MXPA03009222A - Method for identification of proteins from intracellular bacteria. - Google Patents

Abstract

The present invention relates to a novel combination of methods that enables identification of proteins secreted from intracellular bacteria regardless of the secretion pathway. The invention further provides proteins that are identified by these methods. Secreted proteins are known to be suitable candidates for inclusion in immunogenic compositions and/or diagnostic purposes. The invention also provides peptide epitopes (T-cell epitopes) from the identified secreted proteins, as well as nucleic acid compounds that encode the proteins. The invention further comprises various applications of the proteins or fragments thereof, such as pharmaceutical and diagnostic applications.

Description

METHOD FOR THE IDENTIFICATION OF PROTEINS FROM INTRACELLULAR BACTERIA TECHNICAL FIELD OF THE INVENTION The present invention is concerned with a new combination of methods that allows the identification of secreted proteins of intracellular bacteria independently of the secretion route. The invention also provides proteins that are identified by these methods. It is known that secreted proteins are suitable candidates for inclusion in immunogenic compositions and / or diagnostic purposes. The invention also provides peptide epitopes (T cell epitopes) from the identified secreted proteins, also as nucleic acid compounds encoding the proteins. The invention further comprises various applications of the proteins or fragments thereof, such as pharmaceutical applications and diagnostic applications.

BACKGROUND OF THE INVENTION Chlamydia are obligate intracellular bacteria, which multiply inside eukaryotic host cells and are important human pathogens. The order of Chlamydiales comprises a family (Chlamydiaceae) that contains a genus (Chlamydia), which is divided into four species: C. trachomatis, C. pneumoniae, C. psittaci and C. pecorum The human pathogenic serovars of C. trachomatis are divided into: A - C that afflict eye diseases and D to K, which are transmitted sexually and cause urethritis or complications such as salpingitis, epidemics and ectopic pregnancies and LL to L3 that cause a systemic infection , severe, lymphogranuloma venerum (LGV). The human pathogen C. pneumoniae is responsible for respiratory system infections that cause bronchitis and pneumonia and has recently been associated with the development of atherosclerosis (Saikku, et al., 1988 [1], Shor et al., [2] ). If Chlamydia infections are left untreated they can become chronic with severe complications such as sterility, blindness and potentially thrombosis. Due to the intracellular development cycle, persistent Chlamydia infections can cause an aberrant immune response, which fails to clear organisms. Many immunogenic Chlamydia proteins have been considered vaccine candidates, especially proteins exposed on the surface such as the outer outer membrane protein (MOMP) that is immunodominant in C. trachomatis [7], but also stresses proteins of response such as Hsp60 [8.]. However, none of these candidates has been proven efficient in vaccine studies. A probable explanation for the humoral response limited protective immunity is the intracellular nature of the organism. Therefore, an alternative procedure is to find proteins, which are recognizable by the immune system moderated by the cell, which has been shown to be determinant in the resolution of chlamydial infection mainly through the effect of cytotoxic T lymphocytes (CTL) (Igutseme, et al. 1994. [9.]). Increased attention has been paid to secreted proteins since they can be processed in the proteasomes of the host cell and presented as MHC class I antigens on the surface of the cells and thus represent obvious vaccine targets (Hess and Kaufmann, 1993 [ Four. Five]). An example of this was demonstrated for cells infected by Yersinia, which presents an epitope of the YopH effector to the cytotoxic T lymphocytes (CTL) restricted by MHC. (Starnbach &Bevan, 1995 [14-¡]). The interaction between Chlamydia and the host cell is essential for the intracellular survival and spread of the bacteria. There are complete Clamydia genomes, and searchable for the D trachomatis C. seroval (Stephens, et al., 1998 [4.]) (comprising 894 predicted open reading frames - (ORF)) and C. pneumoniae VR1310 (comprising 1073 ORF) (Kalman, et al., 1999 [5.]). In addition complete genomes of C. trachomatis MoPn (Read, et. al., 2000 [12.]) C. pneumoniae AR39 (Read, et al. [12.]) and C. pneumoniae J138 (Shirai, et. al., 2000 [13.]) are publicly available. ? From the genome sequence it is known that Chlamydia possesses genes involved in secretion mechanisms that include several genes with homology to the type III secretion genes of other organisms (Stephens, et al., 1998 [4.] and Kalman , et. al., 1999 [5.]). Candidates for secreted effector proteins are likely to be present in subgroups of type III secretion (Subtil, et al., 2000) [10 ..]. This view was recently illustrated by the discovery of type III secretion characteristics of Cop (Fields &Haclstadt 2000) [11]. However, type III secreted proteins lack recognizable signal peptidase cleavage sites and no consensus sequence for the proteins secreted by the system in Chlamydia has been recognized, such that it can be restricted to the particular organism in question. In addition, the secreted proteins may be a functionally diverse group of proteins located in unpredictable sites in the genome (Subtil, 2000) [10. ] The present state of knowledge concerning secreted Chlamydia effector proteins is limited to proteins present in the inclusion membrane that includes members of Ta family Inc (Rockey, et al., 1995) [15.] [16.]. CopN (Fields &Hackstadt, 2000 [11.]) and CT529 (Fling, et. Al., 2001) [37.]. It has been shown that Chlamydia-specific CD8 + T cells arise during infection, which means that Chlamydia proteins are exposed to host cell cytoplasm which is a prerequisite for the presentation of MHC class I antigens. CT529 has been identified from a genomic library by expression in a eukaryotic cell and by recognition of a specific T cell line (Probst) [41.]. CT529 has been shown to contain an epitope, which in mouse vaccine experiments provides some protection against infection. Expression of eukaryotic cells from a Chlamydia trachomatis serovar L2 library by transaction with a viral vector and subsequently selection with Chlamydia-specific T cells for the detection of proteins comprising restricted MHC class I epitopes has been described in the application International Patent No. WO 00/34483 (Probst) [41.]. This method has resulted in the identification of five positive hundredns, CT529 was contained in one of these, another clone contained three open reading frames but the three remaining clones have not been described further. The disadvantages of such selection is the eukaryotic expression of viral proteins that differ from bacterial expression in a way that alters the processing probability in the proteasome and in the same presentation as MHC antigens and the maintenance and stimulation of T cell clones differ. of the in vivo situation and clones that recognize proteins, which are not accessible during a normal infection, can result in false positives. Other procedures in the above patent application pertain to the identification of candidates for a targeted vaccine against the humoral immune defense. When looking for secreted proteins from intracellular bacteria, the direct idea would be to isolate the cytoplasm from infected host cells and look for bacterial proteins; however, this strategy can not be used for Chlamydia due to the fragility of the chlamydial reticulated body. Another procedure would be to identify pathogenicity factors, which are frequently secreted proteins, by transposon analysis. However, it is not possible to transfect Chlamydia. There is no strategy that can predict which proteins are secreted and effector proteins that code for appropriate genes for vaccine development can be located at unpreventable sites in the genome. A) Yes, there is a need for a reliable system that can limit the number of vaccine candidates in an efficient way in the cost and that involves a minimum of experimental stages. In [18] the effect of IFN-? C. trachomatis A and the expression of L2 protein was investigated by means of [35 S] -methionine / cysteine labeling of C. trachomatis proteins in combination with autoradiography followed by 2D-gel electrophoresis. The IFN-D? Aggregation during infection of HeLa cell cultures with C. trachomatis A resulted in a pronounced down-regulation of several C. trachomatis A proteins, whereas this effect was not evident for C. trachomatis L2. Induction dependent on IFN-? of proteins of -30 and -40 Kda both in C. trachomatis? and L2 was observed. The induction of these proteins was antagonized by adding extraphysiological amounts of L-tryptophan to the culture medium. This indicated that moderate inducibility by IFN-? of these proteins of C. trachomatis is associated with upregulation moderated by IFN- ?. of the host cell enzyme degrading tryptophan indoleamine 2,3 dioxygenase. One of the C. trachomatis proteins induced by IFN migrated with a significantly lower molecular weight in C. trachomatis A compared to C. trachomatis L2. In [19] the proteins C. trachomatis A and L2 inducible by IFN-? previously described (Shaw, et al., 1999) were further characterized. Using MALDI-TOF mass spectrometry followed by database search, the proteins were identified as the subunits of C. trachomatis tryptophan tapeza alfa (TrpA) and beta (TrpB) from preparative 2D gels. Proteins were also induced by IFN-DD in C. trachomatis D and induction was prevented by the addition of extraphysiological amounts of L-tryptophan in all three serovars. TrpA in C. trachomatis A migrated with a lower molecular weight in C. trachomatis A compared to C. trachomatis D and L2. C. trachomatis A and C TrpA are truncated by -7.7 KDA compared to C. trachomatis D and L2 TrpA as revealed by analysis of the trpA gene of these C. trachomatis serovars. The truncation or absence of tryptophan tapeza trachoma that causes serovars (C. trachomatis A, B and C) can impair the ability of synthesis of tryptophan and return to these serovars more susceptible to the exhaustion of tryptophan moderated by IFN- ?. This may explain the differences seen in the pathogenesis among serovars of human C. trachomatis. In [43] the proteasomal degradation of host cell of a secreted protein previously described (p60) of the intracellular bacterium Listeria monocytogenes was investigated. The general strategy used was based on impulse pursuit analysis using methionine / cysteine labeling [35 S] in the presence or absence of. two peptidaldehydes: N-acetyl-Leu-norleucinal (LLnL) and (benzyloxycarboni) -Le.u-Leu-phenylalaninal (Z-LLF), which inhibits the proteolytic activity of the eukaryotic proteasome. The monoclonal antibody raised against p60 was used to precipitate p60 from treated and untreated proteasome inhibitor of J774 cells infected with L. monocytogenes. Evaluation of p60 autoradiographs labeled immunoprecipitates separated by SDS PAGE one-dimensional suggested that proteasome inhibitors were able to inhibit p60 proteasome degradation. The number of epitopes p60-CTL per infected cell decreased after treatment with LLnL and Z-LLF. This suggested a link between the inhibition of proteasomal degradation of p60 and the production of p60-CTL epitope. In [44] mechanisms behind protective immunity and characteristics. General aspects of the cellular immune response to intracellular microorganisms were described with the focus on the development of viable recombinant vaccines against intracellular microbes. Strategies to develop antigen administration systems were discussed with emphasis on ycobacterium bovis BCG and Salmonella typhi aroA. These non-virulent intracellular haxacteria can be genetically modified to provide antigenes, which can serve as targets for a vaccine by immune recognition. The authors indicate the advantages of using secreted proteins as targets for the development of a vaccine since these proteins will be presented and processed to the immune system moderated by the cell while the bacteria still replicates inside the host cell.

BRIEF DESCRIPTION OF THE INVENTION The present invention comprises the identification of secreted proteins by a new combination of methods. The combination of methods described constitutes a secretome (the collection of secreted proteins) by subtraction of the proteome from intracellular bacterial proteins of the total proteome of bacterial proteins present in infected cells. The bacterial proteins are selectively visualized by pulse labeling in the presence of a synthesis inhibitor of the eukaryotic protein followed by dimensional electrophoresis and autoradiography. The protein profiles of purified bacteria are compared with protein profiles of the total lysate of infected cells and the protein points present in the difference image, the secretome, are identified from gels loaded with total lysate of infected cells- by means of spectrometric methods. advanced mass.

The identified secreted proteins are further analyzed by advanced artificial neural networks to provide peptide sequences that are predicted to be good T-cell epitopes. In addition, proteins are selected for which the potency is retarded by host cell proteasome inhibitors since they are Proteins are especially likely to be degraded in the host cell proteasome and presented as MHC class I antigens on the surface of the host cell. In comparison with other strategies for the identification of candidate vaccine proteins and epitopes, the present invention provides a limitation of the number of candidates, which can only be obtained by the new combination of methods. The invention is based on the following observations: Proteins that are secreted from an intracellular bacterium into the host cell will be absent from the purified bacteria but present in whole lysates of infected cells. The 2D protein profiles of purified bacteria also as whole lysates of infected cells can be made visible by two-dimensional electrophoresis using specific pulse labeling of bacterial proteins. The subtraction of the 2D protein profile of purified bacteria from the 2D protein profile of bacterial proteins present in the host cell allows the identification of secreted proteins by mass spectrometry methods. The proteins that are secreted from an intracellular bacterium, which are processed by the host cell proteasome are likely to generate MHC class I antigens, which are capable of activating T cells. The secreted proteins, which exhibit a prolonged potency in response to the addition of eukaryotic proteasome inhibitors r are likely to be presented on the surface of the host cell. The identification of such proteins is enabled by analysis of the 2D protein profiles. 2D cell epitopes can be predicted by artificial neural networks trained to recognize peptides that have a high affinity for the class I complex of MCH. The following definitions are used in connection with the present invention.

DEFINITIONS Secretoma Proteins that are very likely to be secreted from an intracellular bacterium.

Subgroups of secretion (type III) A group of Chlamydia genes that contain genes that have significant homology to the type III secretion gene of other organisms. By definition of secretion group means a collection of ORF (open reading frames) with known or unknown function, which are located up to four genes away from any gene with known homology to genes involved in type III secretion in other bacteria (for example, Salmonella, Shigella, Yersinia).

Proteasome inhibitor Any compound chemically synthesized or occurring in a stable manner in nature, which is capable of reversibly or irreversibly inhibiting the proteolytic activity of the activated 26S eukaryotic proteasome. Those skilled in the art will recognize that the proteolytic activity of the proteasome contains several different activities (eg, chymotrypsin-like activity, which is cleaved after large hydrophobic residues, trypsin-like activity, which is cleaved after basic residues, post activity). -glutamylhydrolase, which is cleaved after the acid residue, BrAAP, which is preferably cleaved after the branched-chain amino acid, SNAAP, which is cleaved after small neutral amino acids of subunits). Several known proteasome inhibiting compounds are commercially available and most include peptide permeable peptide inhibitors in the cell (e.g., peptide aldehydes, peptide vinyl sulfones). Peptide-based inhibitors act as transition state analogues, which form an adduct with the proteasome active sites, while the clasto-lactacystin-p-lactone that occurs stably in nature exerts a proteasome inhibitory effect by means of irreversible modification of the active sites of the proteasome subunits. These compounds and combinations thereof can potentially be used to successfully inhibit the proteasome function and MHC class I antigen processing (for example, MG115, G132, MG262, PS1, clasto-lactacystin-p-lactone, Epoxymicin) . The application of proteasome inhibitors can be used at any point throughout the development cycle of chlamydia either before, during or after pulse marking or persuading is carried out.

Host Cells A host cell is any eukaryotic cell, which can be infected with an intracellular bacterium. Those skilled in the art will recognize that a wide range of immortalized cell lines will be appropriate hosts for infection with Chlamydia in which epithelial cell lines (e.g., HeLa, Hep-2, BHK cells) or immortalized mononuclear cell lines are included, e.g. , U-937. The immortalized host cell can be obtained from carcinoma that occurs stably in nature or by transformation of primary convirus cells, which carry oncogenic genes, which results in cell division and unlimited growth (e.g., SV40). The definition of host cells also includes primary or endothelial mammalian epithelial cell lines, which can be obtained from living mammals or by autopsy and propagated for a limited time in vitro and cell culture of organs.

Genetically modified host cell Those skilled in the art will recognize that the appropriate host cell also includes the host cell, which has been genetically modified to overexpress or suppress genes, which are relevant in the context of chlamydial vaccine development, for example, genes that encode proteasome subunits or other genes that encode functionally important proteins involved in the presentation of MHC-class I.

Proteasome The proteasome is the central enzyme complex for the degradation of non-lysosomal protein that is an essential component of the ATP-dependent proteolytic pathway that catalyzes the rapid degradation of many rate-limiting enzymes, transcriptional regulators and regulatory-critical proteins. In eukaryotes, it is essential for the rapid elimination of abnormal proteins, aggregated, unfolded or normal host cell proteins also as proteins from intracellular bacteria located in the host cell. The proteasome in higher eukaryotes is critically involved in the processing of MHC class I antigens by degradation of proteins to peptides that are delivered to the surface of the host cell as parasites as T cell epitopes.

Impulse Marking Protein labeling means incorporation of amino acids containing radioactive isotopes (eg, L- [35 S] -methionine, L- [methyl-3 H] -methionine, L- [methyl-14 C] -methionine, [35 S] - cysteine, [3 H] -triptofan or combinations thereof) in bacterial proteins over a period of time (eg, 0.5 hours, 1 hour, 2 hours, 4 hours, 6 hours) during which host cell protein synthesis is inhibited using a sufficient concentration of eukaryotic protein synthesis inhibitors. The marking can be done throughout the chlamydia development site. The labeling medium must be sufficiently enriched with nutrients to allow the growth of both the host cell and the pathogen during a time in which the infected cells. they grow The inhibition of host cell protein synthesis can be carried out by addition of cyclohexamide or other inhibitors of host cell protein synthesis (e.g., emetine) during the labeling period, with the effect of allowing the incorporation of radioactive amino acid only in the intracellular bacterium that synthesizes the protein. Protein degradation can be prolonged by the addition of cell-permeable inhibitors of protein degradation to the culture medium during the labeling period. It will be noted that the present invention is not limited to the use of radioactive labeling.

Impulse-follow-up When tracking marked proteins after their synthesis, the lifetime can be estimated, for example, the time elapsed after which the amount of proteins synthesized during the tagging period is degraded by preferably more than 75% (for example, 80%, 90%, 95%, 99%, 100%). This estimation is carried out by measuring the optical density of a given protein spot in the gel before and after a follow-up period and reveals how long the protein is present in the infected cell. Follow-up is carried out by replacing the labeling medium with a culture medium without the radioactive amino acid and harvesting the infected cells at different time points after labeling. A follow-up can be carried out for variable periods after dialing (for example, 0.5 hours, 1 hour, 1.5 hours, 2 hours, 6 hours, 12 hours, 24 hours, 72 hours) and after dialing at several points in the time in order to determine how long the protein is present in the infected cell. The mature form of certain proteins can be processed from a propeptide and thus accumulated during the monitoring period instead of decreasing in quantity. Under these circumstances, the mature protein can accumulate before the degradation can be visualized during the follow-up periods. The period of time during which the protein is degraded can be prolonged by the addition of permeable inhibitors to the cell of protein degradation to the culture medium during the follow-up.

Lysis Regulatory Solution A lysing buffer for use in the present invention is a regulatory solution used to lyse infected cells and solubilize proteins prior to three-dimensional gel electroresis. The lysis buffer contains 9 M urea, 3- [(3-colamidopropyl) dimethylammonium] -1-propanesulfonate (CHAPS; Roche, Germany), tris base 40 mM, DTE 65 mM and Pharmalyte 3-10 at 2% volume / volume (Amersham Pharmacia Biotech). For the enrichment of high molecular weight and hydrophobic proteins, the lysis buffer solution contains alternatively 7 M urea, 2 M thiourea, 3 - [(3-colamidopropyl) dimethylammonium] -1-propanesulfonate at 4% w / v (CHAPS; , Germany), 40 mM tris base, 65 mM dithioerythritol (DTE) and 2% volume / volume Pharmalyte 3-10 (Amersham Pharmacia Biotech). It is recognized that it is possible to alter the lysis buffer in order to increase the solubility of certain proteins (for example, thiouera will increase the solubility of hydrophobic and high molecular weight proteins).

Secreted Effector Protein The term secreted effector protein means any protein, which is secreted by the bacterium into the cytoplasm of the host cell or any intracellular organelle. The secreted effector protein may have a greater influence on the host / pathogen relationship and due to its presence in the cytoplasm of the host cell it may be targeted to the proteasome and presented as MCII-class I antigens on the surface of the host cell. Secreted effector proteins can be secreted by one of several dependent or sec-independent systems (eg, Type I, Type II, Type III, Type IV) described in the literature.

Intracellular bacteria Any bacteria that has the ability to infect and spread within a eukaryotic host cell (eg, Chlamydia, Salmonella, Shigella, Listeria, Legionella, Yersinia). The definition includes intracellular bacteria, which are obligate intracellular, meaning that they only live and propagate using a facultative eukaryotic or intracellular host cell, which means that they can survive both in an extracellular medium and in an intracellular environment.

Elemental body (EB) The collection of Chalmydia bacteria purified by ultracentrifugation and characterized by electron microscopy being approximately 300 nm in diameter and having a condensed nucleus.

Reticulated body (RB) The collection of Chalmydia bacteria purified by ultracentrifugation and characterized by electron microscopy as being approximately 1,000 nm in diameter and having a normal bacterial nucleus.

Analytical gel Any 2D-PAGE gel, which is loaded with an amount of protein sample needed to visualize the proteins. The amount applied for analytical purposes in the examples described herein is commonly 200,000 to 300,000 counts / minute (cpm) or > 100 g of protein for stained gels (for example, stained with silver, stained with coomasie).

Intensity / quantity significantly decreased A reproducible detectable reduction preferably greater than 10% (eg, 20%, 35%, 50%, '65%, "" "80% 7 90%, 100%) in the optical density. the total area of a given point located on a 2D-PAGE gel.

Intensity / quantity increased significantly An increase. reproducible detectable preferably greater than 10% (for example, 20%, 30%, 45%, 60%, 75%, 90%, 100%, 150%, 200%, 300% or greater) in the integrated optical density s, on the total area of a given point located on a 2D-PAGE gel.

Preparative gel A 2D-PAGE gel, which is loaded with a necessary amount of protein sample to allow the identification of specific protease sites by one of the identification methods described herein (for example, MALDI- S). , ESI-Q-TOF, Edman degradation). Commonly, it applies > 500 pg on the gels per. Preparative purposes depending on the pH gradient used immobilized. The definition of preparative gels used in the present invention include gels with proteins that are not fixed, fixed using dyeing protocols (e.g., silver stained, Coomasie stained) or electroabsorbed to the PVDF membranes. It is possible to visualize proteins on preparative gels by applying a background of labeled proteins to the preparative gels, which are separated together with the unlabeled proteins. It is also possible to compare such gels with analytical gels in order to remove the exact protein of interest.

Vaccine Candidate A protein, which is based on results obtained by the methods of the present invention, is potentially secreted from an intracellular bacterium. The secreted proteins are accessible for degradation by the host cell proteasome and peptides derived from these proteins can therefore be presented as MHC-class I antigens on the surface of the infected cell, being thus recognizable by T cells. Such proteins will be consequently, obvious objectives for the development of a vaccine against intracellular bacteria. A protein described as a vaccine candidate may also be useful as a component of a diagnostic test.

Vaccine - In the present invention the term "vaccine" will be understood in its broadest sense as an immunogenic composition, which is apt to produce an adaptive immune response (humoral or cellular). Vaccine candidates, which are capable of producing an adaptive immune response can be administered to animal or human receptors as injectables either in the form of solutions, suspensions or as emulsions. The vaccine candidate which is the active component of the immunogenic composition can be mixed with acceptable pharmaceutical excipients such as water, saline, glycerol and ethanol before injection to the recipient. The injection can be carried out in different ways (for example subcutaneously or intramuscularly). Vaccine candidates can serve as a vaccine either (i) at full length or (ii) as a source for providing immunogenic fragments, eg, T cell epitopes. It is recognized that proteins or peptides alone in combination with other proteins or Peptides can be administered to an animal or human receptor and serve as a vaccine. In addition, a DNA fragment that encodes a vaccine candidate protein can be cloned into a vector, which can be introduced by injection into an animal or human receptor. The DNA fragment is absorbed by, for example, muscle cells and expressed under the control of a promoter, which will be active in eukaryotes. In this so-called DNA vaccine, the expressed DNA fragment is capable of stimulating the immune system.

MHC class I antigen. A higher-histocompatibility class .1 antigen comprises a diverged peptide of a protein that is exposed to the cytoplasm of the host cell, which is conjugated to a heterodimeric MHC class I molecule in the endoplasmic reticulum and is presented on the surface of the cell stuck in the cleft of the HLA complex (in humans) where it can serve as a T cell epitope. Most of the MHC-class I presented peptides are diverged from a protein processed in the cytoplasm of the host cell by the activated 26S proteasome.

HLA Human leukocyte antigen, the name of the largest human histocompatibility complex.

T cell epitope A short-length peptide, which binds a dimeric MHC class I molecule on the surface of a cell, can be recognized by the receptor of a specific cytotoxic T cell, consisting, for example, of 8- 10 amino acids.

Whole cell lysates Infected host cells harvested directly in lysis buffer, without prior purification or fractionation. It is recognized that whole cell lysates can be obtained at any point in time throughout the chlamydial development cycle and that whole cell lysates will contain a mixture of all the proteins present in the infected host cell including those from the bacterium. .

Bacteria purified, which are purified from infected cells. Using Chlamydia as an example, it is possible to purify both RB and EB also as intermediate forms of Chlamydia by density gradient ultracentrifugation methods, depending on the point in time of the development cycle in which the Chlamydias are harvested. The purity can be determined by electron microscopy. In the present invention purity is also easily verified on silver-stained 2D gels by estimating the contribution contaminating highly abundant host cell proteins (eg, actin, beta-tubulin, alpha-tubulin, calreticulin) by the total optical density of "all the proteins present on the gels.

Identified protein Names on identified proteins using identification methods based on mass spectrometry or Edman degradation are indicated ~ sxgua ~ eñcio a nomenclature according to and compatible with that used for the genes in the Chlamydia Genome Project available at http: // Socrates .berkeley. edu: 2431 / and as published in: (i) Stephens, R. S. Raiman, S., Lammel, C, Fan, J., Marathe, R., Aravind, L., Mitchel,., Ollinger, L., Tatusov, R. L. , Zhao, Q., Koonin, 'E. V., Davis, R. W. (1998) Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis. Science 282: 754-759. (ii) Kalman, S., itchell, W., Marathe, R., Lammel, C, Fan, J., Hyman, R.W., Olinger, L. , Grimwood, J., Davis, R. W., Stephens, R. S (1999). Comparative genomes of Chalmydia pneumoniae and C. trachomatis. Nat Gent. 21: 385-389.

ELISPOT In the ELISPOT method, T cells that have been stimulated with in vitro antigen are incubated in microtitre cavities in coated with anti-cytosine antibody (eg, IFN-g, IL-6, TNF-a). After an incubation period, the local production of cytosines around the activated T cells can be visualized by adding a secondary antibody conjugated to an = enzyme such as horseradish peroxidase alkaline peroxidase. An estimate of the cytosine production is made by finally adding a substrate that will be converted enzymatically to a colored product thus allowing the cells that produce cytosine to be visualized.

Adjuvant Adjuvant means an emulsion, which contains a specific immunogen, which can produce an immune response in an animal receptor (eg, Freunds adjuvant). It is recognized that an adjuvant together with the immunogen can be supplemented with components such as dried bacteria or bacterial products, which will improve the immune response in an immunized mammal.Alternatively, immunomodulatory substances, such as lymphokines (for example IFNg, IL12) or Poly I: C can also be administered together with the immunogen and adjuvant.

Seroconversion The development of different classes or subclasses of antibodies in response to an antigen.

Micro immuno fluorescence (MIF or micro-IF) analysis, which measures antibodies against fixed bacteria or proteins by immuno microscopy. fluorescence Immunogenic A protein or peptide is immunogenic if it can produce an adaptive immune response after injection to a person or an animal.

DESCRIPTION OF THE DRAWINGS Figure 1A shows an example of a C. trachomatis D protein gel image of labeled [35S] whole cell lysates 22-24 hours post-infection (hpi), harvested immediately after marking and separated by 2D -PAGE. The black arrows mark proteins whose intensities are significantly reduced on gels with labeled EB proteins (elementary bodies) of 22-24 h.p.i. and 72 h.p.i. purified. The characteristics of pl and PM of the marked points (DT1-77) are listed in Table I. Figure IB-E shows examples of identified vaccine candidates and their presence in C. trachomatis D at different times after the synthesis shown by enlargements of the selected areas of Figure 1A. The lifetime of the protein was estimated by following different times after the labeling throughout the development cycle until the EB purification. The upper scale indicates points in time after marking starting at zero; the lowest scale represents the time in hours post infection beginning with ..24 hours. Figure IB: DT1 and DT2 (CT668). Figure 1C: DT8. Figure ID: DT7 (upper arrow) and DT11 (lower arrow) (both identified as CT610).

Figure 1E: DT3 (bottom arrow, CT783), DT4 (upper arrow, CT858). Figure 2A shows an example of a gel image of C. pheumoniae VR1310 proteins used from whole cells labeled with [35S] of h.p.i. 55-57, harvested immediately after labeling and separated by 2D-PAGE. The black arrows mark - proteins whose intensities are significantly reduced on gels of EB proteins marked in periods of two hours throughout the development cycle, that is, 6, 12, 24, 36, 42, 48, 54, 60 h.p.i. and purified 72 h.p.i .. Arrows mark proteins, which are significantly reduced in intensity on gels of purified EB. The characteristics of pl and PM of the marked points (CP1-91) are listed in Table II. Figure 2B shows an enlarged section of the figure 2A. Figure 2C shows the corresponding image enlargement of EB proteins separated by 2D-PAGE labeled as described above. The enlarged section in Figures 2B and 2C gives an example of two proteins CP63 (identified as CPN1016) and CP65, which are present in whole cell lysate but not in EB. The circled spot is present in both EB and whole cell lysates and has been identified as polypeptide deformylase.

Figure 3A shows a fingerprint of peptide mass used to identify the point No. DTl as the hypothetical protein CT668. The hollow arrows indicate peptides that arise from the autodigestion of trypsin. These peaks were used to perform an internal calibration of the spectra. The black arrows indicate masses of peptides that coincide with the sequence of CT668. The doublet arrows indicate peptides that originate from a contaminating human protein. Figure 3B shows results of using the MS'-Fit identification programming elements on the peptide masses obtained from Figure 3, demonstrating that the highest-ranking C. trachomatis protein is CT668. Figure 4A shows a mass spectrum of peptide generated by ESI-Q-TOF MS from the DTl site comprising the original ion 1744.9 Da double charged (R) KIVDWVSSGEEILNR (A) (black arrow), which matches the amino acid sequence of CT668 . The point of the dotted lines in the peptide Y ions that were generated by fragmentation of the original ion. The deduced amino acid sequence is shown in bold one-letter codes. Figure 4E shows a mass spectrum of the peptide generated by MALDI MS PSD from point CP63. The original ion 1919.8 Da (K) ELLFGWDLSQQTQQARL (L) was fragmented and gave rise to several peptides that reveal the sequence. Two of these are exemplified by 243.35 Da b2 ~ ion (EL) and 356.34 Da b3-ion (ELL) that differ in mass by leucine mass (113 Da). Figure 5 shows the nucleotide sequence of the new candidate protein specific vaccine of C. trachomatis DT8 and the corresponding amino acid sequence shown by the one letter code. Bold amino acid sequence was obtained by sequence labels obtained by ESI-Q-T'OF MS Figure 6 shows pulse follow-up studies in combination with one of the MG-132 proteasome inhibitors. Figure 6.1: the total gel image of a 2D gel loaded with C. trachomatis D proteins labeled 22-24 h.p.i. and followed for 4 hours additionally in the presence of MG 132 of 20 μ ?. Figures 6 ?, 6B and 6C: enlargements of regions containing protein C. trachomatis D, which has a prolonged lifetime due to treatment with MG-132, when compared to follow-up studies carried out with (follow-up + MG 132 ) or without (followed) MG-132. The first row represents protein profiles of infected cell harvested immediately after the two hour marking period. Note that the intensity of DT9, DT10 and DT11 is significantly greater on gels with whole cell lysates that are labeled and followed up in the presence of MG132 compared to gels with whole cell lysates harvested immediately after labeling without MG132. Figure 7A shows a total gel IMB image of whole cell lysates using PAb 245. Al: IMB showing the reaction with the No. DT4 and DT48 point, which are the C-terminal and N-terminal fragments of CT858, respectively. A2: background marked by corresponding radio of the IMB. Figure 7B: ~ IMB with PAb241 against YscN (Bl) and PAb238 against CT668 (point DT1 and DT2) (B_4). Corresponding autoradiography of IMB, showing co-localization with B2: YscN and B5: CT668. Location of YscN (B3) and CT668 (B6) on analytical 2D gels. Figure 7C shows IMB with PAb255 against CT610 Cl: the extension of the 2D gel spot showing that the PAb255 stains at two rows of points, the upper one represents DT7 and the lower one represents DT9, 10, 11 and 12. C2: magnification showing the effect of treatment of cells infected with MG132 for 6 hours before harvesting the cells at 30 hpi.Note that the treatment of MG132 results in a clear relative increase in the abundance of DT9, DT10 and DTII in comparison with the row representing DT7. C3: corresponding labeled analytical gel. C_4: SDS-PAGE IMB with PAb255: Routes a and c: 20 pg and 10 g (respectively) of whole infected cell lysates harvested at 30 h.p.i. Via b and d: 10 g and 5 μg '(respectively) of Used whole infected cell treated for 6 hours with G132 50 μ?, before harvesting the cells at 30 h.p.i. Figure 8 shows an indirect immunofluorescence microscopy showing subcellular localization of vaccine candidates. A and B: HeLa 229 cells infected with C. trachomatis D and fixed with formalin at 24 h.p.i. C: HEp-2 cells infected with C. pneumoniae and fixed with formalin at 72 h.p.i. Row 1 shows images of Normasky-. Row 2 shows the reaction with MAb 32.3 against C. trachomatis OMP visualized by GAM IgG antibody conjugated with rhodamine. Row 3 shows the reaction with rabbit monoclonal antibody specific for the vaccine candidate in question visualized by GAR IgC antibody conjugated by FITCH. Vaccine candidates investigated are A: DT8, B: CT858, C: CPN1016 (homologue of CT858 in C. pneumoniae). White single-headed arrows point at borders of Chlamydia inclusions in infected cells. The hollow arrows point in the cells without infecting. Note that CPN1016 shows the same sub-cellular location and secreted characteristics as CT858. Figure 9 shows a genomic localization of examples of vaccine candidates identified from C. trachomatis D that include identified proteins, which are located in the secretion subgroups type III 1, 2 and 3.

Figure 10 shows the position of C. trachomatis D secretion candidates in 2D gel images of Used whole of infected cells labeled 22-24 hpi, B labeled and purified at the same point in time and EB purified at 72 hpi All the gels have been made using dry imobiline strips of pH 3-10 non-linear. 22-24 h.p.i .: enlargements of the gel image shown in figure 1? of proteins C. trachomatis D from Used whole of infected cells [35S] -marked from 22-24 h.p.- harvested immediately after labeling and separated by 2D-PAGE. Purified RB: corresponding regions of a protein gel image of C. trachomatis D from purified bacteria as RB at 24 h.p.i. immediately after dialing 22-24 h.p.i. Purified EB: corresponding regions of a gel image of labeled bacteria proteins 22-24 h.p.i. and purified as EB 72 h.p.i. In rows A-G candidates for secretion D 4, DT48, DT23, DT76, DT77, DT47 and DT75 have been enclosed in a circle. Figure 11 shows the position of secretory candidates of C. pneumoniae VR1310 in 2D-gel images of whole lysates of infected cells labeled 55-57 h.p. i., purified EB, - whole lysates of infected cells labeled at 34-36 h.p. i. and RB labeled and purified at the same point in time: 55-57 h.p. i .: enlargements of the gel image shown in figure 2A of C. pneumoniae VR1310 proteins from whole cell lysates [35S] -marked at 55-57 h.p. i., harvested immediately after labeling and separated by 2D-PAGE using non-linear pH 3-10 imobilin dry strip. Purified EB: corresponding regions of a gel image (dry strip of non-linear imobilin pH 3-10) of proteins of labeled bacteria in a period of two hours throughout the development cycle, that is, 6, 12, 24, 36, 42, 48, 54, 60 hp i. and purified as EB at 72 h.p. i. 34-36 h.p. i .: regions corresponding to a gel image (dry strip of imobilin pH 4-7 linear) of VR1310 C. pneumoniae proteins from whole lysates of infected cells labeled at 34-36 h.p. i. and harvested immediately after marking. B 36 h.p. i: corresponding regions of a gel image (linear dry imobilin pH 4-7 strip) of VR1310 de.C. pneumoniae of purified bacteria as RB at 36 h.p. i. immediately after marking 34-36 h.p. i.

In 7A-F the candidates for secrecy CP34, CP37, CP46, CP47, CP52, CP63 and CP75 have been enclosed in a circle. G shows a region of the original images of regions in A-F that do not contain secretory candidates.

DETAILED DESCRIPTION OF THE INVENTION Comparison of 2D-PAGE protein profiles of whole cell lysates and purified bacteria Proteins, which are present in whole but present infected cells of purified bacteria, have been potentially secreted from bacteria, for example, Chlamydia. Thus, a method of the initial of the invention is a comparison of 2D-PAGE protein profiles of chlamydia proteins [35S] -marked whole cell lysates of infected cells labeled at different points in the time of the development cycle to profiles Protein 2D-PAGE of purified bacteria [35S] -marked at corresponding time points. This method provides for the detection of several proteins, which are clearly present in the protein profile of whole cell lysates, but only weakly detectable or absent in the protein profile of purified bacteria. From a total of approximately 600 protein spots visualized in lysates, from whole cell to 22-24 h.p.i. using high resolution 2D-PAGE (IPG), these studies elucidated the existence of 77 C proteins. ^ trachomatis D of which the intensity is significantly reduced in elementary bodies (EB). Similarly, 91 proteins had significantly reduced intensities in VR1310 of C. pneumoniae, when comparing whole cell lysates of the 55-57 p.h.i. with purified EB. The detected and annotated proteins have the PM and pl described for protein No. DT1-DT77 for C. trachomatis, as illustrated in Table I and CP1-CP91 for C. pneumoniae as listed in Table II. This method gives an overview of the potentially secreted proteins needed for further investigations. The examples show the comparison of whole cell lysates to EB marked either at (i) points in time corresponding to the marking of the whole cell lysate (C. trachomatis) figure 1 or 2) at points in time throughout the development cycle (C. pneumoniae, figure 2). The purification of RB allows the discrimination between secreted proteins and RB-specific proteins. Protein profiles of whole lysates from infected cells can be compared with RB protein profiles purified at the same point in time to identify secreted proteins. In this procedure specific RBs will not be detected as false positives. The proteins synthesized and secreted at the point in time investigated will be detected. Proteins can be synthesized and secreted at other points in time. The method also includes the detection of secreted proteins immediately after infection, which may have been synthesized in the preceding development cycle. These proteins are visualized by infection with marked EB in the preceding development cycle followed by 2D-PAGE of the total cell Wearers. In a premature stage of the development cycle before the EB differentiated to RB, citpplasma is obtained from the host cell by penetration of Saponin from the cell membrane [30,31]. This is only possible because at that time there will be no contamination of altering RH Chlamydia proteins.

Identification of vaccine candidates' Candida vaccine proteins cut from gels of 2D preparations are identified by means of spectrometry methods. advanced masses. The excised spots are digested with an enzyme such as trypsin, which generates a number of tryptic peptides. By means of MALDI-MS or other methods, the masses of these peptides are determined with an accuracy better than 100 parts per million (ppm). The obtained masses are matched with the theoretical tryptic cleavage products of all the proteins present in the databases using the MS-Fit or Peptidesearch programming elements that allow the identification of the analyzed protein on a statistical basis.

When the protein spots are cut from gels loaded with whole cell lysates, contaminating host cell proteins can be located in the same positions as the bacterial proteins and as an additional complication a point can contain more than one bacterial protein. To avoid interference from contaminants that can lead to unambiguous identifications, ESI-Q-TOF or post-source decay (PSD) can be used, for example, to obtain sequence information of the bacterial protein (s) if it is necessary.

The method includes proteins that are identified by mass spectrometry as indicated by the examples of C. trachomatis D or -VR1310 of C. pneumoniae in Table III (A and B, respectively). Thus, the invention is concerned in a primary aspect with a method for identifying secreted proteins from an intracellular bacterium, comprising the following steps; 1) infect host cells by intracellular bacteria, 2) label intracellular bacteria present in infected cells, 3) prepare: a) whole cell lysates of infected cells, purified bacteria and lysed infected cells, 4) compare 2D-gel electrophoresis protein profiles of (i) the used whole cell of step (3a) with (ii) the purified material and subjected to lysis of step (3b), 5) detect protein spots of stage (4) that are present in the whole cell lysates but absent or present in a significantly reduced amount in the purified bacteria, 6) identify the proteins at the points selected in step (5). Impulse / follow up of vaccine candidates The purpose of this method is to detect secreted proteins, which are degraded in the host cell. In order to estimate the time for which the identified vaccine candidate proteins are present within the host cell a series of impulse / follow-up studies are carried out. The lifespan of [35S] -marked proteins is verified on 2D gels by tracking proteins for several periods after labeling. The time of life provides valuable information on how fast the proteins are degraded, and how long they are present to the inside of the infected cell. The method provides estimated life times of potentially secreted C. trachomatis proteins as exemplified in Table I.

In this alternative aspect of the invention is concerned thus, with a method for identifying secreted proteins of an intracellular bacterium, comprising the following steps: 1) infecting host cells by intracellular bacteria, 2) pulsing the intracellular bacteria present in infected cells, 3) prepare Used whole-cell infected cells after different follow-up periods following step (2), 4) compare 2D-gel electrophoresis protein profiles of whole cell lysates prepared after a different period of follow-up of stage (3), 5) detect protein points from stage (4) that are present in a decreased amount as follow-up periods increase in stage (3), 6) identify the proteins at the points selected in step (5).

Impulse tracking in combination with proteasome inhibitors In order to limit the number of suitable candidates for a vaccine, the invention provides methods of proteasome inhibitor in combination with pulse tracking studies. These experiments provide an excellent tool for verifying the effect of the proteasome of the host cell on the lifetime of the secreted chlamydial proteins. Immunogenic proteins, which are presented on the surface of the eukaryotic cell as MHC-class I antigens, must be stamped ubiquitously and cleaved. By proteolysis in a multi-catalytic protein complex, the proteasome cleaves immunogenic proteins in peptides of a typical length of 8-10 amino acids. These peptides are transported to the ER (endoplasmic reticulum), where they are linked to a heterodimeric molecule MCH-class I and the MHC-antigen complex is subsequently transported to the cell surface. On the surface of the cell the MHC-antigen complex will be recognizable by specific receptors on cytotoxic T-lymphocytes (reviewed in Rock and Goldberg [6]).

It is possible to reduce the activity of the eukaryotic proteasome and prevent the presentation of class I HC by adding cell-permeable proteasome inhibitors such as peptide aldehydes to cell cultures (Rock, et al., 1994) [36.]. Chlamydia proteins for which the lifetime is prolonged by the addition of proteasome inhibitors are capable of being secreted from the bacteria and subsequently processed by the proteasome. Furthermore, this part of the invention will allow the detection of chlamydial proteins, which are degraded in the proteasome very briefly after their release to the host cell and therefore, only detectable in the presence of proteasome inhibitors. The invention comprises vaccine candidates C. trachomatis D and VR1310 of C. pneumoniae that are affected by proteasome inhibids. The proteins DT1, DT2, DT3, DT5, DT9, DT10, DTll, DT13, DT14, DT35, 'DT47, DT59, DT60, DT61, DT62 (as summarized in table IV below) are examples of vaccine candidates C trachomatis D for which the lifespan is prolonged by the addition of proteasome inhibitors - • during the follow-up period. The invention also provides a method for purifying RB, which before the harvest are treated with proteasome inhibitors during a labeling period. A comparison of the whole cell lysates treated with proteasome labeled at the same time as the purified RB treated by proteasome inhibitor, will further produce which proteins are secreted into the cytoplasm of the host cell and degraded in the proteasome. In addition, the host cell lines in these experiments can be genetically altered to overexpress genes, which are determinants in the processing of MHC class I restricted T cell epitopes [38, 39, 40] (Sijts, 2000, Van Hall, 2000, Shockett, 1995). Through the use of such cell lines the effect of such proteasome inhibitors will be more pronounced. Therefore, the invention also comprises the use of commercially available host cell lines that have been genetically modified in genes, which are involved in the presentation of the MHC-class I antigen.

Thus, the invention is concerned in another alternative method for identifying secreted proteins of an intraceilar bacterium, comprising the following steps: 1) infecting host cells by the intraceilular bacteria, 2) culturing the host cells in the presence and absence of a host inhibitor. proteasome, respectively, 3) label the intracellular bacteria present in the infected cells cultured in the presence and absence of a proteasome inhibitor, respectively, 4) prepare whole cell lysates of the infected cells, 5) compare electrophoresis protein profiles of 2D-gel of whole cell lysates of infected cells cultured in the presence and absence of a proteasome inhibitor, respectively, 6) detecting points of proteins from step (5) that are present in whole cell lysates cultured in the presence of a proteasome inhibitor, but absent or present in a significantly reduced amount in whole cell lysates cultured in absence of a proteasome inhibitor, 7) identify the proteins at the points selected in step (6).

Generation of polyclonal antibodies The invention provides polyclonal antibodies, which are specific for vaccine candidates. The gene encoding the vaccine candidate protein is cloned using for example the ligation independent cloning system (LIC). Expressed fusion proteins that span the vaccine candidate sequence are used to immunize rabbits in order to obtain sera containing polyclonal antibodies specific for the vaccine candidate (PAb). The invention uses PAb in the presence of 2D-PAGE in order to confirm the correct antibody's specificity by colocalization or to identify the unrecognized isoforms of vaccine candidates. The invention provides verification / identification of vaccine candidates, by immuno absorption and colocalization as exemplified in Table III. The invention uses PAbs to determine the subcellular localization of vaccine candidates by means of, for example, indirect immunofluorescence microscopy.

Accordingly, the invention also provides one of the above alternative methods, such method further comprising the following steps: 1) obtaining antibodies against proteins of such intracellular bacteria, identified in accordance with any of the above methods, 2) immunoabsorption of 2D- PAGE on whole cell lysates of cells infected with the bacterium using antibodies obtained in step (1), 3) detect protein spots that react in step (2), 4) identify the proteins at the points selected in the step ( 3), Combinations of the four alternative methods are also part of the invention. In preferred embodiments of the methods of the invention, the labeling of the intracellular bacterium is effected by radioactive means, such as [35 S] cysteine, [35 S] methionine, labeled [14 C] amino acids or combinations thereof. The ^ method to identify proteins at selected protein sites may be based on Edman degradation or any "mass spectrometric method, such as MALDI TOF MS (Matrix-Assisted Laser Desorption / Ionisation Time-Of-Flight ass Spectrometry ), ESI Q-TOF MS (Electrospray and Ionisation Quadrupole Time-Of-Flight Mass Spectrometry), PSD-MALDI MS (Post Source Decay MALDI Mass Spectrometry) or combinations of such methods.In addition, proteins can, before identification , being subjected to cleavage by chemical methods, such as treatment with cyanogen bromide or treatment with hydroxylami or by enzymatic methods by any appropriate enzymes, such as trypsin, slimotrypsin, chymotrypsin or pepsin, or combinations thereof. it can be an facultative intracellular bacterium or obligate cellular bacterium and b-acteria of the genus Chlamydia, such as C. pneumoniae, C. trachomatis, C. psitacci or C. pecorum, in which any specific serovar or strain of these are included, are particularly interesting. However, other intracellular bacteria, such as Salmonella, Shigella, Yersinia or Listeria, are also interesting, in connection with the present invention. The host cells to be used according to the invention can be common host cells known in the art, such as an immortalized cell line, for example HeLa, Hep2, McCoy or U937, a primary cell line obtained from mammalian donors or by autopsy, a genetically modified cell line or a culture of organ cells or even other cells where the bacteria can grow. The host cells can be treated with IFN-α. before or during infection with intracellular bacteria and / or may have been genetically modified to overexpress or suppress genes that are recognized as relevant in the context of chlamydial vaccine development. When the method of the invention uses one or more proteasome inhibitors, any known inhibitor, such as MG132, MG262, MG115, epoxymycin, PSI and clasto-lactacystin-p-lactone, are relevant for use. The methods of the invention are particularly interesting for the identification of proteins, which either in full length or as immunogenic fragments thereof are suitable for inclusion in immunogenic compositions and / or diagnostic purposes, especially such proteins, comprising epitopes. of T cells that are candidates for presentation as MHC class I or II and more preferably class I, restricted antigens suitable for inclusion in immunogenic compositions. Thus, in another important aspect of the invention, it is concerned with a protein identifiable by any of. the claimed methods or an immunogenic fragment thereof and preferably such proteins and fragments that are applicable for inclusion in immunogenic compositions and / or diagnostic purposes. The proteins of the invention can be proteins, which are secreted from C. trachomatis and C. pneumoniae. Such proteins are for example those characterized as DT1-77 as given in Table I also as CP1-CP9 as given in Table II, respectively, which have the values of pl and MW given in Tables I and II 'specifically , determined with an average error of +/- 10% and immunogenic fragments thereof.

TABLE 1 Point of PM PM protein DT1 4.45 23.5 DT2 4.55 23.5 DT3 4.55 34.5 DT4 4.75 36.1 DT5 4.83 ¾ 11.4 D point. PM iro -tesina. DT6 9.3 9.27 DT7 4.85-4.9 24.8 DT8 5.1 7.3 DT9 4.73 23.7 DT10 4.8 23.7 DT1 1 4.85 23.7 DT12 4.93 23.7 DT13 6.05 24.3 DT14 6.2 27.5 DT15 6.1 32.4 DT16 5.98 39 DT17 6.28 55.2 OT18 6.1 41 .1 DT1 9 6.1 47.9 DT20 7.4 37.6 DT21 7.7 34.7 DT22 8.2 22.4 DT23 -4.83 30.4 DT24 5 29.5 DT25 5 12.6 DT26 4.7 10.9 DT27 5.15 1 3.5 DT28 5.7 31 .9 DT29 4.97 54.8 DT30 5.86 36 DT31 5.78 36.2 DT32 6.4 10.4 DT33 6.3 13.3 DT34 9.5 32.4 Root point Pt PM DT35 8 46.5 DT36 7.49 40.6 DT37 7.1 5 37.6 DT38 7.24 34.5 DT39 7.44 4T.5 DT40 6.4 67.2 DT41 5.04 56.4 DT42 8.5 32.9 DT43 8.5 30.5 DT44 8.66 42.6 DT45 8.85 43.1 DT46 4.4 87.6 DT47 5.4 41 DT4S 7.36 24.2 DT49 9.25 47.4 DT50 5.0 94 DT51 5.35 1 00.5 DT52 5.41 59.7 DT53 5.97 23 DT54 6.1 2 25.5 DT55 5.34 36.4 DT56 4.88 0.5 DT57 4.87 1 8.5 DT58 6.14 97 DT59 4.5 19.7 DT60 5.5 40.9 DT6 5.5 39.9 DT62 5.98 4 .1 DT63 6.9 46.8 Point of: P ± P prosteina DT64 5.5 34.5 DT65 4.5 68.2 DT6S 4.35 57.6 DT67 6.13 66.5 DT68 6 62.9 | DT69 5.85 65.6 DT70 5.72 70.4 * DT71 5.5 44 DT72 5.85 10.2 DT73 4.45. 30.5 DT74 5.02 48.2 DT75 4.37 21 .9 DT76 5.14 23.3 OT77 5.64 23.0 List of potentially secreted proteins of C. trachomatis D present in whole cell lysates at 24 p.h.i., but significantly reduced in their EB and their estimated pi / PM, +/- 10% estimated error.- Table II 15 20 25 25 Name Pi CP57 8.3 36.0 CP5S 8.7 36.1 CP59 4.5 29: 7 CP60 4.8 26.0 CP61 5.2 27.6 5 CP62 5.4 30.6 CP63 6.2 25.2 CP64 6.6 26.3 CP65 5.9 22.8 CP66 4.7 24.2 CP67 4.8 22.4 CP68 5.1 24.1 CP69 5.2 | 24.3 CP70 5.3 22.3 GP71 5.6 21 .4 CP72 6.9 17.8 CP73 4.8 12.0 CP74 '5.0 8.9 CP75 5.1 1 .9 CP76 6.5 9.3 CP77 7.0 10.5 CP78 7.2 10.4 CP79 8.7 13.0 CP80 5.7 93.3 20 CP81 6.4 37.2 CP82 6.9 45.0 CP83 7.0 41 .6 CP84 7.1 38.6 - CP85 6.3 32.2 25 Name CP86 6.4 32.0 CP87 8.8 31.3 CPS8 5.0 23.8 CP89 4.7 73.0 CP90 7.4 40.1 CP91 7.8 37.7 List of potentially secreted proteins of C. pneumoniae present in whole cell lysadbs at 55 p.h.i., but significantly reduced in EB and its estimated pl / PM, +/- 10% estimated error. The most preferred proteins of the invention are C. trachomatis proteins, such as those identified by the corresponding gene number in the Chlamydia Genome project as CT017 (gene name CT017), CT044 (gene name ssp), CT243 (gene name) IpxD), CT263 (gene name CT263), CT265 (gene name accA), CT286 (gene name clpC), CT292 (gene name dut), CT407 (gene name dksA), CT446 (gene name euo) , CT460 (name of SWIB gene), CT541 (name of mip gene), CT610 (name of gene CT610), CT650 (name of gene recA), CT655 (name of gene kdsA), CT668 (name of gene CT668), CT691 (gene name 'CT691), CT734 (gene name CT734), CT783 (gene name CT783), CT858' (gene name CT858), CT875 (gene name CT875) or 0RF5 (gene name ORF5) or by the name of protein DT8 as given in Table ???? and proteins of C. pneumoniae, such as those identified by the corresponding gene number as CPN0152 (gene name CPN0152) , CPN0702, CPN0705 (gene name CPN0705), CPN0711 (gene name CPN0711), CPN0998 (gene name ftsH), CPN0104 (gene name CPN0104), GPN0495 (gene name aspC), CPN0684 (gene name parB) , 'CPN0796 (gene name CPN0796), CPN0414 (gene name accA), CPN1016 (gene name CPN1016), CPN1040 (gene name CPN1040), CPN0079 (gene name RUO), CPN0534 (gene name dksA), CPN0619 (ndk gene name), CPN0711 (gene name CPN0711), CPN0628 (gene name rsl3), CPN0926 (name of .gen CPN0926), CPN1063 (gene name tpiS) or CPN0302 (gene name IpxD), as is given in Table IIIB and immunogenic fragments thereof.

TABLE IIIA - Point of Number Name Methods of proteins of nr gene * gene-dentification DT1 CT668 CT668 M.Q.I 4.45 23.5 DT2 CT668 CT668 .Q.I 4.55 23.5 DT3 CT783 CT783 M.Q.I 4.55 34.5 DT4 CT858 CT858 .Q.I 4.75 36.1 DT48 · CT858 CT858 M, i 7.36 24.2 DT7 CT610 CT610?,?,? 4.85-4.9 24.8 DT9 CT610 CT610 I 4.73 23.7 DT10 CT610 CT610 I 4.8 23.7 DT11 CT610 CT610! 4.85 23.7 DT12 CT610 CTS10 I 4.93 23.7 0T8 None DT8 * Q, I 5.1 7.8 DT6 CT460 SWI8 9.3 9.27 -DT14 0RF5 0RF5 6.2 27.5 DT22 CT446 euo Q 8.2 22.4 DT23 CT541 mip. M 4.83 30.4 DT24 CT541 mip M 5 29.5 DT25 CT407 dksA M, Q 5 12.6 DT26 CT734 CT734 Q,! 4.7 10.9 DT27 CT292 dut M, Q 5.15 13.5 DT28 CT655 kdsA M, E 5.7 31.9 DT30 CT265 accA 5.86 36 DT35 CTQ17 CT017 M 8 46: 5 DT39 CT017 CT017 M 7.44 46.5 DT36 CT243 IpxD M 7.49 40.6 DT37. CT650 recA, E 7.15 37.6 DT57 CT044 ssp M 4.87 18.5 Protein point Number of Name Methods of l? G gene * of gene Identification PM DT58 CT286 clpC M 6.14 97 ' DT69 CT875 CT875 M 5.85 65.6 DT76 CTB91 CT691 Q 5.14 23.3 DT77 CT263 CT263 Q 5.64 23.0 Table IIB Protein point Number of Name Methods of the PM nr gene * of gene Identification CP34 CPN1 G16 CPN1016 I 5.0 39.3 CP37 CPN0998 ftsH IV! 5.3 40.7 CP42 CPN0104 CPN0104 M '6.4 38.4 CP46 CPN0796 CPN0796 Q 4.6 38.6 CP47 CPN0705 CPN0705 M 4.6 37.8 CP50 CPN0495 aspC M 5.5 38.9 CP52 CPN0152 CPN0152 5.7 33.7 CP55 CP 0684 parB M 6.2 34.7 CP56 CPN0414 accA M 6.3 34.8 CP63 CPN1016 CPN1016 M 6.2 25.2 CP71 CPN1040 CP 1040 M 5.6 21.4 CP72 CPN0079 r! 10 M. 4.8 12.0 CP73 CPN0534 dksA M. 5.0 8.9 CP75 CPN0619 ndk M 5.1 11.9 CP76 CPN0711 CPN071 1 M 6.5 9.3 CP78 CPN0628 rs13 M 7.2 10.4 CP79 CPN0926 CPN0926 M 8.7 13.0 CP88 CPN1063 tpiS M 5.0 23.8 CP91 CPN0302 ípxD M '7.8 37.7 List of examples of vaccine candidates A: C. Trachomatis and B: C. Pneumoniae identified. M: ALDI-S, Q: ESI-Q-TOF MS, P: PSD-MALDI MS, I: Western blotting. *: DT8 represents an expressed protein encoded by a new open reading frame, which is not annotated in the genome of C, trachomatis D. The proteins DT, ?? 23, DT47, DT48, DT75, -DT76 and DT77 shown in the Figure 10, also as the proteins CP34, CP46, CP47, CP52, CP63 and CP75 shown in Figure 11 are of particular relevance. Also preferred proteins of the invention are C. trachomatis pToteínas, which are proteins that have a prolonged lifetime in the presence of proteasome inhibitors, being characterized as having the characteristics of one of the proteins DT1, DT2, DT3, DT5, DT9, DT10, DT11, DT13, DT14, DT17, DT47, DT59, DT60, DT61 or DT62 as given in table IV, determined COJL an average error of ± 10%. The proteins of C. pneumoniae, which are regulated by proteasome inhibitors in the same manner, are also preferred embodiments of the invention.

Table IV List of examples of C. trachomatis D proteins, whose lifetimes are prolonged by treatment with different proteasome inhibitors during labeling and follow-up. Another preferred protein of the invention is a Chlamydia trachomatis D 8 polypeptide, which comprises the sequence SEQ. ID NO: 1, as defined in the claims and inumogenic factors thereof. In. Other preferred embodiments of this aspect of the invention, the proteins have at least 40% sequence identity, preferably at least 60%, more preferably at least 70%, even more preferably 80%, still more preferably 90% and more preferably 95% sequence identity to the proteins or fragments thereof of the invention or comprises at least 7 consecutive amino acids of the proteins of the invention. In a further aspect of the invention, it is concerned with a nucleic acid compound, comprising a sequence encoding a protein or an immunogenic fragment thereof according to the invention. A preferred nucleic acid compound is one comprising a sequence (SEQ ID NO: 2) encoding a DT8 polypeptide, comprising the sequence SEQ ID NO: 1. In still other aspects, the invention is concerned with a vector comprising a nucleic acid compound of the invention, also as a host cell transformed or transfected with the vector. The invention also provides the use of a protein or an immunogenic fragment thereof for the production of antibodies against such a protein, a method for "producing an antibody against intracellular bacteria, wherein a protein or an immunogenic fragment thereof is administered to a producer animal and the antibody is purified thereof, also as an antibody obtainable by this method.In addition, the invention provides in other aspects a pharmaceutical or diagnostic composition comprising the protein or a fragment thereof of the invention, an antibody or a nucleic acid compound of the invention, also as the use of the protein or a fragment thereof, the antibody or the nucleic acid compound in the preparation of a diagnostic reagent.

Identification of T cell epitopes of vaccine candidates The invention provides T cell epitopes that are likely to be expressed on the surface as MHC class I antigens and have a T cell stimulatory effect, as predicted by computer-based methods. from the sequences of the proteins identified in the present invention or experimentally determined by analysis as described further in the examples. Thus, another, important aspect of the invention are epitopes peptides that are likely to be expressed on the surface as Ciase I antigens of MHC and have a T cell stimulatory effect. Accordingly, the invention still provides method for identification of T cell epitopes on proteins secreted from intracellular bacteria, comprising steps such as computer prediction, MHC class molecular binding analysis and / or ELISPOT analysis on a protein or immunogenic fragment thereof identified by the methods of the invention , also as peptide epitopes. As part of this aspect, the invention also provides a nucleic acid compound comprising a sequence encoding such a peptide epitope, also as a vector comprising the nucleic acid compound and a host cell transformed with such a vector. Preferred peptide epitopes of the invention comprise 4 to 25 consecutive amino acids, preferably 6 to 15 and even more preferably 7 to 10 amino acids of a protein of the invention. In a more preferred embodiment of the invention, the epitopes comprise 7 to 10 consecutive amino acids of a C. trachomatis or C. pneumoniae- protein. Another preferred peptide epitope of the invention is an epitope, comprising 4 to 25 consecutive amino acids of a polypeptide comprising the sequence SEQ ID NO: 1, more preferably 6 to 15 and more preferably 7 to 10 amino acids. The peptide-peptides Chlamydia trachomatis, which. comprise an amino acid sequence selected from the sequences SEQ ID NO. 3 - SEQ ID NO. 45, Chlamydia pneumonia peptide epitopes, comprising an amino acid sequence selected from the sequences SEQ ID NO. 46 -SEQ ID NO. 121, Chlamydia pneumonia peptide epitopes, comprising an amino acid sequence selected from the sequences SEQ ID NO. 122 - SEQ ID NO. 148, also as epitopes of the peptide Chlamydia trachomatis, comprising an amino acid sequence selected from the sequences SEQ ID NO. 149 - SEQ ID NO. 194 are from. particular relevance. The identified epitopes of the invention are further characterized in Tables V-VII.

Table V Protein ID Position Sequence of peptides A2 link CT263 181 KLAEAIFPl 8 CT263 170 FLKNNKVKL 123 CT263 56 ALSPPPSGY 210 CT263 141 FlAKQASLV 210 CT263 17 TLSLFPFSL 286 CT263 147 SLVACPCSM 332 CT263 6 LiFADPAEA 386 CT263 4 LLLIFADPA 438 CT541 4 ILSWMLMFA 38 CT541 94 KQMAEVQKA 89 CT541 9 LMFAVALPI 122 CT541 | 135 KLQYRWKE. 221 CT541 1 18 FLKENKEKA 222 CT541 46 KLSRTFGHL 239 CT541 223 SLLIFEVKL 265 CT541 48 VLSGKPTAL 352 CT541 204 'VLYIHPDLA 398 CT541 54 LLSRQLSRT 472 CT691 172 LLQRELMKV 9 CT691 25 ST4NVLFPL 66 CT691 15 PLQAHLELV 114 CT691 6 SLFGQSPFA 94 CT691 212 KLAYRVSMT 251 CT691"194 VLWMQIIKG 284 CT691 29 VLFPLFSAL 298 CT691 122 FLQKTVQSF 468 CT691 8 FGQSPFAPL 480 CT858 85 VLADFIGGL 33 CT858 177 RMASLGHKV 52 CT858 92 GLNDFHAGV 90 CT858 490 FSCADFFPV 90 CT858 379 MLTDRPLEL 101 CT858 408 LLENVDTNV 121 CT858 391 RMILTQDEV 132 CT858 491 SCADFFPW 132 CT858 519 FVFNVQFPN 132. CT858 372 YLYALLSML 247 CT858 539 SLAVREHGA 288 CT858 '109 YLPYTVQKS 350 CT858 219 ATIAPSIRA 358 CT858 40 LLEVDGAPV 375 CT858 512 RTAGAGGFV 384 CT858 250 SLFYSPMVP 431 Predicted epitopes of detected proteins. i " Table VI Protein ID Position Sequence of peptides A2 link CPNQ152 6 FLVSCLFSV 18 CPN0152 135 YLRDAQTIL 28 CPN0152 237 LLIRIQDHV 48 CPN0152 100 KLGRKFAAV 51 CPN0152 266 LVSRTQQTL 164 CPN0152 10 CLFSVAIGA 90 CPN0152 222 GFGPPPIIV 354 CPN0152 249 SLPTKPYIL 387 CPN0152 240 RIQDHVTAN 408 CPN0152 15 AiGASAAPV 410 CPN0152 156 RLGiSGFSL 444 CPN0619 64 F VSGPVW 31 CPN0619 73 LVLEGANAV 398 CPN0705 64 FVGANLTLV 24 CPN0705 89 CLAENAFAG 114 CPN0705 233 KIEEVQTPL 116 CPN0705 2 1 ALKGHQLTL 178 CPN0705 190 QMAEAADLV • 358 CPN0796 583 F GAHVFAS 15 CPN0796 419 LLIQHSAKV 31 CPN0796 372 FLCPFQAPS 39 CPN0796 376 FQAPSPAPV 50 CPN0796 21 1 AMNACVNGI 86 CPN0796 548 FMGIQVLHL 112 C N0796 74 RHAAQATGV 134 CPN0796 328 FQYADGQMV 148 CPN0796 618 SVSAMGNFV 212 CPN0796 460 FLSYRSQVH 214 CPN0796 53 FLLTAIPGS 218 CPN0796 38 VLTPWIYRK 219 CPN0796 656 SWMNQQPL 221 CPN0796 408 SLKNSQQQL 279 CPN0796 162 MLPDTLDSV 284 CPN0796 511 ALPYTEQGL 295 CPN0796 523 VLSGFGGQV 399 CPN0998 22 LLFGWFGV 8 CPN0998 174 SLQERYPTL 29 CPN0998 416 MLLKGQNKV 33 CPN0998 379 FTFLPIILV 53 CPN0998 754 FLGDISSGA 56 CPN0998 36 FLAGKKARV 66 CPN0998 824 LLDAAYQRA 66 CPN0998 374 YLGYLFTFL 78 CPN0998 377 YLFTFLPII 09 CPN0998 717 SLGATHFLP 24 CPN0998 96 ELIDQGHRL 134 CPN0998 381 FLPI! LVLL 97 CPN0998 386 LVLLFVYLV 2 9 CPN0998"161 VTGPATPQL 223 CPN0998 319 SLEKQDPEV 224 CPN0998 567 ILMAATNRP 236 CPN0998 230 LTQETDTEA 237 CPN0998 823 MLLDAAYCr 238 CPN0998 639 LLNEAALLA _ ..- 254 CPN0998 736 ELYDQLAVL 256 CPN0998 199 LIGKYLSPV 294 CPN0998 454 SLGGRIPKG 303 CPN0998 781 GMSPQLGNV 306 CPN0998 645 LLAARKDRT 315 CPN0998 424 VTFADVAGI 427 CPN0998 54 VLTEPLWT 439 CPN0998 66 KIALNDNLV 470 CPN1016 5 KLGAIVFGL 7 CPN1016 135 YLGDEILEV 34 CPN1016 284 FLPTFGPIL 99 CPN1016 439 SLQNFSQSV 108 CPN1016 414 FTDEQAVAV 1 5 CPN1016 92 SLNDYHAGI CPN1016 164 392 175 RMIFTQDEV CPN1016 64 TQQARLQLV CPN1016 294 217 255 SLVAPLIPE March 2 CPN1016 YMVPYFWEE CPN1016 358 576 389 YVEAVKTIV CPN1016 FTQDEVSSA 395 444 516 CPN1016 GAGGFVFQV CPN1016 491 464 498 LLGFAQVRP and ¾ Predicted epitopes of C. pneumoni homologs.

TABLE VII Predicted epitopes of C. pneumoniae homologs to C proteins. trachomatis identified.

TABLE VIII Position ID Link Sequence A2 peptide protein CT149 (CPN0152) 274 FLGAAPAQM 17 CT1 9 (CPN0152) 237 FLGIQDHIL 29 CT149 (CPN0152) 101 LLTANGIAV 31 CT149 (CPN0152) 248 SLPRRIPVL 36 CT149 (CPN0152) 42 GLQEHCRGV 107 CT149 (CPN0152) 60 SLGCHTTIH 170 CT149 (CPN0152) 307 ILTHFÜSNL 181 CT149 (CPN0152) 52 VLSCGYNLV 202 CT1 9 (CPN0152) 195 LLKEICAT! 248 CT149 (CPN0152) 272 RLFLGAAPA 318 CT149 (CPN0152) 141 ATVAKYPEV 338 CT149 (CPN0152) 11 LLSGSGFAA 343 CT 49 (CPN0152) 102 LTANGIAVA 373 CT149 (CPN0152) 15 SGFAAPVEV 397 CT500 (CPNG619) 64 FMiSGPWV 20 CT500 (CPN0619) 103 ALFGES1GV 121 CT500 (CPN0619) 119 SLENAAIEV 212 CT500 (CPN0619) 87 LWIGATNPKE 313 CT500 (CPN0619) 31 RIAAMKMVH 385 CT671 (CPN0705) 102. ALVETPMAV 13 CT671 (CPN0705) 167 FCGANLTLV 49 CT671 (CPN0705) 21.4 SLKARQLNL 1.51 CT671 (CPN0705) 193 QLTEATOLV 239 CT671 (CPN0705) 127 DLQWVEQLV 403 CT671 (CPN0705) 155 IVLDNSNTV 423 CT841 (CPN0998) 22 LLFGVIFGV 9 CT841 (CPN0998) 415 LWKGQNKV 14 _ CT841 (CPN0998) 378 FTFMPIiLV 29 CT841 (CPNQ998) 753 FLGDVSSGA 43 CT841 (CPN0998) 824 LLDAAYQRA 66 CT841 (CPN0998) 780G SDHLGTV 110 CT841 (CPN0998) 715 SLGATHFLP 124 CT841 (CPN0998) 170 NLAALENRV 153 CT841 (CPN0998) 376 YLFTFMPIÍ 160 CT841 (CPN0998) 15 FPTAFFFLL 167 CT841 (CPN0998) 566! LMAATNRP 236 CT841 (C N0998) 66 KTALNDNLV 244 CT841 (CPN0998) 638 LLNEAALLA 254 CT841 (CPN0998) '735 ELYDQLAVL 256 CT841 (CPN0998) 318 ALEKQDPEV 264 CT841 (CPN0998 ) 453 SLGGR! PKG 303 CT841 (CPN0998) 380 F PHLVLL 314 CT841 (CPN0998) 644 L.LAARKDRT 315 CT841 (CPN0998) 423 VTFADVAGi 427 CT841 (CPN0998) 142 YTISPRTDV 467 CT841 (CPN0998) 464 L1GAPGTGK 495 Predicted epitopes of C. trachomatis homologs to identified C. pneumoniae proteins. The peptide epitope can be part of a fusion protein or coupled to a carrier portion. A method frequently used to predict peptide binding to MHC involves portion searches. The more elaborate portion search uses whole matrices that represent the extended portion of the MHC. Although the independent combinatorial specifics of the sequence can be corrected as an average consideration, it is certainly known that it is incorrect for individual peptides. In addition, crystal structures have shown that interactions in a subsite can affect interactions in other subsites. Artificial neural networks (ANNs) are particularly appropriate for managing and recognizing any of such non-linear information sequence. The information can be trained and distributed in a computer network with input layers, hidden layers and output layer, all related in a certain structure by means of weighted connections. Such an ANN can be trained to recognize inputs (peptides) associated with a given output (such MHC link). Once trained, the network must recognize the complicated peptide patterns compatible with the link. Using the ANN procedure, the size and quality of the training set becomes more important. This is particularly true for HLA since only 1% of a random set of peptides will bind to any given HLA. Thus, to generate as few as 100 examples of peptide binding agents, if randomized peptides were selected, they would require the 'synthesis and tests of approximately 10,000 peptides. This would be a very demanding and laborious proportion even at this moderate number of binders in the training set and it has to be repeated for each HLA to be tested. Thus, in relation to the present invention, matrix predictions were used to scan the SWISS-PROT database (http://www.expasy.ch/sprot/) for potentially high affinity binding epitopes. A large number of these have been synthesized and tested in biochemical analysis. As predicted, a much higher representation of high fidelity binders was obtained (approximately 80%). These data were used subsequently to train the ANN. For four of four MHC class I molecules examined, the ANN wo better than the matrix-driven prediction. The predictions have been generated in a way, which predicts the actual link IC50 value instead of an arbitrary classification to "binders" versus "non-binders". Of course, it has been possible to predict binders in a large range which leads to the identification of high affinity binders also as lower affinity binders also as non-binders. The invention further comprises the use of a peptide epitope of the invention for the preparation of a vaccine, also as a vaccine comprising a peptide epitope of the invention, such vaccine optionally containing acceptable excipients. In still another aspect of the invention, it is concerned with the use of a protein of the invention, an antibody of the invention, a nucleic acid compound of the invention or a peptide epitope of the invention in the preparation of a pharmaceutical composition for treating or preventing infection due to an intracellular bacterium, such as a Chlamydia infection, or alternatively, in the preparation of a diagnostic reagent to detect the presence of an intracellular bacterium, such as Chlamydia or antibodies raised against the intracellular bacterium. The invention further provides a method for inducing an immune response in a human, which comprises administering to said human an immunologically effective amount of a protein, an antibody, a nucleic acid compound or a peptide epitope of the invention and especially such methods for treat or prevent infection of humans by an intracellular bacterium, such as C. pneumoniae or C. trachomatis. Finally, the invention provides methods for producing a protein or a fragment thereof of the invention or a peptide epitope of the invention, respectively, which comprises the transformation, infection transaction of a host cell with a vector comprising a a nucleic acid compound encoding such peptide protein or epitope and culture of the host cell under conditions that allow the expression of such a protein or fragment by the host cell. The invention is further illustrated by the following non-limiting examples.

EXAMPLES Example 1: Infection of mammalian cell cultures - semi-confluent HeLa, HEp-2 or McCoy cell monolayers (ATTC, Rockville, MD, USA) were infected with an inclusion forming unit (IFU) of VR1310 of C. pneumoniae, serovar A of C. trachomatis (HAR-13), D (UW-3 / Cx) - or L2 (434 / Bu9) (ATCC) as previously described in [19.] and [17.] The infection medium consisted of RPMI 1640, 25 mM HEPES, 10% FCS, 1% w / v glutamine, 10 mg / ml gentamicin for C. trachomatis A and D and RPMI 1640, 25 mM HEPES, 5% FCS, glutamine at 1% weight / volume, gentamicin 10 mg / ml for C. trachomatis L2.

Example 2: Pulse Marking / Tracking To label the chlamydial proteins for periods of two hours, the infected cell cultures were incubated in medium containing RPMI 1640, gentamicin 10 mg / ml, 40 pg / ml cycloheximide, 100 μg. /?to? [35 S] -methionine / cysteine (Promix, Amersham Pharmacia Biotech, Uppsala, Sweden) as previously described (Shaw, et al., 1999, 2000) [18] [19.]. After labeling, the labeling medium was changed to normal growth medium followed by two washes in normal growth medium and the infected cells were harvested at different points in time after labeling. Similarly, labeled EB proteins were obtained by allowing Chlamydia to grow to 72 h.p.i. after the two hour dialing periods. Then the labeled EBs were harvested and purified using two consecutive stages of density gradient ultracentrifugation essentially as described for C. trachomatis in (Schacter and Wyrick, 1994) [22] and for C. pneumoniae (Knudsen et al., 1999 [17.]). The proteins in the EB preparation and pulse / follow up preparation were labeled at the same intervals as the proteins in the whole cell lysate preparation to facilitate comparison of the correct 2D-PAGE protein profile.

Example 3: Sample preparation Following labeling [35S] the cells were washed twice in PBS and solubilized in a standard lysis pH buffer solution containing 9 M urea, 3- [(3-colamidopropyl) dimethylammonium] -1 -propanesulfonate (CHAPS; Roche, Germany) at 4% w / v, 40 mM Tris Base, 65 mM DTE and Pharmalyte 3-10 (Amersham Pharmacia Biotech). For the enrichment of the high molecular weight and hydrophobic proteins urea 7, thiourea 2 M, 3 - ['(3-colamidopropyl) dimethylammonium] -1-propanesulfonate (CHAPS, Boehringer Mannheim, Germany) at 4% w / v, Base Tris 40 mM, 65 mM dithioerythritol (DTE) and 2% volume / volume Pharmalyte 3-10 (Amersham Pharmacia Biotech) 'was used essentially according to (Harder et al., 1999 [23.]). Samples containing Purified whole cell or purified EB were solidified and centrifuged at 10,000 X g for 10 minutes. The samples were stored at -70 ° until they were used.

Example 4: Separation of Chlamydia proteins Cnlamydia proteins from whole cell lysates and EBs were separated by two-dimensional gel electrophoresis essentially as described in (Shaw, et al., 1999, 2000) [18. ] [19. ] For isoelectric focusing in the first dimension, dry strips "of pH gradient of 18 cm long pH 3-10 NL (non-linear), 4-7 L (linear) or 6-11 (linear) (Amersham Pharmacia Biotech) were refinished with a labeled protein sample amount of 200,000 counts / minute (cpm) in 350 μl of lysis buffer for 12 hours at 20 ° C using the IPGphor ™ apparatus Other strips used in the invention included ultra IPG strips Strips are described in Table IX, which allow us to focus on specific pH ranges containing proteins of interest, if necessary.The voltage during isoelectric focusing at 20 ° C was programmed as follows: one at 300 V, 2 hours at 300-500 V (linear increment), 1 h at 1,000 V, 1 h at 2,000 V, 3 h at 3, 500 V and 5, 000 V at 24 h when using dry strips of 3-10 NL, 4- 7 L and 6-11 L.

TABLE IX: Interval Name of IPG strip length linearity pH covered strip Dry strip Iinmobiline pH 3-10 ho linear 3-10 18 cm Dry strip Immobiline pH 3-10 linear 3-10 18 cm Dry strip Immobiline pH 4-7 linear 4- 7 18 cm Dry strip I mobiiine pH 6-11 linear 6-11 18 cm Dry strip Immobiline pH 6-9 linear 6-9 18 cm Dry strip Immobiline pH 3.5-4.5 linear 3.5 -4.5 18 cm Dry strip Immobiline pH 4-5 linear 4-5 18 cm Dry strip Iinmobiline pH 4.5-5.5 linear 4.5-5.5 18 cm Dry strip Immobiline pH 5-6 linear 5-6 18 cm Strip -¾ci ~ InSiobiriñe pH 5.5-6.7 linear 5.5 -6.7 18 cm List of examples of commercially available IPG dried strips useful in the invention. After the first dimension, the dried strips were balanced in a balancing solution containing 6 M urea, 30% volume / volume glycerol, 0.2% w / v% DTE, 2% w / v SDS, 0.05% Tris-HCl M pH 6.8 for 15 minutes. Then the strips were equilibrated for 15 minutes additionally in a buffer in which the DTE was replaced by iodoacetamide at 2.5% weight / volume. For the second dimension, the Protean II x Multicell system (Bio-Rad, Richmond, CA, USA) was used to separate proteins in gels. of SDS-PAGE linear gradient 9-16% (18 cm X 20 cm X 1 m). The analytical gels were fixed in a solution having 10% acetic acid and 25% 2-Propanol for 20 minutes and treated with Amplify (Amersham Pharmacia Biotech) for 30 minutes. The labeled proteins were visualized by autoradiography after exposure of 8-10 days of Kodak Biomax-MR film (Amersham Pharmacia Biotech) at -70 ° C. Figure 1A shows an example of an autoradiography of a high-resolution analytical IPG 3-10 2D gel (standard lysis buffer was used) of labeled C. trachomatis D proteins 22-24 h.p.i. Figure 2A shows an example of an autoradiograph of a 2D gel of IPG 3-10 (solution, lysis buffer containing diurea was used) of labeled C. pneumoniae proteins of 55-57 h.p.i. A total of approximately 600 protein spots could be visualized in each gel as estimated through the Melanie II programming elements. To prepare samples for mass spectrometry analysis, 2D gels were run with 500-1,000 g of whole cell suspensions. To visualize proteins on preparative gels on X-ray films 2 * X 10e cpm of proteins marked with [35S] -protein from cells cultured in parallel with the uncharged samples, they were run on the same gels. The preparative gels were washed for 10 minutes in ddH20 and fixed without drying. Radioactive ink was used to mark the stitches on the sides of the gels, so that an exact match of the dry gel and the corresponding X-ray film could be made after the exposure. The proteins of interest were extirpated and accumulated together with at least .3 identical gels. Gels using narrow or ultra narrow strips (table IX) were used to increase the separation distance, if the host cell combination was a problem in the mass spectrometric identification.

Example 5: Identification of vaccine candidates using MALDI-MS, ESI-Q-TOF MS, MALDI MS PSD and Edman degradation Protein gel spots prepared from whole cell lysates representing vaccine candidates were. subjected to gel digestion with trypsin. The resulting peptides were purified using reverse phase columns (Gobom, et al., .1999 [20.]) or beads (Gevaert, et al., 1997 [21.]) which consist of Poros R2 material. The samples were subsequently analyzed using a Bruker REFLEX MALDI time-of-flight mass spectrometer (Bruker-Daltonik, GmbH, Bremen, Germany) operating in reflectron mode. The resulting masses were compared with the masses of peptide generated by a theoretical tryptic cleavage of proteins present in databases by mapping peptides as previously described (Schevchenko 1996 [24.]). An example of an identification of DT1 as CT668 using MALDI-MS is shown in Figure 3. Figure 3A shows the peptide mass fingerprint obtained by a MALDI mass spectrometer. The masses obtained were matched with the theoretical tryptic cleavage products of all the proteins present in the bases -of data using the MS-Fit programming elements of Prospector. If the search was restricted to a pl / PM area the proximity to the protein found in the highest-ranking protein gels was CT668 (Figure 3B). Nevertheless, since the host cell proteins are sometimes present in the gel spots with whole cell lysates, the identification can be unambiguous. Therefore, tandem mass spectrometry and post-source decay analysis (PSD) was used to verify the results, if necessary (reviewed in Mann and Wilm, 1995 [25.], Gevaert, 1997 [21.] ) .. The tandem mass spectrometry of peptides generated by gel digestion was carried out in a eletrotatization ionization quadrupole time-of-flight mass spectrometer (ESI-Q-TOF) (Micromass, Manchester, UK). Using this method, a single isolated peptide can be ionized from the sample. By means of the fragmentation of this original ion by collision with a gaseous atmosphere, several new ions were generated and registered in a peptide mass trace. These new ions were distinguished in size by only one amino acid, thus providing details of the amino acid sequence of the original peptide (Mann and Wilm, 1995) [25.].

Figure 4A shows an example of an original fragmented peptide ion of DT1, which produces a sequence, which by means of database search using BLAST or MS-Tag was found to correspond to fragments of CT668.

Sequence tags that arise from the human progesterone binding protein were also identified from the CT668 sample. The peptides of this protein could also be detected in the mass fingerprint of the MALDI-MS peptide (double-headed arrows, figure 3A) if the search was restricted to human proteins. This shows that problematic points, which contain more than one protein, can be unambiguously identified by ESI-Q-TOF, thus forming the identification of problematic MALDI MS. Another method used in the invention to confirm the results of MALDI was PSD. PSD uses that the peptides undergo metastable decay after ionization, which means that the peptide fragments of the same velocity have different mass and therefore possess different kinetic energy. The differences in kinetic energy can be resolved by reflecting the fragments in a magnetic field. The high-energy fragments will penetrate the magnetic field further than the low-energy fragments and are therefore retarded. The resulting spectra "of the fractionation of a single peptide can be used to deduce the amino acid sequence of a peptide sequence tag (PST) (Mann, et al., 1993) [28.] since fragmentation occurs predominantly in Peptide linkages The PST can be matched against protein databases and by this, the protein from which they originate can be identified (Wilkins, et al., 1996 [27.]). the identification of point No. CP63 as CPN1016 by means of PSD MALDI MS is shown in Figure 4B.From a total of 36 masses observed in the PSD spectrum 16 'could be matched within a mass unit with masses that are originate from a theoretical fragmentation of the peptide with the sequence of the original ion 1919.80 Da (R) ELLFGWDLSQQTQQAR (L), which coincides with the CPN1016 protein of C. pneumoniae, using mass spectrometric procedures, examples of the 'identification of candidates for C. trachomatis D vaccine (Table IIIA) and C. pneumoniae (Table Illb) are provided. The values of PM and Pi were determined electrophoretically with an average error of +/- 10%. The DT858 had a theoretical MW of 67 Kda, indicating that the protein identified was a processed fragment of a larger protein. Of course, all three peptides of the ESI-Q-TOF analysis of DT4 were located in the C-terminal part of the protein. Another point, DT48, located in the base region of the gel also contained CT858. All peptides that identify DT48 as CT858 coincided with the N-terminal part of the protein suggesting that DT48 represents the N-terminal fragment of CT858. CT610 was identified from EB by both MALDI MS and Edman degradation in C. trac omatis and L2. However, the protein was significantly reduced in EB compared to whole cell lysates and was therefore still considered as a vaccine candidate. The identification of CT610 by Edman degradation was made of C. trachomatis L2 CT610. The N-terminus was determined to be MNFLDQ, which is different from the predicted MMEVFMNFLDQ sequence of the Chlamydia Genome Project (Stephens, et al. 1998b) [35. ] DT8 was identified based on labels of four sequences generated by ESI TOF MS. These sequences did not correspond to any open reading frame predicted in C. trachomatis D genome [35]. However, by searching for the Chlamydia genome in all 6 reading frames with BLAST significant matches could be generated for all four sequence tags. Analysis of the DNA sequence encoding the peptides and their surroundings produced a new open reading frame that includes a ribosomal binding site, which consisted of a 7.2 Kda protein. The translated DNA sequence of DT8 is shown in Figure 5. This finding illustrates how the mass spectrometric methods used in this invention can identify vaccine candidates encoding potentially important ORFs, which can be neglected in large genome sequencing projects. The point CP63 of C. pneumoniae was identified as an N-terminal fragment of CPN1016, the homolog of C. pneumoniae of CT858 (Figure 2 B and C, Table IIIB) indicates the processing of these prpteins in both chlamydia species. In the following examples more detailed investigations of the properties of the examples on the identified proteins will be presented.

Example 6: Comparison of Used Wholes of Identified Cells with Purified RB Cells infected with C. trachomatis or C. pneumoniae were labeled with [35 S] -methionine / cysteine for a period of two hours in the presence of cycloheximide as described in. .example- 2. At the end of the labeling period, the infected cells were either harvested directly in lysis buffer as described in Example 3 or used for immediate purification of chlamydial RB. The purification of RB was carried out by density gradient ultracentrifugation essentially as described by Schachter and Wyrick, 1994 [22.]. In FIG. 10, 'examples of gel image regions of C. trachomatis D proteins from whole lysates of infected HeLa cells labeled 22-24 h.p.i. are compared to corresponding regions of RB and EB gel images purified from HeLa cells infected with C. trachomatis D labeled 22-24 h.p.i. Identification by mass spectrometry was obtained for DT4 (C-terminal fragment of CT858), DT48 (N-terminal fragment of CT858), DT23 (Mip), DT76 (hypothetical protein CT691) and DT77 (hypothetical protein CT263) as listed in table III. In Figure 11, examples of gel image regions of HEp-2 cells infected with C. pneumoniae labeled at 55-57 h.p.i. and of purified EB labeled at points in time throughout the development cycle are compared with corresponding regions of cultures of cells infected with C. pneumoniae labeled at 34-36 h.p.i. and either harvested as whole lysates of infected cells at 36 h.p.i. or purified as RB at 36 h.p.i. The protein spots encircled in Figure 11 were identified as follows. Figure 11A and E show CP34 and CP63, which have been identified as two fragments of CPN1016. Figure 1ÍB. shows CP37, which has been identified as CPN0998. Figure 11C shows CP46 and CP47, which have been identified as CPN0796 and CPN0705, ^ respectively. Figure 11D shows the CP52 that has been identified as CPN0152. Figure 11F shows the CP75 that has been identified as CPN0619.

Example 7: Detection and identification of proteins located in the subgroups of type III secretion gene While the type III secretion genes in most of the intracellular bacteria are located in a group of genes as an island of pathogenesis, the Chlamydia type III secretion genes have been identified in three different subgroups located at different places in the genome in both C. trachomatis and C. pneumoniae (Stephens, et al. 1998 [4.] and Kalman, et. al., 1995 [5.]). As part of a global proteomic analysis of -C. trachomatis A, D and L2 and VR1310 C. pneumoniae, proteins that were present in secretion groups III were identified from gels run with purified EB. The type III secretion proteins identified from C. trachomatis included the Yop secretion ATPase (yscN), the translocation L protein Yop (YscL) and the secretion chaperone (SycE) necessary for the transport of proteins from the bacterial cytoplasm to the machinery of secretion .. Additionally, the proteins of C. trachomatis D identified, which have - unknown functions but are located in subgroups of type III secretion, include CT560 and the abundant CT577 and CT579. CT668 is clearly present in the Whole-cell-used ones, but absent from purified EB and due to its location close to YscN, this protein can be secreted. The genomic location of the proteins is shown in figure 9. For C. pneumoniae, the proteins of the type III secretion apparatus LcrE (CPN0324), YscC (CPN0702), YscN (CPN0707) and YscL (CPN0826) have been identified. YscC (CP89, Figure II, Table II) is absent from purified EB, probably due to the location in the inclusion membrane, where it is exposed to the cytoplasm of the host cell. Two proteins present in a type III group located around YscC (CPN0702) and YscN (CPN0707) were detected in a considerably higher amount in whole cell lysates than in lysates of purified EB. These were CPN0705 (CP90, figure II, table II) and CPN0711 (CP76, figure II, table II). These proteins can also be located in the inclusion membrane or present in the cytoplasm of the host cell and in both cases these proteins can be accessible to the proteasome.

Example 8: Candidate impulse tracking studies for secreted proteins In order to estimate the time at which the identified candidate proteins could be present inside infected cells, the invention provides a series of impulse tracking studies. In the following examples the infected cell cultures were [35 S] -marked for 22-24 hours. After the labeling period, the medium was changed to normal RPMI growth medium without [35 S] -methionine and the cells were harvested at different times after labeling. The results of several relevant studies showed minor variation, probably due to small differences in host cell density and / or infection efficiency. Figures 1, B, C, D and E provide an example of a pulse / follow experiment. The intensities of CT668 and DT8 (Figures 1: A, B, respectively) were significantly decreased 1.5 hours after synthesis and virtually absent from the gels at 4.5 hours and up to the EB stage. CT610 and CT873 (figure 1: C, D) decreased significantly, but were still acceptable at 4.5 hours and up to the EB stage. The C-terminal fragment of CT858 (D) (and the N-terminal fragment of CT858) was gradually increased during the first follow-up periods, but absent from EB, suggesting that the cleavage product accumulated during the clamidal period. The N-terminal fragment of the C. pneumoniae homolog of CT858, CPN1016 was also absent from EB (Figure 2).

Go to Example 9: Impulse tracking studies in combination with proteasome inhibitors This example shows how to determine which of the vaccine candidates are processed in the proteasome. Permeable proteasome inhibitors in the cell are added to the infected cell cultures during labeling and the follow-up period and the lifetime of proteins compared to that observed for labeling / follow-up without added proteasome inhibitors, an example of the importance of this procedure is shown in Figure 6. The proteins were labeled in the presence or absence of 10-100 'μ? of the proteasome inhibitor MG-132 of 22-24 h.p.i. The labeling medium was then replaced with growth medium with or if G132 after two washes in normal growth medium and 24 h.p.i. at 28 h.p.i. The cell lysates were run on 2D-PAGE (IPG) and compared for controls without MG-132 and to gels with proteins harvested immediately after labeling (Figures 6A, B and C). the. invention provides examples of fifteen proteins of C. trachomatis D, which had an increased lifetime _ due to treatment with proteasome inhibitors. The levels of DT9, DT10 and DT11 were actually higher in follow-up gels + MG 132 than in the controls harvested immediately after the marking period. This indicates that DT9, DT10 and DT11 are degraded very rapidly by the proteasome. In contrast, the 'DT7 levels were not significantly affected by the addition of proteasome inhibitors. The invention includes the use of several other proteasome inhibitors (eg, MG 115, MG262 and lactocysteine), which inhibit different portions of the catalytic activity of the proteasome, which can produce "other proteins that are degraded" in the proteasome (Table IV ).

Example 10: Use of genetically altered cell lines to analyze the effect of the proteasome inhibitor on the lifetime of Chlamydia proteins The invention also provides for the use of commercially available mouse embryonic cell lines MEC-PA28 cell line PW8875. MEC-PA28- is transiected with the subunit 'alpha and .beta PA 28, INF-? inducible proteasome and the j- cell line MEC217 is transfected with L P2 INF-? inducible, LMP7 and MECL of the proteasome. MEC-PA28 and MEC217 are cultured in a semiconfluence and infected with 'C. tr-ac omat-is- or C. pneumoniae-. Embryonic mouse control cells, which are not transfected with the proteasome subunits, were infected in parallel.

Since the transfected genes encoding the overexpressed subunits of the MEC-PA28 and MEC217 cell lines are essential for the processing and presentation of MHC class I antigens, experimental procedures using proteasome inhibitors combined with pulse labeling / tracking are carried performed with this host cell as previously mentioned.

Example 11: Cloning and expression of open reading frames (ORF) that encode vaccine candidates The cloning and expression of the ORFs that code for vaccine candidates was done using the LIC Vector PET-30 kit (Novagen, Madison, USA) according to with the instructions, from the manufacturer. The primers used for the PCR of the. genes had., the following 5 'and 3' end LIC extensions: Front primer: 5 'GACGACGACAAGATX - 3' gene specific sequence, Reverse primer: 5 'GAGGAGAAGCCCGGT - 3' gene specific sequence. (X: the first nucleotide of the specific insertion sequence). Either full length genes or genes without the forward sequence were amplified by PCR using the Expand ™ High Fidelity PCR (Roche, Germany). Thirty-five cycles of PCR were carried out on an apparatus of thermal cycles of DNA (GeneAmp PCR system 9600, Perkin Elmer) as follows: 15 sec at 92 ° C (denaturation) 15 sec at 55 ° C (annealing of the primer) and 4 min. 68 ° C (extension). The resulting PCR products included the extension of LIC close to the specific sequence of the gene. The PCR products were purified by Wizard (Promega, Madison, USA) and ligated to the pET-30 vector. The pET-30 vector contains the gene coding for kanamycin resistance and a histidine tag upstream of the LIC cloning site. Vectors pET-30 containing the candidate genes were transformed into competent E. coli Nova Blue strain. Colonies were selected on kanamycin agar plates and control PCR was carried out on selected colonies using a vector-specific primer and a specific insert primer. The plasmid DNA was • purified from positive colonies containing the specific insertion of the candidate gene. The plasmid DNA was subsequently transformed into E. coli (BL21). Positive colonies of the insertion were selected on kanamycin agar plates. Expression of the fusion protein comprising the specific insertion of the gene that includes a localized N-terminal histidine tag was induced in LB medium of 500 ml by addition of IPTG lmM (Apollo Scientific, GB). E. coli (BL21) expressing recombinant fusion proteins CT668, CT858, CT783, -CT610, -YscN and DT8 of C. trachomatis D and CPN1016 and YscC of VR1310 C. pneumoniae were generated. The recombinant fusion proteins were purified from bacteria subjected to lysis using a nickel resin column (Hig Trap Sepharose, Amersham Pharmacia Biotech) as previously described. SDS-PAGE gels stained by Coomassie from the purified proteins were run. The Coomassie-stained bands representing fusion proteins were identified in an unambiguous manner by MALDI MS to verify that the correct fusion protein had been generated. Sera containing polyclonal antibodies were obtained by nizing New Zealand white rabbits intramuscularly three times with 50 μg of fusion protein dissolved in Freunds' adjuvant and intravenously twice with 50 μg of fusion protein dissolved in PBS as described in [17]. ] by Knudsen, et. to the.

Example 12: Protein Bands Using PAbs Against Vaccine Candidates In order to confirm that the PAbs recognized the correct vaccine candidates and to visualize the potential post-translational modifications or processing, 2D-PAGE nosorption was carried out. 500 μg of unlabeled protein and 2 X 106 cpm of C. trachomatis or C. pneumoniae proteins labeled from whole cell lysates were separated by 2D-PAGE and the proteins were subjected to noabsorption to PVDF membranes. The nostaining was carried out using a 1/500 - 1/1 dilution, 000 of PAbs in a buffer solution containing 150 mM NaCl (or in a high salt concentration, 400 mM), 20 mM Tris, 0.2% w / v gelatin, 0.05% volume / volume Tween 20 (Bio-Rad ) and 2% volume / volume normal goat serum (Dako, Glostrup, -Denmark). The second antibody used was goat anti-rabbit phosphatase-alkaline conjugated IgG (Bio-Rad) diluted 1 / 2,000 in antibody regulatory solution. The spots were stained with 5-bromo-4-chloro-3-indolylphosphate toluide (BCIP) / nitro blue tetrazolium (NBT) (Bio-Rad) until a clear reaction was detected. The immunoblots were scanned by computer and subsequently exposed to X-ray films for approximately 8 days. Melanie II programming elements were used in order to compare immunostained proteins with their [35S] -marked counterparts. An example of a total IMB 2D-PAGE image with PAb245 against CT858 is shown in Figure 7A1 and 7A2. PAb245 reacts reproducibly with DT4 (C-terminal fragment CT858) and DT48 (N-terminal fragment CT858) (Figure 7A1) as indicated by the corresponding labeled background (Figure 7A2). Figures 7B1 and 7B4 show IMB with CT668 and YscN. The immunoreactive protein spots on the gel and their location, based on the labeled background (Figures 7B2 and B5) corresponded to the positions of the proteins on analytical gels (Figures 7B3 and B6), thus confirming that the PAbs reacted with the proteins correct The invention provides an example of IMB which shows that levels of certain isoforms of CT610 are clearly increased in infected cells treated with MG132 compared to controls without treatment. DT7 was identified as CT610 and was located just above DT9, DT10, DT11 and DT12 (Figure 6A). The IMB with PAb255 against CT610 on 2D-gel spots (Figure 7C1) of whole cell lysates reacted clearly with two rows of dots, one row represents DT7 and the other row represents DT9, DT10, DT11 and DT12. Therefore, CT610 is present in different isoforms supposedly due to different post-translational modification and different processing. The. abundance of DT9, DT10, DT11 and DT12. it was clearly increased if the cells were treated with the proteasome inhibitor MG132 (Figure 7C2).

IMB with PAb255 was carried out on ordinary PVDF SDS-PAGE spots with protein from whole cell lysates treated for 6 hours in the presence or absence of MG132, respectively. Figure 7C4 clearly shows an extra band below the band representing the row of points of DT7 in pathways containing proteins from infected cells treated with MG132 (vias b and d) compared to untreated controls (vias a and c). The levels of the upper band, which represent the row of DT7, - were not significantly altered by the proteasome inhibitor treatment.

Example 13: Expression of Candidates in Different Serovars of C. trachomatis and Endocretion in Different Host Cells The invention considers the specific differences of serovar / host cell in expression levels of naturally secreted proteins, since host cell / Chlamydia interactions can be different for other serovars or by culture in other host cells. This is relevant for the election of the vaccine candidate with the greatest potential for a general C. trachomatis vaccine. CT668, CT858, CÍ873 and CT610 were all detected in the same positions in C. trachomatis, D and L2. This is in agreement with the very high conservation of the genes that encode these proteins between C. trachomatis D and L2. In addition, all proteins were expressed when C. trachomatis A, D and L2 were cultured in McCoy cells or Hep-2 cells instead of HeLa cells, indicating that the expression of these proteins is independent of the cell types used. However, based on the gels with Chlamydia protein labeled 22-24 h.p. i. or 34-36 h.p. i. DT8 was detectable at pl 5.1 and PM 7.5 in serovars A and D. However, in serovar L2 DT8 it was detected at pl 6.4 and PM 7.5 supposedly due to minor amino acid substitutions that alter the net charge and the isoelectric point of the protein .

EXAMPLE 14: Indirect immunofluorescence microscopy of vaccine candidates Cavities of glass slides containing monolayers of HeLa semiconfluent cell were infected with C. pneumonia or C. trachomatis D. A low Chlamydia titer was used, so that only about 50 % of the cells were infected, thus making it possible to discriminate clearly between infected cells and uninfected cells. The cells were washed twice in PBS and fixed in formaldehyde or methanol at different h.p. i. and subjected to indirect immunofluorescence microscopy. If necessary, the PAbs were preabsorbed by HeLa protein precipitated by acetone in order to obtain minimal cross-reaction with human proteins. In the example shown in Figure 8, a dilution 1/200 of pre-absorbed rabbit and a 1/25 dilution of mouse monoclonal antibody directed against C. trachomatis MOMP (MAb 32.3) or 'Mab 18.3 against C. pneumoniae was used. Goat anti-rabbit IgG antibody (GAR) fluorescein conjugated isothiocyanate (FITC) and goat anti-xaton IgG antibody (GAM) rhodamine conjugate (Jackson, Trichem, Denmark) was used as secondary antibodies. The double immunostaining was carried out in order to determine the subcellular localization of the vaccine candidates in relation to the inclusion of Chlamydia. PAb 249 directed against DT8, which had a short life time, reacted weakly with RB in chlamydial inclusion (Figure 8 A3). No significant reaction with host cell structures was detected beyond inclusion despite a minimal cross-reaction with HeLa cell proteins. In contrast, CT858 clearly stained the host cell cytoplasm infected but not the cells without infection (Figure 8B3). In general, "the dyeing was more intense at the borders of the inclusions.The staining of the host cell cytoplasm could be visualized from 12 hpi to 72 hpi in accordance with the long life time predicted by the impulse follow-up studies. The same reaction characteristics were observed when PAb emerged against C. pneumoniae CPN1016 which is homologous to CT858 was reacted with C. pneumoniae infected Hep-2C cells.

Description of examples with respect to identified proteins Example 15: CT668 dot number (DT1 and DT2) CT668 was placed immediately upstream of the YscN ATPase in one of the subgroups containing genes with type III secretion genes homology and which do not contain a predictable recognizable signal peptidase cleavage site. CT668 was only present in C. trachomatis D for approximately 4-6 hours during which it decreased uniformly in abundance. The PAbs against CT.668 only seems to react weakly with the RB in the inclusion of IMF, but considering the short lifetime of this protein, this can be explained by a rapid degradation in the host cell. The CT668 ~ has been detected at 12-40 h.p.i., suggesting that the protein is produced during most of the intracellular development. It may therefore be that C. trachomatis is continuously exporting CT668 to the host cell, where it exerts its action and is rapidly degraded. Two variants of CT668 were identified. The "basic variant was more abundant on gels with marked C. trachomatis proteins of 22-24 hpi and subsequently harvested, Interestingly, the intensity of the acid variant was increased and the basic variant decreased with time in all the studies carried out. When the CT668 was followed in 30-minute intervals, the increase in the acid variant was already detectable in one hour (Figure IB) .This finding may suggest that the modification is not due to the operating conditions of the gel, which can create modifications such as carbamylation or amidation Instead, the modification seems to originate exclusively by means of an unknown enzyme, which modifies the protein.The modification of secreted proteins has been described in C. psitacci, where IncA is phosphorylated by a Ser / Thr kinase of host cell after translocation to the inclusion membrane (Rockey, et al., 1997) [29.]. or life of CT668 was prolonged in the treatment with proteasome inhibitor, suggesting that at least limited quantities of the C 668 produced can be processed in the proteasome.

Example 16: DT8 point number (DT8) DT8 is a new 7.2 KDa protein, which based on homology search is a specific protein of C. trachomatis. The SPORT analysis did not indicate a recognizable leader sequence for this protein. The theoretical coordinates pl 5.21 / 7.2 KDa were in excellent agreement with that determined experimentally. Many of the recognized features were observed · for CT668 were observed for DT8 as well. A short lifespan of < 6 hours was observed and IMF showed only a weak reaction with RB. After the DT8 retention codon a potential derivation-cycle region can be predicted by indicating a Rho-independent transcription termination of the protein.

Example 17: Point number DT7, DT9, DT10, DT11, DT12 (CT610) CT610 was not located near any gene with homology to genes that are involved in secretion in other organisms. The protein was identified from both whole cell and EB lysates, but by means of the Melanie II programming elements it was estimated that it was at least 30 times more abundant in whole cell lysates.

The protein was detected in several isoforms represented by two molecular weight polymorphisms as determined by means of Pab255 raised against CT610. These knit rows represented DT7 (upper row) and DT9, 10, 11, 12 (lower row). Both of these rows had a short life span in follow-up impulse studies. Interestingly, the abundance of DT9, DT10 and DT11 was significantly increased after treatment with proteasome inhibitor based on impulse follow-up studies / MG 132. Follow-up impulse studies were verified by IMB of PAGE of SDS with Pab255. Thus, the invention provides evidence that certain isoforms of CT610 are secreted and processed in the proteasome. The different fate of the CT610 isoforms shows the relevance of using Pab raised against the vaccine candidate to detect such isoforms.

Example 18: DT3 dot number (CT783) It has been suggested that CT783 is a disulfide bond isomerase of C. trachomatis protein. CT783 shows homology to thioredoxin disulfide isomerase (CT780) and to a protein disulfide isomerase of Methanobacterium thermcautotrophicum. A forward sequence of amino acid 33 can be predicted by PSOR and SignalP and the. The theoretical pl and molecular weight of the cleaved protein was in agreement with that determined experimentally. In addition, molecular antibodies generated against CT1783 stained the correct spot in 2D-PAGE IMB using 4-7 L and IPG. Due to cleavage of the N-terminal forward sequence, this protein is probably not secreted via type I or type III systems, but more likely system II. A weak SPORT prediction 'suggested a sub-cellular localization in the bacterial inner membrane, although most of the PDI is normally located in the periplasm. CT783 had a very short life span and is virtually absent in Chlamydia after approximately 4-6 hours of follow-up after synthesis. The lifetime of CT783 was prolonged by proteasome inhibitors suggesting potential processing in the proteasome.

Example 19: Number, dot DT4 and DT8 (CT858) and CP63 (CPN1016) CT858 had a cleavable N-terminal forward sequence and was predicted to be a periplasmic protein of 67 KDa, but was identified in. Two different positions on the 'gels. The sequence tags, which identified the DT7 as CT858, all coincided with the C-terminal part of CT858. In the IMB on membrane PDVF 2D-PAGE with Used whole cell, PAb245 reacts clearly and reproducibly with this C-terminal fragment. In addition, Pab245 reacted with the DT48 protein dot, which also has a long lifetime in the impulse tracking studies as seen for DT4. DT48 was also identified · as an N-terminal fragment of CT858 by MALDI MS. The molecular coordinates of DT48 were pl 7.3 / PM 25.8. The N-terminal part of CT858 produces a peptide with coordinates according to those experimentally determined using the pl / PM tool over different N-terminal lengths (without the signal peptide). This analysis suggests a cleavage site around 233S234M235. The fact that the N-terminal and C-terminal fragment of CT858 can be detected on 2D gels up to stage EB (72 h.p.i.), but not in purified EB it is indicative of a long lifespan in the cytoplasm of the host cell. This was in agreement with the very clear detection of CT858 in the cytoplasm of the host cell for up to 72 hours through IMF studies. CT858 showed weak homology to the tail specific protease (tsp) of E. coli, which had been involved in the processing of penicillin binding proteins and includes an IRBP domain of the human interfotreceptor retinoid binding proteins, which bind hydrophobic ligands. Type II secretion has been linked to the export of degrading proteins in several gram negative bacteria. those that include P. aeroginosa and Aeromonas hydrophila. { Revised in Hobbs- and Mattick, 1993) [33.]. In Aeroginosa hydrophila a secreted elastase (ahpB) has recently been suggested as important for organism virulence (Cascon, et al., 2000) [34]. These proteins have similar destinations as the CT858. They are for the most part synthesized as a peptide with a cleavable signal peptide and then processed to a mature moteotein. Another protein C. trachomatis, which also shows homology to the specific protease of the tail, is the hypothetical protein CT441. It continues to be determined if this protein can demonstrate the same secretory characteristics as CT858. The same sub-cellular localization of CT858 was observed for the homolog of C. pneumoniae, CP 1016 with Pab253 against CPN1016, thus indicating a functional conservation of this gene between the two species of Chlamydia.

Example 20: Secreted C. trachomatis D and C. pneumoniae proteins, which were identified by their gene number, were analyzed by an ANN trained to recognize affinity peptides - for human HLA-A2. In Tables V-VIII, peptides selected by the ANN for the predicted HLA-A2 link are listed and the affinity (Kd) is given in nM. The lower the value, the better. Most peptides with Kd less than 50 nM are immunogenic. Peptides with Kd less than 500 nM (but 'greater than 50 nM) are potentially immunogenic. The binding of a given peptide can be improved by substituting a sub-optimal amino acid at the P2 or P9 binding positions - a strategy that will frequently retain the specificity directed against the natural peptide.

Example 21: Determination of the ability of a vaccine candidate to generate specific CD8 + T cytotoxic cells in experimental animal models In a method, vaccine candidates are used as full-length recombinant proteins to immunize experimental animals (mouse or small pig). indias) which include the transgenic A2 mouse that expresses the molecules, class? of human HLA. In another method, vaccine candidates are secreted for T cell epitopes by computer algorithms and subsequently peptides spanning these epitopes are synthesized and used for immunization as described for full-length vaccine candidates. In a third method, peptides of 8-10 amino acids long are synthesized in an overlapping manner, such that they cover the entire sequence of a vaccine candidate and are used for MHC class I binding assays in competition with intermediate binders. marked by radio. The peptide, which are good binders are used for immunization as described for full-length vaccine candidates. Vaccine candidates are administered either as peptide / protein combinations or as individual peptides / proteins in adjuvant. Can vaccine candidates also be administered as a vaccine? or by a virus that expresses the vaccine candidate. Peripheral blood mononuclear cells (PBMC) from the immunized animals are purified by density gradient centrifugation and CD8 + cells are purified by the use of antibodies bound to magnetic beads or by other methods. CD8 + T cell activity is measured by proliferation assays such as ELISPOT and titrated thymidine incorporation and by specific lysis assays (chroma release). PBMC cells or purified CD8 + cells from immunized animals are deposited on microtiter plates, in limiting dilution, with irradiated antigen presenting cells, growth factors and a specific or nonspecific stimulator. For stimulation it specifies individual vaccine candidate proteins or peptides, which have been predicted as good T cell epitopes or found to be good binders for the MHC class I molecule are used. For non-specific stimulation, cells infected with chlamydia are used. The cells are cultured for 9-14 days during which, the antigen-specific cells proliferate. The generation of specific cytotoxic CD8 + T cells is determined by measuring the secretion of cytosine from cells stimulated with ELISPOT analysis. The proliferation of T cells is measured by the incorporation of titrated thymidine followed by scintillation counting. The cytotoxicity of the proliferating cells is measured using a cytotoxic analysis such as chromium release analysis using cells infected with Chlamydia or recombinant cells that express the vaccine candidate protein / peptide as target cells [42].

Example 21: Testing of vaccine candidates for the ability to protect mice and pillbugs against Chlamydia infection. Experimental animals are immunized (as described above) with vaccine candidates as a single protein / peptide or as a combination of vaccine candidate. Following the immunization, the animals are experimentally infected with chlamydia (intranasal infection for C. pneumoniae and genital infection for C. trachomatis). Protection against infection is measured by Chlamydia culture, immunohistochemistry, quantitative PCR and by seroconversion investigation after infection.

Example 23: Determination of the ability of Chlamydia infection to generate specific cytotoxic DT8 + T cells of the vaccine candidate in human. Human serum samples are tested by ELIS (Medac) for the presence of antibodies to chlamydia. Zero-positive individuals are selected for the presence of specific cytotoxic CD8 + T cells of the vaccine candidate. Peripheral blood mononuclear cells (PMBC) from humans that are tested antibody positive for chlamydia are purified by density gradient centrifugation and CD8 + cells are purified by the use of antibodies and magnetic beads or another method. The specifically directed CD8 + -T cell activity against vaccine candidate protein / peptide is measured by the methods described in example 19.

Example 24: Use of Vaccine Candidates for the Development of an ELISA Test for Diagnostic Purposes Since the secreted proteins of the present invention are not present or significantly reduced in purified microorganisms, the body-based immunosorbent assay Purified elementals can not detect antibodies to such proteins. Accordingly, the secreted proteins may represent unrecognized major antigens, which are also involved in the humoral immune response. In addition, an ELISA based on secreted chlamydial proteins can detect persistent infection with Chlamydia since the secreted proteins are only expressed during the intracellular stage of Chlamydia development. 1) The secreted proteins n n produced. as recombinant proteins, which are purified.

Alternatively, overlapping representative peptides representing the secreted proteins are also produced. 2) The ELISA plates are coated with purified recombinant proteins representing secreted proteins (or synthetic peptides that originate from the secreted proteins). The ELISA plate is blocked with 15% fetal calf serum to avoid non-specific binding. 3) The patient sera are selected for antibodies against C. trachomatis or C. pneumoniae using micro-IF or ELISA (Medac). The positive sera are tested on an ELISA plate coated with the recombinant antigens representing the secreted proteins. 4) For the detection of antibody the anti-human IgG, IgA or IgM is used. As a positive control, serum from infected mice is used. 5) The results of micro-IF or ELISA (Med c) are compared with the ELISA based on recombinant proteins that represent the secreted proteins.

References 1. Saikku P, Leinonen M, Mattüa K, Ekman MR, Nieminen S, Makela PH, Huttunen JK, Valíonen V, Serologicai evidence of an association of a novel Chlamydia, TWAR, with chronic coronary heart disease and acuity myocardial infarction. Lancet 1988 Oct 29; 2 (8618): 983-6. Shor A, Kuo CC, Patton DL (1992) Deiecíion of Chlamydia pneumoniae in coronary arterial fatty streaks and atheromatous plaques. S Afr Med J.82 (3): 158-61. Hueck, C.J. (1998) Type líl protein secretion sysfems in bacterial. pathogens of animáis and plants. Microbiol Mol Rev 62, 379-433. Stephens, R.S., Kalman, S., Lammel, C., Fan, J., Maraihe, R., Aravind; L, Mitchell, W., Olinger, L, Tatusov, R.L., Zhao, Q., Koonin, E.V., Davis, R.W. (1998) Genome sequence of an oblige intracelluiar pathogen of humans: Chlamydia trachomatis, Science 282, 754-759. Kalman, S., Mitchell, W., Marathe, R., Lamme !, C, Fan, J., Hyman, R.W., Oünger, L, Grimwood, J., Davis, R.W., Stephens, R.S (999). Comparative genomes of Chlamydia pneumoniae and C. trachomatis, Nat. Gent. 2, 385-389. Rock, K.L., Alfred L. Goldberg (1999) Degradation of cell proteins and the generation of HC class l-presented peptides, Annu. Rev. lmmunol, 17, 739-779 .. Murdin AD, Su H, Manning DS, Klein MH, Parnell MJ, Caldwell HD (1993) A poliovirus hybrid expressing to neutralize epitope from the major outer membrane protein of Chlamydia trachomatis is highly immunogenic. infection immun, 61 (10): 4405-14. Cerrone MC, Ma JJ, Stephens RS (1991) Cloning and sequence of the gene for heat shock protein 60 from Chlamydia trachomatis and immunological reactivity of the protein. Immun Immun, 59 (1): 79-90. Igietseme JU, Magee DM, Williams DM, Rank RG (1994) Roie for CD8 + T cells in antichlamydial mmunity defined by Chlamydia-specific T- lymphocyie clones.lnfect Immun 62 (): 5195-7 Subtil A, Blocker A, Dautry- Varsat A (2000) Type III secretion system in Chlamydia species: identified members and candidates. Microbes Infect 2 (4): 367-9 Fields KA, Hackstadt T (2000) Evidence for the secretion of Chlamydia trachomatis CopN by a type III secretion mechanismMol Microbiol 2000 Dec; 38 (5): 1048-60 Read, TD, Brunham, RC, Shen, C, Gill, SR, Heidelberg, JF, White, O., Hickey, EK, Peterson, J., Utterback, T., Berry, K., Bass, S., Linher, K., Weidman, J., Khouri, H., Craven, B., Bowman, C., Dodson, R., Gwinn,., Nelson, W., DeBoy, R. , Kolonay, J., cClarty, G., Salzberg, SL, Eisen, J-, Fraser, CM (2000) Gengme sequences of Chlamydia * trachomatis oPn and Chlamydia pneumoniae AR39. Nucleic Acids Res 28, 1397-1406 Shirai M, Hirakawa H, Kimoto M, Tabuchi M, Kishi F, Ouchi K, Shiba T, Ishii, K, Hattori M, Kuhara S, Nakazawa T (2000) Comparison of whole genome sequences of Chlamydia pneumoniae J138 from Japan and CWL029 from USA. Nucleic Acids Res 15: 2311-2314 Stambach, MN, Bevan, .J. (1994), Celis infected wííh Yersinía presented an epitope to class I MHC-restricted CTL, J Immunol, 153, 1603- 2 Rockey, DD, Heinzen, RA, and Hackstadt, T. (1995) Cioning and characterization of a Chlamydia psiítaci gene coding for a localized protein in the inclusion membrane of infected cells. Mol. Mcirobiol 15, 617-626 Bannantine, J., Stamm, W., Suchland, R., Rockey, 0. (1998), Chlamydia trachomatis Inc is localized to the inclusion membrane and is recognized by antisera from infected humans and primates, Inct. . immun, 66, 6017-6021 Knudsen K, Madsen AS, Mygind P, Christiansen G, Birkelund S (999) ldentification of two novel genes encoding 97- to 99-kilodalton outer membrane proteins of Chlamydia pneumoniae. Infecí immun 67 (1): 375-83 Shaw, A.C., Christiansen, G., Birkelund, S. (1999) Effects of interferon gamma on Chlamydia trachomatis serovar A and L2 protein expression investigated by two-dimensiona! electrophoresis gel. Electrophoresis 20 (4-5): 775-80. Shaw, A.C., Christiansen, G., Roepstorff, P., Birkelun, S. (2000) Genetic differences in Chlamydia trachomatis tryptophan syníhase a-subunit can explain variat / ons in serovar paíhogenesis. Microbes Infecí 2: 581-592 Gobom J, Nordhoff E, Mirgorodskaya E, Ekman R, Roepstorff P (1999) Sample purification and preparation technique based on nano-scale reversed-phase columns for the analysis of complex peptide mixtures by matrix- assisted iaser desorpíion / ionizaíion mass spectrometry.J Mass Spectrom 34 (2): 105-16 Gevaert, K., Demcl, H., Puype, M., Broekaert, D "De Boeck, S., Houthaeve, T., Vandekerckhove , J. (1997) Peptides adsorbed on reverse-phase chromatographic beads as targets for femtomolesequencing by "post-source decay matrix assisted laser desorption ionizatíon-reflectron time of flight mass spectrometry (MALDI-RETOF-MS). Electrophoresis 18: 2950-2960 Schachter, J., Wyrick, PB (1994) Culture and isolation of Chlamydia trachomatis Methods Enzymol 236: 377-390 Harder, A., Wildgruber, R., Nawrocki, A., Fey, SJ, Larsen, PM, Gorg, A. (1999) Comparison of yeast celi protein soiubilization procedures for two-dimensional electrophoresis Electrophoresis 20 : 826-829 Shevchenko A, Jensen ON, Podteijnikov AV, Sagliocco F, Wilm M, Vorm O, Mortensen P, S, Boucherie H, Mann M (1996) Linking genome and proteome by mass spectrometry: large-scaíe Identification of yeast proteins from two dimensional gels. Proc Nati Acad Sci U SA: 93: 14440-14445 Mann, M, Wilm, M (1995) Electrospray mass spectrometry for protein characíerization. Trends Biochem Sci., 20: 219-24 Wilm M, Mann M (1996) Analyíica] properties of faith nanoelectrospray ion source Anal Chem 68 (1): 1-8 Wilkins MR, Gasteiger E, Sánchez JC, Appel RD, Hochstrasser DF . Protein identífication wiíh sequence tags. Curr Biol. 996 Dec 1; 6 (12): l543-4. Mann M, Hojrup P, Roepstorff P. Use of mass spectrometric molecular weight information to identify proteins in sequence daiabases. Biol Mass Spectrom. 1993 Jun; 22 (6): 338-45. Rockey, DD, Grosenbach, D., Hruby, DE, Peacock, MG, Heinzen, RA, Hackstadt, T. (1997) Chlamydia psittaci IncA is phosphorylated by the host cell and is exposed on the cytoplasmic face of the developing inclusion, Mol . Microbe!., 24, 217-228 Forster C, Marienfeld S, Wilhelm R, Kramer R (1998) Organel! E purification and selective permeabilization of the plasma msmbrane: two different approaches to study vacuoles of the filamentous fungus Ashbya gossypii., EMS Microbiol Lett 1998 Oct 15; 1_67 (2): 209-14 Melan MA (1999) Overview of cell fixatives and cell membrane perrneants. Methods Mol Biol 1999; 5: 45-55 Silber, KR, Keiler, KC, Sauer, RT (1992) Tsp: a tail-specific protease that selectively degrades proteins with nonpolar C termini.Proc Nati Acad Sci USA, 89, 295-9 Hobbs, M, Mattick, JS (1993) Common components in the assembly of type 4 fimbraie, DNA transfer systems, filamentous phage and protein secretion apparatus: a general system for the formation of surface-associated protein complexes. Mol. Microbiol. 10, 233-243 Cascon, A., Yugueros, J., Early, A., Sanchez, M., Hernanz, C, Luengo, JM, Naharro, G. (2000) A major secreted elastase is essenial for pathogenicity of Aeromonas hydrophila. Infect Immun, 68,3233-41 Stephens, R.S., Kalman, S "Fenner, C, Davis, R., (1998b) The Chlamydia Genome Project, httpr // socrates! Berkeley.edu: 4231 /. Rock, KL, Gramm, C, Rothsiein, L, Clark, K., Yein, R., Dick, L., Hwang, D., Goldberg, AL (1994) Inhibitors of the proteasome Block the degradation of Most Cell Proteins and the Generation of Peptides. Presented on HC Class t Molecules. Cell, 78, 761, 771 37. Fling, SP, Sütherland, RA, Steeie, LN, Hess, B., D'Orizio, SEF, aisonneuve, J.-L., Lampe, M., Probst, P., Starnbach, .N. (2001) CD8 T cells recoqnize an inclusion membrane associated protein from the vacuolar country Chlamydia trachomatis, PNAS, 98, 160-1165 38. Sijts, AJ, S. Standera, RE Toes, T. Ruppert, NJ Beekman , PA van Veelen, FA Ossendorp, CJ Meuef, and P.. loetzel (2000). MHC class I antigen processing of an adenovirus CTL epitope is iinked to the levéis of immunoproteasomes in infected cells. J. Immunoi., 164, 4500 39. Van Hall, T., A. Sijts, M. Camps, R. Offringa, C. Melief, P. M. Kloetzel, and F. Ossendorp (2000) Differentiai Influence on Cytotoxic T Lymphocyte Epitope Presentation by Controlled Expression of Either Proteasome Immunosubunits or PA28. J. Exp. Med., 192, 483. 40. Shockett, P., M. Difilippantonio, N. Hellman, and D. G. Schatz (1995). A modified tetracycline-regulated system provides autoregulatory, inducible gene expression in cultured cells and transgenic mice. Proc. Nati Acad. Sci. USA, 92, 6522 41. Probst.P., BhatiaA, Skeiky.Y., Jen, S. (1999), International publication numbenWO 00/34483, PCT7US99 / 290120 42. Hickling KH (1998), Measuring human T -lymphocyte function, Expert Reviews in Molecular Medicine ISSN 1462-3994 43. Sijts, AJj Villanueva, MS, Pamer, E ".G: CTL epitope generation is tightly linked to cellular proteolysis of a Listeria monocytogenes antigen, The Journal of immunoiogy, 1996 , 156, 497-1503 44. Hess, J., Kaufrnann, S.H: Vaccination strategies against intracellular microbes, FEMS Immunoiogy and Medical Microbiology, 1993, 7, 95-104

Claims (73)

1. CLAIMS 1. A method for identifying secreted proteins of an intracellular bacterium, of the Chlamydia species, characterized in that it comprises the following steps: 1) infecting host cells by the intracellular bacteria, 2) marking the intracellular bacteria present in the infected cells, 3) prepare: a) whole cell lysates in the infected cells, b) purified bacteria and lysed the infected cells, 4) compare the 2D-gel electrophoresis protein profiles of (i) the whole cell lysates of step (3a) with (ii) the purified and lysed bacterium from step (3b), 5) detecting protein spots from step (4) that are present in whole cell lysates but absent or present in a significantly reduced amount in the purified bacteria, 6) identify the proteins at the points selected in step (5). 2. A method for identifying secreted proteins of an intracellular bacterium, of the chlamydia species, characterized in that it comprises the following steps: 1) infecting the host cells with the intracellular bacteria, 2) pulsing the intracellular bacteria present in the infected cells, 3) Prepare whole-cell-used infected cells after different follow-up periods following step (2), 4) compare 2D-gel electrophoresis protein profiles of whole cell lysates prepared after a different monitoring period of stage (3), 5) detect protein points from step (4) that are present in decreased amounts as follow-up periods increase in stage (3), 6) identify proteins in the points selected in step (5). 3. The method according to claim 2, characterized in that it further comprises culturing the infected host cells of step (1) in the presence and absence of a proteasome inhibitor and in step (4) comparing the electrophoresis protein profiles. 2D-gel of whole cell lysates of infected cells cultured in the presence and absence of a proteasome inhibitor and in step (5) detect protein spots from step (4) that are present in cell lysates whole cultured in the presence of a proteasome inhibitor, but present or absent in a significantly reduced amount in the Whole-cell-used ones cultured in the absence of a proteasome inhibitor and in step (6) identify the proteins at the selected points in the stage ( 5 ) . 4. The method according to any of claims 1-3, characterized in that it further comprises the following steps: 1) obtaining antibodies against proteins of the intracellular bacteria identified according to any of claims 1-3, 2) immunosorption of 2D -PAGE on Used whole cells infected with such bacteria using antibodies obtained in step (1), 3) detect protein spots that react in step (2), 4) identify the proteins at the points selected in step (3) ). 5. A method for identifying secreted proteins of intracellular bacteria, characterized in that it comprises combinations of the methods according to claims 1 to 4. The method according to any of claims 1-5, characterized in that the marking is carried out by means of radioactive media, such as amino acids marked by - [35 S] cistern, [35 S] methionine, [14 C] or combinations thereof. The method according to any of claims 1-6 for identifying proteins, characterized in that the proteins are either in full length or as immunogenic fragments thereof, are suitable for inclusion in immunogenic compositions and / or diagnostic purposes . 8. The method according to any of claims 1-7, characterized in that the identification method is based on the Edman degradation method or any mass spectrometric method, such as MALDI TOF MES (Matrix-Assisted Laser Desorption / Ionisation Time-Of-Flight Mass Spectrometry), ESI-Q-TOF MS (Electrospray Ionisation Quadrupole Time-Of-Flight Mass Spectrometry),. PSD-MALDI MS (Post Source Decay MALDI Mass Spectrometry) or combinations of such methods. 9. The method according to any of claims 1-8, characterized in that the proteins, before identification, are subjected to cleavage by chemical methods, such as treatment with cyanogen bromide or hydroxylamine treatment or by enzymatic methods with any suitable enzyme, such as trypsin, slimotrypsin, cimothyrosine or pepsin or combinations thereof. 10. The method according to any of claims 1-9, characterized in that the intracellular bacteria are an intracellular facultative bacterium or an obligate intracellular bacterium. 11. The method according to claim 10, characterized in that the bacteria are of the genus Chlamydia, such as C. pneumoniae, C. trachomatis, C. psittaci or C. pecorum, in which any specific serovar or strain specific to these. 12. The method according to claim 11, characterized in that the intracellular bacterium is Chlamydia trichomatis. 13. The method according to claim 11, characterized in that the intracellular bacterium is Chlamydia pneumoniae. The method according to any of claims 1-13, characterized in that the host cell is an immortalized cell line, such as HeLa, Hep2, McCoy or U937, a primary cell line obtained from mammalian donors or by autopsy, a line genetically modified cell or, a cell culture of organ. The method according to claim 14, characterized in that the host cells have been genetically modified to over express or suppress genes that are recognized as relevant in the context of chlamydial vaccine development, such as genes encoding proteasome subunits or other genes encoding functionally important proteins involved in the presentation of MHC class I. 16. The method according to any of claims 1-15, characterized in that the host cells are treated with IFN-α. before or during infection with intracellular bacteria. 17. The method according to any of claims 2 or 4-16, characterized in that proteasome inhibitors are used, such as MG132, MG262, MG115, epoxymycin, PSI and clasto-lactacystin-lactone or combinations thereof. 18. A protein characterized in that it is identifiable by the method according to any of claims 1-17 or an immunogenic fragment thereof. 19. The protein according to claim 18, characterized in that it is applicable for inclusion in immunogenic compositions and / or diagnostic purposes and an immunogenic fragment thereof. 20. The protein according to claim 19, characterized in that it comprises T cell epitopes that are candidates for presentation as restricted MHC class I or II antigens suitable for inclusion in immunogenic compositions. 21. The protein according to claim 20, characterized in that it comprises T cell epitopes that are candidates for presentation as restricted MHC-class I antigens suitable for inclusion in immunogenic compositions. 22. A Chlamydia trachorr.atis protein according to any of claims 18-20, characterized in that it has the "pl and PM characteristics of one of the DT1-DT77 proteins as given in table 1, determined with an error average of +/- 10% or an immunogenic fragment thereof 23. A Chlamydia trachomatis protein according to any of claims 18-21, characterized in that it is identified by the corresponding gene number as CT017 (gene name CT017). ), CT044 (gene name ssp), CT243 (gene name IpxD), CT263 (gene name CT263), CT26.5 (gene name accA), CT286 (gene name clpC), CT292 (name of ^ gen dut), CT407 (name of dksA gene), CT446 (name of gene euo), CT460 (name of SIB gene), CT541 (name of mip gene), CT610 (name of "gene CT610), CT650 (name | of recA gene), CT655 (name of kdsA gene), CT668 (gene name CT668), CT691 (gene name CT691), CT734 (gene name CT734), CT783 (gene name CT783), CT858 (gene name CT858), CT875 (gene name CT875) or 0RF5 (name of gene ORF5) or by the name of protein DT8 as given in Table IILA or an immunogenic fragment thereof. 24. The Chlamydia trachomatis protein according to any of claims 13-21, characterized in that it has the characteristics of pl and PM of one of the proteins of DT1, DT2, DT3, DT5, DT9, DT10, DT11, DT13, DT14, DT17, DT47, DT59, DT60, DT61 or DT62 as given in Table IV, determined with an average error of +/- 10% or an immunogenic fragment thereof. 25. The protein Chlamydia trachomatis deformity with claim 22, characterized in that it is selected from the DT4 proteins (gene name CT858), DT23 (name of mip gene), DT47, DT48 (gene name CT858), DT75, DT76 ( gene name CT691) and DT77 (gene name CT263) or an immunogenic fragment thereof. 26. A Chlamydia pneumoniae protein according to any of claims 18-21, characterized by the characteristics of pl and PM of one of the CP1-CP91 proteins as given in Table II, determined with average error of +/- 10% or an immunogenic fragment thereof. 27. The Chlamydia pneumoniae protein according to any of claims 18-21, characterized in that it is identified by the corresponding gene number as CPN0152 (gene name CP 0152), CPN0702, CPN0705 (gene name CPN0705), CPN0711 ( gene name CPN0711), CPN0796 (gene name CPN0796), CPN0998 (gene name ftsH), CPN0104 (gene name CPN0104), CPN0495 (gene name aspC), CPN0684 (gene name parB), CPN07.9S ( gene name CPN0796), CPN0414 (gene name accA), CPN1016 (gene name CPN1016), CPN1040 (gene name CPN1040), CPN0079 (gene name RUO), CPN0534 (gene name dksA), CPN0619 (name of gene ndk gene), CPN0711 (gene name CPN0711), CPN0628 (gene name rsl3), CPN0926 (gene name CPN0926), CPN1016 (gene name CPN1016), CPN1063 (gene name tpiS) or CPN0302 (gene name IpxD ), as given in Table IIIB or an immunogenic fragment thereof. 28. The protein of C. pneumoniae according to claim 26, characterized in that it is selected from proteins such as those identified by the corresponding gene number as CP34 (gene name CPN1016), CP37 (gene name CPN0998), CP46 (gene name CPN0796), CP47 (gene name CPN0705), CP52 (gene name CPN0152), CP63 (gene name CPN1016) and CP75 (gene name ndk) or an immunogenic fragment thereof. 29. A Chlamydia trachomatis polypeptide, characterized in that it is DT8 and comprises the following sequence (SEQ ID NO: 1): MQHTIMLSLENDNDKLASMMDRVVAASSSILSASKDSESN RQFTIS ~ KAPDKEAPCRVSYVAASALSE or an immunogenic fragment thereof. 30. A protein characterized in that it has at least 40% sequence identity, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% and more preferably at least 95% sequence identity with the proteins according to any of claims 18-29 or an immunogenic fragment thereof. 31. A protein or immunogenic fragment thereof, characterized in that it comprises at least 7 consecutive amino acids of the proteins according to any of claims 18-30. 32. A Chlamydia trachomatis protein or an immunogenic fragment thereof according to claim 31, characterized in that it comprises an amino acid sequence, selected from the sequence of SEQ. ID. DO NOT. 3 -SEQ. ID. DO NOT. 45. 33. A Chlamydia pneumoniae homolog of the Chlamydia trachomatis proteins according to claim 32 or an immunogenic fragment thereof, characterized in that it comprises an amino acid sequence, selected from the sequences of SEQ ID NO. 122 - SEQ ID NO. 148. 34. "The Chlamydia pneumoniae protein or an immunogenic fragment thereof according to claim 31, characterized in that it comprises an amino acid sequence selected from the sequences of SEQ ID No. 46-SEQ ID No. 121. 35. The Chlamydia trachomatis homolog of the Chlamydia pneumoniae proteins according to claim 34 or an immunogenic fragment thereof, characterized in that it comprises an amino acid sequence, selected from the sequences of SEQ ID NO 149 - SEQ ID NO 194. 36. A nucleic acid compound, characterized in that it comprises a sequence encoding a protein or an immunogenic fragment thereof, according to any of claims 18-35 37. A nucleic acid compound, characterized in that it comprises a sequence encoding a polypeptide according to claim 29. 38. A nucleic acid compound according to claim 37, characterized in because it comprises the following sequence (SEQ ID NO: 2): ATGC CACAC TTATGCTGTCTTTAGAGAACGATAATGATAAGCTTGCTTCTATGATG GATCGAGTTGTTGCTGCGTCATCAAGCATTCTTTCTGCTTCCAAAGATTCTGAGTCCAAT AGACAGTTTACTATTTCTAAAGCTCCGGATAAAGAAGCTCCTTGCAGAGTATCTTATGTA GCTGCAAGTGCACTTTCAGAATAG or a fragment or degenerative sequence thereof. 39. A vector characterized in that it comprises a nucleic acid compound according to any of claims 36-38. 40. A host cell characterized in that it is transformed or transfected with a vector according to claim 39. 41. The use of a protein or an immunogenic fragment thereof according to any of claims 18-35, characterized in that it is for the production of antibodies against such protein or fragment. 42. A method for producing an antibody against intracellular bacteria, characterized in that a protein or an immunogenic fragment thereof according to any of claims 18-35, is administered to a producing animal and the antibody is purified from the same. 43. An antibody characterized in that it is obtainable by the method according to claim 42. 44. A pharmaceutical or diagnostic composition characterized in that it comprises a protein or an immunogenic fragment thereof according to any of claims 18-35, antibody according to claim 43 or a nucleic acid compound according to any of claims 36-38. 45. The use of a protein or immunogenic fragment thereof according to any of claims 18-35, an antibody according to claim 43 or a nucleic acid compound according to any of claims 36-38, characterized in that it is used in the preparation of a diagnostic reagent. 46. A method for the identification of T cell epitopes on secreted proteins of an intracellular bacterium of the Chlamydia species, characterized in that it comprises the steps of identifying the secreted proteins of an intracellular bacterium according to the method of "any of the claims 1 to 17, followed by a computer prediction, binding analysis of MHC class molecules and / or ELISPOT analysis for the identification of T cell epitopes in the secreted proteins, or immunogenic fragments thereof 47. An epitope of peptide characterized in that it is obtainable in accordance with the method of the claim 46, such peptide epitope is likely to be present on the surface. 48. The peptide epitope comprising 4 to 25 consecutive amino acids of a protein according to any of claims 18-31, preferably 6 to 15 amino acids and more preferably 7 to 10 amino acids. 49. A peptide epitope characterized in that it comprises 7 to 10 consecutive amino acids of a Chlamydia trachomatis or Chlamydia pneumoniae. 50. A peptide epitope characterized by comprising 4 to 25 consecutive amino acids · of a polypeptide comprising the sequence SEQ ID NO: 1, preferably 6 to 15 amino acids and more preferably 7 to 10 amino acids. 51. The peptide epitope of Chlamydia trachomatis according to claim 47, characterized in that it comprises an amino acid sequence selected from the sequences SEQ ID NO. 3 - SEQ ID NO. 45. 52. A peptide epitope of Chlamydia pneumoniae of the peptide epitopes of Chlamydia trachomatis according to claim 51, characterized in that it comprises an amino acid sequence selected from the sequences of SEQ ID NO. 122 - SEQ ID NO. 148. 53. The peptide epitope Chlamydia pneumoniae according to claim 47, characterized in that it comprises an amino acid sequence selected from the sequences SEQ ID NO. 46 - SEQ ID NO. 121. 54. The Chlamydia trachomatis peptide epitope of the peptide epitopes of Chlamydia pneumoniae according to claim 53, characterized in that it comprises an amino acid sequence, selected from the sequences SEQ ID NO. 149 - SEQ ID NO. 194. 55. The peptide epitope according to any of claims 47-54, characterized in that it is part of a fusion protein. 56. The peptide epitope according to any of claims 47-54, characterized in that it is conjugated to a carrier portion. 57. A nucleic compound, characterized in that it comprises a sequence encoding a peptide epitope according to any of claims 47-56. 58. A vector characterized in that it comprises a nucleic acid compound according to claim 57.> 59. A host cell transformed or transfected with a vector according to claim 58. 60. The use of a peptide epitope of 2. The immunogenic composition according to any of claims 47-56, characterized in that it is for the preparation of an immunogenic composition. 62. The use of a protein according to any of claims 18-35, an antibody according to claim 43, a nucleic acid compound according to any of claims 36-38 or 57 or a peptide epitope of according to any of claims 47-56, characterized in that it is used in the preparation of tion of a pharmaceutical composition to treat or prevent infection due to an intracellular bacterium. 63. The use of a protein according to any of claims 22-35, an antibody according to claim 43 or a nucleic acid compound according to any of claims 36-38 or 57 or a peptide epitope of according to any of claims 47-56, in the preparation of a pharmaceutical composition for the treatment or prevention due to a Chlamydia. 64. The use of a protein according to any of claims 18-35, an antibody according to claim 43, a nucleic acid compound according to any of claims 36-38 or 57 or a peptide epitope of according to any of claims 47-56, characterized in that it is used in the preparation of a. diagnostic reagent to detect the presence of an intracellular bacterium or antibodies raised against the intracellular bacteria. 65. The use of a protein according to any of claims 22-35, an antibody according to claim 43, a nucleic acid compound according to any of claims 36-38 or 57 or a peptide epitope according to any of "claims 47-56, characterized in that it is used in the preparation of a diagnostic reagent to detect the presence of Chlamydia or antibodies raised against Chlamydia 66. A method for inducing an immune response in a human, characterized in that it comprises administering to said human an effective immunological amount of a protein in accordance with any of claims 18-35, an antibody according to claim 43, a nucleic acid compound according to any of claims 36-38 or 57 or a peptide epitope according to any of claims 47-56. The method according to claim 66, characterized in that it is for the treatment or prevention of infection of humans or animals by an intracellular bacterium. 68. The method according to any of claims 66-67, characterized in that the intracellular bacterium is of the genus Chlamydia. 69. The method according to claim 68, characterized in that the intracellular bacterium is C. trachomatis. 70. The method according to claim 68, characterized in that the intracellular bacterium is C. pneumoniae. 71. A method for producing a protein or fragment thereof according to any of claims 18-35, characterized in that it comprises transforming, transfecting from infection a host cell of a vector according to claim 39 and culturing the host cell under conditions that allow the expression of each protein or fragment by the host cell. 72. The method for producing a peptide epitope according to any of claims 47-54, characterized in that it comprises transformation, transfection of infection a host cell with a vector according to claim 38 and culture of the host cell under conditions that they allow the expression of such peptide epitope by the host cell. 73. A method according to any of claims 1-17, characterized in that it further comprises the steps of computer prediction, MHC class molecule binding analysis and / or ELISPOT analysis for the identification of T cell epitopes in a protein or an immunogenic fragment thereof, identified in the stage