MXPA03001569A - T CELL RECEPTOR Vbgr;-Dbgr;-Jbgr; SEQUENCE AND METHODS FOR ITS DETECTION. - Google Patents

Abstract

In one embodiment, the present invention is directed to a first oligonucleotide comprising the sequence of or derived from 5 -CTAGGGCGGGCGGGACTCACCTAC-3 or the nucleic acid sequence complementary thereto. The first oligonucleotide can be used with a nucleic acid of between 15 and 30 nucleotides that does not comprise the sequence of the first oligonucleotide and is found in the region from Vbgr; to Jbgr; of the Vbgr;13.1 gene in Vbgr;13.1 T cells, wherein the sequences of the oligonucleotide and the nucleic acid are not found on the same strand of the Vbgr;13.1 gene pair, to amplify a portion of the Vbgr;13.1 gene. Alternatively, the first oligonucleotide can be used with a labeling moiety in methods of detecting a LGRAGLTY motif found in T cell receptors of Vbgr;13.1 T cells. This motif is associated with autoimmune diseases, such as multiple sclerosis (MS). Once the motif is detected, the autoimmune disease can be treated or its progress monitored. The autoimmune disease can be treated by administering one ore more peptides comprising the LGRAGLTY motif.

Description

SEQUENCE OF VB-DB-JB CELL RECEIVER T AND METHODS FOR DETECTION BACKGROUND OF THE INVENTION This is a continuation in part of co-pending application serial number 09/507, 819 filed on February 22, 2000. The United States government may have rights in the present invention pursuant to economic support number NS 36140 from of National Institutes of Health.

FIELD OF THE INVENTION The present invention relates generally to the field of treatment of autoimmune disease, such as multiple sclerosis (MS). More particularly, it relates to a T cell receptor sequence found in some patients with MS, and methods for their detection.

DESCRIPTION OF THE RELATED ART In humans and in other mammals, the T cell receptors are found in the T cells. The T cell receptors comprise α and β chains, with the β chains comprising the following regions from the N-terminal and the C-terminal:? ß-? ß-? ß. The T-cell receptors normally vary in the? ß-? ß-? ß regions. When an antigen is presented to the T cells by an antigen presenting cell (APC), a T cell receptor with variable regions (including? ß-? ß-? ß) that appears to recognize the antigen, binds to the antigen on the APC. The T cell contains the T cell receptor thus carrying out the activation (clonal expansion). The pathogenesis of numerous autoimmune diseases is believed to lie in the responses of the autoimmune T cell to the antigens normally presented by the organism. An example of such a disease is multiple sclerosis (MS), which generally helps generate in the T cell responses to antigens to myelin, in particular myelin basic protein (MBP). It was found that MBP reactive T cells undergo live activation, and occur at a higher precursor frequency in the blood and cerebrospinal fluid in patients with MS as opposed to control individuals. These MBP-reactive T cells produce Th1 cytokines, for example IL-2, TNF, and interferon ?. These Th1 cytokines facilitate the migration of inflammatory cells within the central nervous system and exacerbate the destructive inflammatory myelin response in MS. Various regulatory mechanisms can be used in the treatment of MS. One such is vaccination with one or more of the limited number of peptides associated with T cell membrane with extracellular domains. Vandenbark, Patent of E.U.A. 5, 614, 192, describes the treatment of autoimmune diseases by the use of immunogenic peptides of the cell receptor of 15 to 30 amino acids comprising at least part of the second complementarity determining region (CDR2) of the T cell receptor. A co-pending US patent application by Zhang (60/099, 102) describes the treatment of autoimmune diseases by the use of immunogenic peptides of the T cell receptor in combination with marker peptides for immunogenic T cell activation. wherein vaccination with peptides of the T cell receptor can be improved is by determining which, if any, common motifs are found in the T cell receptors of a patient with an autoimmune disease such as MS. If these reasons are found, then the patient can be vaccinated with peptides identical to the motives, in order to facilitate the treatment. Therefore, it is desirable to have the amino acid sequences of the common motifs found in the T cell receptors of patients with autoimmune diseases. It is also desirable to be able to easily detect such motifs in a patient sample by any method, such as PCR. Furthermore, it is desirable to use peptides identical to the described motifs for treating a patient with autoimmune disease. The present invention describes said common motif found in the T cell receptors of a subpopulation of cells? ß13.1, the "LGRAGLTY motif", which has the amino acid sequence Leu Gly Arg Ala Gly Leu Thr Tyr (SEQ ID NO: 3), as well as a method for its easy detection by PCR. This motif is found in some T cell receptors of some T cells that recognize amino acids 83-99 of MBP (hereinafter "MBP83-99"). The motif in the context of this subpopulation of T? ß13.1 cells can be referred to hereafter as "LGRAGLTY-Vp13.1". Peptides identical to the motif can be used to vaccinate patients for the purpose of treating or preventing autoimmune diseases with which LGRAGLTY-Vp13.1 is associated. One such autoimmune disease is MS.BRIEF DESCRIPTION OF THE INVENTION In one embodiment, the present invention is directed to an oligonucleotide of about 15 to 30 nucleotides in length which comprises at least 10 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary thereto or derived therefrom. Even more preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO :, or a sequence complementary to it. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto.

In a series of additional embodiments, the oligonucleotide can be used in the amplification or detection of a nucleic acid sequence found in LGRAGLTY-V i3.1 cells. In a subset of such embodiments, the oligonucleotide is used in a pair of primers, the pair of primers comprising or derived from: (a) a first primer which is an oligonucleotide of about 15 to 30 oligonucleotides in length and comprises minus 10 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary thereto; and (b) a second primer which is an oligonucleotide of about 15 to 30 nucleotides in length that does not comprise sequence (a), and said second primer can be found in the? ß or? ß region of the? 13 gene. 1 (SEQ ID NO: 2) in the T cell receptor of T cells, wherein the sequences of (a) and (b) are not in the same chain of the T cell receptor gene. Preferably said first primer is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO: 1 , or a sequence complementary to it. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the sequence of SEQ ID NO: 1, or the sequence complementary thereto.

In other subseries of such embodiments, the oligonucleotide is used as an oligonucleotide probe, the oligonucleotide probe comprising: (a) an oligonucleotide of about 15 to 30 nucleotides in length and comprising at least 10 contiguous nucleotides of SEQ ID.

NO: 1, or a sequence complementary to it; and (b) a marked portion. Preferably, the oligonucleotide is from about 15 to 30 nucleotides in length, and comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary to it. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto. The labeled portion is preferably selected from 32P or digoxigenin. In another embodiment, the present invention is directed to a method for detecting MBP83-99 Vp13.1 cells expressing an LGRAGLTY motif, comprising: (i) obtaining a nucleic acid sample from MBP83-99 Vp13.1 cells; (ii) contacting the nucleic acid sample with a selected primer pair or derivative from: (a) a first primer comprising an oligonucleotide of about 15 to 30 nucleotides in length and comprising at least 10 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary thereto or derived therefrom; and (b) a second primer comprising an oligonucleotide of about 15 to 30 nucleotides in length which does not comprise the sequence of (a) and is in the region from Vp to Jp of the Vp13.1 gene in Vp13 T cells. 1 (SEQ ID NO: 2), wherein the sequences of (a) to (b) are not in the same chain of the Vpi 3.1 gene; and (iii) detecting the presence of the nucleic acid encoding the LGRAGLTY motif. Preferably the first initiator is an oligonucleotide, from about 15 to 30 nucleotides in length, which comprises 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary to it. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto. Another embodiment of the present invention is directed to peptides, from about 8 to about 45 amino acid residues in length, comprising the LGRAGLTY motif (for example, comprising the sequence of SEQ ID NO: 3). In various aspects of this embodiment, of the invention, the peptides comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 contiguous amino acids of the sequence of SEQ ID NO: 32. Preferably the peptide sequence is SEQ ID NO: 3 or the sequence is residues 2-21 of SEQ ID NO: 32. More preferably the peptide sequences are residues 2-21 of SEQ ID NO: 32. In yet another embodiment, the present invention is directed to a method for treating an autoimmune disease, comprising: (a) obtaining MBP83-99? ß13.1 cells from a human; (b) detecting the presence of a nucleic acid encoding the LGRAGLTY motif by the method described above; and, if the nucleic acid is detected, (c) administering one or more peptides from 9 to about 45 amino acid residues in length, each comprising the LGRAGLTY motif, to the human. In various aspects of this embodiment, of the invention, the peptides administered to the human each comprise 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 contiguous amino acids of the SEQ sequence ID NO: 32 Preferably the peptide sequence is SEQ ID NO: 3 or the peptide sequence comprises residues 2-21 of SEQ ID NO: 32. More preferably the peptide sequences are residues 2-21 of SEQ ID NO: 3.

NO: 32 In even a further embodiment, the present invention is directed to a method for monitoring an autoimmune disease, comprising: (a) obtaining MBP83-99? ß13.1 cells from a human; (b) detecting the presence of a nucleic acid encoding the LGRAGLTY motif by the method described above; and, if the nucleic acid is detected, (c) quantify the nucleic acid.

BRIEF DESCRIPTION OF THE DRAWINGS The following drawings are part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention can be better understood with reference to one or more of these drawings in combination with the detailed description of the specific embodiments presented herein. Figure 1 shows the experimental procedure for the cloning and sequencing of PCR products derived from PBMC. The cDNAs derived from PBMC specimens were amplified by the 5 '? ß13.1 primer and the 3'?? Primer from four PBMC specimens positive for LGRAGLTY motif expression and were ligated into the cloning vector pCR2.1 and they transformed into E. coli. The plasmid DNA was selected by PCR with an M13 primer and the LGRAGLTY-specific primer. The positive plasmids that showed visible amplification by PCR were sequenced for the? ß? ß? ß sequences with an? ß13.1 primer. Figure 2 shows patterns of reactivity of two MBP83-99 T cell clones to the analogous peptides with particular alanine substitutions. Two pairs of MBP83-99 cell clones that exhibited identical rearrangements for ß13.1 (for MS7-E2.6 and MS27-C3.1) and a Va-Ja binding sequence (for MS7-E2.6 and MS27) -C3.1) were examined for reactivity to a panel of peptides with substituted alanine in [3H] -thymidine incorporation assays. A mouse fibroblast cell line expressing DRB1 * 1501 was used as a source of antigen presenting cells. The proliferative responses of the clones to each analogous peptide were measured after 72 hours and the results were presented as incorporated CPM. The shaded boxes represent > 50% decrease in the proliferation of T cell clones in response to analogous peptides. Figure 3 shows the cross-examination of the specificity of the CDR3 oligonucleotides with original clones of T cell and unrelated clones. A series of oligonucleotides specific for the TCR VDJ region was examined for its specificity to detect known white DNA sequences, present in the original MBP83-99 cell clones as well as in the unrelated MBP83-99 T cell clones derived from from the same individuals and different individuals. The PCR reactions were carried out using oligonucleotides specific to CDR3 as the forward primers and a 3'-Cp primer as the reverse primer. The plain colored boxes represent the positive detection of the DNA sequences present in the original T cell clones or in the T cell clone (s) that share the same CDR3 sequences. All primers were also examined for binding to the DNA products of randomly selected T-cell clones that had unrelated CDR3 sequences (shaded boxes). Figure 4 shows the detection of the white DNA sequence complementary to the VPI3.1 LGRAGLTY motif in randomly selected PBMC specimens derived from patients with MS. The cDNA prepared from PBMC specimens from patients with randomly selected MS (n = 48) was initially amplified in RT-PCR using a specific primer at 5Vp13.1 and a 3'-Cp primer. The PCR amplified products were then hybridized subsequently with an oligonucleotide probe labeled with digoxigenin specific for the LGRAGLTY motif. Clone MBP83-99 (MS7-E2.6) and a non-T cell clone (MS32-B9.8) were used as positive and negative controls, respectively. MS-7 and MS-27 were the original PBMC specimens from which the clones MS7-E2.6 (MS-7 in Table 1) and clone MS27-C3.1 (MS-27 in Table 1) were derived. ). The asterisks indicate the positive expression of DRB1 * 1501. Figure 5 shows the detection of motif Vp 13.1 -LGRAGLTY in randomly selected PBMC specimens derived from normal subjects. The PBMC specimens obtained from 20 normal subjects (NS) were analyzed under the same conditions as described in the legend of Figure 4. The original clone (MS7-E2.6) and a clone unrelated to T cell ( MS32-B9.8) were used as positive and negative controls, respectively. The asterisks indicate the positive expression of DRB1 * 1501. Figure 6 shows the semi-quantitative comparison of LGRAGLTY motif expression in PBMC specimens derived from patients with MS and from normal subjects. The expression of the Vp13.1-LGRAGLTY motif was analyzed by semi-quantitative PCR in relation to the expression of Cp in each cDNA derived from PBMC of individuals with MS and normal individuals. The level of relative expression was calculated as (LGRAGLTY motif expression / Cp expression) x 100%. Figure 7 shows the detection of motif 13.1 -LGRAGLTY in short-term MBP83-99 T cell lines derived from patients with MS. A panel of independent short-term MBP83-99 T-cell lines was generated from five patients with MS using a synthetic peptide 83-99 of MBP. All these T cell lines were confirmed by their specific reactivity to the MBP83-99 peptide (CPM in response to MBP83-99 / CPM control >; 5). The cDNA products were amplified using a specific primer at 5'-Vpi3.1 and a 3'-Cp primer in PCR. The amplified PCR products were subsequently hybridized with an oligonucleotide probe labeled with digoxigenin corresponding to the motif V 13.1-LGRAGLTY in a Southern blot analysis. The cDNA products derived from the original MBP83-99 clone (MS6-E2.6) and an unrelated T cell clone (MS32-B9.8) were used as positive and negative controls, respectively. Figure 8 shows the proliferative responses of PBMCs (peripheral blood mononuclear cells) to immunizing clones of T-cell reactive to MBP and TCR pees in relation to the frequency of MBP-reactive T cells in immunized MS patients. 8A: The proliferative responses of PBMCs obtained from two immunized patients are expressed as stimulation signals, which are defined below. Beads / minute (CPM) of PBMC cultured with reactive T cell clones to irradiated, immunising MBP, expressing the CDR3 common sequence (motif positive T cell clones, MS7-D2.2 and MS27-D4.4) / sum of CPM of PBMC grown alone and CPM of irradiated T cells cultured alone. The proliferative response of the pee positive to the motif (amino acids 2-21 of SEQ ID NO: 32) and a control TCR pee (amino acids 1-20 of SEQ ID NO: 48) were determined in proliferation assays in which PBMCs were cultured 100,000 cells / well with the TCR pees (20 μ p \\), respectively, for 5 days. All the experiments were carried out at two time points corresponding to the baseline (before) and two months after the fourth (after) vaccination. 8B: The frequency of the T cell precursor specific for MBP was estimated at the same time points. NS = normal subjects.

Figure 9 shows the estimated frequency of the B cell precursor that produces anti-idiotypic antibodies to the TCR pee in PBMCs from immunized patients. The PBMCs were obtained from two patients with immunized MS and two healthy randomly selected individuals who had not been immunized. Cells were cultured in the presence of derived supernatants from a cell line producing EBV and Cyclosporin A (Sandoz, Basel, Switzerland). All wells with positive growth were selected for the presence of antibodies reactive to the TCR pee positive to the motif and the TCR control pee in ELISA. The frequency of the B cell precursor that produces anti-idiotypic antibodies to the TCR pee was estimated by dividing the number of positive wells by the total number of PBMC sown initially.

DESCRIN OF THE ILLUSTRATIVE MODALITIES To help understand the invention, several terms are defined below. "PCR" means the polymerase chain reaction, for example, as generally described in the U.S. Patent. No. 4, 683, 202 (published July 28, 1987 to Mullins), which is incorporated herein by reference. PCR is an amplification technique in which the selected oligonucleotides, or primers, are hybridized to nucleic acid templates in the presence of a polymerization agent (such as a polymerase) and four nucleotide triphosphates, and extension products are formed from of the initiators. These products are subsequently denatured and used as molds in a cycle formation reaction, which amplifies the number and quantity of existing nucleic acids to facilitate their subsequent detection. A variety of PCR techniques are available and can be used with the methods according to the invention. "Initiator" means an oligonucleotide, either natural or synthetic, capable of acting as a starting point of DNA synthesis complementary to a specific DNA sequence in a template molecule. "Derived from," in the context of the term "initiator (s) or probe (s) derived from," means that the initiator or probe is not limited to the listed nucleotide sequence (s), but also includes variations in the listed nucleotide sequence (s) including additions, deletions, or nucleotide substitutions to the extent that variations to the listed sequence (s) retain the ability to act as an initiator in the detection of T cell receptor DNA encodes the sequence Vpi3.1-LGRAGLTY, for example, Leu Gly Arg Ala Gly Leu Thr Tyr (SEQ ID NO: 3). "Immunogenic," when used to describe a pee, means that the peptide is capable of inducing an immune response, whether mediated by T cell, antibody, or both. "Antigenic" means that the peptide can be recognized in a free form by antibodies and in the context of MHC molecules in the case of antigen-specific T cells. "Disease related to the immune system" means a disease in which the immune system is involved in the pathogenesis of the disease. A subset of diseases related to the immune system are autoimmune diseases. Autoimmune diseases contemplated by the present invention include, but are not limited to, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, systemic lupus erythematosus, autoimmune thyroiditis (Hashimoto's thyroiditis), Graves' disease, inflammatory bowel disease, autoimmune uveoretinitis, polymyositis , and certain types of diabetes. In view of the present disclosure, one skilled in the art can readily perceive other autoimmune diseases that can be treated by the compositions and methods of the present invention. "T cell-mediated disease" means a disease produced in an organism as a result of T cells recognizing peptides that are normally found in the organism. "Treatment" or "treating," when it refers to the protection of an animal from a disease, means the prevention, suppression, or suppression of the disease. The prevention of the disease involves the administration of a composition of the present invention to an animal prior to the induction of the disease. The suppression of the disease involves the administration of a composition of the present invention to an animal after the induction of the disease, but before its clinical appearance.

The repression of the disease involves the administration of a composition of the present invention to an animal after the clinical onset of the disease. It will be appreciated that in human medicine it can not always be known when a composition of the present invention will be administered in the course of the induction of the disease. In one aspect, the present invention is directed to a pair of primers comprising the sequence of a derivative form from: (a) a first primer which is an oligonucleotide of about 15 to 30 nucleotides in length, comprising at least 10 contiguous nucleotides of SEQ ID NO: 1, or the nucleic acid sequence complementary thereto; and (b) a second primer which is an oligonucleotide of about 15 to 30 nucleotides long which does not comprise a sequence of (a) and is found in the region from? ß to jp of the T cell receptor gene in cells ? \ /ß13.1, wherein the sequences of (a) and (b) are not in the same chain of the T cell receptor gene. Preferably, said first primer is an oligonucleotide, of about 15 to 30 nucleotides in length , and which comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO :, or a complementary sequence thereof. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto. The primers according to the invention are designed to amplify a fragment of a gene encoding a T cell receptor of? 13.1 of human cells, the fragment comprising an amino acid motif of Leu Gly Arg Ala Gly Leu Thr Tyr (SEQ ID NO: 3). The gene from T \ / β13.1 cells encoding the T cell receptor comprising the LGRAGLTY motif has been subjected to GenBank accession number AF117132. The sequence of the gene from V 13.1 T cells encoding the T cell receptor comprising the LGRAGLTY motif is given in the present invention as SEQ ID NO: 2. In the method according to the invention, a fragment of approximately 400 bp of the T cell receptor gene from cells? /? 13.1 is amplified using two primers, wherein the first primer is in the CDR3 region, and the second initiator is in the region? ß. The region ? ß-? ß- ß of the T cell receptor gene will be between the CDR3 a? ß regions, inclusive. In a preferred embodiment, the primers are the pair of primers described above. The primers according to the invention also include the oligonucleotides that are derived from the initiators (a) - (b). A sequence is derived from an initiator (a) or (b) if it has or contains substantially the same sequence as one of the primers and retains the ability to selectively bind to approximately the same CDR3 or ß region of the region ? ß-? ß- ß of the T cell receptor gene from T? ß13.1 cells as described above. More particularly, the primer can differ from an initiator (a) or (b) in length or by the type of nucleic acid at one or more positions along the sequence, as long as it retains selectivity for the identified regions of the Vp-Dp-Jp region of the T cell receptor gene from Vpi3.1 T cells. For example, an initiator can be an oligonucleotide having at least 15 nucleotides, wherein the 15 nucleotides are identical to a series of contiguous nucleic acids selected or derived from a sequence of the initiators (a) - (b). The primer can also be any oligonucleotide of about 30 nucleotides or less comprising a segment having the sequence selected or derived from any of the primers (a) - (b). The number of nucleotides in the primer must be high enough to retain selectivity, however, low enough to retain efficiency and operability in the synthesis of the primer and in the PCR procedure. The primer may have variations including deletions, additions, or substitutions of nucleotides to the extent that sequence variations of the primers (a) - (b) retain the ability to act as an initiator in the detection of Vpi3.1-LGRAGLTY . The detection method of VP13.1-LGRAGLTY according to the invention uses a pair of the aforementioned initiators in a method that detects the presence of any ß13.1-LGRAGLTY in a sample. The sample to be evaluated for the presence of? ß 13.1 -LGRAGLTY is a nucleic acid, preferably DNA. The DNA can be genomic DNA, cDNA, DNA previously amplified by PCR, or any other form of DNA. The sample can be isolated, directly or indirectly, from any animal or human body tissue that expresses ß-chain genes of the T-cell receptor. A preferred body tissue is peripheral blood mononuclear cells (PBMC). If the sample is of genomic DNA, it can be isolated directly from body tissue. If the sample is cDNA, it can be isolated indirectly by reverse transcription of the mRNA directly isolated from the body tissue. If the sample is DNA previously amplified by PCR, it is indirectly isolated by amplification of genomic DNA, cDNA, or any other form of DNA. In a preferred embodiment, a portion of the T cell receptor gene from ß13.1 cells, the portion comprising a sequence encoding the LGRAGLTY motif, is amplified to improve the ability to detect the presence of ß13.1 -LGRAGLTY (5 -CTAGGGCGGGCGGGACTCACCTAC-3 '(SEQ ID NO: 1)). The amplification can take place by a PCR reaction, using any particular PCR technique or equipment that provides a sensitive, selective and rapid amplification of the portion in the sample. For example, the PCR amplification can follow a procedure in which a reaction mixture is prepared, which contains the following ingredients: 5 μl of pH II regulator for PCR (100 mM Tris-HC1, pH 8.3, KCI 500 mM), 3 μ? _ Of 25 mM MgCl 2, 1 μ? of 10 mM dNTP mixture, 0.3 μ ?. of poümersa Taq (5? _? / μ1_) (AmpliTaq Gold, Perkin Elmer, Norwalk, CT), 3 pmoles of initiator A, and 30 pmoles of initiator B. In light of the present disclosure, the person skilled in the art will be capable of selecting appropriate A and B primers for the purpose of PCR amplification of the portion of the T cell receptor gene from? β 3.1 cells. The aforementioned mixture is suitable for amplifying 1 μL · of DNA sample. Henceforth, the DNA to be amplified can be referred to as the "template". A sample of DNA is added to the aforementioned reaction mixture, the PCR reaction can be carried out with an amplification profile of 1 minute at 95 ° C (denaturation); 20 seconds at 56 ° C (fixation), and 40 seconds at 72 ° C (extension) for a total of 35 cycles. In the PCR reaction, the annealing can be denatured by heating and fixed to two oligonucleotide primers. The oligonucleotides delimit an area of the nucleic acid sequence to be amplified. The heat-stable DNA polymerase is included in the reaction mixture. The polymerase elongates the primers attached to the complementary DNA by the addition of the appropriate complementary nucleotides. Preferred polymerases have the characteristics of being stable at temperatures of at least 95 ° C, have a processing speed of 50-60 and have an extension rate greater than 50 nucleotides per minute.

Approximately 40 PCR cycles are used in a typical PCR amplification reaction. However, certain PCR reactions can work with as few as 15 to 20 cycles or as many as 50 cycles. Each cycle consists of a melting step in which the tempering is heated to a temperature above about 95 ° C. The temperature of the PCR reaction is subsequently lowered to allow fixation of the primers to the template. In this setting step, the reaction temperature is adjusted from 55 ° C to 72 ° C for approximately 20 seconds. Longer or shorter times may be appropriate depending on the specific reaction. The temperature of the PCR reaction is then raised to allow a maximum elongation of the primers to be affected by the polymerase. In this extension step, the reaction temperature is adjusted to between about 70 ° C to 75 ° C for about 40 seconds. Higher or lower temperatures and / or longer or shorter times may be adequate depending on the specific reaction. In addition, before the first cycle begins, the reaction mixture can be subjected to an initial denaturation for a period of about 5 minutes to 15 minutes. Similarly, after the last cycle is completed, the reaction mixture can be subjected to a final extension for a period of about 5 minutes to 10 minutes.

The amplification can be carried out using a two-step PCR. In this technique, a first amplification reaction by PCR is carried out to amplify a first region that is longer than, and comprises, a region of interest. A second PCR amplification reaction is then carried out, using the first region as a template, to amplify the region of interest. If any initiator from the first PCR reaction can be used in the second PCR reaction, the second PCR reaction is "semi-nested". If any initiator from the first PCR reaction can be used in the second PCR reaction, the second PCR reaction is "nested". In a preferred mode for carrying out the method of the present invention, the VP13.1-LGRAGLTY motif is amplified by two-step PCR. In the first PCR reaction, the sample is amplified using a first primer that binds to the Vp region of the T cell receptor gene and a second primer that binds to the Cp region of the T cell receptor gene, using the reaction mixture and profile described above. The first PCR reaction amplifies a first region that is approximately 600 bp and extends from Vp through the Vp-Dp-Jp junction to Cp. The second PCR reaction is nested or semi-nested; a portion of the first region is partially amplified using the pair of primers (a) - (b). The second PCR reaction amplifies the region of interest. After amplification of any DNA encoding Vp13.1-LGRAGLTY in the sample, the amplification product is detected.

This detection can be done through several procedures. For example, an aliquot of the amplification product can be loaded onto a gel for electrophoresis, to which an electric field is applied to separate the DNA molecules by size. In another method, an aliquot of the amplification product is loaded onto a gel stained with green SYBR, ethidium bromide, or another molecule that will bind to the DNA and emit a detectable signal. For example, ethidium bromide binds to DNA and emits visible light when illuminated by ultraviolet light. A dried gel could alternatively contain an oligonucleotide labeled with radioactivity or chemically labeled (which may be referred to hereafter as an "oligonucleotide probe") complementary to a portion of the amplified template sequence, from which autoradiography is taken by exposing the gel to a movie. In another embodiment, the present invention relates to an oligonucleotide probe, comprising (a) an oligonucleotide of about 15 to 30 nucleotides in length, comprising at least 10 contiguous nucleotides of SEQ ID NO:, or the complementary nucleic acid sequence to the same; and (b) a marked portion. Preferably "(a)" is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary thereto. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto. Preferably the labeled portion is selected from 32 P or digoxigenin. A typical radiolabeled oligonucleotide useful for the detection of amplification products produced using primers of the present invention is taken from the region? ß-? ß-? ß. If the region \ /ß13.1-LGRAGLTY is amplified by the two-step semi-nested PCR described above, where an initiator corresponding to the sequence encoding the LGRAGLTY motif is used, any oligonucleotide of about 10 or more can be used. nucleotides, and preferably of about 18 or more nucleotides, which is complementary to a portion of each chain of the? ß13.1 -LGRAGLTY amplified region. More preferably, the oligonucleotide 5'-CTAGGGCGGGCGGGACTCACCTAC-3 '(SEQ ID NO: 1) or the nucleic acid sequence complementary thereto is used as a probe. The present invention also comprises a test kit, comprising a first primer (a) of about 15 to 30 nucleotides in length comprising at least 10 contiguous nucleotides of SEQ ID NO: 1, or the nucleic acid sequence complementary thereto. . In a preferred embodiment, the test kit additionally comprises a second primer (b), wherein the first primer is a nucleic acid sequence of about 15 to 30 nucleotides in length that does not comprise the sequence of (a) and is found in the? ß to? ß region of the T cell? 13.1 receptor gene in T cells, where the sequences of (a) and (b) are not in the same chain of the T cell receptor gene. More preferably said first primer is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary to it. More preferable is an oligonucleotide, of about 15 to 30 nucleotides in length, which comprises the nucleotide sequence of SEQ ID NO: 1, or the sequence complementary thereto. In this embodiment, the test equipment additionally comprises at least one equipment useful in the amplification of V i3.1-LGRAGLTY DNA by PCR techniques as described above. Exemplary reagents that can be included in the kit include, but are not limited to, pH regulators, deoxynucleotide triphosphates, heat-stable DNA polymerase such as Taq polymerase, VPI3.1-LGRAGLTY DNA for positive control, and non-DNA Vpi3.1-LGRAGLTY for negative control. Other reagents that can be included in the test equipment are known to the skilled artisan. In another preferred embodiment, the test equipment additionally comprises a marked portion. Preferably the labeled portion is 32P or digoxigenin.

Another embodiment of the present invention is directed to peptides, from about 8 to about 45 amino acid residues in length, comprising the LGRAGLTY motif (for example, comprising the sequence of SEQ ID NO: 3). In various aspects of this embodiment, of the invention, the peptides comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 contiguous amino acids of the sequence of SEQ ID NO: 32. Preferably the peptide sequence is SEQ ID NO: 3 or the sequence is residues 2-21 of SEQ ID NO: 32. More preferably the peptide sequences are residues 2-21 of SEQ ID NO: 32. In a preferred aspect of this embodiment of the invention, the peptides are present as purified peptides. By "purified peptides" it is meant that most (more than 50%) of the polypeptides in the sample are the desired peptide. Preferably, the desired peptides constitute more than 70% of the peptides in the purified peptide sample. More preferably the peptide constitutes more than 90% of the peptides in the sample. Even more preferably the peptide constitutes more than 95% of the polypeptide in the sample. Additionally, the term "purified peptide" indicates that the sample does not contain substances that interfere with the operation of the present invention. The peptides according to this aspect of the invention can be from any source compatible with the present invention either natural or synthetic (which can be obtained from commercial sources known to those skilled in the art).

Other embodiments of the present invention provide pharmaceutical compositions comprising the peptides described above. Methods for producing peptide pharmaceutical compositions are known in the art, see for example, Patents of E.U.A. numbers 6, 066, 619 and 6, 068, 850 which are incorporated herein by reference. Various aspects of this embodiment of the present invention may comprise a pharmaceutically acceptable excipient, carrier, or diluent and do not contain any biologically harmful substance. The pharmaceutical compositions of the present invention can be formulated by a person skilled in the art. Exemplary pharmaceutical formulations are also described in Remington's Pharmaceutical Sciences (Alfonso R. Gennaro Ed., 16th Edition, 1980), which is a standard text of reference in the pharmaceutical field, and is incorporated herein by reference. The pharmaceutical compositions may further comprise coloring agents or stabilizers, osmotic agents, antibacterial agents, or any other substances that do not interfere with the function of the composition. The pharmaceutical compositions of the invention may, for example, be formulated as a solution, suspension, or emulsion in association with a pharmaceutically acceptable parenteral vehicle. The vehicle may contain additives that maintain isotonicity (eg, sodium chloride or mannitol) and chemical stability (eg, pH regulators and preservatives). It should be appreciated that endotoxin contamination should be maintained at a moderate level, eg, less than 0.5 ng / mg protein. In addition, for administration in humans, preparations must achieve sterility, pyrogenicity, general safety, and purity standards as required by the United States Food and Drug Administration Office of Biological Standards. The formulations can be sterilized by commonly used techniques such as filtration. The phrase "pharmaceutically acceptable" refers to substances and compositions that do not produce an adverse, allergic, or otherwise unfavorable reaction when administered to an animal, or to a human, as appropriate. A substance that causes any of these adverse effects could be classified as "biologically harmful" within the scope of the present invention. The pharmaceutically acceptable substances and compositions may include, but are not limited to solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and delayed absorption. The use of any conventional ingredient is contemplated, except when it is incompatible with the invention. In addition, supplemental active agents that serve some other pharmacologically convenient purposes, may also be incorporated within the present compositions. The present invention also comprises a method for treating an autoimmune disease. The disease is one in which, for at least some patients, the T cell receptors comprising LGRAGLTY are found in? ß13.1 cells. Other types of T cells, and / or? 13.1 cells lacking T cell receptors comprising the LGRAGLTY motif, may be presented by the patient. The method comprises: (a) obtaining MBP83-99 \ / ß13.1 T cells from a human; (b) detecting the presence of a nucleic acid encoding the LGRAGLTY motif by the method described above; and, if the nucleic acid is detected, (c) administering a pharmaceutical composition comprising one or more pees from 9 to about 45 amino acid residues in length, to the human; wherein each pee is comprised of the LGRAGLTY motif. In various aspects of this method, the pharmaceutical composition administered to the human comprises one or more pees having 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 contiguous amino acids of the sequence of SEQ ID NO: 32. Preferably the pee sequence is SEQ ID NO: 3 or the pee sequence comprises residues 2-21 of SEQ ID NO: 32. Most preferably the pee sequences are residues 2-21 of SEQ ID NO: 32. The autoimmune disease may be any autoimmune disease in which the T-cell receptors comprising the LGRAGLTY motif are found in? ß13.1 cells. Autoimmune diseases contemplated by the present invention include, but are not limited to, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, systemic lupus erythematosus, autoimmune thyroiditis (Hashimoto's thyroiditis), Graves' disease, inflammatory bowel disease, autoimmune uveoretinitis, polymyositis , and certain types of diabetes. A preferred autoimmune disease is multiple sclerosis (MS). If the nucleic acid encoding an LGRAGLTY motif is detected by the methods described above, the autoimmune disease can be treated by administering pharmaceutical compositions comprising one or more pees as described above. The pharmaceutical compositions of the present invention may be administered alone, or in combination with a T cell activation marker pee. Preferably the pharmaceutical composition is administered in combination with a T cell activation marker pee, in accordance with the Zhang disclosure, US Patent Application 60/099, 102, incorporated herein by reference. The administration of the pee can lead to an immunogenic response, wherein the patient will develop antibodies and T cell receptors that recognize and bind to the LGRAGLTY motif of the T cell receptors found in Vpi 3.1 cells. Because Vpi3.1-LGRAGLTY can be present both in patients suffering from MS and in normal individuals not suffering from the disease, it is envisioned that the pharmaceutical compositions of the present invention can be administered to both MS patients and normal individuals. In an alternative embodiment, if the nucleic acid encoding an LGRAGLTY motif is detected by the methods described above, the autoimmune disease can be monitored by quantification of the nucleic acid. The greater the amount of nucleic acid present in a sample, such as PBMC, the greater the number of Vpi3.1 T cells and the greater the probable severity of the symptoms of the autoimmune disease. Also, depending on the time between the presentation of the high levels of \ /ß13.1 in T cell and the appearance of symptoms, the doctor may receive an opportunity to apply treatments that tend to minimize the severity of symptoms and / or treat the disease before the symptoms appear. The following examples are included to demonstrate preferred embodiments in the invention. It should be appreciated by those skilled in the art that the techniques described in the examples below represent techniques discovered by the inventor to function well in the practice of the invention, and therefore can be considered to constitute preferred modes for their practice. However, those skilled in the art should, in light of the present descrin, appreciate that many changes can be made in the specific modalities which are described and still obtain a similar or similar result without departing from the spirit and scope of the invention. invention.

EXAMPLES EXAMPLE 1 DNA sequence of? ß-? Β-JB of the T-cell receptor and sequence motifs shared between MBP83-99-specific T-cell clones derived from different patients with MS A panel of 20 CD4 + independent T cell clones were generated from several patients with MS. All T cell clones recognized peptide 83-99 of myelin basic protein (MBP83-99) in the context of HLA-DR2 as determined by the use of mouse fibroblasts (L cells) transfected with DRB1 * 501 as antigen presenting cells. T cell clones were characterized for rearrangement of the TCR V gene in reverse transcription-PCR (RT-PCR) using oligonucleotide primers specific for Va and Vp and subsequently sequenced for the Va-Ja and? ß-? ß- binding regions ?H.H. The sequences of the binding regions are shown in Tables 1 and 2. Table 1. Summarizes the results of the analysis with a panel of 20 MBP83-99-specific independent cell clones characterized in accordance with their use of the Va gene by transcription Reverse-PCR using a panel of oligonucleotide primers specific for the Va gene families (the sequence of the unique primers used is indicated by underlining in the DNA sequence corresponding to each clone). The amino acid sequences of the "Va", "n", "Ja", and "Ca" portions of each clone are indicated in Table 1, as follows: "n" portions are underlined, "Va" sequences and "Ja" are shown in bold on their respective sides of the "n" sequence, and the "Ca" sequence is displayed in normal font without being underlined. The amplified PCR products were hybridized with Ca-cDNA probes labeled with digoxigenin and subsequently analyzed for DNA sequence. Table 2. Summarizes the results of a panel analysis of 20 independent T-cell clones specific to MBP83-99. The clones were analyzed for use of the Vp gene by reverse transcription-PCR using a series of oligonucleotide primers specific for twenty-six families of the Vp gene (the sequence of the specific primer for each clone is indicated by underlining in the corresponding DNA sequence). The "Vp", "D", "Jp", and "CP" portions of each clone are indicated in Table 2, as follows: "D" portions are underlined, the "Vp" and "Jp" sequences are shown in bold on their respective sides of the sequence "D", and the remaining sequence "CP" is in normal font (not underlined or in bold). The amplified PCR products were hybridized with Cp cDNA probes labeled with digoxigenin and subsequently analyzed for DNA sequence.

TABLE 1 Sequence of the V | ¾ TCR gene specific for peptide BP83-99 CLON DE Gen V Sequence of? ß -? -? ß-? ß CELL T (# DNA or Access sequence of GenBank) amino acids S37-B9.1? ß17 Amino acid YLCASSTRQGPQETQYFGPGTR (AF117135) LLVLEDLKN (SEQ ID NO: 48) DNA TATCTCTGTGCCAGTAGTACCC GGCAAGGACCTCAAGAGACCC AGTACTTCGGGCCAGGCACGC GG CTCCTG GTG CTCG AGG ACC TGAAAAAC (SEQ ID NO: 49) MS8-D2.7? ß8 Amino Acid YLCASSLGQGAYEQYFGPGTRL (AF117136) TVTEDLKN (SEQ ID NO: 50) DNA TATCTCTGTGCCAGCAGCTTAG GACAGGGGGCTTACGAGCAGT ACTTCGGGCCGGGCACCAGGC TCACGGTCACAGAGGACCTGA AAAAC (SEQ ID NO: 51) MS8-A2.7? ß8 Amino Acid YLCASSLGQGAYEQYFGPGTRL (AF117136) TVTEDLKN (SEQ ID NO: 52) DNA TATCTCTGTGCCAGCAGCTTAG GACAGGGGGCTTACGAGCAGT ACTTCGGGCCGGGCACCAGGC TCACGGTCACAGAGGACCTGA AAAAC (SEQ ID NO: 53) MS8-A1.15 SS8 YLCASSLGQGAYEQYFGPGTRL Amino Acid (AF117136) TVTEDLKN (SEQ ID NO: 54)? DNA TATCTCTGTGCCAGCAGCTTAG GACAGGGGGCTTACGAGCAGT ACTTCGGGCCGGGCACCAGGC TCACGGTCACAGAGGACCTGA AAAAC (SEQ ID NO: 55) MS8-D1.3? ß8 Amino Acid YFCASSLQVYSPLHFGNGTRLT (AF1 7137) VTEDLNK (SEQ ID NO: 56) DNA TACTTCTGTGCCAGCAGTTTAC AAGTGTATTCACCCCTCCACTT TGGGAACGGGACCAGGCTCAC TGTGACAGAGGACCTGAACAA G (SEQ ID NO: 57) Although the rearrangements of Va and Vp vary between individual MBP83-99 T cell clones, many of these independent T cell clones derived from a given individual share identical Va and Vp chains with the same Va-Ja and Vp-Dp-Jp binding region sequences. The finding is consistent with the in vivo clonal expansion of T cells specific to MBP83-99 in patients given MS as previously reported (Vandevyver 1995, Wucherpfenning 1994). Interestingly, as indicated in Tables 1 and 2, an independent T cell clone (clone E2.6) derived from one patient (MS-1) shared the same Vpi3.1 and Va17 with 3 of 4 clones of T cell (clones C3.1, D7.16 and F3.4) obtained from another patient (MS-2). Vpi3.1 of these T cell clones shared an identical DNA sequence with the Vp-Dp-? ß binding region.

EXAMPLE 2 Oligonucleotide primers specific to? ß-? ß-Jp were highly specific and sensitive in the detection of corresponding DNA sequences present in MBP83-99 cell clones as well as in PBMC containing original MBP83-99 T cells.

A series of 14 oligonucleotide primers were synthesized in accordance with the DNA sequences within the Vp-Dp-jp binding regions of independent MBP83-99 T cell clones and subsequently examined for their specificity in RT-PCR. The DNA sequences of these oligonucleotide primers are shown in Table 3.

TABLE 3 DNA sequences of oligonucleotide primers specific for VB DB-JB These a? ß-? ß-? ß-specific primers bound exclusively to DNA sequences present in the original MBP83-99 T cell clones and did not bind to the sequences derived from unrelated MBP83-99 cell clones. (figure 2), suggesting its high specificity for the original DNA sequences of? ß-? ß-? ß. The only exception was evidenced for the clone MS1.E2.6 and the clone MS2-C3.1, in which the first primer was linked to the ß-? ß-? Β binding DNA sequence shared by both clones of T-cell. Given the specificity of the oligonucleotide primers of ß-? ß-? ß and the high sensitivity of the detection system by PCR, the inventors wondered if this system of detection by means of two-step PCR using the 5 'primers? ß and oligonucleotide primers specific to αβ- ß- ß- ß could be used to detect DNA sequences corresponding to ß-? ß-? ß present in specimens of peripheral blood mononuclear cells (PB C) in which originated MBP83-99 cell clones. The results of two separate experiments showed positive detection of the? ß-? ß-? ß sequences in original PBMC specimens. Therefore, the findings demonstrate that the PCR detection system where the sequence? / ß-? ß-? ß served as a fingerprint, was specific and sensitive to trace the MBP83-99 T cells present in the cells peripheral blood mononuclear cells by hybridization of probes of identical DNA sequences.

EXAMPLE 3 Detection of a common DNA sequence of VB-DB-JB in PBMC specimens derived from different patients with MS and from healthy individuals Next, the inventors examined whether the DNA sequences corresponding to the ß-? ß-? ß binding regions of MBP83-99 T-cell clones could be detected in randomly selected PBMC specimens from a group of patients with MS and healthy individuals. The same amplification system was used by PCR using corresponding specific primers for ß families (in the first PCR) and specific primers for the ß-? ß-? ß sequences (in the second semi-nested PCR). It was combined with Southern blot analysis with the corresponding? ß-? ß-? ß probes to carry out the hybridization. Given the specific requirements for the two-step PCR detection system and the specificity of the ß-? ß- ß primers and probes, the identified DNA sequences could be derived from specific ß TCR chains and represented either sequences identical or similar to the sequence? / ß-? ß-? ß of interest. The results indicated that only one ß-? Β-ββ oligonucleotide primer (MS1-E2.6, ß13.1-ΔT ??) detected DNA sequence complementary to TCR Vp13.1 in 15 of 48 (31%) specimens of PBMC obtained from different patients with MS. Therefore, the finding indicates the presence of MBP83-99 T cells that express ß 13.1 -LGRAGLTY in these patients with MS. Under similar experimental conditions, the same primer also detected the corresponding DNA sequence in 5 of 20 (25%) specimens of PBMC derived from healthy individuals. The 13 remaining primers of? ß-? ß-? ß did not identify any signal sequence in the same panel of PBMC specimens. The results were reproducible in three separate experiments. The identified DNA products amplified by the E2.6 primer originated from T cells expressing ß 3.1 because the a ß13.1 specific primer was used in the first PCR for amplification. further, the identified sequence \ / ^ 13.1-LGRAGLTY was also amplified in 13 of 24 (54%) short-term MBP83-99 T cell lines generated from five patients with MS (MS-25, MS36 and MS39) whose specimens PBMC were shown to contain the sequence? ß13.1-LGRAGLTY. The results thus confirmed that the ß13.1-LGRAGLTY DNA sequence detected in PBMC specimens originated from T cells recognizing MBP83-99. The finding also suggests that MBP83-99 T cells expressing the ß13.1-LGRAGLTY sequence represent all or most of the MBP83-99 T cell lines found in some patients with MS. A combined PCR-hybridization DNA detection system where the? / ß-? ß-? ß sequences were used as a fingerprint provided a useful tool for tracing the T-cell specific antigen by detecting identical binding sequence a? / ß-? ß-? ß. The high specificity and sensitivity of the detection system allowed the identification of a? / ß-? ß-? ß-specific sequences in peripheral blood T cells. The present study demonstrates for the first time that a common subpopulation of Vp13.1 T cells that recognizes the immunodominant peptide 83-99 of MBP and that uniformly express a sequence identical to? ß-? ß- ß is present in approximately 30% of patients with MS. The conclusion is based on the step-by-step experiments described in the present invention. First, the identical DNA sequence (\ ^ 13.1-LGRAGLTY) was found among independent MBP83-99 T-cell clones derived from different patients with MS. Second, the sequence was identified in cDNA products amplified from TCR? ß13.1 of PBMC specimens obtained from different patients with MS. Third, the DNA sequence was detected in short-term independent TMBP83-99 cell lines generated from PBMC specimens that were shown to contain the sequence \ ^ 13.1-LGRAGLTY. The MBP83-99 T cells expressing the sequence / 13.1-LGRAGLTY seem to represent all or most of the MBP83-99 cell lines generated from some patients with MS. Finally, the presence of the V ^ 13.1-LGRAGLTY sequence in PBMC specimens was confirmed by recombinant DNA cloning and direct DNA sequencing. Furthermore, it is not surprising that MBP83-99 T cells expressing the common sequence ^ ^ 13.1-LGRAGLTY are also present in some healthy individuals. Studies reported so far indicate that MBP reactive T cells, including T cells that recognize immunodominant peptide 83-99, are also present in some healthy individuals (Zhang 1994, Ota 1990). However, there is a functional difference that these T cells carry out clonal activation and expansion in vivo in patients with MS, as opposed to healthy individuals (Zhang 1994). These T? ß13.1 MBP83-99 cells that share the common sequence? ß-? ß- ß may represent a significant fraction of the MBP83-99 T cells found in some patients with MS. This possibility is supported by the observation that the V ^ 13.1-LGRAGLTY sequence was present in 40% of the short-term MBP83-99 T cell lines generated from patients with MS after two stimulation cycles. The common sequence identified? / ß-? ß-? ß can be used as a specific marker in a quantitative PCR detection system to detect a common subpopulation of MBP83-99 T cells in the blood and brain spinal fluid in a large group of patients with MS for the purpose of in vivo monitoring of clonal expansion and in vivo activity potentially associated with the disease. This method will be superior to conventional cell culture based assays because in vitro selection and expansion of MBP reactive T cells are often prevented by several inhibitory factors inherent in cell culture. This is consistent with a recent study in which the frequency of MBP-reactive T cells was found to be surprisingly high in patients with MS when direct ex vivo analysis is used to quantitate MBP-reactive T cells (Hafler as last author JEM 1997 ). further, it has been shown that synthetic peptides corresponding to TCR induce anti-idiotypic T cell responses to MBP reactive T cells in patients with MS (Chou et al, J.I.). Therefore, a TCR peptide containing a common CDR3 sequence can be of great potential in the production of anti-idiotypic T cells to suppress a specific subpopulation of MBP reactive T cells in a group of patients whose MBP83-99 T cells contain the common sequence motif CDR3. Immunization with said common CDR3 peptide could be advantageous over the CDR2 peptides or CDR3 peptides dependent on the individual as a potential treatment procedure in patients with MS (Vandenbark 1996).

EXAMPLE 4 Induction of immune responses to immunize T-cell clones reactive to MBP and a 20-element TCR peptide by T-cell vaccination in patients with MS and the generation of B-cell lines that produce antibodies specific to the TCR peptide that incorporate the CDR3 common sequence from immunized patients It has been demonstrated that subcutaneous inoculations with autologous MBT-reactive T-cell clones induced substantial anti-idiotypic T cell responses in patients with MS, which correlated with the progres decrease of circulating MBP-reactive T cells used for vaccination ( Medaer et al., 1995).

Materials and methods Reagents and peptides The media used for cell culture were serum-free medium Aim-V (Life-Technologies, Grand Island, NY). The immunodominant peptide (residues 83-99) of MBP and two 20 amino acid TCR peptides were synthesized by Chiron Mimotope (San Diego, CA). The purity of the peptides was greater than 95%.

Estimation of the frequency of precursor T-cell reactive to MBP PBMCs were seeded at 200,000 cells / well (for a total of 96 wells) in the presence of MBP (40 μg / mL). Seven days later, all cultures were re-stimulated with MBP in the presence of irradiated autologous PBMCs. After another week each well was divided into four aliquots (approximately 104 cells per aliquot) and cultured in duplicate with 105 irradiated autologous PBMCs in the presence and absence of MBP. The cultures were maintained for three days and pulsed with [3 H] thymidine (Nycomed Amersham, Arlington Heights, IL) at one μ? Per well during the last 16 hours of culture. The cells were then harvested using an automated cell harvester, and the incorporation of [3 H] thymidine was measured. A well / culture was defined as specific for MBP or MBP peptides when the counts per minute (CPM) were greater than 1000 and exceeded the reference CPM (in the absence of MBP) by at least three times. The frequency of the precursor of MBP-reactive T cells was then estimated by dividing the number of specific wells by the total number of PBMCs (19.2 x 106 cells) seeded in the initial culture.

Myelin reactive T cell clones Positively identified T cell lines were cloned using limiting dilution assay in the presence of phytohemagglutinin-protein (PHA-P) at 2 μ? / ???. The cultures were fed fresh medium every three to four days. Wells with positive growth were evaluated for specific reactivity to peptide MBP83-99 in proliferation assays. The resulting T cell clones specific to MBP83-99 were further characterized and used for T cell vaccination.

Analysis of the TCR V gene and DNA sequencing Re-dispositions of the V gene of the T cell receptor of the MBP-reactive T-cell immunizing clones were analyzed using reverse transcription-PCR. The TCR genes a and ß were amplified and sequenced directly as described elsewhere (Vandevyer et al., 1995; Zhang; Y.C.Q. et al., 1998). Briefly, total RNA was extracted from 106 cells of each T cell clone relative to MBP83-99 using RNeasy mini kit (QIAGEN, Santa Clarita, CA). The first strand of the cDNA that was reverse transcribed from the total RNA was amplified by PCR with a series of primers specific to the family of TCR Va and? ß genes whose sequences were published (Vandevyer et al., 1995; Zhang; YCQ et al., 1998). The amplified PCR products were separated on a 1% agarose gel by electrophoresis and stained with ethidium bromide. The visualized PCR products were subsequently cut and purified using QIAquick® gel extraction equipment (QIAGEN, Santa Clarita, CA), prior to sequence analysis. The purified PCR products were sequenced directly with the T7 sequencing kit (Pharmacia, Uppsala, Sweden). 1.5 μg of the template was sequenced with 2 pmoles of the corresponding V gene primer using the dideoxy-chain termination method.

Immunization of patients with S with T-cell clones reactive to irradiated autologous MBPs Two patients who had been clinically confirmed for MS using magnetic resonance imaging were included in this study. They were diagnosed as having MS relapsing for more than two years. The patients had not taken any immunomodulatory drug at least three months before the study. Immunizations with autologous irradiated T cell clones reactive to MBP83-99 were carried out as previously described (J. Zhang et al., 1992, 1993). Briefly, the T cell clones reactive to MBP83-99 were activated and expanded in the presence of PHA seven days before injection. The T cells were then irradiated at 10,000 rads (using a 60Co source) and washed extensively with sterile saline. A total of 4 x 107 cells from two autologous T-cell clones were resuspended in 2 ml of sterile saline and injected subcutaneously into the arms. Each patient received a total of four injections at two-month intervals to achieve immune responses suitable as defined by the proliferation of PBMC to immunizing T cell clones. The protocol was approved by the Institutional Human Subjects Committee at the Baylor College of Medicine. The forms of consent were obtained from the patients after explaining the experimental procedures. Patients were evaluated for adverse events and disability assessment (scale evaluation of expanded disability) before and after each immunization. The selections with RI enhanced by gadolinium were carried out before and at different points in time after immunization. The clinical and radiographic evaluation was part of a separate clinical study.

Generation of antibody-producing cell B lines by transformation with EBV The method was described elsewhere (J. Zhang, 1989, 1991). Briefly, PBMC were seeded at 20,000 cells / well in microtiter plates (Costar, Cambridge, A) in the presence of cell-free supernatant of the B95.8 line that produces EBV (ATCC, Bethesda, MD) at 0.5 μ? / ??? of Ciclosporin A (Sandoz, Basel, Switzerland) to selectively inhibit the growth of the T cell. Cells were cultured for 14 days with medium changes every 3-4 days. On day 14, wells with positive growth were visualized and culture supernatants were harvested for evaluation. The frequency of the B cell precursor that produces specific antibodies was estimated by dividing the number of positive wells by the total number of PBMC sown. The positive B-cell lines were subsequently transferred to 24-well plates (Costar, Cambridge, MA) for expansion. The B cell lines typically produced 2-10 μg / ml of relatively pure antibodies.

Detection of anti-TCR antibody by ELISA Culture supernatants were re-collected from individual B-cell lines and evaluated for the presence of anti-idiotypic antibodies using ELISA. Briefly, the microtiter plates were coated overnight at 4 ° C with the positive motif TCR peptide or with the control TCR peptide, respectively, at a concentration of 1 μg / ml.

The wells were then blocked at 37 ° C for two hours with PBS containing 2% bovine serum albumin (BSA) (Sigma, St. Louis, MO) and washed four times with 0.02% Tween® 20 (Sigma , St. Louis, MO) in a 0.9% NaCl solution. Each sample and its control were added to the adjacent wells and incubated for two hours. The plates were washed four times and incubated for 30 minutes with a goat anti-IgG / lgM human antibody conjugated to horseradish peroxidase at a dilution of 1: 1500 (Sigma, St. Louis, MO). 0.0125% tetramethylbenzidine / 0.008% H2O2 in citrate pH buffer (pH = 5.0) was used as a substrate, and the color development was stopped using 2N H2SO4. The optical densities were measured using an ELISA reader (Biorad, Hercules, CA). The wells containing medium only served as control of the background signal.

Immunoblot analysis The Used ones were prepared from a T-cell clone reactive to representative MBP (MS7.E2.6) expressing the common CDR3 sequence using a standard method described elsewhere (Hjelmeland et al., 1984). Briefly, 5 x 106 T cells were lysed in 100 μ? of pH regulator for lysis containing 150 M NaCl, 50 mM Tris (pH 7.6), 0.5% Triton X-100, 1 mM PMSF, 10 μg / ml aprotinin, 10 μg / ml leupeptin. Cell debris was centrifuged at 13,000 g for 20 minutes at 4 ° C. The resulting lysates were subjected to electrophoresis using 10% SDS-PAGE. After the blot, the nitrocellulose membranes were cut into strips and then blocked with 5% low fat milk powder in pH regulated saline with Tris containing 0.1% Tween® 20 (milk-TBST). The strips were then incubated with undiluted supernatants in mini-incubation trays for one hour at room temperature. An goat anti-IgG antibody and human IgM (heavy + light chains) coupled to horseradish peroxidase as a secondary antibody (100 ng / ml in milk-TBST 2%) were used and incubated with washed strips for 45 minutes in a row. by improved chemiluminescent viszation of membrane proteins (Amersham, Piscataway, NJ). The supernatant obtained from a B cell line transformed with EBV that produces non-reactive antibodies was used as a negative control. A human TCR anti-beta-chain rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was included as a positive control.

Flow cytometry A T-cell clone reactive to representative MBP (MS7-E2.6) expressing the common CDR3 sequence was incubated with the anti-idiotypic antibodies derived from the individB cell lines at 4 ° C for 30 minutes . The supernatant obtained from a B cell line transformed with EBV that produces non-reactive antibodies was used as a control. After washing with pH-FACS buffer (PBS containing 5% fetal calf serum and 0.01% sodium azide) by centrifugation at 2300 rpm for 2 minutes at 4 ° C, the cells were resuspended and stained with a anti-IgG / IgM antibody from human fluorescein conjugated (FITC). After two washes, the cells were resuspended in 300 μ? of pH-FACS regulator and analyzed by flow cytometry using uri FACScan (Becton Dickinson, San José, CA).

The inhibition assay 20,000 cells of the immunizing MBP-reactive T-cell clones (T cell clones with positive motif and negative motif) were cultured in 150 μ? with Irradiated autologous PBMCs (100,000 cells / well) in the presence and absence of peptide 83-99 of MBP (20 μ9 ???). Fifty μ? of undiluted supernatants were added into each well. Cell proliferation was measured after 72 hours in [3H] -thymidine incorporation assays. The supernatant obtained from a B cell line transformed with EBV that produces non-reactive antibodies was used as a control.

Results Functional and structural characteristics of immunizing MBP-reactive T-cell clones A panel of four MBP-reactive T-cell clones was generated from two patients with relapsing-remitting MS. These T-cell clones expressed the CD4 phenotype and recognized the immunodominant peptide 83-99 of MBP in the context of DR4 or DR2 molecules (DRB1 * 1501). These were analyzed for TCR V gene rearrangements by RT-PCR using primers specific to Va and Vp and subsequently sequenced for the Va-Ja and? ß-? ß-? ß binding regions. An independent T cell clone (E2.6) derived from patient MS7 shared the same Va17 and ß13.1 genes from TCR with another T cell clone (C3.1) obtained from a different patient (MS27). The two T cell clones had an identical sequence, SEQ ID NO: 3 within the? 13.1-? ß-? ß binding region while their Va17 chains had two distinct Va-Ja binding region sequences. As mentioned above, the identified sequence Leu Gly Arg Ala Gly Leu Thr Tyr (SEQ ID NO: 3) represented a common CDR3 motif among the Tβ13.1 cells that recognized the immunodominant region 83-99 of MBP in different patients with MS (23).

Induction of immune responses to immunizing MBP-reactive T cell clones and a 20-element TCR peptide by T cell vaccination in patients with MS Each patient received a total of four subcutaneous inoculations with two irradiated T-cell autologous clones reactive to MBP (2 x 107 cells per clone) at two-month intervals. The proliferative responses of PBMC to the autologous immunizing T cell clones were examined at two time points corresponding to the baseline and two months after the last immunization. As shown in Figure 8A, the proliferative responses of both irradiated immunizing T cell clones were increased in the patients after T cell vaccination and substantially exceeded the baseline value. In addition, responses to the TCR peptide incorporating the common sequence CDR3 (peptide with positive motif, consisting of amino acids 2-21 of SEQ ID NO: 32), as opposed to a CDR3 control peptide (peptide with negative motif, consisting of of amino acids 1-20 of SEQ ID NO: 48) derived from a non-immunizing T cell clone was evident after vaccination. However, the magnitude of the specific proliferation in response to the positive motif peptide was considerably less than that induced by the irradiated immunizing T cells (Figure 8A). The proliferative response of immunizing T cells correlated inversely with a decrease in the frequency of circulating MBP reactive T cells in immunized patients (Figure 8B).

The generation of the B cell lines producing antibodies to the TCR peptide incorporates the common sequence CER3 from immunized patients. The inventors then examined whether immunization with irradiated T cells could produce specific responses to anti-idiotypic antibody in patients. Since whole T cells express a variety of surface molecules that can interfere with the detection of anti-idiotypic serum antibodies, the TCR peptide incorporating the common sequence CDR3 (peptide with positive motif) was used as the antigen for selection. . The 20-element TCR peptide derived from a T cell clone reactive to non-immunizing MBP (peptide with negative motif) was included in all experiments as a control. The CDR3 sequence of the control peptide was not detected in the immunizing T cell clones. No reactivity could be detected to the specific antibody either to the TCR peptide or to the original immunizing T cells using ELISA or flow cytometry, when evaluated with serum derived from the two patients (data not shown). To further verify whether the anti-idiotypic antibodies were present in the vaccinated patients, the inventors generated a panel of antibody-producing cell B lines from the post-vaccination blood specimens using a cell culture-based technique that combines transformation with EBV with limiting dilution (see materials and methods). Since the pre-vaccination PBMCs were not available for the experiments, the cells obtained from two healthy individuals randomly selected as control subjects were used and analyzed under the same experimental condition. Supernatants of the resulting B cell lines (92 cell lines from each patient / individual) were evaluated for the presence of antibodies to the TCR peptide with positive motif and to the control TCR peptide, respectively, in ELISA. Antibodies were defined as anti-idiotypic when they exhibited specific reactivity to the TCR peptide with positive motif but not to the control TCR peptide. As shown in Figure 9, B cells that produce specific anti-idiotypic antibodies occurred at the precursor frequency of 1.75 x 10"6 in patients MS7 and MS27, respectively, as compared with the two control subjects not immunized. In contrast, no specific antibody reactivity was detected to the control peptide in the same supernatants. The results suggest that the high frequency of B cells producing anti-idiotypic antibodies was associated with T cell vaccination. All compositions and / or methods described and claimed herein can be elaborated and executed without experimentation in the light of the present description. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations can be applied to the compositions and / or methods and in the steps or sequence of steps of the method described. in the present invention without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related can be substituted for the agents described in the present invention, while the same or similar results can be achieved. All of these similar substitutions and apparent modifications to those skilled in the art are considered within the spirit, scope and concept of the invention as defined by the appended claims.

References All references are listed in the present invention, as far as they are necessary to describe and / or enable the present claims as if they were fully incorporated as references. Hjelmeland, J.M. and Chrambach, A. (1984) "Solubilization of functional membrane proteins" Meth. Enzymol. 104: 305-318 Medaer, RP, Stinissen, L, Raus, I and Zhang, J. (1995) "Depletion of myelin basic protein reactive T cells by T cell vaccination: A pilot clinical trial in multiple sclerosis", Lancet 346: 807-808. Vandevyver, C, Mertens, N., van de Elson, P., Medaer, R., Raus, J., and Zhang, J (1995) "Clonal expansion of myelin basic protein-reactive T cells in patients with multiple sclerosis: restricted T cell receiver V gene rearrangements and DCR3 sequence. " Eur. J Immunol. 25: 958-968. Zhang, J., Lambrechts, J., Heyligen, H., Vandenbark, A., and Raus, J. (1989) "Human B cell lines secreting IgM antibody specific for myelin basic protein." J Neuroimmunol. 23: 249. Zhang, J., Chin, Y., Henderikx, P., Medaer, R., Chou, CH, and Raus, J. (1991) "Antibodies to myelin basic protein and measles virus in multiple sclerosis: precursor frequency analysis of the antibody producing B cells. " Autoimm. 1 1:27. Zhang, J., Medaer, R., Hashim, G., Ying, C. van den Berg-Loonen, E., and Raus, J. (1992) "Myelin basic protein-specific T lymphocytes in multiple sclerosis and controls: precursor frequency, fine specificity, and cytotoxicity. " Ann. Neurol, 32: 330. Zhang, J., Medaer, K, Stinissen, P., Hafler, D.A., and Raus, J (1993) "MHC restricted depletion of human myelin basic protein reactive T cells by T cell vaccination." Science 261: 1451-1454 Zhang, YCQ, Kozovska, M., Aebischer, I., Li, S., Boehme, S., Crowe, P., Rivera, VM, and Zhang, J. (1998) "Restricted TCR Va gene rearrangement in T cells recognizing an immunodominant peptide of myelin basic protein in DR2 patients with multiple sclerosis. " Int. Immunol 10: 991 LIST OF SEQUENCES < 110 > Jingwu, Zhang < 120 > Sequence? ß-? ß-? ß of the T-cell receptor and methods for its detection < 130 > BCOL005P 10237.0005. PCOOOO < 160 > 77 < 170 > Patentln version 3.0 < 210 > 1 < 211 > 24 < 212 > DNA < 213 > Artificial < 220 > < 223 > Synthetic Oligonucleotide < 400 > 1 ctagggcggg cgggactcac ctac 24 < 210 > 2 < 211 > 400 < 212 > DNA < 213 > Homo sapiens < 400 > 2 catgtctccg ataacccaga ggatttcccg ctcaggctgc tgtcggctgc tccctcccag 60 acatctgtgt acttctgtgc cagcagccta gggcgggcgg gactcaccta cgagcagtac 120 ttcgggccgg gcaccaggct cacggtcaca gaggacctga aaaacgtgtt cccacccgag 180 gtcgctgtgt ttgagccatc agaagcagag atctcccaca cacactggta cccaaaaggc 240 caggcttcta tgcctggcca ccccgaccac gtggagctga gctggtgggt gaatgggaag 300 gaggtgcaca gtggggtcag cacagacccg cagcccctca aggagcagcc cgccctcaat 360 gactccagat actgcctgag cagccgcctg agggtctcgg 400 < 210 > 3 < 211 > 8 < 212 > PRT < 213 > Homo sapiens < 400 > 3 Leu Gly Arg Ala Gly Leu Thr Tyr 1 5 < 210 > 4 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 4 Tyr Phe Cys Ala Leu Ser Arg Gly Gly Ser Asn Tyr Lys Leu Thr Phe 1 5 10 15 Gly Lys Gly Thr Leu Leu Thr Val Asn Pro Asn lie Gln Asn 20 25 30 < 210 > 5 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 5 tacttctgtg ctctgagtag gggaggtagc aactataaac tgacatttgg aaaaggaact ctcttaaccg tgaatccaaa tatccagaac 90 < 210 > 6 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 6 Tyr Tyr Cys Ala Leu Lys Arg Asn Phe Gly Asn Glu Lys Leu Thr Phe 1 5 10 15 Gly Thr Gly Thr Arg Leu Thr lie lie Pro Asn lie GIn Asn 20 25 30 < 210 > 7 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 7 tattactgtg ctctaaaaag aaactttgga aatgagaaat taacctttgg gactggaaca agactcacca tcatacccaa tatccagaac 90 < 210 > 8 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 8 Tyr Phe Cys Wing Wing Pro Pro Gly Gly Ser Asn Tyr Lys Leu Thr Phe 1 5 10 15 Gly Lys Gly Thr Leu Leu Thr Val Asn Pro Asn lie Gln Asn 20 25 30 < 210 > 9 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 9 tactíctgtg cagcaagccc cggaggtagc aactataaac tgacatttgg aaaaggaact ctcttaaccg tgaatccaaa tatccagaac 90 < 210 > 10 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 10 Tyr Phe Cys Wing Wing Met Gly Asp Phe Gly Asn Glu Lys Leu Thr Phe 1 5 10 15 Gly Thr Gly Thr Arg Leu Thr lie lie Pro Asn lie Gln Asn 20 25 30 < 210 > 11 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 11 tacttctgtg cagcaatggg ggactttgga aatgagaaat taacctttgg gactgg agactcacca tcatacccaa tatccagaac 90 < 210 > 12 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 12 Tyr Phe Cys Wing Wing Met Gly Asp Phe Gly Asn Glu Lys Leu 1 5 10 15 Gly Thr Gly Thr Arg Leu Thr lie lie Pro Asn lie GIn Asn 20 25 30 < 210 > 13 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 13 tacttctgtg cagcaatggg ggactttgga aatgagaaat taacctttgg gactgg agactcacca tcatacccaa tatccagaac 90 < 210 > 14 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 14 Tyr Phe Cys Wing Wing Met Gly Asp Phe Gly Asn Glu Lys Leu Thr Phe 1 5 10 15 Gly Thr Gly Thr Arg Leu Thr lie lie Pro Asn lie GIn Asn 20 25 30 < 210 > 15 < 2U > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 15 tacttctgtg cagcaatggg ggactttgga aatgagaaat taacctttgg gactggaaca agactcacca tcatacccaa tatccagaac 90 < 210 > 16 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 16 Tyr Phe Cys Ala Leu Ser Val Ala Gly Gly Thr Ser Tyr Gly Lys Leu 1. 5 10 15 Thr Phe Gly GIn Gly Thr Le Leu Thr Val His Pro Asn Me GIn Asn 20 25 30 < 210 > 17 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 17 tacttctgtg ctctgagcgt tgctggtggt actagctatg gaaagctgac atttggacaa i gggaccatct tgactgtcca tccaaatatc cagaac 96 < 210 > 18 < 211 > 33 < 212 > PRT < 213 > Homo sapiens < 400 > 18 Tyr Tyr Cys Leu Val Gly Asp Wing Val Arg Pro Gly Gly Gly Asn Lys 1 5 10 15 Leu Thr Phe Gly Thr Gly Thr Gln Leu Lys Val Glu Leu Asn lle Gln 20 25 30 Asn < 210 > 19 < 211 > 99 < 212 > DNA < 213 > Homo sapiens < 400 > 19 tactactgcc tcgtgggtga cgccgtgagg ccgggaggag gaaacaaact cacctttggg acaggcactc agctaaaagt ggaactcaat atccagaac 99 < 210 > 20 < 211 > 33 < 212 > PRT < 213 > Homo sapiens < 400 > 20 Tyr Tyr Cys Leu Val Gly Asp Wing Val Arg Pro Gly Gly Gly Asn Lys 1 5 10 15 Leu Thr Phe Gly Thr Gly Thr Gln Leu Lys Val Glu Leu Asn lle Gln 20 25 30 Asn < 210 > 21 < 211 > 99 < 212 > DNA < 213 > Homo sapiens < 400 > 21 tactactgcc tcgtgggtga cgccgtgagg ccgggaggag gaaacaaact cacctttggg acaggcactc agctaaaagt ggaactcaat atccagaac 99 < 210 > 22 < 211 > 29 < 212 > PRT < 213 > Homo sapiens < 400 > 22 Tyr Phe Cys Wing Thr Asp Wing Gly Gly Thr Tyr Lys Tyrle Phe Gly 1 5 10 15 Thr Gly Thr Arg Leu Lys Val Leu Wing Asn lle Gln Asn 20 25 < 210 > 23 < 211 > 87 < 212 > DNA < 213 > Homo sapiens < 400 > 23 tacttctgtg ctacggacgc aggaggaacc tacaaataca tctttggaac aggcaccagg ctgaaggttt tagcaaatat ccagaac 87 < 210 > 24 < 211 > 27 < 212 > PRT < 213 > Homo sapiens < 400 > 24 Tyr Tyr Cys Leu Val Gly Asp Asp Asp Met Arg Phe Gly Wing Gly 1 5 10 15 Thr Arg Leu Thr Val Lys Pro Asn lle Gln Asn 20 25 < 210 > 25 < 211 > 81 < 212 > DNA < 213 > Homo sapiens < 400 > 25 tactactgcc tcgtgggtga catcgatgac atgcgctttg gagcagggac cagactgaca gtaaaaccaa atatccagaa c 81 < 210 > 26 < 211 > 28 < 212 > PRT < 213 > Homo sapiens < 400 > 26 Tyr Phe Cys Wing Thr Ser Val Asn Thr Asp Lys Leu lie Phe Gly Thr 1 5 10 15 Gly Thr Arg Leu Gln Val Phe Pro Asn lie Gln Asn 20 25 < 210 > 27 < 211 > 84 < 212 > DNA < 213 > Homo sapiens < 400 > 27 tacttctgtg ctacatcggt taacaccgac aagctcatct ttgggactgg gaccagatta caagtctttc caaatatcca gaac 84 < 210 > 28 < 211 > 35 < 212 > PRT < 213 > Homo sapiens < 400 > 28 Tyr Phe Cys Wing Being Ser Gln Asp Arg Phe Trp Gly Gly Thr Val Asn 1 5 10 15 Thr Glu Wing Phe Phe Gly Gln Gly Thr Arg Leu Thr Val Val Glu Asp 20 25 30 Leu Asn Lys 35 < 210 > 29 < 211 > 105 < 212 > DNA < 213 > Homo sapiens < 400 > 29 tatttctgtg ccagcagcca agatcgtttt tgggggggga cggtgaacac tgaagctttc 60 tttggacaag gcaccagact cacagttgta gaggacctga acaag 105 < 210 > 30 < 211 > 28 < 212 > PRT < 213 > Homo sapiens < 400 > 30 Tyr Phe Cys Ala 'Being Ser Wing Met Gly Glu Thr Gln Tyr Phe Gly Pro 1 5 10 15 Gly Thr Arg Leu Leu Val Leu Glu Asp Leu Lys Asn 20 25 < 210 > 31 < 211 > 84 < 212 > DNA < 213 > Homo sapiens < 400 > 31 tatttctgtg ccagcagcgc tatgggagag acccagtact tcgggccagg cacgcggctc ctggtgctcg aggacctgaa aaac 84 < 210 > 32 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 32 Tyr Phe Cys Wing Being Ser Leu Gly Arg Wing Gly Leu Thr Tyr Glu Gln 1 5 10 15 Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 33 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 33 tacttctgtg ccagcagcct agggcgggcg ggactcacct acgagcagta cttcgggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 34 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 34 Tyr Phe Cys Wing Being Ser Leu Gly Arg Wing Gly Leu Thr Tyr Glu Gln 1 5 10 15 Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 35 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 35 tacttctgtg ccagcagcct agggcgggcg ggactcacct acgagcagta cttcgggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 36 < 211 > 31 < 212 > PRT < 213 > Homo sapiens < 400 > 36 Phe Cys Wing Being Ser Leu Gly Arg Wing Gly Leu Thr Tyr Glu Gln Tyr 1 5 10 15 Phe Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 37 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 37 tacttctgtg ccagcagcct agggcgggcg ggactcacct acgagcagta cttcgggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 38 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 38 Tyr Phe Cys Wing Being Ser Leu Gly Arg Wing Gly Leu Thr Tyr GIu GIn 1 5 10 15 Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr GIu Asp Leu Lys Asn 20 25 30 < 210 > 39 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 39 tacttctgtg ccagcagcct agggcgggcg ggactcacct acgagcagta cttcgggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 40 < 211 > 29 < 212 = > PRT < 213 > Homo sapiens < 400 > 40 Tyr Phe Cys Wing Being Ser Pro Thr Val Asn Tyr Gly Tyr Thr Phe Gly 1 5 10 15 Ser Gly Thr Arg Leu Thr Val Val Glu Asp Leu Asn Lys 20 25 < 210 > 41 < 211 > 87 < 212 > DNA < 213 > Homo sapiens < 400 > 41 tatttctgtg ccagcagccc gacagttaac tatggctaca ccttcggttc ggggaccagg 60 ttaaccgttg tagaggacct gaacaag 87 < 210 > 42 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 42 Tyr Phe Cys Wing Being Ser Tyr Ser lie Arg Gly GIn Gly Asn Glu GIn 1 5 10 15 Tyr Phe Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 43 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 43 tacttctgtg ccagcagtta ctcgattagg ggacagggta acgagcagta cttcgggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 44 < 211 > 32 < 212 > PRT < 213 > Homo sapiens < 400 > 44 Tyr Phe Cys Wing Being Ser Tyr Ser lie Arg Gly Gin Gly Asn Glu GIn 1 5 10 15 Tyr Phe Arg Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 <210 > 45 < 211 > 96 < 212 > DNA < 213 > Homo sapiens < 400 > 45 tacttctgtg ccagcagtta ctcgattagg ggacagggta acgagcagta cttccggccg ggcaccaggc tcacggtcac agaggacctg aaaaac 96 < 210 > 46 < 211 > 29 < 212 > PRT < 213 > Homo sapiens < 400 > 46 Tyr Leu Cys Wing Being Ser Gln Asp Arg Val Wing Pro Gln Tyr Phe Gly 1 5 10 15 Pro Gly Thr Arg Leu Leu Val Leu Glu Asp Leu Lys Asn 20 25 < 210 > 47 < 211 > 87 < 212 > DNA < 213 > Homo sapiens < 400 > 47 tatctctgtg ccagcagcca agatcgggtt gcgccacagt acttcgggcc aggcacgcgg 60 ctcctggtgc tcgaggacct gaaaaac 87 < 210 > 48 < 211 > 31 < 212 > PRT < 213 > Homo sapiens < 400 > 48 Tyr Leu Cys Wing Being Ser Thr Arg Gln Gly Pro Gln Glu Thr Gln Tyr 1 5 10 15 Phe Gly Pro Gly Thr Arg Leu Leu Val Leu Glu Asp Leu Lys Asn 20 25 30 < 210 > 49 < 211 > 93 < 212 > DNA < 213 > Homo sapiens < 400 > 49 tatctctgtg ccagtagtac ccggcaagga cctcaagaga cccagtactt cgggccaggc 60 acgcggctcc tggtgctcga ggacctgaaa aac 93 < 210 > 50 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 50 Tyr Leu Cys Wing Being Ser Leu Gly GIn Gly Wing Tyr Glu GIn Tyr Phe 1 5 10 15 Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 51 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 51 tatctctgtg ccagcagctt aggacagggg gcttacgagc agtacttcgg gccgggcacc aggctcacgg tcacagagga cctgaaaaac 90 < 210 > 52 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 52 Tyr Leu Cys Wing Being Ser Leu Gly Gln Gly Wing Tyr Glu Gln Tyr Phe 1 5 10 15 Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 53 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 53 tatctctgtg ccagcagctt aggacagggg gcttacgagc agtacttcgg gccgggcacc 60 aggctcacgg tcacagagga cctgaaaaac 90 < 210 > 54 < 211 > 30 < 212 > PRT < 213 > Homo sapiens < 400 > 54 Tyr Leu Cys Wing Being Ser Leu Gly Gln Gly Wing Tyr Glu Gln Tyr Phe 1 5 10 15 Gly Pro Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 30 < 210 > 55 < 211 > 90 < 212 > DNA < 213 > Homo sapiens < 400 > 55 tatctctgtg ccagcagctt aggacagggg gcttacgagc agtacttcgg gccgggcacc 60 aggctcacgg tcacagagga cctgaaaaac 90 < 210 > 56 < 211 > 29 < 212 > PRT < 213 > Homo sapiens < 400 > 56 Tyr Phe Cys Wing Being Ser Leu GIn Val Tyr Ser Pro Leu His Phe Gly 1 5 10 15 Asn Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Asn Lys 20 25 <210 > 57 < 211 > 87 < 212 > DNA < 213 > Homo sapiens < 400 > 57 tacttctgtg ccagcagttt acaagtgtat tcacccctcc actttgggaa cgggaccagg 60 ctcactgtga cagaggacct gaacaag 87 < 210 > 58 < 211 > 31 < 212 > PRT < 213 > Homo sapiens Tyr Phe Cys Ala lle Ser Glu Ser lle Gly Thr Gly Thr Glu Ala Phe 1 5 10 15 Phe Gly GIn Gly Thr Arg Leu Thr Val Val Glu Asp Leu Asn Lys 20 25 30 < 210 > 59 < 211 > 93 < 212 > DNA < 213 > Homo sapiens < 400 > 59 tacttctgtg ccatcagtga gtcgattggt acgggaactg aagctttctt tggacaaggc accagactca cagttgtaga ggacctgaac aag 93 < 210 > 60 < 211 > 31 < 212 > PRT < 213 > Homo sapiens < 400 > 60 Tyr Phe Cys Ala lle Ser Glu Ser lle Gly Thr Gly Thr Glu Ala Phe 1 5 10 15 Phe Gly GIn Gly Thr Arg Leu Thr Val Val Glu Asp Leu Asn Lys 20 25 30 < 210 > 61 < 211 > 93 < 212 > DNA < 213 > Homo sapiens < 400 > 61 tacttctgtg ccatcagtga gtcgattggt acgggaactg aagctttctt tggacaaggc 60 accagactca cagttgtaga ggacctgaac aag 93 < 210 > 62 < 211 > 28 < 212 > PRT < 213 > Homo sapiens < 400 > 62 Tyr Leu Cys Wing Ser Arg Asp Arg Ser Tyr Glu Gln Tyr Phe Gly Pro 1 5 10 15 Gly Thr Arg Leu Thr Val Thr Glu Asp Leu Lys Asn 20 25 < 210 > 63 < 211 > 84 < 212 > DNA < 213 > Homo sapiens < 400 > 63 tacctctgtg ccagccggga caggtcctac gagcagtact tcgggccggg caccaggctc acggtcacag aggacctgaa aaac 84 < 210 > 64 < 211 > 31 < 212 > PRT < 213 > Homo sapiens < 400 > 64 Tyr Phe Cys Ala lie Ser Glu Gly Ser Ser Gly Asn Thr lie Tyr 1 5 10 15 Phe Gly Glu Gly Ser Trp Leu Thr Val Val Glu Asp Leu Asn Lys 20 25 30 < 210 > 65 < 211 > 93 < 212 > DNA < 213 > Homo sapiens < 400 > 65 tacttctgtg ccatcagtga ggggtccagc tctggaaaca ccatatattt tggagaggga 60 agttggctca ctgttgtaga ggacctgaac aag 93 < 210 > 66 < 211 > 26 < 212 > PRT < 213 > Homo sapiens < 400 > 66 Phe Tyr lie Cys Ser Ala lie Asp Gly Tyr Thr Phe Gly Ser Gly Thr 1 5 10 15 Arg Leu Thr Val Val Glu Asp Leu Asn Lys 20 25 < 210 > 67 < 211 > 78 < 212 > DNA < 213 > Homo sapiens < 400 > 67 ttctacatct gcagtgctat agacggctac accttcggtt cggggaccag gttaaccgtt gtagaggacc tgaacaag 78 < 210 > 68 < 211 > 21 < 212 > DNA < 213 > Homo sapiens < 400 > 68 agcagccaag atcgtttttg g < 210 > 69 < 211 > 24 < 212 > DNA < 213 > Homo sapiens < 400 > 69 ctagggcggg cgggactcac ctac < 210 > 70 < 211 > 24 < 212 > DNA < 213 > Homo sapiens < 400 > 70 ctagggcggg cgggactcac ctac < 210 > 71 < 211 > 24 < 212 > DNA < 213 > Homo sapiens < 400 > 71 tactcgatta ggggacaggg taac < 210 > 72 < 211 > 18 < 212 > DNA < 213 > Homo sapiens < 400 > 72 caagatcggg ttgcgcca < 210 > 73 < 211 > 24 < 212 > DNA < 213 > Homo sapiens < 400 > 73 acccggcaag gacctcaaga gacc < 210 > 74 < 211 > 18 < 212 > DNA < 213 > Homo sapiens < 400 > 74 agcttaggac agggggct

Claims (1)

1. < 210 > 75 < 211 > 18 < 212 > DNA < 213 > Homo sapiens < 400 > 75 gccagccggg acaggtcc < 210 > 76 < 211 > 18 < 212 > DNA < 213 > Homo sapiens < 400 > 76 gagtagattg gtacggga < 210 > 77 < 211 > 21 < 212 > DNA < 213 > Homo sapiens < 400 > 77 tacatctgaa gtgctataga c NOVELTY OF THE INVENTION CLAIMS 1. - A peptide of 8 to about 45 amino acids in length, comprising the sequence of SEQ ID NO: 3. 2. The peptide according to claim 1, further characterized in that it is SEQ ID NO: 3. 3. - The peptide according to claim 1, further characterized in that it comprises amino acids 2-21 of SEQ ID NO: 32. 4. - The peptide according to claim 1, further characterized in that it consists of amino acids 2-21 of SEQ ID NO. : 32. The use of a peptide of any of claims 1 to 4, which is from 9 to about 45 amino acids in length, in the manufacture of a medicament for treating an autoimmune disease in a human. 6. The use as claimed in claim 5, wherein said autoimmune disease is associated with T cells MBP83-99? ß13.1 and wherein the sequence of the gene? ß13.1 is SEQ ID NO: 2. 7. - The use as claimed in claim 5, wherein said medicament further comprises a T cell activation marker peptide. 8. The use as claimed in claim 5, wherein the autoimmune disease is multiple sclerosis. 9. - A method for detecting MBP83-99? ß13.1 T cells expressing an LGRAGLTY motif, the method comprising: (a) obtaining a nucleic acid sample from MBP83-99 Vpi3.1 T cells; (b) contacting the nucleic acid sample with a selected primer pair or derivative from: (i) a first primer comprising an oligonucleotide of about 15 to 30 nucleotides in length and which comprises at least 10 contiguous nucleotides of SEQ ID NO: 1, or a sequence complementary thereto or derived therefrom; and (ii) a second primer comprising an oligonucleotide of about 15 to 30 nucleotides in length that does not comprise the sequence of (a) and is found in the region from Vp to Jp of the Vp13.1 gene in Vpi3 T cells. 1 (SEQ ID NO: 2), wherein the sequences of (a) and (b) are not in the same chain of the Vp13.1 gene; and (c) detecting the presence of the nucleic acid encoding the LGRAGLTY motif. 10. A pharmaceutical composition for treating an autoimmune disease comprising a peptide of 8 to about 45 amino acids in length, wherein said peptide comprises the sequence of SEQ ID NO: 3. 11. The pharmaceutical composition according to claim 10, further characterized in that the peptide is SEQ ID NO: 3. 12. The pharmaceutical composition according to claim 10, further characterized in that the peptide comprises amino acids 2-21 of SEQ. ID NO: 32. 13. - The pharmaceutical composition according to claim 10, further characterized in that the peptide consists of amino acids 2-21 of SEQ ID NO: 32.