH 7.5, 0.5 mM NaCl, 1 mM DTT). Fractions containing the TNF-α protein, determined by SDS-PAGE and an optical density at 280 nm, accumulate and concentrate with a 5K mwco filter and its buffer is changed to PBS. This solution is then filtered at 0.2 μp ?, freeze in a dry ice and ethanol bath and stored at -80 ° C. EXAMPLE 5 CLONING AND MUTAGENESIS OF INTERLEUCINE-1 HUMAN TYPE 1 RECEPTOR (IL-1RI) The binding of the receptor for IL-1 (accession number SWS P14778) to IL-? A or IL-? ß is another important mediator of the responses immunological and inflammatory. This interaction is controlled by at least three mechanisms. First, the IL-R2 protein binds to IL-? A and IL-? ß but does not emit a signal. Second, proteolytically processed IL-1 R1 and IL-1R2 are soluble and bind to circulating IL-1. Finally, there is a natural IL-IR antagonist, termed IL-IRa that functions by binding of IL-1R1 and de-65 - this blocks the binding of IL-1R1 to IL-1: and IL-1B. The inhibition of these interactions with a small orally available molecule may be desirable in treatment of diseases such as rheumatoid arthritis, autoimmune disorders and ischemia. Two structures of IL-1R have been resolved [with an antagonist peptide, IGOY, Vigers, G.P.A., et al., J. Biol. Chem. 275: 36927-36933 (2000); with a receptor antagonist, 1IRA, Schreuder, H, et al., ature 386: 194-200 (1997)]. Type 1 Cloning of Human IL-1 The IL-1 receptor has three regions: an N-terminal extracellular region, a transmembrane region, and a C-terminal cytoplasmic region. The extracellular region itself contains three C2-like domains similar to immunoglobulin. The constructs used here contain two N-terminal domains of the extracellular region. The numbering of wild type and imitant IL-1R residues follows the convention of the first amino acid residue (L) of the mature protein constituting residue number 1 after processing of the signal sequence [Sims, J. E-, et al., Proc. Nati Acad. Sci. U.S. A. 86: 8946-8950 (1989)]. The sequence of the protein in domain 2 shown below as SEQUENCE IDENTIFICATION NUMBER OF: 62. 1 LEADKCKERE EKIILVSSAN EIDVRPCPLN PNEHKGTITW YKEDSXTPVS TEQASRIHQH Sl KEKLWFVPAX VEDSGHYYCV VRNSSYCL.II KISAKFVEKE PNICYNACAI FKQKLPVAGD 121 GGLVCPYMEF FKNENNELPK LQWYKDCKBL LLDNIHFSGV KDRLXVMNVA EKHRGNYTCH 181 ASYTYLGKQY PITRVIEFIT READING - 66 - Briefly, cysteine mutants are produced in the context of a domain 2 receptor and a domain 2 receptor with a his tag. In addition, the constructs possess a mutation at the glycosylation site and a construct possesses a mutation at a glycosylation site in addition to a deletion at the C terminal residue of the region of domain 2. The assembly of these constructs is described below. The DNA sequence encoding the human interleukin-1 receptor (IL-1R) is isolated by PCR from a HepG2 cDNA library (ATCC) using PCR primers (ILIRsigintFor 5 '; ILIRintRev 5') corresponding to the signal sequence and the end of the extracellular domain of the protein. ILIRsigintFor TTACTCAGACTTATTTGTTTCATAGCTCTA IDENTIFICATION SEQUENCE NUMBER: 63 ILIRintRev GAAATTAGTGACTGGATATATTAACTGGAT IDENTIFICATION SEQUENCE NUMBER: 64. The appropriate size band is isolated from an agarose gel and used as the template for a second round of PCR using oligonucleotides (ILIRsigFor; ILlR319Rev) , which are designed to contain EcoRI and Xhol restriction endonuclease sites for subcloning into a pFBHT vector. ILIRsig For CCGGAATTCATGAAAGTGTTACTCAGACTTATTTGTTTC - 67 - IDENTIFICATION SEQUENCE NUMBER: 65 IL1R319 Rev CCGCTCGAGTCACTTCTGGAAATTAGTGACTGGATATATTAA IDENTIFICATION SEQUENCE NUMBER: 66 The pFBHT vector is modified from the original pFastbacl (Gibco / BRL) by cloning the sequence for TEV protease followed by tag (His) 6 and a stop signal in the Xhol and HindIII sites. The PCR product containing the IL-1R sequence is cut with the restriction endonucleases (41 μl of PCR product, 2 μl of each endonuclease, 5 μl of appropriate lOx buffer, incubated at 37 ° C for 90 minutes). The pFBHT vector is cut with restriction endonucleases (6 μg of DNA, 4 μ of each endonuclease, 10 μ of the appropriate lOx buffer, water up to 100 μ?, Incubated at 37 ° C for 2 hours, 2 μm are added) CIP and incubate at 37 ° C for 45 minutes). The products of the nuclease separation are isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng of the pFBH vector, 150 ng of the IL1R PCR product, 4 μl of buffer 5x ligase [300 mM Tris, pH 7.5, 50 mM MgCl2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 5 ° C for 1 hour). Are transformed 10 μ? of the ligation reaction in XL1 blue cells (Stratagene) (10 μl of reaction mixture, 10 μl of CM 5x [C1 0.5 M, CaCl2 0.15M, MgCl2 0.25 M], 30 μl of water, 50 μl. of competent cells in PEG-DMSO, incubated at 4 ° C-68 - for 20 minutes, and 25 ° C for 10 minutes), and plated on plates of LB / agar containing 100 μg / ml of ampicillin. After incubation at 37 ° C overnight, the colonies alone are grown in 3 ml of 2YT medium for 18 hours. The cells are then isolated and 'double-stranded DNA is extracted from the cells using the Qiagen DNA iniprep kit. A domain version of IL1R is generated by PCR using the IL1R-FBHT clone of domain 3 as a template. PCR is carried out using the ILIRsigFor primers (NUMBER IDENTIFICATION SEQUENCE: 65) corresponding to the signal sequence, in addition to one of the following two reverse primers. The reverse primers are ILlR2Drevstop-Xho, which corresponds to the end of the second extracellular domain of the protein with a stop signal and ILlR2Drev-Xho, which corresponds to the end of the second extracellular domain of the protein without a stop signal to create a fusion with the TEV protease site and the His tag. ILlR2Drevstop-Xho CCGCTCGAGTCATCATTTGTTTTCCTCTAGAGTAATAAA SEQUENCE IDENTIFICATION NUMBER: 67 ILlR2Drev-Xho CCGCTCGAGTCATTTGTTTTCCTCTAGAGTAATAAA SEQUENCE IDENTIFICATION NUMBER: 68 The PCR primers contain restriction sites (EcoRI at the 5'end and XhoI at the 3 '), - 69 - which used to bind the domain version 2 within the vector pFBH. The PCR product containing the IL1R2D sequence is cut with the restriction endonucleases (41 μl of PCR product, 2 μl of each endonuclease, 5 μl of appropriate lOx buffer); incubate at 37 ° C for 90 minutes). The nuclease separation products are isolated from a 1% agarose gel, TBE buffer) and ligated together using T4 DNA ligase (200 ng of the pFBHT vector, 150 ng of the IL1R2D PCR product, 4 μl of 5x ligase buffer [300 mM Tris, pH 7.5, 50 mM MgCl2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 15 ° C for 1 hour). Are transformed 10 μ? of the ligation reaction in XL1 blue cells (Stratagene) (10 μl of reaction mixture, 10 μl of CM 5x [0.5 M KCl, 0.15M CaCl 2, 0.25 M MgCl 2], 30 μl of water, 50 μl. of competent cells in PEG-DMSO, incubated at 4 ° C for 20 minutes, 25 ° C for 10 minutes), and plated on plates of LB / agar containing 100 μg / ml of ampicillin. After incubation at 37 ° C overnight, the colonies alone are grown in 3 ml of 2YT medium for 18 hours. The cells are then isolated and double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep kit. Additionally, the two glycosylation sites within IL1R2D, N83 and N176 are each mutated individually to a histidine in order to produce a more homogeneous protein. Each of these unique mutants occurs in the context of the domain 2 protein without a his tag (sILlRd2-FB) and the domain 2 protein with a his tag (sILlRd2-FBHT). The mutation is carried out by PCR using two sets of primers to produce two fragments, followed by the binding of the fragments using the outer primers ILIRsigFor (IDENTIFICATION SEQUENCE NUMBER: 65) and either ILlR2Drevstop-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 67) OR ILlR2Drev-Xho (IDENTIFICATION SEQUENCE NUMBER: 68) as described in the following. Brief descriptions of the glycosylation mutants of domain 2 and their construction. The construct for mutant N83H without a his tag, is referred to as SIL1R2D-N83H-FB and is generated using ILIRsigFor (IDENTIFICATION SEQUENCE NUMBER: 65) and N83HR (IDENTIFICATION SEQUENCE NUMBER: 69) together with N83HF (IDENTIFICATION SEQUENCE) NUMBER: 70) and ILlR2Drevstop-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 67). N83HR GAGGCAGTAAGATGAATGTCTTACC SEQUENCE OF IDENTIFICATION NUMBER: 69 N83HF CTATTGCGTGGTAAGACATTCATCTT SEQUENCE OF IDENTIFICATION NUMBER: 70 The construct for mutant N83H with a his tag is called as SIL1R2D-N83H-FBHT and is generated using ILIRsigFor (SEQUENCE OF IDENTIFICATION NUMBER: - 71 - 65) and N83HR (IDENTIFICATION SEQUENCE NUMBER: 69) together with N83HF (SEQUENCE OF IDENTIFICATION NIMMER: 70) and ILlR2Drev-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 68). The construct for mutant N176H without a his tag is referred to as SIL1R2D-N176H-FB and is generated using ILIRsigFor (IDENTIFICATION SEQUENCE NUMBER: 65), N176HR (IDENTIFICATION SEQUENCE NUMBER: 71), N176HF (IDENTIFICATION SEQUENCE NUMBER: 72) and ILlR2Drevstop-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 67). N176HR ATGACAAGTATAGTGCCCTCTATGCTTTTCACG SEQUENCE OF IDENTIFICATION NUMBER: 71 NI76HF GCTGAAAAGCATAGAGGGCACTATACTTGTCAT IDENTIFICATION SEQUENCE NUMBER: 72 The construct for mutant N176H with a his tag is called SIL1R2D-N176H-FBHT and is generated using ILIRsigFor (SEQUENCE OF IDENTIFICATION NUMBER: 65), N176HR (SEQUENCE OF IDENTIFICATION NUMBER: 71), together with N176HF (SEQUENCE OF IDENTIFICATION NUMBER: 72); and ILlR2Drev-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 68). The PCR products are isolated from an agarose gel and PCR is used to join the two fragments using ILIRsigFor (IDENTIFICATION SEQUENCE NUMBER: 65) and ILlR2Drevstrp-Xho (SEQUENCE OF IDENTIFICATION NUMBER: 67) or ILlR2Drev-Xho (SEQUENCE IDENTIFICATION NUMBER: 68). The PCR products containing the IL1R2D-72-sequences synthesized at the glycosylation site are cut with the restriction endonucleases (41 μl of PCR product, 2 μl of each endonuclease, 5 μl of appropriate lOx buffer; incubate at 37 ° C for 90 minutes). The nuclease separation products are isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (200 ng of the pFBHT vector, 150 ng of the IL1R2D PCR product, 4 μ of buffer of 5x ligase [300 mM Tris, pH 7.5, 50 mM MgCl 2, 20% PEG 8000, 5 mM ATP, 5 mM DTT], 1 μl ligase, incubated at 15 ° C for 1 hour). Are transformed 10 μ? of the ligation reaction in XL1 blue cells (Stratagene) (10 μl of reaction mixture, 10 μl of KCM 5x [C1 0.5 M, CaCl2 0.15M, MgCl2 0.25 M], 30 μl of water, 50 μl. of competent cells in PEG-DMSO, incubated at 4 ° C for 20 minutes, 25 ° G for 10 minutes), and plated on plates of LB / agar containing 100 μg / ml of ampicillin. After incubation at 37 ° C overnight, the colonies alone are grown in 3 ml of 2YT medium for 18 hours. The cells are then isolated and double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep kit. The subsequent plasmids are called as. SIL1R2D-N83H-FB or SIL1R2D-N83H-FBHT and as SIL1R2D-N176H-FB or as SILR2D-N176H-FBH. Finally, an additional construct is produced using the SL1R2D-N83H-FB construct. The additional 73-construct contains the IL1R domain 2 receptor without a his tag and with two mutations: a N83H glycosylation mutation and a deletion of the C terminal residue (K205). This construct is called SIL1R2D2M-FB, and is made using the nucleotide K205del. 205 of CTCGAGTCATCAGTTTTCCTCTAG IDENTIFICATION SEQUENCE NUMBER: 73 Generation of IL-IRI Cysteine Mutations Mutants directed to the IL1R2D site are prepared by the single-stranded DNA method [modification of Kunkel, T.A., Proc. Nati Acad. Sci. U.S.A. 82: 488-492 (1985)]. Oligonucleotides are designed to contain the desired mutations and 15-20 bases of flanking sequence. The single chain form of the IL1R2D plasmid (SIL1R2S-FBHT, SIL1R2D-N176H-FB / FBHT, SIL1R2D-N83H-FB / FBHT, SIL1R2D2M-FB) is prepared by transformation of the double-stranded plasmid into the CJ236 cell line (1 μ? Double-stranded for IL1R- FB, 2 μ? Of 2 × KCM salts, 7 μ? Of water, 10 μ? Of competent CJ236 cells in PEG-DMSO, incubated at 4 ° C for 20 minutes at 25 ° C for 10 minutes; LB / agar with 100 ampicillin and incubate at 37 ° C overnight). The unique colonies of CJ236 are then grown in 50 ml of 2YT medium until the average logarithmic phase; then add 10 μ? Phage - 74 - Cooperator VCS (Stratagene). and the mixture is incubated at 37 ° C overnight. The single chain DNA of the supernatant is isolated by phage precipitation (1/5 volume of PEG 8000 / 2.5 M NaCl, centrifugation at 12K for 15 minutes). The single-stranded DNA is isolated after phage using the Qiagen single stranded DNA kit. Site-directed mutagenesis is carried out as follows. Oligonucleotides are dissolved to a concentration of 10 OD and phosphorylated at the 5 'end (2 μμ of oligonucleotide, 2 μ? Of 10 mM ATP, 2 μ? Of 10 × Tris-magnesium chloride buffer, 1 μ? Of 100 mM DTT, 10 μ? Of water, 1 μ? Of T4 PNK, incubated at 37 ° C for 45 minutes). The phosphorylated oligonucleotides are then annealed to a single-stranded DNA template (2 μl of the single-stranded plasmid, 1 μl of oligonucleotide, 1 μl of MlOx buffer, 6 μl of water, heated to 94 ° C. for 2 minutes, 50 ° C for 5 minutes and cooled to room temperature). Next, double-stranded DNA is prepared from the annealed oligonucleotide / template (2 μl of TM lOx buffer, 2 μl of 2.5 mM dNTP, 1 μl of 100 mM DTT, 1.5 μl of 10 mM ATP are added, μ? of water, 0.4 μ? of T7 DNA polymerase, 0.6 μ? of T4 DNA ligase, incubated at room temperature for 2 hours). Then E. coli (XL1 blue, Stratagene) is transformed with the double-stranded DNA (1 μ? Of double-stranded DNA, 10 μ? Of 5 × KCM, 40 μ? Of water, 50-75 μ μ of competent cells DMSO, incubated for 20 minutes at 4 ° C, 10 minutes at room temperature), plated on LB / agar containing 100 μg / ml ampicillin and incubated at 37 ° C overnight. Approximately four colonies for each plate are used to inoculate 5 ml of '2YT containing 100 g / ml of ampicillin; these cultures are grown at 37 ° C for 18-24 hours. The plasmids are then isolated from the cultures using the Qiagen miniprep kit. These plasmids are sequenced to determine which of the clones IL1R2D-FB contains the mutation that is desired. The sequencing of the IL1R2D genes is carried out as follows. The plasmid DNA concentration is quantified by absorbance at 280 nm. 800 ng of the plasmid is mixed with 8 μ sequencing reagents. of DNA, 3 μ? of water, 1 μ? of sequencing primer, 8 μ? of sequencing mixture with Big Dye [Applied Biosystems]). The sequencing primers used are direct FB and inverse FB, which are shown below. FB Direct TATTCCGGATTATTCATACC IDENTIFICATION SEQUENCE NUMBER: 74 FB Inverse CCTCTACAAATGTGGTATGGC IDENTIFICATION SEQUENCE NUMBER: 75 The mixture is then run through a PCR cycle (96 ° C, 10 s, 50 ° C, 5 s, 60 ° C, 4 minutes; 25 cycles) and the DNA reaction products are precipitated 20 μ? of mixing, 80 μ? of isopropanol 75%; they are incubated for 20 minutes at room temperature, they are sedimented at 14K rpm - for 20 minutes; Washes with 250 μ? of 70% ethanol; heat 1 minute at 94 ° C). The precipitated products are then suspended in Temppression Suppression Buffer (TSB, Applied Biosystems) and the sequence is read and analyzed by a capillary gel sequencer from Applied Biosystems 310. In general, 3 of the 4 plasmids contain the mutation desired. A list of the constructs and their mutants is given below, although any imitator with cistern can be made in any of the indicated contexts. sU.1R2D-N83H-FB E1 IC, IX3C, VI6C, Q10SC, 1110C, K112C, K114C, VI 17C, V124C, Y127C, E129C sD_ 1R2D-NS3H-PBHT 1C, I13C, V16C, Q108C, IllOC. Kl 12C, Ql 13C, Kl 14C. V117C, V124C, Y127C, E129C -? - 1 R2D-N 176H-FB EllC sIL 1E2D-N17SH-FBHT EllC, VI 6C, V124C, E129C sXLlE2r > 2M-FB EllC. K12C, I13C, A107C, Kl 12C, V124C, V127.

Mutagenic Oligonucleotides EllC AAAATTATTTTACATTCACGTTCC IDENTIFICATION SEQUENCE NUMBER: 76 K12C CACTAAAATTATACATTCT CACGTTC IDENTIFICATION SEQUENCE NUMBER: 77 I13C TGAC CTAAAA CATTTTTCTTCACG SEQUENCE OF IDENTIFICATION NUMBER: 78 - 77 - VI6C ATTTGCAGATGAACATAAAATTATT SEQUENCE IDENTIFICATION NUMBER: 79 Al07C AAATATGGCTTGGCAATTATAACATAAG SEQUENCE IDENTIFICATION NUMBER: 80 Q108C CTTAAATATGGCGCATGCATTATAACA SEQUENCE IDENTIFICATION NUMBER: 81 1110C GTTTCTGCTTAAAGCAGGCTTGTGCATT SEQUENCE IDENTIFICATION NUMBER: 82 Kl12C GGGTAGTTTCTGACAAAATATGGC SEQUENCE IDENTIFICATION NUMBER: 83 Q113C AACGGGTAGTTTACACTTAAATATGGC SEQUENCE IDENTIFICATION NUMBER: 84 K114C CTGCAACGGGTAGGCACTGCTTAAATATG SEQUENCE IDENTIFICATION NUMBER: IR IL-All plasmids 89 Expression of Mutant Proteins: 85 V117C CTCCGTCTCCTGCACAGGGTAGTTTCTG SEQUENCE IDENTIFICATION NUMBER: 86 V124C CATATAAGGGCAACAAAGTCCTCC SEQUENCE IDENTIFICATION NUMBER: 87 Y127C AAAAAACTCCATACAAGGGCACACAAG SEQUENCE IDENTIFICATION NUMBER: 88 E129C TTTAAAAAAACACATATAAGGGCA SEQUENCE IDENTIFICATION NUMBER IL1R-FB / FBHT were specifically relocated based on the site within the - 78 - baculovirus shuttle vector (bacmid) by transforming the plasmids into DHlObac competent cells (Gibco / BRL) as follows: 1 μ? of DNA at 5 ng / μ ?, 10 μ? of KCM 5x [KC1 0.5 M, CaCl2 0.15 M, MgCl2 0.25 M], 30 μ? of water, with 50 μ? of competent cells in PEG-D SO, incubated at 4 ° C 'for 20 minutes, 25 ° C for 10 minutes, 900 μ? of SOC and incubated at 37 ° C with shaking for 4 hours, then seeded on LB / agar plates containing 50 g / ml kanamycin, 7 μg / ml gentamicin, 10 μg / ml tetracycline, 100 μg / ml of Blu-gal, and 10 pg / ml of IPTG. After incubation at 37 ° C for 24 hours, the large white colonies are taken and grown in 3 ml of 2YT medium overnight. The cells are then isolated and the double-stranded DNA is extracted from the cells as follows: the pellet is resuspended in 250 μ? of solution 1 [15 mM Tris-HCl (pH 8.0), 10 mM EDTA, 100 ng / ml ribonuclease A]. 250 μ? of solution 2 (0.2 N NaOH, SDS 1%), mix gently and incubate at room temperature for 5 minutes Add 250 μl of 3M potassium acetate and mix, and place the tube on ice for 10 minutes The mixture is centrifuged for 10 minutes at 14,000 xg and the supernatant is transferred to a tube containing 0.8 ml of isopropanol.The contents of the tube are mixed and placed on ice for 10 minutes, centrifuged for 15 minutes at 14,000 x g. The pellet is washed with 70% ethanol and dried in air and the DNA is resuspended in 40 μ of TE The bacmid DNA is used to transfect Sf9 cells Sf9 cells are seeded at 9 x 105 cells per well of 35 mm in 2 ml of medium Sf-900 IISFM containing a 0.5x concentration of antibiotic-antifungal and allowed to bind at 27 ° C for 1 hour.During this time, 5μ of the DNA of the bacmid in 100 μl of medium without antibiotics, 6 μl of CellFECTIN reagent is diluted in 100 μl of medium without antibiotics and then the two solutions are mixed gently and allowed to incubate for 30 minutes at room temperature. The cells are washed once with medium without antibiotics, the medium is aspirated and then 0.8 ml of medium is added to the lipid complex. and it is placed on top of the cells. The cells are incubated for 5 hours at 27 ° C, the transiection medium is separated and 2 ml of medium are added with antibiotics. The cells are incubated for 72 hours at 27 ° C and the virus is harvested from the cell culture medium. The virus is amplified by adding 0.5 ml of virus to 50 ml of Sf9 cell culture at 2 x 106 cells / ml and incubating at 27 ° C for 72 hours. The virus is harvested from the cell culture medium and this concentrate is used to express the various IL1R constructs in High-Five cells. 1 1 of high-five cell culture is infected at 1 x 106 cells / ml with virus, to approximately MOI of 2 and se - 80 - incubated during 72 hours. The cells are pelleted by centrifugation and the supernatant is loaded onto an IL1R antagonist column at 1 ml / min, washed with PBS followed by a wash with buffer A (0.2 M NaOAc, pH 5.0, 0.2 M NaCl). The protein is eluted from the column by running a gradient of 0-100% buffer B (0.2 M NaOAc, pH 2.5, 0.2 M NaCl) in 10 minutes, followed by 15 minutes of 100% B buffer at 1 ml / min collecting fractions of 2 ml in tubes containing 300 μ? of Tris without cushioning. The appropriate fractions are pooled, concentrated and dialyzed against 50 μM Tris 1, pH 8.0, 100 μM NaCl at 4 ° C and filtered through a 0.2 μp filter. EXAMPLE 6 CLONING AND MUTAGENESIS OF CASPASA-3 HUMAN (CASP-3) Caspase-3 (access number SWS P42574) is one of a series of caspases involved in cell apoptosis. It exists as the inactive proforma, and can be processed by caspases 8, 9 or 10 to form a small subunit and a large subunit, which heterodimerize to constitute the active form. The caspases that are substrates for caspase-3 in cascade with caspase-6, caspase-7 and caspase-9. It has been shown that caspase-3 is important for the separation of the 4A protein from the β-amyloid precursor. This separation has been related to the deposition of Abeta peptide and the death of neurons in Halzheimers disease and hippocampal neurons after ischemic and exitoxic brain damage. There is a crystal structure available for caspase-3 [1CP3, Mittl, P.R., et al., J Biol. Chem 272: 6539-6547 (1997)]. Cloning of Human Caspase-3 The human version of caspase-3 (also known as Yama, CPP32 3) has been cloned directly from Jurkat cells (Clone E6-1; ATCC). Briefly, total RNA is purified from Jurkat cells growing at 37 ° C / 5% C02 using Tri-Reagent (Sigma). The oligonucleotide primers are designed to allow the DNA to encode the large and small subunits of Caspasa-3 / Yama / CPP32 that are amplified by polymerase chain reaction (PCR). Briefly, the DNA encoding amino acids 28-175 (which covers most of the large subunit) is directly amplified from 1 μg of total RNA using Ready-To-Go-PCR spheres (Amersham / Pharmacia) and the following oligonucleotides: direct large casp-3 TTCCATATGTCTGGAATATCCCTGGACAACAGTTA IDENTIFICATION SEQUENCE NUMBER: 90 cas-3 large inverse AAGGAATTCTTAGTCTGTCTCAATGCCACAGTCCAG SEQUENCE OF IDENTIFICATION NUMBER: 91 The DNA that codes for amino acids 176-277 - 82 - (spanning most of the small subunit) is directly amplified from 1μg of total RNA using Ready-To-Go-PCR spheres (Amers am / Pharmacia) and the following oligonucleotides: direct small casp-3 TTCCATATGAGTGGTGTTGATGATGACATGGCG IDENTIFICATION SEQUENCE NUMBER: 92 casp-3 small reverse AAGGAATTCTTAGTGATAAAAATAGAGTTCTTTTGTGAG IDENTIFICATION SEQUENCE NUMBER: 93 The amplified DNA corresponding to the large subunit or the small subunit of caspase-3 is then separated with the restriction enzymes EcoRI and Ndel and cloned directly using standard molecular biology techniques in pRSET-b (Invitrogen) digested with EcoRI and Ndel . [See, for example, Tewari. M., et al., Yama / CPP32 ß, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly (ADP-ribose) polymerase, Cell 81; 801-809 (1995)]. Generation of Casp-3 Cys Mutations Plasmids containing DNA encoding either the large or small subunits of Caspase-3 are transformed separately into E. coli 12 CJ236 cells (New England BioLabs) and the cells containing each construct are selected for their ability to grow on agar plates - 83 - containing ampicillin. The overnight cultures of the large and small subunits are individually grown in 2? (containing 100 g / ml ampicillin) at 37 ° C. Each culture is diluted 1: 100 and grown at ASOo = 0.3-0.6. A sample of 1.5 ml of each culture is extracted and infected with 10 μ? phage VCS-M13 (Stratagene), is stirred at 37 ° C for 60 minutes and overnight culture of each is prepared with 1 ml of the infected culture diluted 1: 100 in 2? with 100 μg / ml of ampicillin and 20 μg / μl of chloramphenicol, and it is grown at 37 ° C. The cells are centrifuged at 3000 rcf for 10 minutes and a 1/5 volume of PEG20% / 2.5 M NaCl is added to the supernatant. The samples are incubated at room temperature for 10 minutes and then centrifuged at 4000 rcf for 15 minutes. The phage pellet is resuspended in PBS and centrifuged at 15 rpm for 10 minutes to separate the remaining particulate material. The supernatant is retained and the single chain DNA of the supernatant is purified following the procedures for the QIA pre equipment. spin 13 (Qiagen). Mutagenic Oligonucleotides Mutations of cysteine in the small subunit are produced with the corresponding primers: Y204C TCGCCAAGAACAATAACCAGG IDENTIFICATION SEQUENCE NUMBER: 94 S209C GCCATCCTTACAATTTCGCCA - 84 - IDENTIFICATION SEQUENCE NUMBER: 95 21 C CTGGATGAAACAGGAGCCATC IDENTIFICATION SEQUENCE NUMBER: 96 S251C AGCGTCAAAGCAAAAGGACTC IDENTIFICATION SEQUENCE NUMBER: 97 F256C CTTTGCATGACAAGTAGCGTC SEQUENCE OF IDENTIFICATION NUMBER: 98 Mutations of cysteine in the large subunit are made with the corresponding primers: M61C CCGAGATGTACATCCAGTGCT SEQUENCE OF IDENTIFICATION NUMBER: 99 T62C AGACCGAGAACACATTCCAGT SEQUENCE OF IDENTIFICATION NUMBER: 100 S65C ATCTGTACCACACCGAGATGT SEQUENCE OF IDENTIFICATION NUMBER: 101 H121C TTCTTCACCACAGCTCAGAAG IDENTIFICATION SEQUENCE NUMBER: 102 L168C GCCACAGTCACATTCTGTACC IDENTIFICATION SEQUENCE NUMBER: 103 Approximately 100 pmol of each primer is phosphorylated upon incubation at 37 ° C for 60 minutes in buffer containing TM IX buffer (0.5 M Tris, pH 7.5, 0.1 MgCl2 M), 1 mM ATP, 5 mM DTT, and 5U of T4 kinase (NEB). The kinase primers are annealed to the template DNA in a reaction volume of 20 μ? (~ 50 ng of primer with -85-kinase, TM IX buffer and 10-50 ng of single-stranded DNA) by incubation at 85 ° C for 2 minutes, 50 ° C for 5 minutes and then at 4 ° C for 30 minutes. -60 minutes. A combination of extension is added to each reassociation reaction (ATP 2 itiM, 5 mM dNTP, 30 mM DTT, T4 DNA ligase (NEB) and T7 polymerase (NEB)) and incubated at room temperature for 3 hours. The mutagenized DNA is transformed into E. coli XLl-Blue cells and the colonies containing the plasmid DNA are selected for growth on LB agar plates containing 100 μg / ml ampicillin. DNA sequencing is used to identify plasmids that contain the appropriate mutation. Expression of the Casp-3 Mutant Proteins The plasmid DNA coding for the cysteine mutations in the large subunit is transformed into Codon Plus BL21 cells and the plasmid DNA encoding cysteine mutations in the small subunit is transformed into BL21 cells ( DE3) pLysS. Codon Plus BL21 cells containing plasmids encoding the wild-type and mutated versions with cysteine in the large subunit are grown in 2YT containing 150 pg / ml ampicillin, overnight at 37 ° C and harvested immediately . BL21 pLysS cells containing the plasmids encoding the wild-type and mutated versions with cysteine de-86 - the small subunit are grown in 2YT at 37 ° C with 150 μ / ta1 ampicillin to A6oo = 0.6. The cultures are subsequently induced with IPTG ImM and grown for an additional 3-4 hours at 37 ° C. After harvesting the cells by centrifuging at 4K rpm for 10 minutes, the cell pellet is resuspended in Tris-HCl (pH 8.0) / 5 mM EDTA and subjected to microfluidization twice. The inclusion bodies are isolated by centrifugation at 9K rpm for 10 minutes and then resuspended in 6 M guan dina hydrochloride. The denatured subunits are diluted rapidly and uniformly up to 100 pg / ml in renaturation buffer (100 mM tris / KOH (pH 8.0), 10% sucrose, 0.1% CHAPS, 0.15 M NaCl and 10 mM DTT) and allowed to renature by incubation at room temperature for 60 minutes, with gentle agitation. The renatured proteins are dialyzed overnight in a buffer containing 10 mM Tris (pH 8.5), 10 mM DTT and 0.1 mM EDTA. The precipitate is separated by centrifugation at 9K rpm for 15 minutes and the supernatant is filtered through a 0.22 m cellulose nitrate filter. The supernatant is then loaded onto an anion exchange column (Uno5 Q-Column (BioRad)), and the correctly folded caspase-3 protein is eluted with a gradient of 0-0.25 M NaCl at 3 ml / min. Aliquots of each fraction are subjected to electrophoresis in a denaturing gel of - 87 - polyacrylamide and the fractions containing the Caspase-3 protein are accumulated. EXAMPLE 7 CLONING AND MUTAGENESIS OF THE HUMAN PHYSIAN TIROSINE F0SFATASE-1B (PTP-1B) PTP-1B (accession number SWS P18031) is a tyrosine phosphatase having a C terminal domain that is associated with the endoplasmic reticulum (ER, its acronym in English) and a phosphatase domain that is oriented towards the cytoplasm. The proteins that dephosphorylate are transported to this place by vesicles). The activity of PTP-1B is regulated by phosphorylation on serine and protein degradation. PTP-1B is a negative regulator of insulin signaling and plays a role in the cellular response to interferon stimulation. This phosphatase may play a role in obesity by decreasing the sensitivity of organisms to leptin, which increases appetite. Additionally, PTP-1B plays a role in the control of cell growth. A crystal structure for PTP-1B has been resolved [1PTY, Puius, Y. A., et al., Proc Nati Acad Sci U S A 94: 13420-13425 (1997)]. Cloning of human PTP-1B full length human PTP-1B has a length of 435 amino acids; the protease domain comprises the first 288 amino acids. Because the truncated portions of PTP-IB comprising the protease domain are fully active, several truncated versions of PTP-IB are often used. CDNA encoding the first 321 amino acids of human PTP-IB is isolated from total RNA of human fetal heart (Clontech). The oligonucleotide primers corresponding to nucleotides 91 to 114 (Dir) and complementary to nucleotides 1030 to 1053 (Inv) of the cDNA for PTP-IB [Genbank M31724.1, Chernoff, J., et al., Proc. Nati Acad. Sci. USES. 87: 2735-2739 (1990)] are synthesized and used to generate an AND using the polymerase chain reaction. Direct GCCCATATGGAGATGGAAAAGGAGTTCGAG IDENTIFICATION SEQUENCE NUMBER: 104 Inverse GCGACGCGAATTCTTAATTGTGTGGCTCCAGGATTCGTTT IDENTIFICATION SEQUENCE NUMBER: 105 The forward primer incorporates an Ndel restriction site in the first ATG codon and the Rev primer inserts a UAA stop codon followed by an EcoRI restriction site after nucleotide 1053. The cDNAs are digested with nucleases of restriction Ndel and EcoRI and are cloned into pRSETc (Invitrogen) using standard molecular biology techniques. The identity of the isolated cDNA is verified by DNA sequence analysis (the methodology is indicated in the last paragraph). - 89 - A shorter cDNA, PTP-IB 298 encoding amino acids 1-298, is generated using the forward and Rev2 oligonucleotide primers and the clone described above as a template in a polymerase chain reaction. Rev2 TGCCGGAATTCCTTAGTCCTCGTGGGAAAGCTCC IDENTIFICATION SEQUENCE NUMBER: 106 Generation of PTP-IB Cysteine Mutants Mutants directed to the PTP-IB site (amino acids 1-321), PTP-IB 298 (amino acids 1-298) and PTP-IB 298-2M (where Cys32 and Cys92 change to Ser and Val, respectively) are prepared by the single-stranded DNA method (modification of Kunkel, 1985). 298-2M is produced with the following oligonucleotides. C32S CTTGGCCACTCTAGATGGGAAGTCACT 'IDENTIFICATION SEQUENCE NUMBER: 107 C92V CCAAAAGTGACCGACTGTGTTAGGCAA IDENTIFICATION SEQUENCE NUMBER: 108 Oligonucleotides are designed to contain the desired mutations and 12 flanking sequence bases on each side of the mutation, the single chain form of PTP-lB / pRSET, PTP-IB 298 / pRSET and PTP -IB 298-2M / pRSET are prepared by transforming the double-stranded plasmid into the CJ236 cell line (1 μ? Of double-stranded plasmid DNA, 2 μ? Of 5 × KCM salts, 7 μ? Of water, 10 μ? of CJ236 cells competent in PEG-DMSO, incubated in ice-90- for 20 minutes, followed by 25 ° C for 10 minutes, sown in plates in LB / agar with 100 μg / ral of ampicillin and incubated at 37 ° C. ° C during the night). The single colonies of CJ236 cells are then grown in 100 ml of 2YT medium to the logarithmic mean phase; then add 5 μ? of cooperating phage VCS (Stratagene) and the mixture is incubated at 37 ° C overnight. The single chain DNA of the supernatant is isolated by phage precipitation (1/5 volume of PEG 8000/20% / 2.5 M NaCl, centrifugation at 12K for 15 minutes). The single-stranded DNA is then isolated from the phage using the Qiagen single stranded DNA kit. The site-directed mutagenesis is completed as follows. The oligonucleotides are dissolved in TE (10 mM Tris, pH 8.0, 1 mM EDTA) to a concentration of 10 OD and phosphorylated at the 5 'end (2 μ? Of oligonucleotide, 2 μ? Of 10 mM ATP, 2 μ?). of buffer Tris-magnesium chloride lOx, 1 μ? of DTT 100 mM, 12.5 μ? of water, 0.5 μ? of T4 PNK, incubated at 37 ° C for 30 minutes). The phosphorylated oligonucleotides are then annealed to a single-stranded DNA template (2 μ? Of single-stranded plasmids, 0.6 μ? Of oligonucleotide, 6.4 μ? Of water, heated at 94 ° C for 2 minutes, cooled slowly to the ambient temperature). Next, double-stranded DNA is prepared from the reassociated oligonucleotide / template (2 μl of TM lOx buffer, 2 μl of the 2.5 mM dNTP, 1 μl of DTT-91- is added) 100 mM, 0.5 μ? of ???, 10 mM, 4.6 μ? of water, 0.4 μ? of DNA polymerase T7, 0.2 μ? of DNA ligase T4; incubated at room temperature for 2 hours). E. coli (XL1 blue, Stratagene) is then transformed with the double-stranded DNA (5 μ? Double-stranded DNA, 5 μ? KC, 5 × 15 μ? Water, 25 μ? Competent PEG cells -DMSO, incubate 20 minutes on ice, 10 minutes at room temperature), sow in plates on LB / agar containing 100 μg / ml of ampicillin and incubate at 37 ° C overnight. Approximately 4 colonies of each plate are used to inoculate 5 ml of 2YT containing 100 g / ml of ampicillin; these cultures are grown at 37 ° C for 18-24 hours. The plasmids are then isolated from the cultures using the Qiagen miniprep kit. These plasmids are sequenced to determine which clones contain the desired mutation. A list of the constructs and unique cysteine mutations performed in each context is given below. Construct Mutants PTP-1 B 321 H25C, D29C, R47C, D48C, S50C, K120C, M258C PTP-1 B 298 H25C, D29C, D48C, S50C, K120C, M258C, F280C PTP-1 B 298-2M E4C, E8C, H25C, A27C, D29C, K36C, Y46C , R47C, D48C, V49C, S50C, F52C, K120C, S151C, Y152C, T178C, D181C, F182C, E186C, S187C, A189C, K197C, E200C, L272C, E276C, 1218C, M258C, Q262C, V287C However, it should be understood that any of the mutants directed to the site can be made in any PTP-1B construct. For example, another construct is another truncated version of PTB-1B having the residues 1-382, which is shown as the SEQUENCE OF IDENTIFICATION NUMBER: 109 below. 1 MEMEKEFEQI DKSGSWAAIY QDIRHEASDF PCRVAKLPKN KNRNRYRDVS PFDHSRIKLH 61 QEDNDYINAS LI MEEAQRS YILTQGPLPN TCGHFWEMW EQ SRGWML NRVMEKGSLK 121 CAQYWPQKEE KEMIFEDTNL KLTLISEDIK SYYTVRQLEL ENLTTQETRE ILHFHYTTWP 181 DFGVPESPAS FLNFLFKVRE SGSLSPEHGP WVHCSAGIG RSGTFCLADT CLLLMDKRKD 241 PSSVDIK VL LEMRKFRMGL IQTADQLRFS YLAVIEGAKF IMGDSSBQDQ WKELSHEDLE 301 PPPEHIPPPP RPPKRILEPH NG CREFFPN HQ VKEETQE DKDCPIKEEK GSPLNAAPYG 361 IESMSQDTEV RSRWGGSLR GA Utagenic oligonucleotides E4C CTCGAACTCCTTGCACATCTCCATATG SEQUENCE OF IDENTIFICATION NUMBER: 110 E8C CTTGTCGATCTGGCAGAACTCCTTTTC SEQUENCE OF IDENTIFICATION NUMBER: 111 H25C GTCACTGGCTTCACATCGGATATCCTG SEQUENCE OF IDENTIFICATION NUMBER: 112 H27C TGGGAAGTCACTGCATTCATGTCGGAT - 93 - SEQUENCE OF IDENTIFICATION NUMBER: 113 D29C TCTACATGGGAAGCAACTGGCTTCATG SEQUENCE OF IDENTIFICATION NUMBER: 114 K36C GTTCTTAGGAAGACAGGCCACTCTACA SEQUENCE OF IDENTIFICATION NUMBER: 115 Y46C IDENTIFICATION NUMBER ACTGACGTCTCTGCACCTATTTCGGTT SEQUENCE: 116 SEQUENCE IDENTIFICATION R47C GGGACTGACGTCACAGTACCTATTTCG NUMBER: 117 SEQUENCE IDENTIFICATION D48C AAAGGGACTGACGCATCTGTACCTATT NUMBER: 118 SEQUENCE IDENTIFICATION V49C GTCAAAGGGACTGCAGTCTCTGTACCT NUMBER: S50C 119 IDENTIFICATION NUMBER CTATGGTCAAAGGGACAGCGTCTCTGTACC SEQUENCE: 120 F52C IDENTIFICATION NUMBER CCGACTATGGTCACAGGGACTGACGTC SEQUENCE: 121 SEQUENCE IDENTIFICATION Kl20C GTATTGTGCGCAACATAACGAACCTTT NUMBER: 122 S151C SEQUENCE IDENTIFICATION NUMBER CACTGTATAATAGCACTTGATATCTTC: 123 SEQUENCE IDENTIFICATION 152C GTCGCACTGTATAACATGACTTGATATC NUMBER: 124 SEQUENCE IDENTIFICATION T178C CAAAGTCAGGCCAGCAGGTATAGTGGAA NUMBER: 125-94 - DI81C IDENTIFICATION NUMBER AGGGACTCCAAAGCAAGGCCATGTGGT SEQUENCE: 126 SEQUENCE IDENTIFICATION E186C GAATGAGGCTGGTGAGCAAGGGACTCCAAAG NUMBER: 127 S187C SEQUENCE IDENTIFICATION NUMBER GAATGAGGCTGGGCATTCAGGGACTCC: 128 SEQUENCE IDENTIFICATION Al89C GTTCAAGAATGAGCATGGTGATTCAGG NUMBER: 129 SEQUENCE IDENTIFICATION Kl97C CTGACTCTCGGACGCAGAAAAGAAAGTTC NUMBER: 130 E200C GAGTGACCCTGAGCATCGGACTTTGAAAAG IDENTIFICATION NUMBER SEQUENCE: 131 M258C CTGGATCAGCCCACACCGAAACTTCCT IDENTIFICATION NUMBER SEQUENCE: 132 Q262C CTGGTCGGCTGTACAGATCAGCCCCAT IDENTIFICATION NUMBER SEQUENCE: 133 L272C CTTCGATCACAGCGCAGTAGGAGAAGCG IDENTIFICATION NUMBER SEQUENCE: SEQUENCE GAATTTGGCACCGCAGATCACAGCCAG 276C 134 IDENTIFICATION NUMBER: 135 UI281C AGAGTCCCCCATGCAGAATTTGGCACC IDENTIFICATION SEQUENCE NUMBER: 136 V287C CCACTGATCCTGGCAGGAAGAGTCCCC IDENTIFICATION SEQUENCE NUMBER: 137 In addition to cysteine mutations, mutations that remove naturally occurring cysteines can also be performed. For example, two different "deletions" of Cys 215 are performed in the context of PTP-1B 298-2M using the following oligonucleotides: C215A GATGCCTGCACTGGCGTGCACCACAAC IDENTIFICATION SEQUENCE NUMBER: 138 S215S GATGCCTGCACTGGAGTGCACCACAAC IDENTIFICATION SEQUENCE NUMBER: 139 In the context of PTP- 1B 298 two quadruple mutants are made using the oligonucleotide C92A shown below. These are C32S, C92A, V287C, C215A, which use the SEQUENCE OF IDENTIFICATION NUMBER: 107, SEQUENCE OF IDENTIFICATION NUMBER: 140, SEQUENCE OF IDENTIFICATION NUMBER: 137 and SEQUENCE OF IDENTIFICATION NUMBER: 138 and C32S, C92A, E276C, C215A, which use SEQUENCE OF IDENTIFICATION NUMBER: 107, SEQUENCE OF IDENTIFICATION NUMBER: 140, SEQUENCE OF IDENTIFICATION NUMBER: 135, and SEQUENCE OF IDENTIFICATION NUMBER: 138. C92A CCAAAAGTGACCGGCTGTGTTAGGCAA SEQUENCE OF IDENTIFICATION NUMBER: 140 Sequencing of the clones of PTP-1B it is carried out as follows. The concentration of plasmid DNA is quantified by absorbance at 280 nm, 1000 ng of the plasmid is mixed with sequencing reagents (1 DNA, ß μ? of - 96 - water, 1 μ? of sequence primer to 3.2 μm / μ ?, 8 μ? of sequential mixture with Big Dye [Applid Biosystems] ). The sequencing primers are SEQUENCE OF IDENTIFICATION NUMBER: 17 and IDENTIFICATION SEQUENCE NUMBER: 18. The mixture is then run through a PCR cycle (9S ° C, 10 s; 50 ° C, 5s; 60 ° C 4 minutes, 25 cycles) and the DNA reaction products are precipitated (mixture of 20 μ ?,, 80 μ? Of 75% isopropanol, incubated 20 minutes at room temperature and then set at 14 K rpm for 20 minutes). minutes, washing with 250 μ? of 75% isopropanol, heating for 1 minute at 94 ° C). The precipitated products are then resuspended in 20 μ? from TSB (Applied Biosystems) and the sequence is read and analyzed by an Applied Biosystems 310 capillary gel sequencer. In general, 1/4 of the plasmids contain the desired mutation. Expression of PTP-IB Cysteine Mutants Mutant proteins are expressed as follows. PTP-IB clones are transformed into BL21 codon plus cells (Stratagene) (1 μl of double-stranded DNA, 2 μl of 5x KCM, 7 μl of water, 10 μl of competent DMSO cells, incubated minutes at 4 ° C, 10 minutes at room temperature), plates are seeded on LB / agar containing 100 μ? / p ?? of ampicillin and incubated at 37 ° C overnight. Two single colonies are taken from the frozen glycerol plates or concentrates of these mutants and inoculated into 100 ml of 2YT with 50 μg / ml of carbenicillin and grown overnight at 37 ° C. 50 ml of the cultures are added overnight at 1.5 1 of 2YT / carbenicillin (50 μg / ml) and incubated at 37 ° C for 3-4 hours until the late logarithmic phase (absorbance at 600 nm ~ 0.8-0.9) . At this point, protein expression is induced with the addition of IPTG to a final concentration of 1 mM. The cultures are incubated at 37 ° C for another 4 hours and then the cells are harvested by centrifugation (7K rpm, 7 minutes) and frozen at -20 ° C. The PTP-IB proteins are purified from frozen cell pellets as described in the following. First, the cells are lysed in a microfluidizer in 100 ml of buffer containing 20 M MES, pH 6.5, 1 mM EDTA, 1 M DTT and 10% glycerol buffer (with 3 passes through a microfluidizer [Microfluidies 110S] ) and the inclusion bodies are separated by centrifugation (10 rpm, 10 minutes). The purification of all the PTP-IB mutants is carried out at 4 ° C. The supernatants from the centrifugation are filtered through cellulose acetate 0.45 μ? (5 μl of this material is analyzed by SDS-PAGE) and loaded onto a SP Sepharose rapid flow column (2.5 cm diameter x 14 cm long) equilibrated in buffer A (20 mM MES, pH 6.5, EDTA 1 mM, 1 mM DTT, 1% glycerol) at 4 ml / min. The protein is then eluted using a gradient of 0-50% buffer B for 60 minutes (buffer B: 20 mM MES, pH 6.5, 1 mM EDTA, 1 mM DTT,-98-glycerol 1%, 1 M NaCl). The yield and purity are examined by SDS-PAGE and, if necessary, PTP-1B is further purified by hydrophobic interaction chromatography (HIC). The protein is supplemented with ammonium sulfate until it is reached a final concentration of 1.4 M. The protein solution is filtered and loaded onto a HIC column at 4 ml / min in buffer A2: 25 m Tris, pH 7.5, 1 mM EDTA, 1.4 M (NH) 2 SO4, 1 mM DTT. The protein is eluted with a gradient of 0-100% buffer B for 30 minutes (B2 buffer: 25 mM Tris, pH 7.5, 1 mM EDTA, 1 mM DTT, 1% glycerol). Finally, the purified protein is dialysed at 4 ° C in the appropriate assay buffer (25 mM Tris, pH 8, 100 mM NaCl, 5 mM EDTA, 1 mM DTT, 1% glycerol). Yields vary from one mu to another but are usually within the range of 3-20 mg / 1 of culture. EXAMPLE 8 CLONING? MUTAC-INFECTION OF THE INTEGRATION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV IN) HIV IN is one of the key enzyme targets of the human immunodeficiency virus; separates two oligonucleotides from each 3 'end of the originally blunt viral DNA, and inserts the viral DNA into the host DNA by chain transfer. The integration procedure is completed by the DNA-99-host repair enzymes. HIV IN has three distinct domains: the N terminal domain, the catalytic core domain and the C terminal domain. Although the structures by X-ray crystallography of each of these isolated domains have already been resolved, the manner in which they interact with each other is not yet clear. Integration is absolutely essential for the replication of the virus and the progress of the disease and therefore integrase inhibitors could be used in the treatment of HIV / AIDS. Integrase core domain structures are available [1EXQ, Chen. J. C. -H. , et al., Proc. Nati Acad. Sci. U.S.A. 97: 8233-8238 (2000); 1BL3, Maignan, S., et al., J Mol Biol 282 .359-368 (1998); in complex with tetraphenil arsonium, 1HYZ and 1HYV, Molteni, V., et al, Acta Crystallogr D Bio Crystallog., 57: 536-544 (2001)]. Cloning of HIV IN The numbering of HIV-1 integrase residues, both wild type and mutant, follows the convention of the first amino acid residue of the mature protein that constitutes residue number 1, and the catalytic core domain of the HIV integrase. l is composed of residues 52-210 [Leavitt, AD, et al., J Biol. Chem 268: 2113-2119 (1993)]. A plasmid construct, pT7-7 HT-INtetra / coding for the core domain of HIV-100 integrase - (residues 50-212) having a 6x histidine tag in the N-terminal part and a separable thrombin binder and mutations C56S, W131D, F129D, and F185K in the pT7-7 vector background (Novagen) [Chen. J. C. -H. , et al., Proc. Nati Acad. Sci. U.S.A. 97: 8233-8238 (2000)] is obtained from Dr. Andy Leavitt of UCSF. Upon comparison of the crystal structure of this core domain variant [Chen, J. C. -H., et al., Proc. Nati Acad. Sci. U.S.A. 97: 8233-8238 (2000)], with other integrase core structures it is observed that the F139D mutation, designed to increase the solubility of the protein, causes a rotation of the side chain that transmits a distortion to the catalytically important Aspll6. The mutation is therefore reverted to the wild-type phenylalanine residue by mutagenesis Quickchange (Stratagene) following the manufacturer's instructions and using the SEQUENCE OF IDENTIFICATION NUMBER: 141 AND SEQUENCE OF IDENTIFICATION NUMBER: 142. D139F1-int GTATCAAACAGGAATTCGGTATCCCGTACAAC SEQUENCE OF IDENTIFICATION NUMBER: 141 D139F2-int GTTGTACGGGATACCGAATTCCTGTTTGATACC IDENTIFICATION SEQUENCE NUMBER: 142 This general pT7-7 HT-INtri, which codes for the triple mutant (C56S, W131D, F185K) of the integrase nucleus, SEQUENCE OF IDENTIFICATION NUMBER: 143. - 101 - 52 GQVDSSPGIW QLDCTHLEGK VILVAHVHVAS GYIEAEVIPA ETGQETAYFL LKLAGRWPVK 112 TIHTDNGSNF TGATVRAACD WAGIKQEFGI PYNPQSQGW ESMNKELKKI IGQVRDQAEH 172 LKTAVQMAVF IHNKKRKGGI GGYSAGERIV DIIATDIQT In preparation for producing cysteine mutations at sites of association, the two cysteines wild type (C130 and C65) are replaced by alanine residues and the DNA encoding this INtri-labeled nucleus INtri domain is transferred into a pRSET A vector containing an origin of replication Fl that allows the preparation of single-stranded plasmid DNA and thus mutagenesis by the Kunkel method [Kunkel , TA , et al., Methods Enzymol. 204: 125-139 (1991)]. Substitution of C130 by alanine is carried out by cassette mutagenesis using a double chain cassette constituted of SEQUENCE OF IDENTIFICATION NUMBER: 144 and SEQUENCE OF IDENTIFICATION NUMBER: 145. The cassette containing the appropriate protruding portions at each end is ligated in pT7-7 HT-INtri digested with BsiWI and EcoRI. C130A cassette 1 GTACGTGCTGCAGCCGACTGGGCTGGTATCAAACAGG IDENTIFICATION SEQUENCE NUMBER: 144 C130A cassette 2 GAATTCCTGTTTGATACCAGCCCAGTCGGCTGCAGCAC IDENTIFICATION SEQUENCE NUMBER: 145 The C65A mutation is carried out independently -102- by Quickchange mutagenesis in pT7-7 HT-INtri using SEQUENCE IDENTIFICATION NUMBER: 146 and SEQUENCE OF IDENTIFICATION NUMBER: 147. C65A1-int ATCTGGCAACTGGACGCGACTCACCTCGAGGGT SEQUENCE OF IDENTIFICATION NUMBER: 146 C65A2-int ACCCTCGAGGTGAGTCGCGTCCAGTTGCCAGAT IDENTIFICATION SEQUENCE NUMBER: 147 The DNA encoding the integrase core domain of HT-C130A is subcloned into the pRSET A vector by PCR cloning. The NUMBER IDENTIFICATION SEQUENCE: 148 and NUMBER IDENTIFICATION SEQUENCE: 149 are used as PCT primers, and the resulting amplified product is digested with Ndel and Hind III, and ligated into pRSET A which has been digested with the same enzymes, for generate pRSET-HT-C130A-INtri. C130_rsetF GGAGATATACATATGCACCACCATACC IDENTIFICATION SEQUENCE NUMBER: 148 C130_rsetR ATCATCGATGATAAGCTTCCTAGGTCTGG IDENTIFICATION SEQUENCE NUMBER: 149 A Ba HI fragment of pT7-7 HT-C65A-INtri containing the C65A mutation is ligated into pRSET-HT-C130A-INtri to generate pRSET-HT -Inpiantiiia- This plasmid serves as a template for additional Kunkel mutagenesis to introduce cysteine substitutions at positions selected for association. The NUMBER IDENTIFICATION SEQUENCE is used: - 103 - 17 for sequenced. Oligonucleotides utagénicos Q62C IDENTIFICATION NUMBER GTGAGTCGCGTCCAGGCACCAGATACCCGG SEQUENCE: 150 SEQUENCE IDENTIFICATION D64C CTCGAGGTGAGTCGCGCACAGTTGCCAGATAC NUMBER: 151 SEQUENCE IDENTIFICATION T66C CTTTACCCTCGAGGTGACACGCGTCCAGTTGCC NUMBER: 152 SEQUENCE IDENTIFICATION HS7C GGATAACTTTACCCTCGAGGCAAGTCGCGTCCAGTTG NUMBER: 153 L68C IDENTIFICATION NUMBER AACTTTACCCTCGCAGTGAGTCGCGTCCA SEQUENCE: 154 SEQUENCE IDENTIFICATION K71C GCAACCAGGATAACGCAACCCTCGAGGTG NUMBER: 155 SEQUENCE IDENTIFICATION CAGTTTCCTGACCAGTGCAGGCCGGGATAACTTC E92C NUMBER: 156 SEQUENCE IDENTIFICATION Hl14C GGATCCGTTGTCAGTGCAGATGGTTTTAACCGGC NUMBER: 157 SEQUENCE IDENTIFICATION D116C GTTGGATCCGTTGCAAGTGTGGATGGTTTTAACCG NUMBER: 158 NI20C CGGTAGCACCAGTGAAGCAGGATCCGTTGTCAGTG IDENTIFICATION SEQUENCE NUMBER: 159 N144C CACCCTGAGACTGCGGGCAGTACGGGATACCGA IDENTIFICATION SEQUENCE NUMBER: 160 Ql 8C CATAGATTCAACAACACCGCAAGACTGCGGGTTGT - 104 - SEQUENCE OF IDENTIFICATION NUMBER: 161 I151C GCTCTTTGTTCATAGATTCGCAAACACCCTGAGA SEQUENCE OF IDENTIFICATION NUMBER: 162 El52C GCTCTTTGTTCATAGAGCAAACAACACCCTGAGA SEQUENCE OF IDENTIFICATION NUMBER: 163 NI55C IDENTIFICATION NUMBER CCGATGATTTTTTTGAGCTCTTTGCACATAGATTCAACAAC SEQUENCE: 164 SEQUENCE IDENTIFICATION l56C CCGATGATTTTTTTGAGCTCGCAGTTCATAGATTC NUMBER: 165 SEQUENCE IDENTIFICATION K159C CCTGACCGATGATTTTGCAGAGCTCTTTGTTCAT NUMBER: 166 SEQUENCE IDENTIFICATION Gl63C CCTGATCACGAACCTGGCAGATGATTTTTTTG NUMBER: 167 SEQUENCE IDENTIFICATION Ql68C GGTTTTCAGGTGTTCAGCGCAATCACGAACCTGA NUMBER: 168 TI74C GCCATCTGAACCGCGCATTTCAGGTGTTCAGCC IDENTIFICATION SEQUENCE NUMBER: 169 Expression of IN Cysteine Mutants The core domain expression plasmids of pT7-7 and integrase pRSET are transformed into BL21star E. coli (Invitrogen) by standard methods, and a single colony is used of the resulting plate to inoculate 250 ml of YT 2x broth containing 100 μg / I? ll of ampicillin. After allowing to grow overnight at 37 ° C, the cells are harvested by centrifugation at 4 rpm and resuspended in 100 ml of - 105 - 2YT / amp. 40 ml of the washed cells are used to inoculate 1.5 1 of the same medium and, after growing at 37 ° C to an OD at 600 nm of between 0.5 and 0.8, the culture is moved at 22 ° C and allowed to cool . IPTG is added to a final concentration of 0.1 mM and expression continues for 17-19 h at 22 ° C. The cells are harvested by centrifugation at 4K rpm. Cell pellets are resuspended in 100 ml of Wash 5 buffer (Wash 5: 20 mM Tris HC1, 1 M MgCl2, 5 mM imidazole, 5 mM β-mercaptoethanol, pH 7.4) and lysis is carried out by sonication for 1 minute , repeated for a total of 3 times, with a rest period of 2 minutes between them. Cell debris is separated by centrifugation at 14K rpm followed by filtration. The integrase core domain is purified by affinity chromatography on Ni-NTA super flux resin (Qiagen) at 4 ° C. After loading the cell lysate, the column is washed with Wash 40 buffer (Wash 40: 20 mM Tris-HCl, 0.5 M NaCl, 400 mM imidazole, 5 mM β-mercaptoethanol, pH 7.4) and the IN-labeled core domain. His is eluted with E400 buffer (E400: 20 mM Tris-HCl, 0.5 M NaCl, 400 mM imidazole and 5 mM β-mercaptoethanol). The purified enzyme is dialyzed against 20 mM Tris, 0.5 M NaCl, 2.5 mM CaCl 2 and 5 mM β-mercaptoethanol, pH 7.4 at 4 ° C and aliquots are formed in 1.5 ml tubes. Biotinylated thrombin (Novagen) (thrombin 2U / mg protein) is added and the tubes are spun overnight at 4 ° C, -106-followed by thrombin separation using streptavidin-agarose resin (Novagen) and separation of the His-tagged protein and the peptides of the material separated by passage through a second column of Ni-NTAse rapid flow: arose · Separated and purified integrase core domain is dialyzed against 20 mM Tris-HCl, 0.5 NaCl M, 3 mM DTT and 5% glycerol, pH 7.4 and stored at -20 ° C. The protein concentrations are determined by absorbance at 280 nm after removing the salt in columns NAP-5 (Pharmacia) using 28? 1% = (1174) and the molecular weights are confirmed by ESI mass spectrometry (Finnigan). EXAMPLE 9 ENZYME 1 PROTEIN SEPARATOR BACE1) SITE AMYLOID PRECURSOR ß HUMAN BACE1 (access number SWS 56817) is an integral glycoprotein type 1 that is an aspartic protease. Found mainly in the Golgi apparatus, BACE1 separates the amyloid precursor protein to form the Abeta peptide. A strong relationship between the deposition of this peptide in the brain and Halzheimer's disease has been demonstrated; therefore, BACE1 is one of the primary targets for this disease. A crystal structure of BACE1 has been resolved [1FKN, Hong, L. et al., Science 290: 150-153 (2000)]. Cloning of BACE 1 Human - 107 - The sequence of the protease domain gene (bases 64-1362, amino acid residues 22-454) is subcloned from pFBHT in the pRSETC expression vector of E. coli by PCR, to create pB22, which serves as a template for mutagenesis in order to incorporate cysteine association sites. For a description of pFBHT, a modified pFastBac plasmid, see Example 4 above. The subcloning is carried out as follows. The cDNA coding for full-length human BACE1, bases 1-1551, is obtained from the initiator Met codon and includes 48 additional bases of the mRNA transcript after the stop codon [Vassar, R. , et al. , Science 286: 735-741 (1999)] by a combination of PCR cloning of 1425 bases 3 'from human cDNA libraries and synthesis of the remaining 5' 5 'bases by serial superposition PCR. All PCR reactions are performed using Advantage2 polymerase (Clontech) according to the manufacturer's instructions. PCR fragments spanning bases 126-374 are obtained by PCR from a human cerebral cortex library and SEQUENCE OF IDENTIFICATION NUMBER: 170 and SEQUENCE OF IDENTIFICATION NUMBER: 171; a fragment spanning bases 339-770 is obtained by PCR from a Stratagene Unizap XR human brain cDNA library and NUMBER IDENTIFICATION SEQUENCE: 172 and SEQUENCE IDENTIFICATION NUMBER: 173; and the fragment of the 3 'end is obtained, which covers the bases 735-1551 by PCR from a human brain library, using the SEQUENCE OF IDENTIFICATION NUMBER: 174 and SEQUENCE OF IDENTIFICATION NUMBER: 175. The three fragments , which have 35 base pairs of overlap in the junctions, are gel purified and combined in a PCR reaction, using primers for the ends (NUMBER IDENTIFICATION SEQUENCE: 170 and NUMBER IDENTIFICATION SEQUENCE: 176) to amplify the product 126-1551. For2 GCTGCCCCGGGAGACCGACGAAGA IDENTIFICATION NUMBER SEQUENCE: 170 midRev2 CGGAGGTCCCGGTATGTGCTGGAC IDENTIFICATION NUMBER SEQUENCE: 171 midFor CCAGAGGCAGCTGTCCAGCACATA IDENTIFICATION NUMBER SEQUENCE: 172 midRevl TCCCGCCGGATGGGTGTATACCAG IDENTIFICATION NUMBER SEQUENCE: 173 BACE14 GTACACAGGCAGTCTCTGGTATACACC IDENTIFICATION NUMBER SEQUENCE: 174 BACE11 GTGTGGTCCAGGGGAATCTCTATCTTCTG IDENTIFICATION SEQUENCE NUMBER: 175 BACE5 GTCATCGTCTCGAGTCACTTCAGCAGGGAGATGTCATGAG IDENTIFICATION SEQUENCE NUMBER: 176 Piece 126-1551 and subsequent elongate products - 109 - are used as templates for the series superposition PCR reactions, to add the bases -126 5 'remnants using the IDENTIFICATION SEQUENCE NUMBER: 177, SEQUENCE OF IDENTIFICATION NUMBER: 178 and SEQUENCE OF IDENTIFICATION NUMBER: 179 as direct primers, with the IDENTIFICATION SEQUENCE NUMBER: 176 always as the reverse primer. BACE fill2 CGGCTGCCCCTGCGCAGCGGCCTGGGGGGCGCCCCCCTGGGGCTGCGGCTGCCCCGGGAG SEQUENCE OF IDENTIFICATION NUMBER: 177 BACE filll ATGGGCGCGGGAGTGCTGCCTGCCCACGGCACCCAGCACGGCATCCGGCTGCCCCTGCGC IDENTIFICATION SEQUENCE NUMBER: 178 BACE for-EcoRi CCGGAATTCATGGCCCAAGCCCTGCCCTGGCTCCTGCTGTGGATGGGCGCGGGAGTG SEQUENCE OF IDENTIFICATION NUMBER: 179 SEQUENCE OF IDENTIFICATION NUMBER: 179 and SEQUENCE OF IDENTIFICATION NUMBER: 176 contain EcoRi and Xhol restriction sites, respectively, and digestion of the PCR product, together with the Bacoluvirus expression vector, pFBHT with the same enzymes is followed by gel purification and ligation of the resulting DNA fragments, which provides the construct, pFBHT-BACE. This construct is used as a template for PCR amplification of bases 1-1362, which correspond - 110 - to the preproBACE soluble protease domain - using NUMBER IDENTIFICATION SEQUENCE: 180 and IDENTIFICATION SEQUENCE NUMBER: 181. proFor-Nde CGCCATATGGCGGGAGTGCTGCCTGCCCACGGC. IDENTIFICATION SEQUENCE NUMBER: 180 BACErev-RI CCGGAATTCTCAGGTTGACTCATCTGTCTGTGGAAT SEQUENCE OF IDENTIFICATION NUMBER: 181 The SEQUENCE OF IDENTIFICATION NUMBER: 180 and SEQUENCE OF IDENTIFICATION NUMBER: 181 contain the restriction sites Ndel and EcoRI respectively, and the digestion of the PCR product together with the expression vector of E. coli, pRSETC with the same enzymes is followed by gel purification and ligation of the resulting DNA fragments leading to the pBl construct. The vector pB1 is then used as a template for Kunkel mutagenesis (Kunkel, TA, et al., Methods Enzymol, 154: 367-382

[1987]) to suppress the BACE presequence (bases 1-63) which produces the pB22 construct . The pB22 construct serves as a template for mutagenesis in order to incorporate cysteine association sites, using either the Kunkel method or the Quickchange mutagenesis kit (Stratagene). Mutagenic Oligonucleotides L91C GCCTGTATCCACGCAGATGTTGAGCGT SEQUENCE OF IDENTIFICATION NUMBER: 182 T133C CTGCCCTGGCAGTAGGGCACATACCA - 111 - SEQUENCE OF IDENTIFICATION NUMBER: 183 Q134C TTCCCACTTGCCGCAGGTGTAGGGCAC SEQUENCE OF IDENTIFICATION NUMBER: 184 F169C CGTTGATGAAGCACTTGTCTGATTCGC SEQUENCE OF IDENTIFICATION NUMBER: 185 I171C IDENTIFICATION NUMBER GTTGGAGCCGTTGCAGAAGAACTTGTC SEQUENCE: 186 SEQUENCE IDENTIFICATION R189C GGAGTCGTCAGGACAGGCAATCTCAGC NUMBER: 187 SEQUENCE IDENTIFICATION Y259C GATGACCTCATAACACCACTCCCGCCG NUMBER: 188 SEQUENCE IDENTIFICATION N294C GGGCAAACGAAGGCAGGTGGTGCCACT NUMBER: 189 SEQUENCE IDENTIFICATION R296C TTTCTTGGGCAAACAAAGGTTGGTGGT NUMBER: 190 T390C CATAACAGTGCCGCAGGATGACTGTGA SEQUENCE OF IDENTIFICATION NUMBER: 191 V393C AACAGCTCCCATACAAGTGCCCGTGGA SEQUENCE OF IDENTIFICATION NUMBER: 192 Expression of BAC Human Mutants Plasmid pB22 is transformed into BL21star E. coli (Invitrogen) by standard methods, and a single colony of the resulting plate is used to inoculate 50 ml of 2xYT broth containing 100 pg / ml of ampicillin. After growing overnight at 37 ° C, 40 ml of the culture - 112 - are used to inoculate 1.5 1 of the same medium, and after growing at 37 ° C to an OD at 600 nm of between 0.5 and 0.8, IPTG is added to a final concentration of 1.0 mM and expression continues for 3 h at 37 ° C. The cells are harvested by centrifugation at 4 rpm. The cell pellets are resuspended in 100 ml of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and the lysis is carried out using a French press microfluidizer (two passes). The crude extract containing BACEl as insoluble inclusion bodies is centrifuged at 14K rpm for 15 minutes and the resulting pellet is washed by resuspension in PBS (10 mM sodium phosphate, 150 mM NaCl, pH 7.4) followed by centrifugation at 14K rpm during 20 minutes. The washed inclusion body pellets are solubilized in 50 mM CAPS, 8 M urea, 1 mM EDTA and 100 mM β-mercaptoethanol, pH 10 and the remaining insoluble residues are separated by centrifugation at 20 rpm for 30 minutes. BACEl is renatured by slow injection of urea-solubilized protein between 50 and 100 volumes of rapidly stirred water, or 10 mM Na2C03, pH 10, followed by incubation at room temperature for 3-7 days. When the enzymatic activity of BACEl is no longer increased with respect to time, the pH of the renaturation solution is adjusted 8.0 by the addition of 5 mM Tris-HCl (final concentration) and loaded on a Q-Sepharose column. The protein is eluted using a linear-113 gradient from 0 to 500 mM NaCl in 10 mM Tris-HCl, H 8.0. BACE1 is further purified by chromatography on S-Sepharose at pH 4.5. The purified enzyme is dialyzed versus 20 mM Tris, 0.125 M NaCl, pH 7.2 at 4 ° C and stored at 4 ° C. The protein concentrations are determined by absorbance at 280 nm, using e28? 1% = (0.74). EXAMPLE 10 CLONING AND MUTAGENESIS OF PROTEIN KINASE ACTIVATED BY MITOGEN / KINASE KINASE REGULATED BY EXTRACELLULAR SIGNAL (MEK) Mek-1 (Accession number SWS Q02750) is a double-specificity kinase that plays a fundamental role in cell proliferation and survival in response to mitogenic stimuli. The Mek-1 enzyme is the central component of a three-kinase shell commonly referred to as the MAP kinase cascade. This cascade of Raf-Mek-Erk kinase transmits information from cell surface receptors (eg EGFR, HER2, PDGFR, FGFR, IGF, etc.) to the nucleus. This trajectory is activated by approximately 30% in all tumor types, either by overexpression of specific receptors on the cell surface (for example HER2 in breast cancers) or through activating mutations in Ras, a key upstream component of this trajectory. The interruption of the Mek-1 function has remarkable antitumor effects both in cell culture and in animals. Mek-2 (number of - 114 - access S S P36507) is a double specificity kinase that is highly homologous (79% identity) with Mek-1 and which is expressed in a coordinated manner with Mek-1. Therefore, Mek-1 and Mek-2 represent attractive targets for the development of novel therapeutic treatments against cancer. There are no crystalline structures for Mek-1 or Mek-2 until now. Cloning of human Mek-1 and Mek-2 The numbering of the residues of Mek-1 and Mek-2 wild-type mutants starts at their respective amino-terminal parts, with the residue number 1 constituted by the start methionine, according to the sequences presented by the NCBI (NCBI access number L05624 for Mek-1 and NCBI access number HUMMEK2F for Mek-2). All the stages of cloning and standard mutagenesis are carried out according to the recommendations of the enzyme manufacturers. The DNA encoding human Mek-1 is isolated from the plasmid pUSE MEK1 (Upstate Biotechnology) and inserted into the plasmid pGEX-4T (Amersham) in frame with GST, as follows. First, digested pUSE MEK1 with Notl (New England Biolabs), the 3 'overhanging part is filled in with the Klenow fragment of DNA polymerase (New England Biolabs) and isolated from an agarose gel of the product of 1193 pairs of bases that codes for MEK1. It is linearized pGEX-4Tl by digestion by EcoRI (New England Biolabs) and the 3 'overhang is similarly filled with the Klenow fragment of DNA polymerase (New England Biolabs). The DNA fragments for ME1 and for pGEX-4T-l are then ligated with T4 ligase and amplified in E. coli strain ToplOF '(Invitrogen) to generate the pGEX-MEXl plasmid. The DNA encoding human Mek-2 is isolated from the plasmid pUSE MEK2 (Upstate Biotechnology) and inserted into the plasmid pGEX-4T-1 (Amersham) in frame with GST, as follows. First, digested pUSE MEK2 with Notl (New England Biolabs), the 3 'overhanging part is filled in with the Klenow fragment of DNA polymerase (New England Biolabs) and the 1213 base pair product encoding MEK2 is isolated from an agarose gel. PGEX-4T.l is linearized by digestion with EcoRI (New England Biolabs), and the 3 'overhang is similarly filled in with the Klenow fragment of DNA polymerase (New England Biolabs). The DNA fragments for MEK2 and for pGEX-4T-l are then ligated with T4 ligase and amplified in E. coli strain ToplOF '(Introgen) to generate the plasmid pGEX-MEX2. Generation of cysteine of Mek-1 and Mek-2 All mutagenesis steps are performed using long-range PCR. The reactions contain the original plasmid (2 ng / μ?), The direct strand mutant primer (0.5 μ?) And the antisense strand mutant primer - 116 - (0.5 μ?) Which is unique for each reaction. In addition, all reactions contain dNTP (25 μ?) And Pfu polymerase (0.05 units / μ ?; Stratagene). The reactions are incubated for 1 minute at 95 ° C followed by 16 cycles of (0.5 minutes at 95 ° C / 1 minute at 55 ° C and 2 minutes at 68 ° C) and 10 final minutes at 68 ° C. The original plasmid DNA is then digested with Dpnl (New England Biolabs) and the remaining linear PCR product is transformed into E. coli strain ToplOF '(Invitrogen). The mutagenized plasmid DNA, the result of in vivo recombination and subsequent amplification, is purified using QIAquick columns (Qiagen) and verified by sequencing. First, a 6xHIS epitope tag is introduced into pGEX-ME 1, in the carboxy-terminal part of MEK1, to generate pGEX-MEK1-HIS using the direct and antisense oligonucleotides MEK1-6HIS-s and MEK1-6HIS-as, respectively. Similarly, the 6xHIS epitope tag is introduced into pGEX-MEK2, in the carboxy-terminal part of MEK2, to generate pGEX-MEK2 -HIS using the direct and antisense oligonucleotides MEK2-6HIS-S and MEK2-6HIS-as, respectively. MEK1-6HIS-S CACGCTGCCAGCATCGGCGTCGACCCAACCCTGGTT CCGCGTGGATCCCATCACCATCACCATCACTGAGCG GCCAATTCCCGG SEQUENCE OF IDENTIFICATION NUMBER: 193 - 117 - MEK1-6HIS- s CCGGGAATTGGCCGCTCAGTGATGGTGATGGTGATG GGATCCACGCGGAACCAGGGTTGGGTCGACGCCGAT IDENTIFICATION NUMBER GCTGGCAGCGTG SEQUENCE: 194 MEK2- 6H S-s ACGCGTACTGCAGTGGGCGTCGACCCAACCCTGGTT CCGCGTGGATCCCATCACCATCACCATCACTGAGCG IDENTIFICATION NUMBER GCCAATTCCCGG SEQUENCE: 195 MEK2 - 6HIS-as CCGGGAATTGGCCGCTCAGTGATGGTGATGGTGATG GGATCCACGCGGAACCAGGGTTGGGTCGACGCCCAC TGCAGTACGCGT IDENTIFICATION SEQUENCE NUMBER: 196 Subsequently, 16 individual mutations are introduced into pGEX-MEXl-HIS. Similarly, 16 individual analogous mutations are introduced into pGEX-MEK2-HIS. Each of these mutations introduces a cysteine into the ME1 or MEK2 protein and each is named according to the resulting amino acid substitution. For example, the pair of primer MEK1-N78C-direct and MEK1-N78C-antisense is used to introduce a cysteine at the N78 site of MEK1, generated by pGEX-MEK1 / N78C-HIS, Mutagenic oligonucleotides MEK1-N78C-s GAGCTGGGGGCTGGCTGCGGCGGTGTGGTGTTC SEQUENCE IDENTIFICATION NUMBER: 197 - 118 - MEK1-N78C-as GAACACCACACCGCCCGCAGCCAGCCCCCAGCTC IDENTIFICATION NUMBER SEQUENCE: 198 EK1-G79C-s CTGGGGGCTGGCAATTGCGGTGTGGTGTTCAAG IDENTIFICATION NUMBER SEQUENCE: 199 G79C-as-MEK1 SEQUENCE IDENTIFICATION NUMBER CTTGAACACCACACCGCAATTGCCAGCCCCCAG 200-I107C MEK1-S IDENTIFICATION NUMBER GAGATCAAACCCGCATGCCGGAACCAGATCATA SEQUENCE: 201 MEK1- I107C-as TATGATCTGGTTCCGGCATGCGGGTTTGATCTC SEQUENCE IDENTIFICATION NUMBER: 202 MEK1-R108C-S ATCAAACCCGCAATCTGCAACCAGATCATAAGG SEQUENCE IDENTIFICATION NUMBER: 203 ME 1-R108C-as CCTTATGATCTGGTTGCAGATTGCGGGTTTGAT SEQUENCE IDENTIFICATION NUMBER: 204 MEK1-I111C-S GCAATCCGGAACCAGTGCATAAGGGAGCTGCAG SEQUENCE IDENTIFICATION NUMBER: 205 MEK1-IlllC -as CTGCAGCTCCCTTATGCACTGGTTCCGGATTGC SEQUENCE OF IDENTIFICATION NUMBER: 206 MEK1-E114C-S AACCAGATCATAAGGTGCCTGCAGGTTCTGCAT SEQUENCE OF IDENTIFICATION NUMBER: 207 MEKl-E114C-as ATGCAGAACCTGCAGGCACCTTATGATCTGGTT SEQUENCE OF IDENTIFICATION NUMBER: 208 MEK1-L118C-S AGGGAGCTGCAGGTTTGCCATGAGTGCAACTCT SEQUENCE OF IDENTIFICATION NUMBER: 209 - 119 - MEKl-L118C-as AGAGTTGCACTCATGGCAAACCTGCAGCTCCCT SEQUENCE IDENTIFICATION NUMBER: 210 MEK1-V127C-S AACTCTCCGTACATCTGCGGCTTCTATGGTGCG SEQUENCE IDENTIFICATION NUMBER: 211 ME 1-V127C-as CGCACCATAGAAGCCGCAGATGTACGGAGAGTT SEQUENCE IDENTIFICATION NUMBER: 212 MEK1-M143C-S GAGATCAGTATCTGCTGCGAGCACATGGATGGA SEQUENCE IDENTIFICATION NUMBER: 213 MEK1 -M143C-as TCCATCCATGTGCTCGCAGCAGATACTGATCTC SEQUENCE OF IDENTIFICATION NUMBER: 214 MEK1-S150C-S CACATGGATGGAGGTTGCCTGGATCAAGTCCTG SEQUENCE OF IDENTIFICATION NUMBER: 215 MEK1-S150C-as CAGGACTTGATCCAGGCAACCTCCATCCATGTG SEQUENCE IDENTIFICATION NUMBER: 216 MEK1-L180C-S AAAGGCCTGACATATTGCAGGGAGAAGCACAAG SEQUENCE IDENTIFICATION NUMBER: 217 ME 1-L18OC-as CTTGTGCTTCTCCCTGCAATATGTCAGGCCTTT SEQUENCE IDENTIFICATION NUMBER: 218 MEK1-I186C-S AGGGAGAAGCACAAGTGCATGCACAGAGATGTC SEQUENCE IDENTIFICATION NUMBER: 219 MEK1-I186C-as GACATCTCTGTGCATGCACTTGTGCTTCTCCCT SEQUENCE OF IDENTIFICATION NUMBER: 220 MEK1-K192C-s ATGCACAGAGATGTCTGCCCCTCCAACATCCTA SEQUENCE OF IDENTIFICATION NUMBER: 221 ME 1-K192C-as TAGGATGTTGGAGGGGCAGACATCTCTGTGCAT - 120 - IDENTIFICATION NUMBER SEQUENCE: 222 MEK1-S194C-S IDENTIFICATION NUMBER AGAGATGTCAAGCCCTGCAACATCCTAGTCAAC SEQUENCE: 223 MEK1-S194C-as GTTGACTAGGATGTTGCAGGGCTTGACATCTCT IDENTIFICATION NUMBER SEQUENCE: 224 -L197C MEK1-S SEQUENCE IDENTIFICATION NUMBER AAGCCCTCCAACATCTGCGTCAACTCCCGTGGG: 225 MEK1-Ll97C-as CCCACGGGAGTTGACGCAGATGTTGGAGGGCTT SEQUENCE IDENTIFICATION NUMBER: 226 MEK1-V211C-s CTCTGTGACTTTGGGTGCAGCGGGCAGCTCATC IDENTIFICATION NUMBER SEQUENCE: ME 227-as 1-V211C GATGAGCTGCCCGCTGCACCCAAAGTCACAGAG IDENTIFICATION NUMBER SEQUENCE: 228 MEK2 -N82C-s GAGCTGGGCGCGGGCTGCGGCGGGGTGGTCACC IDENTIFICATION NUMBER SEQUENCE: 229 MEK2 -N82C-as GGTGACCACCCCGCCGCAGCCCGCGCCCAGCTC SEQUENCE IDENTIFICATION NUMBER: 230 MEK2 -G83C-s CTGGGCGCGGGCAACTGCGGGGTGGTCACCAAA SEQUENCE OF IDENTIFICATION NUMBER: 231 MEK2-G83C-as TTTGGTGCCACCCCGCAGTTGCCCGCGCCCAG SEQUENCE OF IDENTIFICATION NUMBER: 232 MEK2-I111C-S GAGATCAAGCCGGCCTGCCGGAACCAGATCATC SECUEN IDENTIFICATION CIA NUMBER: 233 MEK2-IlllC-as GATGATCTGGTTCCGGCAGGCCGGCTTGATCTC SEQUENCE OF IDENTIFICATION NUMBER: 234 - 121 - MEK2-R112C-s ATCAAGCCGGCCATCTGCAACCAGATCATCCGC IDENTIFICATION NUMBER SEQUENCE: 235 MEK2-R112C-as GCGGATGATCTGGTTGCAGATGGCCGGCTTGAT IDENTIFICATION NUMBER SEQUENCE: 236 MEK2-I115C-s GCCATCCGGAACCAGTGCATCCGCGAGCTGCAG IDENTIFICATION NUMBER SEQUENCE: 237 MEK2 -I115C-as CTGCAGCTCGCGGATGCACTGGTTCCGGATGGC IDENTIFICATION NUMBER SEQUENCE: 238 MEK2- E118C-S AACCAGATCATCCGCTGCCTGCAGGTCCTGCAC SEQUENCE OF IDENTIFICATION NUMBER: 239 ME 2-E118C-as GTGCAGGACCTGCAGGCAGCGGATGATCTGGTT SEQUENCE IDEN ification NUMBER: 240-S MEK2 -L122C IDENTIFICATION NUMBER CGCGAGCTGCAGGTCTGCCACGAATGCAACTCG SEQUENCE: 241 MEK2-L122C-as CGAGTTGCATTCGTGGCAGACCTGCAGCTCGCG IDENTIFICATION NUMBER SEQUENCE: 242 MEK2-VI31C-s AACTCGCCGTACATCTGCGGCTTCTACGGGGCC IDENTIFICATION NUMBER SEQUENCE: 243 MEK2-V13lC-as GGCCCCGTAGAAGCCGCAGATGTACGGCGAGTT SEQUENCE OF IDENTIFICATION NUMBER: 244 ME 2-MI47C-s GAGATCAGCATTTGCTGCGAACACATGGACGGC SEQUENCE OF IDENTIFICATION NUMBER: 245 MEK2-M147C-as GCCGTCCATGTGTTCGCAGCAAATGCTGATCTC SEQUENCE OF IDENTIFICATION NUMBER: 246 MEK2-S154C-S CACATGGACGGCGGCTGCCTGGACCAGGTGCTG - 122 - IDENTIFICATION NUMBER SEQUENCE: 247 MEK2 -S154C-as CAGCACCTGGTCCAGGCAGCCGCCGTCCATGTG IDENTIFICATION NUMBER SEQUENCE: 248 MEK2 -Ll84C-s CGGGGCTTGGCGTACTGCCGAGAGAAGCACCAG IDENTIFICATION NUMBER SEQUENCE: 249 MEK2 -L184C-as CTGGTGCTTCTCTCGGCAGTACGCCAAGCCCCG IDENTIFICATION NUMBER SEQUENCE: 250 MEK2-I190C-S CGAGAGAAGCACCAGTGCATGCACCGAGATGTG SEQUENCE IDENTIFICATION NUMBER: 251-as MEK2 -I190C IDENTIFICATION NUMBER CACATCTCGGTGCATGCACTGGTGCTTCTCTCG SEQUENCE: 252 MEK2 -Kl96C- s SEQUENCE IDENTIFICATION NUMBER ATGCACCGAGATGTGTGCCCCTCCAACATCCTC: 253 MEK2 -K196C-as GAGGATGTTGGAGGGGCACACATCTCGGTGCAT IDENTIFICATION NUMBER SEQUENCE: 254 MEK2-S198C-s IDENTIFICATION NUMBER SEQUENCE CGAGATGTGAAGCCCTGCAACATCCTCGTGAAC : 255 MEK2 -S198C-as GTTCACGAGGATGTTGCAGGGCTTCACATCTCG SEQUENCE OF IDENTIFICATION NUMBER: 256 MEK2-L201C- s AAGCCCTCCAACATCTGCGTGAACTCTAGAGGG SEQUENCE OF IDENTIFICATION NUMBER: 257 MEK2 -L201C ~ as CCCTCTAGAGTTCACGCAGATGTTGGAGG GCTT SEQUENCE OF IDENTIFICATION NUMBER: 258 MEK2-V215C-S CTGTGTGACTTCGGGTGCAGCGGCCAGCTCATA SEQUENCE OF IDENTIFICATION NUMBER: 259 - 123 - MEK2-V215C-as TATGAGCTGGCCGCTGCACCCGAAGTCACACAG IDENTIFICATION SEQUENCE NUMBER: 260 Sequence primers pGEX direct GGGCTGGCAAGCCACGTTTGGTG IDENTIFICATION SEQUENCE NUMBER: 261 pGEX inverse CCGGGAGCTGCATGTGTCAGAGG IDENTIFICATION SEQUENCE NUMBER: 262 Expression of Mek-1 and Mek-2 Mutants Mutant alleles of Mek-1 and Mek-2 are expressed in E. coli and purified essentially as described for Mek-1 [by McDonald, OB, et al., Analytical Biochem 268: 318-329 (1999)]. The plasmids containing the mutant alleles of Mek-1 and Mek-2 are transformed into BL21 cells of DE3 pLysS (Invitrogen) according to the suggestions manufacturer. The cultures are grown at 37 ° C from colonies alone in 100 ml of 2YT medium supplemented with 100 g / ml ampicillin and 100 pg / ml chloramphenicol. This culture is then added to 2.5 1 of 2YT supplemented with 100 pg / ml of ampicillin to obtain a D06oo of about 0.05 and then grown to a D0600 of about 0.07 at 30 ° C. The expression of induces with the addition of IPTG to a final concentration of 1 mM and the culture is incubated for 4 hours at 25 ° C. The cells are pelleted in a Sorfall GSA rotor at 65K rpm for 15 minutes and stored at -80 ° C. - 124 - The Mek-1 and Mek-2 mutants are purified from the cells by first resuspending the cell pellets in ice-cold PBS containing 0.5% Triton X-100 and incubation on ice for 45 minutes, followed by extensive sonication. The lysates are clarified by centrifugation in a Sorvall GSA rotor at 12K rpm for one hour. The fusion proteins are first purified in Ni-NTA resin (Qiagen) according to the manufacturer's suggestions, followed by further purification in glutathione agarose, as described [by McDonald, O. B., et al., Analytical Biochem. 268: 318-329 (1999)]. The epitope tags are separated with thrombin separation and the aliquots of the purified protein are stored at -80 ° C in TBS containing 10% glycerol. EXAMPLE 11 CLONING AND MUTAGENESIS OF HUMAN S-CATECHESINE (CATS) Cathepsin S (accession number S S P25774) is a thiol protease that is primarily located in the lysosome. This enzyme plays important roles in the presentation of antigen by processing the CPH-II antigen receptor; therefore, inhibitors for the enzyme can be used for diseases such as inflammation and autoimmunity such as rheumatoid arthritis, multiple sclerosis, asthma and organ rejection. It has also been reported that catS is present in increased concentrations in the - 125 - Alzheimer's disease and brain with Down syndrome compared to a normal brain. A structural model of captesin S [1BXF, Fengler, A. & Brandt W., Protein Eng 11: 1007-1013 (1998)] and a crystal structure of the C25S mutant [Turkenburg, J.P. et al. Acta Crystallogr D Biol. Crystallog 58: 451-455 (2002)]. Cloning of human catS DNA sequence coding for cathepsin (catS) human is isolated by PCR from plasmid pDualGC (Stratagene # E01089) using PCR primers included in the following which correspond to the N and C terminal portions of the protein. These primers are designed to contain at EcoRI and Xhol restriction endonuclease sites, for subcloning into a modified pFastBac vector, pFBHT (see Example 4 above). The IDENTIFICATION SEQUENCE NUMBER: 263 is used with the SEQUENCE OF IDENTIFICATION NUMBER: 264 and the SEQUENCE OF IDENTIFICATION NUMBER: 265 to produce catS with and without the 6xhis tag, respectively. 5 'CatS EcoRI CCGGAATTCATGAAACGGCTGGTTTGTGTGCT IDENTIFICATION SEQUENCE NUMBER: 263 3 'CatS Xhol CCCCGCTCGAGGATTTCTGGGTAAGAGGGAAAG IDENTIFICATION SEQUENCE NUMBER: 264 3 'CatS Xhol stop CCCCGCTCGAGCTAGATTTCTGGGTAAGAGGGAAA IDENTIFICATION SEQUENCE NUMBER: 265 The PCR reaction is purified on a Qiaguick PCR-126-purification column (Qiagen). The PCR product containing the catS sequence is cut with restriction endonucleases (42 μl of PCR products, 1 μl of each endonuclease, 5 μl of appropriate lOx buffer, incubated at 37 ° C for 3 hours). The pFBHT vector is cut with restriction endonucleases (5 μg of DNA, 1 μ? Of each endonuclease, 3 μ? Of appropriate lOx buffer, water up to 30 μ?, Incubated at 37 ° C for 3 hours, 1 μ agrega is added CIP and incubated at 37 ° C for 60 minutes). The products of the nuclease separation are isolated from an agarose gel (1% agarose, TBE buffer) and ligated together using T4 DNA ligase (50 ng of the pFBHT vector and 50 ng of the catS PCR product in 10 μl). μl of 2x ligase buffer (Roche), 1 μl ligase, which is incubated at 25 ° C for 15 minutes). Transforms 1 μ? of the ligation reaction in Library Efficiency Chemically Competent DH5a cells (Invitrogen) (1 μl of ligation reaction, 100 μm of competent cells, incubated at 4 ° C for 30 minutes, 42 ° C for 45 -seconds, 4 ° C for 2 minutes and then 900 μl of SOC medium is added and incubated for 1 hour with shaking at 225 rpm at 37 ° C), and seeded onto LB / agar plates containing 100 μg / ml ampicillin. After incubation at 37 ° C overnight, the colonies are grown alone in 3 ml of LB medium containing 100 μg / ml of ampicillin for 8 hours. The cells are then isolated and the double-stranded DNA is extracted from the cells using the Qiagen DNA miniprep kit. Sequencing of the gene for catS is carried out using the forward and reverse amplification primers of M13 / pUC (Invitrogen # 18430-017). Generation of Cysteine Mutations of CatS Mutations are generated using the previously described [Kunkel T. A., et al., Met ods Enzymol 154: 367-382 (1987)]. The DNA oligonucleotides used are shown below and are designed to ibridize with direct-strand DNA from the plasmid. The sequences are verified using the primers with IDENTIFICATION SEQUENCE NUMBER: 74 and IDENTIFICATION SEQUENCE NUMBER: 75. Mutagenic oligonucleotides Y18C CACAAGAACCTTGACATTTCACTTCAGT SEQUENCE OF IDENTIFICATION NUMBER K64C CACCATTGCAGCCACAGTTTCCATATTT SEQUENCE OF IDENTIFICATION NUMBER: 267 N67C CATGAAGCCACCACAGCAGCCTTTGTT SEQUENCE OF IDENTIFICATION NUMBER: 268 T72C CTGGAAAGCCGTGCACATGAAGCCACC IDENTIFICATION SEQUENCE NUMBER: 269 E115C GCCATAAGGAAGGCAAGTGTACTTTGA IDENTIFICATION SEQUENCE NUMBER: 270 R141C GAAAGAAGGATGACACGCATCTACACC - 128 - SEQUENCE OF IDENTIFICATION NUMBER: 271 F1 6C ACTTCTGTAGAGGCAGAAAGAAGGATG IDENTIFICATION SEQUENCE NUMBER: 272 F211C TGGGTAAGAGGGACAGCTAGCAATCCC IDENTIFICATION SEQUENCE NUMBER: 273 Mutations of elimination of cysteines are also made using the following oligonucleotides. C12A CACTTCAGTAACAGCCCCTTTCTCTCTC SEQUENCE OF IDENTIFICATION NUMBER: 274 C12Y CACTTCAGTAACATACCCTTTCTCTCTC SEQUENCE OF IDENTIFICATION NUMBER: 275 C25S CACTGAAAGCCCAGGAAGCACCACAAGA SEQUENCE OF IDENTIFICATION NUMBER: 276 Cl1OA CAGTGTACTTTGAAGCTGTGGCAGCACG IDENTIFICATION SEQUENCE NUMBER: 277 Expression of CatS Mutant Proteins All CatS-FBHT plasmids are specifically relocated to the site within the bacoluvirus shuttle vector (bacmid) by transformation of the plasmids into competent DHlObac cells (Gibco / BRL), as follows: mix 1 μ? of DNA at 5 ng / μ ?, 10 μ? of KC 5x [KC1 0.5 M, CaCl2 0.15 M, MgCl2 0.25 M], 30 μ? of water with 50 μ? of competent cells in PEG-DMSO, incubated at 4 ° C for - 129 - 20 minutes, 25 ° C for 10 minutes, 900 μ? of SOC and incubated at 37 ° C with shaking for 4 hours, and then plated on LB / agar plates containing 50 g / ml kanamycin, 7 g / ml gentamicin, 10 g / ml tetracycline and 100 g / ml of Bluo-gal, 10 g / ml of IPTG. After incubation at 37 ° C for 24 hours, large white colonies are taken and grown in 3 ml of 2YT medium overnight. The cells are then isolated and the double-stranded DNA is extracted from the cells, as follows: the pellet is resuspended in 250 μ? of solution 1 [15 mM Tris-HCl (pH 8.0), 10 mM EDTA, 100 μg / ml ribonuclease A]. 250 μ? of solution 2 [NaOH 0.2 N, SDS 1%], mix gently and incubate at room temperature for 5 minutes. 250 μ? of 3 M potassium acetate, mix and place on ice for 10 minutes. Centrifuge for 10 minutes at 14,000 x g and transfer the supernatant to a tube containing 0.8 ml of isopropanol. Mix and place on ice for 10 minutes. Centrifuge at 15 minutes at 14,000 x g, wash with 70% ethanol and settle in dry air and resuspend DNA at 40 μ? of TE. The bacmid DNA is used to transfect Sf9 cells. Sf9 cells are seeded at 9 x 10 5 cells per well of 35 ml in 2 ml of Sf-900 II SFM medium containing 0.5 x antibiotic-antifungal concentration and allowed to bind at 27 ° C for 1 hour. During this time, they are diluted by 5 μ? of bacmid DNA in 100 μ? of the medium without antibiotics, 6 μ? of CellFECTIN reagent in 100 μ? of medium without antibiotics and then the two solutions are mixed gently and allowed to incubate for 30 minutes at room temperature. The cells are washed once with medium without antibiotics, the medium is aspirated and then 0.8 ml of medium is added to the lipid-DNA complex and placed on top of the cells. The cells are incubated for 5 hours at 27 ° C, the transfection medium is removed and 2 ml of medium are added with antibiotics. The cells are incubated for 72 hours at 27 ° C and the virus is harvested from the cell culture medium. The virus is amplified by adding 1.0 ml of virus to 50 ml of Sf9 cell culture at 2 x 106 / ml and incubated at 27 ° C for 72 hours. The virus is harvested from the cell culture medium and this concentrate is used to express the various constructs of catS in High-Five cells. An amount of 1 1 of High-Five cell culture at 2 x 10 6 cells / ml is infected with virus at an MOI of about 2 and incubated for 72 hours. The cells are pelleted by centrifugation and the supernatant is dialyzed against 20 1 of charge buffer (Na¾P04 50 m, pH 8.0, 300 mM NaCl, 10 mM imidazole), filtered and loaded onto a Ni-NTA column (Superflow Ni-NTA, Qiagen) at 1 ml / min, washed with loading buffer at 2 ml / min and it is eluted with 50 mM NaH2P0, - 131 - H 8.0, 250 mM imidazole NaCl 300 me. EXAMPLE 12 CASPASA-1 Caspase-1 (accession number SWS P25774), like other caspases, exists as an inactive form, and is processed proteolytically into a large subunit and a small subunit, which then combine to form the enzyme active An important substrate of caspase-1 is the preform of interleukin-1 (ß). Caspase-1 produces the active form of this cytokine, which plays a role in processes such as inflammation, septicemic shock and wounds. Additionally, active caspase-1 induces apoptosis and plays a role in the progression of Huntington's disease. The structure of caspase-1 [1BMQ, Okamoto, Y., et al., Chem Pharm Bull (Tokyo), 47: 11-21 (1999)] has been solved. IL-13 IL-13 (accession number SWS P35225), which is produced mainly by activated Th2 cells, shows structural and functional similarities with IL-4. Like IL-4, it increases the secretion of immunoglobulin E by B lymphocytes and is related to the expulsion of parasites. In addition, IL-13 inactivates the production of cytokines including IL-1, IL-6, TNF-α and IL-8 by stimulated monocytes. Interleukin IL-13 also prolongs the survival of monocytes, increases the expression of CPH class II and CD23 on the surface of monocytes and increases the expression of CD23 in B lymphocytes. In addition, IL-2 and IL-13 synergize regulation of interferon gamma synthesis. Due to these effects, IL-13 plays a role in conditions such as allergy and asthma. In particular, a polymorphism at position 130 (Q) increases the risk of developing asthma. The structure of IL-13 by nuclear magnetic resonance (NMR) has been solved [1GA3, Eissenmesser, EZ et al., J. Mol. Biol. 310 231-241 (2001)]. CD40L CD40L (accession number SWS P29965 ) is a protein found in two forms, a transmembrane form and also an extracellular soluble form, processed proteolitically active.The transmembrane form is expressed on the surface of CD4 + T lymphocytes Like other members of the TNF family, forms a homotrimer CD40L mediates the proliferation of B lymphocytes, epithelial cells, fibroblasts and smooth muscle cells.The binding of CD40L to the CD40 receptor on T lymphocytes provides a critical signal for the switching and production of the isotype class of human antibodies. Immunoglobulin Defects in CD40L induce an elevation of IgM levels and a deficiency in all other immunoglobulin subtypes. attachment of autoimmune diseases and rejection of grafts. In addition, the reduced interaction between CD40L and its receptor reduces the degree of tau hyperphosphorylation in the mouse model of Alzheimer's disease. The crystal structure of CD40L has been resolved [1 ALY, Karpusas, M., et al., Structure 3: 1031-1039 (1995), erratum in Structure 3: 1046 (1995)]. HUMAN B LYMPHOCYTE ACTIVATING FACTOR (BAFF) A member of the TNF superfamily, BAFF (access number SWS Q9Y275) is a homotrimer and is found in transmembrane and soluble forms. The transmembrane form is processed by the furin family of protein convertases. BAFF is activated by interferon-gamma and is inactivated by treatment with PMA / ionomicin. BAFF joins three different receivers. When it binds to the specific B lymphocyte receptor (BAFFR), it promotes B lymphocyte survival and the B lymphocyte response. In addition, both BAFF and the proliferation-inducing ligand (APRIL) bind to the transmembrane activator receptors and the CAML interacting (TACI) and B lymphocyte maturation antigen (BCMA), which forms a pathway of 2 ligands and 2 receptors that is responsible for the stimulation of T lymphocytes and the function of B lymphocytes in humoral immunity. BAFF inhibitors can serve as therapeutic substances for autoimmune diseases characterized by abnormal activity - 134 - of B lymphocytes, such as systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA). A structure of the soluble protein is available [1JH5, Liu, Y., et al., Cell, 108: 383-394 (2002)]. P53 TUMOR SUPPRESSOR P53 (access number SWS P04637), is a transcription factor that suppresses tumor growth, binds DNA as a homotetramer and is activated by phosphorylation of a serine residue. There are two mechanisms of tumor suppression, based on cell type: induction of growth suppression and activation of apoptosis. P53 controls cell growth by regulating the expression of a set of genes. For example, it increases the transcription of an inhibitor of cyclin-dependent kinases. Apoptosis is obtained as a result of P53-mediated stimulation of Bax or Fas expression, or a decrease in Bcl2 expression. P53 is mutated or inactivated in approximately 60% of known cancers and is often also overexpressed in various tumor tissues. Reversible p53 inhibitors can be used as an adjuvant for conventional radiotherapy and chemotherapy in order to avoid damage to normal tissue during treatment as well as its serious side effects. It has been shown that such an inhibitor protects mice from deadly doses of radiation without promoting tumor formation. There is a crystal structure of human p53-p53 bound to the mdm2 protein of Xenopus laevis [1YCQ, Kussie, P.H., et al., Science 274: 948-953 (1996)]. PROTEIN MDM2 THAT LINKS P53 In response to DNA damage, p53 increases the transcription of the mdm2 protein (access number SWS Q00987). In a negative feedback form, mdm2 inhibits cell cycle suppression induced by p53 and apoptosis, by two means. First, mdm2 binds the transcriptional activation domain of p53, reduces its transcriptional activation activity. Second, in the presence of ubiquitin El and E2, mdm2 serves as an E3 ligase of ubiquitin protein for itself and for p53. The ubiquitination of p53 allows it to be exported from the nucleus of the proteasome, where it is destroyed. There are eight isoforms of mdm2 that are produced by alternative splicing. These are mdms2, mdm2-A, mdm2-Al, mdm2 ~ B, mdm2-C, mdm2-D, mdm2-E, and mdm2-. Of these, mdm2-A, mdm2-B, mdm2-C, mdm2-D and mdm2-E are observed in human cancers but not in normal tissues. Amplification of mdm2 has also been observed in certain types of tumors that include soft tissue sarcoma, osteosarcoma and glioblastoma. These tumors often contain wild-type p53. Small molecule inhibitors of mdm2 can promote the proapoptotic activity of wild-type p53 and find use in cancer treatments. The structure - 136 - of mdm2 in Xenopus laevis has been resolved, forming a complex with human p53 [1YCR, ussie, P. H. et al., Science 274: 948-953 (1996)]. BCL-X Bcl-x (accession number S S Q07817) is a member of the Bcl2 family of proteins and has two major isoforms produced by alternative splicing, bcl-x (L), bcl- (S). The large isoform, bcl-x (L) is found in postmitotic cells of long duration and inhibits apoptosis, while the short isoform bcl-x (S), is found in cells with a high turnover rate and promotes apoptosis. The large isoform inhibits apoptosis by binding to a voltage-dependent anionic channel (VDAC) and preventing the release of cytochrome c activator of mitochondrial membrane apoptosis. This antiapoptotic activity depends on the BH4 domain (homology with bcl-2) of Bcl- (L); the binding of this protein to other members of the Bcl2 family depends on the BH1 and BH2 domains. The expression of Bcl-x (L) has been observed to be expressed mainly by neoplastic cells in most cases of lymphoma. Inhibition of the expression of bcl-x (L) in several cell lines results in apoptosis. In this way, due to its antiapoptotic effects, bcl- (L) is a target for cancer treatments. Interestingly, the binding of Bcl-x (L) to other members of the Bcl2 family, the pro-apoptotic protein Bax-137, results in an increase in apoptosis (see below). A crystal structure of Bcl-x (L) has been resolved [IMAZ, Muchmore, S.W., et al. Nature 381: 335-341 (1996)]. BAX Bax [access number SWS Q07812 (Bax a); SWS Q0.7814 (BAX ß); SWS Q07815 (BAX?); SWS P55269 (BAX d)] promotes apoptosis by binding to the antiapoptotic protein bcl-x (L), induces the release of cytochrome c and activates caspase-3. Bax has several isoforms produced by alternative splicing; some are membrane bound and others are cytoplasmic. The Bax BH3 domain is necessary for its binding to members of the anti-apoptotic Bcl2 family. Defects in Bax are observed in some cell lines from hematopoietic cancers. Bax agonists can be used in cancer treatments, while Bax inhibitors can be used to counteract neuronal cell death resulting from ischemia, spinal cord damage, Parkinson's disease and Alzheimer's disease. A BAX R structure has been resolved [1F16, Suzuki, M., et al., Cell 103: 645-654 (2000)]. CDC25A CDC25A (accession number SWS P30304) is a double specific phosphatase also known as M-phase inducing phosphatase 1 (MPI1). Induced by cyclin B, se - 138 - requires CDC25A for cell cycle progress and induces mitosis in a dose dependent manner. CDC25 dephosphorylates directly to CDC2, thereby decreasing its activity. It has also been shown in vitro that CDC25 dephosphorylates CDK2 in complex with cyclin E. Elevated concentrations of CDC25 can activate uncontrolled cell growth and are associated with increased mortality in patients with breast cancer. Activated CDC25A has also been observed in degenerating neurons of brains with Alzheimer's disease. A structure of the catalytic core has been solved [1C25, Fauman, F. B. , et al., Cell 93: 617-525 (1998)]. CD28 CD28 (access number SWS PIO747) is a disulfide-linked homodimeric transmembrane protein that is expressed on activated B lymphocytes and a subset of T lymphocytes. This protein can be linked to three others: B7-1, B7-2, and CTLA-4 . The interaction of CD28 with B7-1 and B7-2 present on the surface of antigen presenting cells (APC) results in a costimulation of activation of T cells that have not been previously exposed, whereas Subsequent interaction of the same B7-1 and B7-2 molecules with CTLA-4 induces the attenuation of T-cell stimulation. The signaling pathways associated with CD28 are important therapeutic targets - 139 - for autoimmune diseases, reverse rejection (known also as graft-versus-host disease, GVHD), graft rejection and promotion of immunity against tumors. The structure of CD28 has not been solved so far. B7 There are 2 B7 proteins: B7-1 (access number SWS P33681), also known as CD80 and B7-2 (access number SWS P42081), also known as CD86. Both are highly glycosylated transmembrane proteins that are expressed on activated B lymphocytes. Early events in the immune response are controlled by the interactions of these molecules with CD28 and CTLA-4 (see above). In this way, B7-1 and B7-2 are important targets for therapeutics in the treatment of autoimmune diseases. A structure of the soluble form of B7-1 has been resolved [1DR9, Ikemizu, S., et al. , Immunity 12: 51-60 (2000)] in addition to a B7-1 structure in complex with CTLA-4 [1I8L-Stamper, C. C, et al., Jtature 410: 608-611 (2001)]. In addition, a structure of B7-2 in complex with CTLA-4 has been solved [1185, Schwartz, J.-C. D., et al., Nature 410: 604-608 (2001)]. C5A The immune system comprises, in part, the complement cascade, which is a set of more than 20 proteins. C5a is one of these complement proteins; is - 140 - a cytokine-like activation product of C5. C5a affects inflammation and specifically has a role in the recruitment of neutrophils in response to bacterial infection. In cases of septicemia, the dispersal of bacterial toxins that can be life-threatening through the blood, the effects of C5a are depleted due to overexposure of the neutrophils to excessive amounts of this complement protein. In addition, the levels of expression of the C5a receptor (access number SWS P21730) are increased in certain vital organs during septicemia. In this way, C5a or C5a receptor inhibitors can help in the treatment of septicemia. C5a inhibitors can also be used in the treatment of bullous pemphigoid, the most common autoimmune blistering disease. Another effect of C5a is its synergy with Abeta peptide to promote the secretion of IL-1 and IL-6 in THP-1 cells similar to human macrophages; therefore, C5a may be involved in the pathogenesis of Alzheimer's disease. Although the structure of C5a [1KJS, Zhang, X, et al., Proteins 28: 261-267 (1997)] has not been resolved by NMR, there is no structure of the C5a receptor up to now. AKT Akt is an important component of the signaling pathway of growth factor receptors. - 141 - There are three highly related Ak5 genes, Akt 1-3 (access numbers SWS P31749, Aktl; SWS P31751, Akt2; SWS Q9Y243), which show compensatory effects among themselves. However, they have different expression patterns, suggesting that each can have unique functions as well. Each Akt is activated by phosphorylation of multiple residues and activated by the IL kinase. The binding of Akt activated to PI3K (phosphatidyl inositol 3-kinase) causes the change of active Akt to the plasma membrane. Akt has pleiotropic effects that lead to cell survival. Additionally, Akt amplification and elevated Akt levels have been found in some types of cancers. Recently, a crystal structure of the Akt2 kinase domain, also known as ??? -?, Has been obtained [Yang, J., et al., Molecular Cell 9: 1227-1240 (2002)]. CD45 CD45 (accession number SWS P08575) is a receptor protein tyrosine phosphatase that is located mainly in the plasma membrane of leukocytes; It has several isoforms that differ in the extracellular domain, whose importance is currently unknown. Substrates for CD45 include the lyc, fyn kinases and other src kinases. Additionally, CD45 is coupled in non-covalent interactions with the lymphocyte phosphatase-associated protein (LPAP). CD45 is critical for activation through the 142-antigen receptor on T lymphocytes and B lymphocytes, and may also be important for antigen-mediated activation in other leukocytes. The dimerization of CD45 disables its function. CD45 inhibitors can be used to prevent rejection of allogeneic grafts. The structure of CD45 is not known to date. HER2 RECEIVER OF CELLULAR SURFACE TYPE TYROSIN KINASE HER-2 (accession number S S P04626), otherwise known as ErbB2 is a receptor kinase kinase that is related to EGFR (ErbBl). Although ligands for HER-2 are not known in isolation, when HER-2 dimerizes with other members of the ErbB family, ie, ErbBl, ErbB3 and ErbB4, the dimeric complex can bind to many ligands. These ligands include heregulins, EGFr, pcelulin and NRG, although the binding depends on what type of ErbB proteins are in the heterodimer. Ligand binding increases the phosphorylation of HER-2 and carries out subsequent intracellular signaling steps. HER-2 is often overexpressed in breast cancer cells and this overexpression can mediate its proliferation. Breast cancer cells that overexpress HER-2 are also more sensitive to HER-2 inhibitors. HER-2 is also implicated in many other cancers, such as cancer of the ovary, prostate, lung, fallopian tubes, osteosarcoma and medulloblastoma in childhood. The structure of this receiver has not been solved yet. - 143 - GYMPOGEN SYNASE CIMASA-3 HUMAN (G5K-3) GSK-3 (access numbers SWS P49840, GSK-3a, SWS P49841, GSK-3) is involved in the hormonal control of Myb, glycogen synthase and c-jun. The phosphorylation of c-jun by GSK-3 decreases the affinity of c-jun for DNA. Additionally, GSK-3 is phosphorylated by IL-1 and Akt-1. Phosphorylation by Aktl causes the inhibition of the catalytic activity of GSK-3, which normally phosphorylates cyclin D, so it directs Cyline D for destruction. The net effect of this phosphorylation of GSK-3 is the promotion of cell survival. Increased GSK-3 activity has been found in tissue from diabetic patients, which is consistent with its role in the development of insulin resistance. In addition, GSK-3p is overexpressed in brains with Alzheimer's disease and this overexpression is related to hyperphosphorylation of tau protein, a distinctive element of the disease. Finally, the effects of some mood stabilizing drugs such as lithium appear to be mediated by inhibition of GSK. Therefore, it is possible that GSK-3 inhibitors increase the effectiveness of some psychoactive drugs. There is a structure available for GSK-3 [1H8F, Djani, R., et al., Cell 105: 721-732 (2001)]. ? -ß7 The protein complex -? /? -7 is a transmembrane-144 integrin that plays a key role in migration and lymphocytic homotation. Specifically, the complex serves as a receptor for E-cadherin. A-E (access number SWS P38570) is constituted by two subunits, o, and β, the ex subunit itself is constituted by a light chain and a heavy chain linked by a disulfide bond. Likewise, ß-7 (access number SWS P26010) is also made up of subunits OÍ and ß. The complex α - β / β-7 normally mediates the adhesion of intraepithelial T lymphocytes to the layers of epithelial cells of the mucosa; it also plays a role in the spread of lymphoma other than Hodgkin's. In addition, a possible mechanism of inflammation involves the migration of lymphocytes from the intestinal epithelium to other parts of the body. Changes in the concentrations of a -? /? 7 have been observed in various diseases. Elevated levels of this integrin have been observed in patients with systemic lupus erythematosus (SLE) in the lung epithelium of patients with interstitial lung disease, and in the synovial fluid of patients with rheumatoid arthritis. Altered patterns of a -? /? 7 expression have been observed in patients with Crohn's disease, and antibodies to this complex have been shown to prevent immunization-induced colitis in a mouse model. Therefore, inhibitors for this complex would be valuable in the treatment of inflammation, especially inflammation of the mucosa. There are no structures available for a-? or ß-7. TISSUE FACTOR Human tissue factor (accession number SWS P1372S), also known as thromboplastin, is an 'integral transmembrane protein that is normally found on the surface of extravascular cells. When skin damage occurs, the tissue factor is exposed to the blood and forms complexes with the active form of the coagulation enzyme factor VII, known as factor VIIA (see below). Tissue factor can bind both inactive and active forms of coagulation factor VII and is an obligate cofactor for factor VIIA in the activation of the coagulation cascade. In addition, since tissue factor plays a major role in thrombosis, inhibition of this factor would be expected to decrease the risk of clinical thrombosis outcomes such as atherosclerosis, arterial occlusion, stroke, and myocardial infarction. A structure of the extracellular domain of tissue factor has been resolved [2HFT, Muíler, Y. A., et al. , J Mol Biol 256: 144-159 (1996)]. FACTOR VII Factor VII (accession number SWS P08709) is the zymogen form (inactive precursor) of the Vlla factor of the coagulation serine protease. More than 99% of this - 146 - protease circulates in the form of an inactive single chain; Upon separation of an Arg-Ile peptide bond by one of several factors, the two-chain, active form is produced. This two-chain form comprises a heavy chain and a light chain, linked by a disulfide bond. The enzymatic carboxylation of the Glu residues in factor VII, which depend on vitamin K, allows the protein to be a calcium. In the presence of calcium and the cofactor of human tissue factor (see above), factor Vlla separates factor X and factor IX to produce their respective active forms that propagate the coagulation cascade. Defects in factor VII can cause bleeding disorders, where the recombinant factor Vlla finds use as a treatment. Conversely, certain gene polymorphisms for factor VII have been linked to an increased risk of myocardial infarction, which is often caused by blood clots. It is expected that factor VII inhibitors will find use in preventing heart disease. A structure of the zymogen form of factor VII has been resolved in complex with an inhibitory peptide [1 JBU, Eigenbrot, C, et al., Structure 9: 621-636 (2001)]. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (22)

1. - 147 - CLAIMS Having described the invention as above, the content of the following claims is claimed as property: 1. A method, characterized in that it comprises: a) obtaining a set of coordinates of a three-dimensional structure of a TB protein having n number of residues; b) selecting a candidate residue i in the three-dimensional TBM structure where the candidate residue i is the i th residue where i is a number between 1 and n and residue i is not a cysteine; c) selecting a residue j in which the residue j is adjacent to the residue i in the sequence; d) determining a candidate reference value where the candidate reference value is a spatial relationship between the remainder i and the remainder j; e) obtaining a database comprising sets of coordinates of disulfide-containing protein fragments wherein each fragment comprises at least one cysteine linked to the disulfide and a first adjacent residue wherein the disulfide-linked cysteine and the first adjacent residue share the same sequential relation as residue i and residue j; - 148 - f) determining a comparative reference value for each fragment wherein the comparative reference value is the corresponding spatial relationship between the disulphide-bound cysteine and the first adjacent residue as the candidate reference value is between the residue i Y 3 l And g) determine a rating where the rating is a measure of the number of fragments in the database, which has a comparative reference value that is equal to or similar to the candidate reference value. 2. The method according to claim 1, characterized in that it further comprises: selecting a residue k wherein the residue k is adjacent to the residue i in the sequence, and A: is not j; and wherein the candidate reference value is a spatial relationship between the residue i, the residue j and the residue kj each fragment comprises at least one disulfide-linked cysteine, a first adjacent residue and a second adjacent residue wherein the joined cysteine by disulfide and the first and second adjacent residues share the same sequential relation as residue i, residue j and residue k; and the comparative reference value is the corresponding spatial relationship between the disulfide-linked cysteine, - 149 - the first adjacent residue and the second adjacent residue as the candidate reference value is between the remainder i, the remainder j and the remainder k. 3. A method, characterized in that it comprises: a) obtaining a set of coordinates of a three-dimensional structure of a TBM protein having n number of residues; b) selecting a candidate residue i in the three-dimensional structure of the TBM, where the candidate residue i is the i th residue where i is a number between 1 and n and the residue i is not a cysteine; c) selecting the residue j and the residue k where the residue j and the residue k are both adjacent in sequence to the residue i; d) determining a candidate reference value where the candidate reference value is a spatial relationship of at least one atom of the main structure of each of the residue i, the residue j and the residue k; e) obtaining a database comprising sets of coordinates of protein fragments containing disulfide wherein each fragment comprises at least one disulfide-linked cysteine, a first adjacent residue and a second adjacent residue wherein the disulfide-linked cysteine, the The first adjacent residue and the second adjacent residual share the same sequence relation as - 150 - the residual i, the residual j and the residual k; f) determining a comparative reference value for each fragment, where the comparative reference value is the corresponding spatial relationship between the disulphide-bound cistern, the first adjacent residue and the second adjacent residue to the extent that the candidate reference value is between the remainder i, the remainder j and the residual k; and g) determining a rating where the rating is a measure of the number of fragments in the database that has a comparative reference value that is equal to or similar to the candidate reference value. 4. The method according to any of claims 1 to 3, characterized in that the spatial relationship comprises a dihedral angle. 5. The method according to any of claims 1 to 3, characterized in that the spatial relationship comprises a pair of angles F?. 6. The method according to any of claims 1 to 3, characterized in that the spatial relationship comprises a plurality of distances between atoms of two residues. The method according to any of claims 1 to 3, characterized in that the residue i is accessible at least partially on the surface. - 151 - 8. The method according to claim 7, characterized by the residue i having an accessible surface area of at least about 20 Á2. 9. The method according to any of claims 1 to 3, characterized in that the residue i does not participate in a hydrogen bonding interaction with a main structure atom of the TBM. 10. A method, characterized in that it comprises: a) obtaining a three-dimensional structure of a TBM having a number n of residues and a site of interest; b) selecting a candidate residue i that is at or near the site of interest where the candidate residue i is the i th residue where i is a number between 1 and n and residue i is not a cysteine; c) generating a set of mutated TBM structures in which each mutated TBM structure possesses a cysteine residue instead of a residue i and wherein the cysteine residue is placed in a standard rotamer conformation; and d) evaluate the set of mutated TBM structures. The method according to claim 10, characterized in that the cysteine residue is topped with an S-methyl group. 12. The method according to claim 152, characterized in that the conformation of the standard rotamer for cysteine comprises an angle? which is selected from the group consisting of about 60 °, about 180 ° and about 300 °; and an angle 2 2 which is selected from the group consisting of about 60 °, about 120 °, about 180 °, about 270 ° and about 300 °. The method according to claim 10, characterized in that the evaluation step comprises determining whether each rotamer conformation establishes an unfavorable spherical contact with the TBM. The method according to claim 10, characterized in that the evaluation step comprises a force field calculation. The method according to claim 11, characterized in that the evaluation step comprises determining whether each rotamer conformation places the methyl carbon of the S-methyl group closer to the site of interest as compared to Cp. 16. A set of variant proteins, each of the proteins is a mutated version of a TBM, characterized in that the different cysteine residue that is naturally present in the TBM is mutated to a cysteine. The assembly according to claim 16, characterized in that it comprises at least three cysteine mutants. 18. The assembly according to claim 16, characterized in that one or more cysteines that occur naturally from the TBM are mutated to a different cysteine residue. 19. The assembly according to claim 16, characterized in that the TBM is a cell surface receptor or soluble receptor. 20. The assembly according to claim 16, characterized in that the TBM is a cytokine. 21. The assembly according to claim 16, characterized in that the TBM is an enzyme. 22. The assembly according to claim 16, characterized in that the TBM is selected from the group consisting of IL-2; IL-4; TNF-CÍ; IL-1 receptor; caspase-3; PTP-1B; HIV integrase; BACE1; MEK-1; Cat-S; caspase-1; IL-13; CD40L; BAFF; P53; mdm2; bcl-x; bax; CDC25A; CD28; B7; C5A; AKT; CD45; HER2; GS -3; a -? / ß-7; tissue factor and factor VII. - 154 - SUMMARY OF THE INVENTION The present invention relates generally to variants of biological target molecules ("TBM") and to methods for producing and using same to identify ligands of TBM. More specifically, the invention relates to individual variants of TBM and sets of TBM variants, each of which represents a modified version of a protein of interest where a thiol has been introduced into or near the site of interest. The ligands of the TBM are identified, in part, by the formation of a covalent bond between a potential ligand and a reactive thiol in the TBM.