MXPA02008827A - Method for treating retinal degeneration with purinergic receptor agonists. - Google Patents

Abstract

The present invention provides a method of preventing or treating retinal degeneration arising from pathophysiological or physical conditions. The method comprises administering to a patient a pharmaceutical composition comprising a purinergic P2Y receptor ligand, in an amount effective to elevate its extracellular concentration to activate retinal glial and neuronal cell surface P2Y receptors and mount a neuroprotective response. Methods of administering including intravitreal bolus and sustained administrations, transscleral delivery, topical, and systemic administrations. The pharmaceutical composition useful in this invention comprises a P2Y purinergic receptor agonist, which include uridine 5 di and triphosphate (UDP, UTP) and their analogs, adenosine 5 diphosphate (ADP) and its analogs, cytidine 5 di and triphosphate (CDP, CTP) and their analogs, and dinucleoside polyphosphate compounds.

Description

02. l & Z f- METHOD FOR TREATING RETINAL DEGENERATION WITH AGONISTS OF THE PURINERGIC RECEIVERS TECHNICAL FIELD The present invention relates to a method for protecting or delaying the cell death of retinal neurons by the administration of purinergic receptor agonists such as uridine 5'-di- and triphosphates, cytidine 5'-di- and triphosphates, polyphosphates of dinucleosides and their analogues.

BACKGROUND OF THE INVENTION The degeneration of retinal neurons is a debilitating condition and a leading cause of irreversible blindness worldwide (National Eye Institute, "Vision Research: A National Plan, 1994-1998"). Retinal degeneration is usually an end point of a variety of systemic and ocular diseases and environmental conditions. Degenerative retinopathies generally affect two populations of neuronal cells in the retina: photoreceptors and ganglion cells. The degeneration of photoreceptors and ganglionary cells can < * arise from neurodegenerative diseases (macular degeneration, glaucoma, reticulitis pigmentosa), optic nerve degeneration and optic neuritis, chronic metabolic diseases (proliferative diabetic retinopathy), exposure to neurotoxins, ischemia and physical trauma (Yanoff and Duker, "Ophthalmology", 8.1. 1-8.48.1; National Eye Institute, "Vision Research: A National Plan, 1994-1998").

Previous work has shown that subconjunctival injections of ATP in rabbits results in an increased ATP content in the choroid and retina (Dobromyslov et al., Clinical Conference of May 24, 1966). Dobromyslov et al. they also show that the subconjunctival injection of ATP reduces the loss of vision in patients suffering from maculodystrophy, pigmentary dystrophy, complicated myopia and very advanced glaucoma. . { Vestn Of tamol. January February; 24-6, 1969). Dobromyslov et al. propose that a direct composition or stock of energy reserves occurs in the subconjunctival administration of ATP because of the rapid decomposition of ATP in the retina. The authors postulate that the increase in total ATP levels in the retina improves the metabolic support of photoreceptors 5 because rhodopsin hydrolyses ATP, and ATP They have a well-known function as an energy source in the cell. At present, subconjunctival injection of ATP is not used for the treatment of retinal dystrophy.

To date, methods to treat retinal degeneration are aimed at activating growth factor receptors, such as glia-derived neurotrophic factor (GDNF), ciliary neurotrophic factor (CNTF), and brain-derived neurotrophic factor (BDNF) (Louis , US Patent No. 5,664,150; La Vail., Et al., US Patent No. 5,667,968). The receptor systems employed by these signaling proteins, GDNF, CNTF and BDNF, are from a class of receptors different from the P2Y receptor family. Currently, these treatments have not been developed for use in the clinic.

Previous work has demonstrated the presence of P2Y receptors in the glial and neuronal cells of the mature nervous system (Abbracchio and Burnstock, Jpn J Pharmacol, 78: 113-45, 1998). P2Y receptors belong to a class of G-protein coupled receptors (GPCRs) that activate a variety of intracellular signaling pathways. Although the characteristics of Signaling of P2Y receptors in many cell types are well known, the physiological functions of P2Y receptors in the nervous system are not well characterized. In the central, peripheral and sensory nervous systems, activation of P2Y receptors profoundly affects glia, a type of cell that plays an important role in the development, function and survival of the nervous system. Previous work has suggested a function for P2Y receptors in neurotransmission, neuronal to glial cell-cell signaling, alterations of gene expression, neuritogenesis and interactions with growth factors in an additive or synergistic manner (Abbracchio and Burnstock, Jpn J Pharmacol, 78: 113-45, 1998).

Glial cells in mature nervous systems provide trophic support to neurons and are therefore a viable cellular target for effecting neuronal conservation and survival in a variety of neurodegenerative conditions. The Müller cells, the astrocytes and the retinal pigment epithelium are three types of glial cells in the retina. These form a network of support cells around the neurons, and this close anatomical proximity is what gives the glial cells the ability to maintain the survival and protection of neurons. Glial cells provide mechanical support, clean debris after neuronal death and injury; they provide insulating sheaths for the electrical conduction of nerve impulses; they buffer the extracellular, metabolic, ionic composition of neurotransmitters and fluids; control the excess growth of neurons after damage and death; and provide trophic support for neurons under normal and pathological conditions (Kandel and Schwartz Principies of Neuroscience, 1979, 2nd edition, Elsevier, New York, 1985). Under conditions of neurological stress and disease, the extracellular environment surrounding neurons and glia is drastically disrupted, and glial cells contain a broad array of receptors that can integrate this plurality of external stimuli to install an appropriate adaptive response (Kandel and Schwartz , Supra). Adenosine 5'-triphosphate (ATP) is a ubiquitous source of cellular energy and is normally contained within cells or can be released extracellularly under regulated conditions (Ralevic and Burnstock, Pharmacol, Rev. 50: 413-92, 1998). However, under pathological neurological conditions, it is believed that ATP is released in an unregulated capacity from damaged cells and subsequently it can activate ATP receptors of the cell surface in the glia (Abbracchio and Burnstock, Jpn J Pharmacol, 78: 113-45, 1998). The subtype of P2Y nucleotide receptors found in the glia responds to extracellular nucleotides by the activation of a variety of intracellular signaling pathways and enables activated glial cells to respond to stress and implicit neuronal damage (Abbracchio and Burnstock, Jpn J Pharmacol, 78: 113-45, 1998).

It has been shown that uridine 5'-triphosphate (UTP) and ATP activate P2Y subtypes of purinergic receptors in multiple glial cells of the central nervous, peripheral and sensory systems including oligodendrocytes, astrocytes, Müller cells, epithelium retinal pigmentary and resident macrophages (Abbracchio and Burnstock, Jpn J Pharmacol, 78: 113-45, 1998, Kirischuk et al., J Physiol (Lond), 483: 41-57, 1995, Liu and Wakakura, Jpn J Ophthalmol, 42: 33-40, 1998, Lyons et al., J Neurochem, 63: 552-60, 1994, Neary and Zhu, Neuroreport, 5: 1617-20, 1994, Peterson et al., J Neurosci 17: 2324-37, 1997. ). It has been shown that mild mechanical forces stimulate the release of ATP from the retina, which could be signaled through the P2Y receptors in the -V neuronal cells and retinal glial cells (Jensen, IOVS (suppl.), 40: 1237, 1999). Activation of P2Y receptors in glial cells causes concomitant stimulation of the release of phospholipase C and Ca from the intracellular reserves and activation of the intracellular ras-MAPK pathway (mitogen-activated protein kinase), which are linked to the differentiation and cell survival (Indestrup and Salter, Neuroscience, 86: 913-23, 1998, Neary et al., J Neurosci, 19: 4211-20, 1999, Segal and Greenberg, Annu Rev Neurosci, 19: 463-89, 1996). Stimulation of DNA synthesis and cell proliferation by purines have been observed in primary astrocytes and astrocytoma cells (Neary et al., J Neurochem, 63: 2021-7, 1994; Neary et al., J Neurochem, 63 : 490-4, 1994; Rathbone et al., In Vi tro Cell Dev Biol, 28A: 529-36, 1992). ATP leads to the induction of a variety of intracellular signaling pathways linked to mitogenic activity, which include the stimulation of immediate early genes such as c-fos and c-jun, the binding of the transcriptional activating protein-1 complex ( AP-1) to DNA, and the activation of protein kinase regulated by extracellular signals (Bolego et al., Br J Pharmacol, 121: 1692-9, 1997; Chen and Sun, Neuroschem Res. , 23: 543-50, 1998; Priller et al., Neuroscience, 85: 521-5, 1998; Wu and 8 '^ - Mf' col., Mol Pharmacol, 53: 346, 1998). '. In the nervous system, the glia-specific activation of the AP-1 complex, the immediate early genes and the ras-MAPK pathway are associated with a primary response of the glial cells to the disturbance and trauma that arise from the environment and genetic etiologies (Segal and Greenberg, Annu Rev Neurosci, 19: 463-89, 1996). It is thought that activation of these intracellular signaling pathways in glial cells represents an adaptive response to neuronal stress or tension and enables the glia to mount a neuroprotective response to provide trophic conditioning to neurons of injury and subsequent damage (Segal and Greenberg, Annu Rev Neurosci, 19: 463-89, 1996).

Glia often undergoes phenotypic changes in response to stress and injury, which include proliferation and hypertrophy in a process known as reactive gliosis, which involves activation (upregulation) of the fibrillar acid protein of the glia (GFAP) and elongation of the gliotic processes (Eddleston and Mucke, Neuroscience, 54: 15-30, 1993; Hatten et al., Glia, 4: 233-43, 1991; Bidet et al., Trends Neurosci, 20: 570-7, 1997). Recent studies showed that reactive astrocytes, positive for GFAP, are required to protect i aiamíi? á á á á á neurons with extensive cell death in a model of mechanical injury of neuronal degeneration in the central nervous system (Bush et al., Neuron, 23: 297-308, 1999). It has been shown that ATP increases the expression of GFAP in rat cerebral cortical astrocytes and prolongs astrocytic processes (Abbracchio et al., Int J Dev Neurosci, 13: 685-93, 1995). Similar effects are observed for growth factors such as basic fibroblast growth factor and ciliary neurotrophic factor which, as shown, confer neuroprotection in a variety of neurodegeneration models in animals (Segal and Greenberg, Annu Rev Neurosci, 19: 463 -89, 1996).

The following references describe the compositions of the P2Y receptor agonists and / or the treatment of diseases of the eyes. USPN 5,900,407 (Yerxa, et al) discloses a method for the stimulation of tear secretion in an individual in need of treatment. The method consists of the administration, on the ocular surface of the individual, of an agonist of the purinergic receptors, such as uridine 5-triphosphate, cytidine 5-triphosphate, adenosine 5-triphosphate, or their analogs and derivatives, in an amount effective to stimulate the secretion of the fluid tear USPN 5,837,861 (Pendergast, et al) describes the P2Y2 purinergic receptors of the dinucleotide polyphosphates having the structure of formula I, wherein X is oxygen, methylene or difluromethylene; n = 0 or 1; m = 0 or 1; n + m = 0, 1 or 2; and B and B 'are each, independently, a purine residue or a pyrimidine residue bound by the 9 or 1 position. The compounds are useful in the treatment of chronic obstructive pulmonary diseases, bronchitis, certain pneumonias, cystic fibrosis, sinusitis and otitis half. USPN 5,763,447 is directed to a method for the prevention and treatment of pneumonia, which includes pneumonia associated with ventilation, in an individual bedridden or immobilized in need of such treatment. The method consists of administering to the patient's airways a purinergic receptor such as uridine 5 '-triphosphate (UTP), P1, P4-di (uridine-5') tetraphosphate, or its analogues, in an amount effective to promote drainage of fluid in the congested airways. WO 99/09998 discloses a method of using uridine 5'-diphosphate and analogs thereof to treat a lung disease. The compounds described in the above references (patents 07,? 861 and 47 and WO 99/09998), which have activity with purinergic receptors, are incorporated herein by reference. Boyer and col., (Br. J. Pharmacol. 118: 1959 (1996)) synthesized and produced a series of extended chain 2-thioether adenosine monophosphate (AMP) derivatives as agonists for the activation of P2Y receptors bound to phospholipase C turkey erythrocyte membranes, P2Y receptors bound to adenylyl cyclase from C6 rat glioma cells, and the human P2U receptor, cloned, stably expressed in human astrocytoma cells 1321 NI.

Useful methods in the treatment of retinal degenerations would be convenient. Such a treatment could prevent or reduce the rate of retinal degeneration from multiple sources. Based on the cellular localization of the P2Y receptors in the retina and the signaling pathways of P2Y receptors, we were motivated to explore the usefulness of P2Y receptor agonists for the development of a treatment like this.

COMPENDIUM OF THE INVENTION The present invention provides a method for the prevention or treatment of retinal degeneration, wherein retinal degeneration originates from conditions physical or pathophysiological. The method consists in administering to a patient a pharmaceutical composition containing a ligand of P2Y receptors in an amount effective to activate the P2Y receptors on the cell surface of neuronal and glial cells of the retina to mount a neuroprotective response. Methods of administration include intravitreal boluses and sustained administrations, transscleral delivery, topical, oral and systemic administrations, and intraoperative administration.

The pharmaceutical compositions useful in this invention comprise P2Y receptor agonists. P2Y agonists activate Ca 2+ signaling, mitogen-activated protein kinase signaling and glial fibrillary acidic protein expression in glial cells of the retina. P2Y agonists include uridine 5-di'- and triphosphate (UDP, UTP) and its analogs (formulas la and Ib), 5 '-adenosine monophosphate (AMP) and its analogs, adenosine 5'-di and triphosphate (ADP, ATP ) and its analogues (formulas lia and Ilb) and cytidine 5 '-di- and triphosphate (CDP, CTP) and their analogs (formulas Illa and Illb). P2Y agonists also include dinucleoside polyphosphate compounds of general formula (IV). l ^ tik & ^ The compounds of the present invention are selective agonists of P2Y receptors. These are useful in the treatment of neuronal degeneration in the retina, in which retinal or photoreceptor glangionary cells are susceptible to death as a result of physical or disease conditions, including (but not limited to) dry and exudative macular degeneration. age-related, Stargardt's disease, Best's disease and cystoid macular edema, glaucoma, retinitis pigmentosa, retinal detachment, uveitis, phytic damage, surgical and traumatic damage, degeneration of the retina induced by toxins, bacteria and viruses.

BRIEF DESCRIPTION OF THE FIGURES Figure 1: Location in si tu of the P2Y2 mRNA in the adult rabbit retina by DIG labeling of the antisense probe (left) and sense probe (right).

Figure 2: Location in si tu of P2Y2 mRNA in monkey retina by DIG labeling of the antisense probe (left) and sense probe (right). £ 2-5 ^ --a ™ ¡k ¡Jü ^ Figure 3: Effects of dCP4U, IP4U, BDNF and vehicle (Veh) on scotopic B wave amplitudes of ERG records made at half illumination (24 dB). The concentration and duration between injection and bright light exposure for each compound are shown above in each pair of bar graphs. Before treatment, the ERG records of each eye in each experimental cohort showed no difference in B wave amplitudes between the pretreated eyes (upper frame). After 2 weeks of exposure for 84 hours in bright light, the eyes of the cohorts treated with dCP4U (1 mM, 16 h, 10 mM, 16 h, and 10 M, 48 h), IP4U (10 mM, 48 h ), and BDNF (0.5 μg, 48 h) showed higher B wave amplitudes than untreated contralateral eyes. No differences were observed between the eyes with vehicle and those not treated in the cohort treated with the vehicle.

Figure 4: Effects of dCP4U, IP4U, BDNF and Veh on the scotopic B wave amplitudes from the ERG records made with bright illumination (0 dB).

Figure 5: Effects of dCP4U, IP4U, BDNF and Veh on the amplitudes of the scotopic A wave from the ERG records made with bright illumination (0 dB). • v » Figure 6: Effect of dCP4U, IP4U, BDNF and Veh on the histological parameters of the outer nuclear layer thickness and outer / inner segment thickness in the lower hemisphere two weeks after exposure for 84 hours in bright light. In general, all eyes treated, grouped by cohort (dCP4U, IP4U and BDNF) showed larger histological parameters than untreated eyes for each cohort. No effects of the vehicle were observed on these histological parameters.

Figure 7: Effects of dCP4U, IP4U, BDNF and Veh on the histological parameters of the outer layer thickness and the thickness of the inner / outer segment in the lower hemisphere, two weeks after exposure for 84 hours in bright light. In general, all treated eyes grouped by cohort (dCP4U, IP4U and BDNF) showed larger histological parameters than untreated eyes for each cohort. However, similar effects were observed in vehicle treatment.

Abbreviations: RPE, retinal pigment epithelium; OS, external segments; IS, internal segments; ONL, outer nuclear layer; INL, internal nuclear layer; IPL, internal plexiform layer; GCL, ganglion cell layer. HE observed considerable labeling in the RPE and GCL layers of rabbits and monkeys, and additional labeling was observed in the IS layer of monkeys.

DETAILED DESCRIPTION OF THE INVENTION The invention relates to a method for treating retinal degeneration by providing neuroprotection in the retina. The method consists in administering to a mammal a pharmaceutical composition comprising an effective therapeutic amount of ligands of the P2Y receptors. The "effective therapeutic amount" as used herein means an amount effective to treat retinal degeneration, which is an effective amount to reverse, stop or retard the degeneration of retinal neurons, or to provide protection to retinal neurons against further damage. and degeneration. The preferred method targets neurons and retinal glia to produce an adaptive response for the activation of P2Y2 receptors, which is a subtype of the P2Y family of receptors, and thus signal a neuroprotective response in the retina. The method delivers to a mammal an effective amount of P2Y receptor agonists such that the extracellular concentration of the agonist is sufficient to activate the P2Y receptors on the cell surface in the retina.

Degenerations of the retina subject to the treatment disclosed in this invention include degenerative diseases of the retina that result in injury or death of retinal neurons, such as photoreceptors and retinal ganglion cells. Degenerative diseases of the retina include inherited, acquired and degenerative diseases of the retina, induced by inflammation. Degenerative diseases of the inherited retina include, for example, all forms of macular degeneration such as age-related dry and exudative macular degeneration, Stargardt's disease, Best's disease, glaucoma, retinitis pigmentosa, and optic nerve degeneration. Acquired degenerative diseases of the retina, for example, are caused by cystoid macular edema, detachment of the retina, phytic damage, ischemic retinopathies due to venous or arterial occlusion or other vascular disorders, retinopathies due to trauma, surgery, or penetrating injuries of the eye, and peripheral vitretinopathy. Degenerative diseases of the retina induced by inflammation are caused, for example, by retinal degeneration induced by viruses, bacteria and toxins, or uveitis, They can lead to optic neuritis. This invention also provides a method for protecting retinal neurons against damage resulting from post-surgical trauma and complications from further exposure to harmful bright light in a protective mode. The method can also be used in conjunction with other therapeutic modalities to treat degenerations of the retina including, but not limited to, the administration of growth factors, neurotrophins, cytokines, ribozymes, anti-inflammatory agents, antibiotics, antiviral agents and gene therapy.

This invention proposes that P2Y2 receptors are located in multiple cell types in the retina, and are densely expressed in retinal ganglion cells, astrocytes, Müller cells, photoreceptors and the retinal pigment epithelium. Applicants believe that activation of P2Y receptors in Müller cells causes activation and upregulation of glial fibrillary acidic protein (GFAP) throughout all the radial processes of Muller's cells, which plays an important role in the protection induced by the P2Y2 receptors observed from the neurons of the retina.

This invention provides a method for using a pharmaceutical composition comprising p2Y receptor agonists for the treatment of a variety of retinopathies. P2Y agonists include nucleoside mono-, di-, and triphosphates and dinucleoside polyphosphates. The nucleoside monophosphate useful in this invention includes adenosine 5'-monophosphate (AMP) and its derivatives, such as AMP substituted with 2-thioether, for example, 2-hexylthio AMP (Br. J. Pharma col. 118: 1959 (1996) ). The nucleoside di- and triphosphates useful in this application include uridine 5'-di and triphosphate (UDP and UTP) and their analogues of the general formulas la and Ib; adenosine 5-di- and triphosphate (ADP and ATP) and their analogs of the general formulas lia and Ilb; and cytosine 5'-di and triphosphate (CDP and CTP) and their analogs of the general formulas Illa and Illb, and dinucleoside polyphosphates of the general formula IV.

The UDP and its analogs are represented by the formula: v. * "J * 20 Formula the where; Xi and X2 are each independently O "or S" And it is H or OH; R is selected from the group consisting of O, i, o, methylene and dihalomethylene (e.g., dichloromethylene, difluoromethylene); R2 is selected from the group consisting of H, halogen, alkyl, substituted alkyl, alkoxy and azido; R3 is selected from the group consisting of nothing, H, alkyl, acyl (which includes arylacyl) and arylalkyl; Y R 4 is selected from the group consisting of -OR ', -SR' and N'RR ", wherein R 'and R" are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxy and aryloxy, and with the proviso that R 'is not present when R4 has a double bond of an oxygen atom or sulfur to the carbon in the 4-position of the pyrimidine ring.

As used herein, the term "alkyl" refers to C? _ Or even linear, branched or cyclic, saturated or unsaturated (i.e. alkenyl and alkynyl) hydrocarbon chains, eg, methyl groups, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, octyl, ethenyl, propenyl, butenyl, pentenyl, hexenyl, octenyl, butadienyl, propinyl, butenyl, pentynyl, hexinyl, heptyl, allyl and arylalkenyl and arylalkynyl groups optionally substituted. As used herein, the term "acyl" refers to an organic acid group wherein the -OH of the carboxyl group has been substituted with another substituent (ie, as represented by RCO-, where R is a group alkyl or an aryl group). As such, the term "acyl" specifically includes aryl acyl groups. The examples specific to the acyl groups include acetyl and benzoyl. As used herein, the term "aryl" refers to heterocyclic aromatic rings and 5- and 6-membered hydrocarbons. Examples of aryl groups include cyclopentadienyl, phenyl, furan, thiophene, pyrrole, pyran, pyridine, imidazole, isothiazole, isoxazole, pyrazole, pyrazine, pyrimidine, and the like. The term "alkoxide" as used herein refers to C? ~ Ox or even linear, branched or cyclic, saturated or unsaturated oxo hydrocarbon chains including, for example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, p-butoxy and pentoxy. The term "aploxyl" as used herein refers to aryloxy as phenyloxyl, and aryloxy substituted with alkyl, halo or alkoxy. As used herein, the terms "substituted alkyl" and "substituted aryl" include alkyl and aryl groups, as defined herein, in which one or more atoms or functional groups of the aryl or alkyl group are substituted with another atom or functional group, for example, halogen, aryl, alkyl, alkoxy, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate and mercapto. The terms "halo" "halide" or "halogen" as used herein refers to fluorine, chlorine, bromine and iodine groups. f 23 Illustrative compounds of the compounds of Formula (la) include those described in WO 99/09998; which is incorporated herein by reference. Compounds of the formula la, for example, include: uridine 5'-diphosphate (UDP); Uridine 5 '-0- (2-thiodiphosphate) (UDPßS); 5-bromouridine 5'-diphosphate (5-BrUDP); 5- (1-phenylethynyl) -uridine 5'-diphosphate (5- (1-phenylethynyl) UDP); 5-methyluridine 5 '-diphosphate (5-methylUDP); 4-hexylthiouridine 5'-diphosphate (4-hexylthioUDP); 4-mercaptouridine 5'-diphosphate (4-mercaptoUDP); 4-methoxyuridine 5'-diphosphate (4-methoxyUDP); 4- (N-morpholino) uridine 5'-diphosphate ((N-morpholino) UDP; 4-hexyloxyuridine 5'-diphosphate (4-hexyloxyUDP); N, N-dimethylcytidine 5'-diphosphate (N, N-dimethylCDP); N-hexylcytidine 5'-diphosphate (N-hexylCDP); and N-cyclopentylcytidine 5'-diphosphate (N-cyclopentylCDP).

Preferred compounds of Formula include UDP and UDPβS and 4-thioUDP. Certain compounds of the Formula la (e.g., UDP dUDP, UDPßS and 4-mercaptoUDP) are known and can be prepared according to known methods or variations thereof, which will be apparent to those skilled in the art. For example, the identification and preparation of certain nucleoside diphosphate thiophosphate analogs (such as UTP-β S) are mentioned in US Patent No. 3,846,402 (Eckstein, et al.) And in R. S. Goody and F. Eckstein, J. Am. Chem. Soc. 93: 6252-6257 (1971). Otherwise, UDP, and other analogues thereof, are also available from suppliers such as Sigma (St. Louis, MO) and Pharmacia (Uppsala, Sweden).

The UTP and its analogues are represented by the general formula Ib; Formula Ib where : Xi, X2 and X3 are each independently O or S And it is H or OH; Ri. R2. R3 and R4 are defined as in the formula la.

Preferably, X2 and X3 are 0 ~, Ri is oxygen or I2, and R2 is H. Particularly preferred compounds of the formula Ib include uridine 5'-triphosphate (UTP) and uridine 5 '-0- (3-thiotriphosphate) (UTP? S).

The ADP and its analogues are represented by the general formula lia: Formula lia where : Rl, Xi, X2 and Y are defined as in Formula la; Z is H; Cl or SR, wherein R is alkyl (C1-C20, saturated or unsaturated); «To í 26 *" V R3 and R4 are H while R2 is nothing and there is a double bond between N-1 and C-6 (adenine), or R3 and R4 are H, while R2 is nothing and Z is SR, or R3 and R4 are H, while R2 is 0 and there is a double bond between N-1 and C-6 (adenine 1-oxide), or R3, R4 and R2 taken together are -CH = CH-, forming a ring from N-6 to N-l with a double bond between N-6 and C-6 (1, N6-ethenoadenine).

Particularly preferred compounds of Formula Ia include 5'-adenosine diphosphate (ADP) and 2-methyl-SADP.

The ATP and its analogues are represented by the general Formula I lb: where: Ri, Xi, X2 and Y are defined as in Formula Ib, and R2, R3, R4 and Z are defined as in the Formula bundle.

The CDP and its analogues are represented by the Illa general formula: Formula Illa where : Rl, Xi, X2 and Y are defined as in Formula la; 20 R5 and Rβ are H, while R7 is nothing and there is a double bond between N-3 and C-4 (cytosine) or R5, Rβ and R7 taken together are -CH = CH-, forming a ring of N-3 to N-4 with a double bond between N-4 and C-4 (3, N -etenocytosine), optionally the hydrogen of the 4 or 5 position of the ethene ring is substituted with alkyl, substituted alkyl, aryl, substituted aryl (heteroaryl, etc.), alkoxy, nitro, halogen or azido.

The CTP and its analogues are represented by the general Illb formula: Formula IIIb where : Ri, Xi, X2 and Y are defined as in Formula Ib, and R5, R6 and R7 are defined as in the Illa Formula, Preferred compounds of Formula Illb include cytidine 5'-triphosphate (CTP) and 4-n-trophenyl ethenocytidine 5'-triphosphate.

For simplicity, Formula I, II and III herein illustrate the active compounds found in nature in the D configuration, but 1" * the present invention also includes compounds with the L configuration, and mixtures of compounds with the D and L configurations, unless otherwise specified. The D configuration found in nature is preferred.

The dinucleoside polyphosphates are represented by the general Formula IV: where : X is oxygen, methylene, difluoromethylene, imido; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3 or 4; B and B 'are each independently a purine residue or a pyrimidine residue attached by the 9 or 1 position, respectively; Z = OH or N3, Z '= OH or N3; Y = H or OH; and Y '= H U OH.

The ribosyl moieties are in the D configuration, as shown, but they can be L or D and L-. D configuration is preferred A preferred compound of formula IV includes Formula IVa: Formula IVa where : X = O; n + m = 1 or 2; Z, Z ', Y and Y' = OH B and B 'are uracil, thymine, cytosine, guanine, adenine, xanthine, hypoxanthine or as defined in Formulas V and VI; or X = O; n + m = 3 or 4; Z, Z ', Y and Y' = OH B = uracil; B 'is uracil, thymine, cytosine, guanine, adenine, xanthine, hypoxanthine or as defined in formulas V and VI; or X = 0; n + m = 1 or 2; Z, Y and Z '= OH; Y '= H; B = uracil; B 'is uracil, thymine, cytosine, guanine, adenine, xanthine, hypoxanthine or as defined in Formulas V and THAT? ? i.ttl i? .m? iÉ ^^ 32 i C * -. * S I; or X = O; N + m = 0, 1 or Z and Y = OH; Z '= N3; Y '= H B = uracil; B 'is thymine; or X = 0; n + m = 0, 1 or 2; Z and Z '= N3; Y and Y '= = H B and B' = ti ina; or X = CH2, CF2 or NH; n and m = 1; Z, Z ', Y and Y' = OH; B and B 'are uracil, thymine, cytosine, guanine, adamine, xanthine, hypoxanthine or as defined in Formulas V and VI; i MeMMITIoN? i iiiiii? iigf ^ i¡J.Mr. ^ iaMrÉMr? ii ?? iMii? .. i.a.Éi ^? É. l Formula V where Ri is hydrogen, C? _8 alkyl, C3_6 cycloalkyl, phenyl or phenyloxy; wherein at least one hydrogen of the Ci-s alkyl, phenyl, phenyloxy, is optionally substituted with a portion selected from the group consisting of: halogen, hydroxy, C? _4 alkoxy, C? _4 alkyl, C? io, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulphonic acid, amino, C? _4 alkylamino, C? _4 di-alkylamino, wherein the alkyl groups are optionally attached to form a heterocycle,? -A ( alkyl) CONH (alkyl) - and? - A (alkyl) NHCO (alkyl) -, wherein A is amino, mercapto, hydroxy or carboxyl; R2 is O, or is not present; or R1 and R2 taken together form a 5-membered fused imidazole ring, optionally substituted at the 4 or 5 positions of the ethene moiety with C1-4 alkyl, phenyl or phenyloxy, wherein at least one C1- alkyl hydrogen 4, phenyl, phenyloxy, is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C 1-4 alkoxy, C 1-4 alkyl, Cd-io aryl, C 7-12 arylalkyl, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulfonic acid, amino, C 1-4 alkylammo, and dialkylamino of C? _4, wherein the dialkyl groups are optionally attached to form a heterocycle; Y R3 is hydrogen, NH2, C1-8 alkyl, C3-6 cycloalkyl, phenyl; or phenyloxy; wherein at least one hydrogen of the NH 2, C 8 alkyl, phenyl or phenyloxy, is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C 1-4 alkyl, Cg-1 aryl, C 7 alkylaryl , C 1-4 alkoxy, C 7-12 arylalkyloxy, C 1 4 alkylthio, phenylthio, C 7-12 aralkylthio, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulfonic acid, amino, C 1 alkylamino 4, phenylamino, arylalkylamino of C7-12, di-alkylamino of C? _4, wherein the dialkyl groups are optionally attached 1 ll ll nuil. ?????. iÉ ??? to form a heterocycle,? -A (alkyl) CONH (alkyl) B- and? -A (alk?) NHCO (alkyl) B-, where A and B are independently amino, mercapto, hydroxy or carboxyl.

Substituted adenine derivatives (formula V) include adenine 1-oxide; 1-N6- (ethene substituted in the 4 or 5 position) adenine; adenine substituted at position 6; or aminoadenine substituted at the 8-position, [6-aminohexyl] carbamoylmethyl-adenine; and amine (hydroxy, thiol and carboxy) (C2-10 alkyl) -adenine-acylated, wherein the acyl group is selected from, but not limited to, acetyl, trifluoroacetyl, benzoyl, substituted benzoyl, etc., or the carboxylic moiety is present as its ester or amide derivative, for example, the ethyl or methyl ester or its methyl, ethyl or benzamido derivative.

B and B 'can also be a pyrimidine with the general formula of Formula VI, linked through position 1 to the ribosyl residue: Formula VI where: R 4 is hydrogen, hydroxy, mercapto, amino, cyano, C 7-12 arylalkoxy, Cilt _g alkylthio, Ci-e alkoxy, C? _ Alqu alkylamino or C-4-4 di-dialkylamino, wherein the alkyl groups are optionally joined to form a heterocycle; R 5 is hydrogen, acetyl, benzoyl, C 1-6 alkyl, phenyloxy, C? _5 alkanoyl, aroyl or sulfonate; Rβ is hydroxy, mercapto, C -4 alkoxy, C7-12 arylalkoxy, C? _6 alkylthio, amino, S-phenyl, C1-5 disubstituted amino, triazolyl, C1-6 alkylamino, or dialkylamino of C? wherein the dialkyl groups are optionally attached to form a heterocycle or attached to N to form a substituted ring; Rs and Rd taken together form a fused, 5-membered imidazole ring, enters positions 3 and 4 of the pyrimidine ring and forms a 3, N -tetocytosine derivative, wherein the ethene portion is optionally substituted at positions 4 or 5 with alkyl of C? _4, phenyl or phenyloxy; wherein at least one hydrogen of the C 1-4 alkyl, phenyl or phenyloxy is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C 1-4 alkoxy, C 1-4 alkyl, C 6? 0 aryl, C7-.12 arylalkyl, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulfonic acid, amino, C? _4 alkylamino and C 1-4 dialkylamino, wherein the di-alkyl groups are optionally attached to form a heterocycle; R7 is hydrogen, hydroxy, cyano, nitro or C2-8 alkenyl; wherein the alkenyl portion is optionally attached through an oxygen to form a ring, wherein at least one hydrogen of the alkenyl portion on the carbon adjacent to the oxygen is optionally substituted with C 1-6 alkyl, phenyl, C 2- alkynyl Substituted, halogen, substituted C 1-4 alkyl, CF 3, C 2-3 alkenyl, C 2-3 alkynyl, allylamino, bromovinyl, ethylpropenoate or propenoic acid; or R6 and R7 together form a saturated or unsaturated ring of 5 or 6 members linked through N 0 to R 6, the ring optionally containing substituents which themselves contain functionalities; provided that when Rs is amino or substituted amino, R7 is hydrogen; Y Rs is hydrogen, amino or dialkylamino of C 1-4, alkoxy of C 1-4, arylalkoxy of C7-12, alkylthio of C 1-4, arylalkylthio of C7-12, carboxamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy or phenylthio.

In the general structure of the above Formulas I, II, III, V and VI, dotted lines in positions 2 to 6 are proposed to indicate the presence of a single or double bond in these positions; the relative positions of the double or single bonds are determined depending on whether the substituents R4, R5 and R? they are capable of keto-enol tautomerism.

In the general structurals of Formula V and VI above, the acyl groups comprise alkanoyl or aroyl groups. The acyl groups contain 1 to 8 carbon atoms, particularly 1 to 4 carbon atoms optionally substituted by one or more appropriate substituents, as described below. The groups aryl, including the aryl portions of these groups such as aryloxy are preferably phenyl groups optionally substituted by one or more suitable substituents, as described below. The aforementioned alkenyl and alkynyl groups contain 2 to 8 carbon atoms, particularly 2 to 6 carbon atoms, for example, ethenyl or ethynyl, optionally substituted by one or more appropriate substituents as described below.

Suitable substituents in the aforementioned alkyl, alkenyl, alkynyl and aryl groups are selected from halogen, hydroxy, C? _4 alkoxy, C? -4 -4 alkyl, Cg-12 aryl, C6-12 ar arylalkoxy, carboxy, cyano , nitro, sulfonamido, sulfonato, phosphate, sulphonic, amino and substituted amino; wherein the amino is simply or doubly substituted by an alkyl of C? _4, and when it is doubly substituted, the alkyl groups are optionally attached to form a heterocycle.

The preferred dinucleoside polyphosphate compounds useful in this invention are P, P-di (uridine-5 ') -tetraphosphate of dUP4U, U2P3, U2P, dCP4U, CP4U, IP5I, AP4A, CP3U, UP3A and A2P3.

? J 40 Some compounds of Formula I, II and III can be prepared by methods known to those skilled in the art; some compounds are available commercially, for example, from Sigma Chemical Co. (St. Louis, MO 63178). The compounds of the Formula (UDP and its analogs) can be prepared according to WO 99/09998. The compounds of Formulas Ib, Ilb and Illb (UTP, ATP, CTP and their analogues) can be prepared according to USP 5,763,447. The compounds of Formula IV can also be prepared according to the known procedures described by Zamecnik et al., Proc. Na ti. Acad. Sci. USA 89, 838-42 (1981); and Ng and Orgel, Nucleic Acids Res. 15: 3572-80 (1987), Pendergast et al., USPN 5,837,861, or variations thereof.

The compounds of the present invention also include their non-toxic pharmaceutically acceptable salts, such as, but not limited to, an alkali metal salt such as sodium or potassium; an alkaline earth metal salt such as manganese, magnesium or calcium; or a tetralkylammonium or ammonium salt, that is, NX4 (where X is C? _4). The pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects. The present invention also . j? * -.- 41 includes acylated prodrugs of the compounds described herein. Those skilled in the art will know some synthetic methods that can be employed to prepare non-toxic, pharmaceutically acceptable salts and acylated prodrugs of the compounds.

The pharmaceutical compositions can be topical, systemic, subcryotic, transeclerotic or intravitreal delivery, so that the extracellular concentration of the P2Y2 agonists is raised to activate the P2Y receptors on the cell surface in the retina. The methods of release are intravitreal release and transesclerotic release. Intravitreal delivery may include single or multiple intravitreal injections, or by means of an implantable intravitreal device, which releases the P2Y agonists in a sustained capacity. Intravitreal delivery may also include delivery during surgical manipulation in the treatment of retinal detachment, diabetic retinopathy or macular degeneration as adjuvant of the solution for infraocular irrigation or applied directly to the vitreous humor during the surgical procedure.

The transesclerotic release with a minimum of invasion can be used to release an effective amount of the active compounds in the retina with negligible systemic absorption. The transesclerotic supply uses the large and accessible surface area of the sclera, the high degree of hydration of which makes it conductive of water soluble substances, and the hypocellularity with insufficient assistance of the proteolytic enzymes and protein binding sites, and permeability that does not decline appreciably with age. An osmotic pump loaded with active compounds can be implanted in an individual so that the active compounds are delivered transeclerotically in the retina in a slow release mode (Ambati et al., Invest. Ophtha ol. Vis. Sci., 41: 1186-91 (2000)).

The active compounds can also be administered topically by administering the active compounds in the eye of a patient by any suitable means, but preferably they are administered through a liquid or gel suspension of the active compound in the form of drops, spray or gel.

Otherwise, the active compounds can be applied to the eye by means of liposomes. In addition, ^^^^^^^^^^^^^^^^ Active compounds can be instilled into the tear film by means of a catheter-pump system. Another embodiment of the present invention involves the active compound contained within a selective or continuous delivery device, for example, membranes employed in the Ocusert ™ System (Alza Corp., Palo Alto CA), or in the Vitrasert ™ System (Bausch & amp;; Lomb, CLairmont, CA). As a further embodiment, the active compounds may be contained within, carried by, or attached to, contact lenses that are placed over the eye. Another embodiment of the present invention involves the active compound contained within a swab or sponge that can be applied on the ocular surface. Another embodiment of the present invention involves the active compound contained in a liquid spray that can be applied to the ocular surface.

The active compounds can be administered systemically to the eye. The term "systemic" as used herein includes subcutaneous injection; intravenous, intramuscular, intrasternal injection; infusion, inhalation, transdermal administration, oral administration; and intraoperative instillation.

A systemic method involves an aerosol suspension of respirable particles comprising the active compound, which the individual inhales. The active compound must be absorbed into the bloodstream by the lungs, and subsequently come into contact with the lacrimal glands in an effective pharmaceutical amount. The respirable particles can be liquid or solid, with a particle size small enough to pass through the mouth and larynx after inhalation; in general, the particles range from about 1 to 10 microns, preferably 1-5 microns, are considered respirable in size.

Another method of systemically administering the active compounds to the eyes of the individual involves the administration of a liquid / liquid suspension in the form of eye drops or eye washes or nasal drops of a liquid formulation, or a nasal spray of respirable particles. that the individual inhales. Liquid pharmaceutical compositions of the active compound for producing a nasal spray or eye or nasal drops can be prepared by combining the active compound with a suitable vehicle, such as pyrogen-free, sterile water or sterile saline by the techniques known to those skilled in the art. The technique.

The active compounds can be administered systemically to the eyes through skin absorption using transdermal patches or pads. The active compounds are absorbed into the bloodstream through the skin. The concentration of the active compounds in plasma can be controlled using patches containing different concentrations of the active compounds.

Additional means of systemically administering the active compound to the eyes of the individual could involve a suppository form of the active compound, such that an effective therapeutic amount of the compound reaches the eyes through absorption and systemic circulation.

Additional means of systemically administering the active compound involves the direct intraoperative instillation of a gel, edema or suspension in liquid form of an effective therapeutic amount of an active compound.

For topical application, the solution containing the active compound may contain a vehicle compatible with the physiological medium, as those skilled in the ophthalmic art may select, using criteria conventional. The vehicles may be selected from the known ophthalmic vehicles including, but not limited to, saline, aqueous polyethers such as polyethylene glycol, polyvinyls such as polyvinyl alcohol and povidone, cellulose derivatives co or methylcellulose and hydroxypropylmethylcellulose, petroleum derivatives as mineral oil and white petrolatum, fatty acids such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil and polysaccharides such as dextran, and glucosamine glucans such as sodium hyaluronate and salts such as sodium chloride and potassium chloride.

For systemic administration such as in injection and infusion, the pharmaceutical formulation is prepared in a sterile medium. The active ingredient, depending on the vehicle and concentration used, can be suspended or dissolved in the vehicle. Adjuvants such as local anesthetics, preservatives and buffering agents can also be dissolved in the vehicle. The sterile injectable preparation can be a suspension or sterile injectable solution in an acceptable, non-toxic solvent or diluent. Acceptable solvents and vehicles may be sterile water, saline or Ringer's solution.

For oral use, an aqueous suspension is prepared by adding water to dispersible powders or granules with a dispersing agent or wetting agent, suspending agent, one or more preservatives and other excipients. Suspending agents include, for example, sodium carboxymethyl cellulose, methyl cellulose, and sodium alginate. Dispersing or wetting agents include naturally occurring phosphatides, condensation products of allyl oxide with fatty acids, condensation products of ethylene oxides with long chain aliphatic alcohols, condensation products of ethylene oxide with partial esters of fatty acids and a hexitol, and condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides. Preservatives include, for example, ethyl p-hydroxybenzoate and n-propyl. Other excipients include sweetening agents (e.g., sucrose, saccharin), sabotage agents and coloring agents. Those skilled in the art are aware of the main specific excipients and wetting agents included by the above general description.

For oral application, the tablets are prepared by mixing the active compound with excipients acceptable pharmaceutics, non-toxic, suitable for the manufacture of tablets. These excipients may be, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncovered or they may be covered by known techniques for delayed disintegration and absorption in the gastrointestinal tract and thereby providing a sustained action for a long period of time. For example, a time release material, such as glyceryl mono-stearate or glyceryl distearate, may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert, solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as a soft gelatin capsule wherein the active ingredient is mixed with water or an oily medium, for example, peanut oil, liquid paraffin or olive oil. Formulations for oral use can also be presented as chewable gums by soaking the active ingredient in gums so that the ingredient active is slowly released with chewing.

For rectal administration, the compositions in the form of suppositories can be prepared by mixing the active ingredient with a suitable non-irritating excipient which is solid at room temperature, but liquid at the rectal temperature and therefore melts in the rectum to release the compound. Such excipients include cocoa butter and polyethylene glycols.

The pharmaceutical utility of the P2Y agonist compounds of this invention is indicated by the inositol phosphate assay for P2Y activity. This widely used assay, as described in E. Lazarowski, et al., Brit. J. Pharm. 116, 1619-27 (1995), depends on the measurement of the formation of inositol phosphate as a measure of the activity of the compounds that activate the receptors bound by the G proteins to phospholipase C.

The present invention facilitates that the activation of P2Y purinergic receptors in glial cells by agonists improves the survival of neurons in vivo. The present invention describes the utility of agonists, inducing the activity of purinergic receptors in the glia of the sensitive nervous system v 50 mounting a neuroprotective response directed to a plurality of diseases under which a therapeutic modality is clinically beneficial.

The invention is further illustrated by the following examples which are not intended to limit the invention in its scope or spirit for the specific processes described herein. 10 EXAMPLES Example 1. Localization of gene expression of P2Y receptors in the rabbit and primate retina: # 15 Tissues. The rabbit retina was prepared albino and mono after enucleation of the eye, fixation and cryopreservation. The tissue was cryosected in cross sections through the retina, retinal pigment epithelium, and choroids in sections of 5 μM of thickness and mounted on glass slides for hybridization m if you with antisense and sense oligonucleotide probes designed specifically against regions of P2J2 mRNA - The tissues were also counterstained with hemotoxylin [sic] and eosin (H & E) 25 to evaluate the quality and orientation of the tissues of the study. Examination of the H & E indicates that all tissues were suitable for ISH.

Synthesis of the riboprobe. A PCR product containing nucleosides 253-651 of a human P2Y2-R cDNA was obtained from a sponsor. The nucleotides of P2Y2-R 273-627 were reamplified with P2Y2 primers (sequence of the forward primers: 5 'AGGAGATGTGTTGGGCAGCAGTGAGGAC 3', SEQ ID NO: 1; reverse primer sequence: reverse 5 'ACCAGGGTTTTCTGGCCAACCTGTGACT 3' SEQ ID NO: 2) designed to remove sequences from the flanking plasmids and incorporate an upstream T3 promoter or a downstream T7 promoter. The resulting PCR products were processed to synthesize the riboprobes labeled with digoxigenin by in vitro transcription (IVT). Antisense and sense riboprobes were synthesized using T7 and T3 RNA polymerases, respectively, in the presence of digoxigenin-11-UTP (Boehringer-Mannheim) using a MEGAscript or MAXIscript IVT kit (Ambion) according to the manufacturer. After IVT, the model DNA was degraded with DNase-1, and the unincorporated digoxigenin was removed by ultrafiltration. The integrity of the riboprobe was assessed by electrophoresis through a gel of 52 denaturing polyacrylamide. The apparent molecular size was calculated by comparison with the electrophoretic mobility of a ladder RNA of 100-1000 base pairs (Ambion). The performance of the probe and the labeling were evaluated by immunochemical absorption. The riboprobes were distributed in aliquots of 5 μL and stored at -80 ° C until their use for ISH.

Hybridization in situ. The frozen tissues were 10 cut into 5 μm sections, mounted on SuperFrost Plus slides (Fisher Scientific), and then fixed for 15 minutes in 4% paraformaldehyde in PBS at pH 7.4. The sections # were prehybridized in the absence of the probe, then 15 incubated overnight in hybridization buffer containing 400 ng / ml of any antisense or sense probe. After hybridization, the slides were subjected to a series of astringent washes after hybridization to reduce non-staining. 20 specific. Hybridization was visualized by immunohistochemistry using anti-digoxigenin Fab conjugated with alkaline phosphatase and nitro blue bromochloroindolyl tetrazolium phosphate chloride (Boehringer-Mannheim) according to the manufacturer. The tissue sections were 25 dyed by contrast with red firm nuclear. The Negative controls included retinal tissue stained with the P2Y2R sense probe.

Results The two pairs of slides showed the sense and antisense results for rabbit (Figure 1) and monkey (Figure 2) tissues. Both tissues showed positive staining using the antisense probe (Figures 1 and 2, left), but negative staining using the control sense probe (Figures 1, 2, right). These results demonstrate that rabbit and monkey retinas contained the message for P2Y2 receptors. The cellular localization of the antisense probe demonstrates pronounced P2Y2 expression along the inner limiting membrane, compatible with localization in retina astrocytes whose cell bodies are localized. mainly in this layer. Staining of cell bodies was also observed in the ganglion cell layer and in a subset of cells in the inner nuclear layer, compatible with the presence of P2Y2 in Muller and ganglion cells. Additional staining is observed through the outer limiting membrane and may reflect cytoplasmic staining of the microvilli of the Müller cells or internal segments of the photoreceptors. Finally, intense staining was observed along the retinal pigment epithelium (RPE). In this way, the expression of P2Y2 was demonstrated in retinal neurons and glia.

Example 2: Protection of photoreceptors against the damaging effect of constant light Model in animal. Photorepresentations of albino Sprague-Dawley rats are susceptible to damage as a result of exposure for approximately 4 days in bright light, 10 constant. The degeneration of photoreceptors induced by light in Sprague-Dawley rats is an animal model widely used for retinal degeneration in humans after exposure to toxic levels of bright light, or in disease conditions 15 (La Vail, et al., Proc Nati, Acad. Sci 89: 11249-11253, 1992). This model is used to test the ability of P2Y2 receptors to protect photoreceptors from degeneration caused by exposure to constant bright light. 20 Experimental design. Sprague-Dawley rats were ^ r maids up to an age of -10 weeks and caged under a cyclic illumination of 12 light / dark hours in an illuminated cage of -20 ft-cd. Before exposure to 25 bright light, the animals were injected intra vitreously (injection 1 μL) with P2J2 receptor agonists such as dCP4Ü and IP4U, and returned to normal cyclic lighting conditions for 16 or 48 hours, after this time the animals were caged under constant bright light (~ 175 ft- cd) for 84 hours. The following concentrations were tested for each compound: dCP4U (1 and 10 mM), IP4U (10 mM), and BDNF (0.5 μg). After 84 hours of constant bright illumination, the animals were returned to the 10 normal cyclic lighting conditions for 2 weeks before slaughter. To assess retinal function, scotopic and photopic electroretinograms (ERG) were performed one week before exposure to bright light, and just before sacrifice. The ERG provided 15 a functional measure of the originating electrical activity through the retina in response to exposure to brief flashes of light, and represents a relatively noninvasive measure of the function and integrity of the photoreceptors. A series of responses was made 20 scotopic (24 dB illumination) opaque and a series of ** ^ M scotopic responses (0 dB illumination) bright. The ERG responses of the opaque illumination come mainly from the rod photoreceptors, and the ERG response of the bright illumination come from the 25 photoreceptors of cones and poles combined. After of the sacrifice, the eyes were enucleated and processed by sections in paraffin and stained with hemotoxilin [sic] and eosma to determine the histological characteristics of the retina. Histological analysis provided morphological information of the photoreceptors and other parts of the retina at the cellular level. The animals were treated in one eye with the P2Y agonist and the opposite eye remained untreated. A separate control group of animals was treated with vehicle shock absorber in one eye and the opposite eye remained untreated. Another separate positive control group was treated with the brain-derived neurotrophic factor (BDNF) in one eye and the opposite eye remained untreated. BNDF previously had shown to improve the survival of photoreceptors in the model (La Vail, et al., Proc. Nati Acad. Sci. 89: 11249-11253, 1992).

Results Animals treated with the P2Y, vehicle or BDNF receptor agonists were examined for neuroprotection of the photoreceptors, using the ERG and histology as measures. Eyes treated with the P2Y agonists in general showed larger scotopic ERG responses at both illumination intensities tested (Figures 3, 4 and 5), whereas the 57 vehicle only had minimal effect on the ERG. In the lower hemisphere of the retina, the thickness of the outer nuclear layer (consisting of photoreceptor nuclei) and the inner / outer segments in the eyes treated with dCP4U and IP4U were generally greater than in the untreated and vehicle-treated eyes (Figure 6). These effects of the two P2Y receptor agonists are comparable with those of the BDNF positive control (Figure 6). In the upper hesmiferium, all treated and control groups showed a comparable increase in the thickness of the outer nuclear (Figure 7). The results of Figures 3-7 demonstrated that P2Y receptor agonists improve the survival of photoreceptors in the light damage model, comparable to the effects of BDNF.

Claims (17)

1. A method to treat degenerative diseases of the retina, consists of: administering to a patient a pharmaceutical composition containing an effective therapeutic amount of a P2Y receptor agonist compound, wherein the amount is effective to increase the concentration The extracellular retinal agonist is activated so that the P2Y receptors on the cell surface of the glial cells and the neuronal cells of the retina are activated to mount a neuroprotective response, where the P2Y receptor agonist is a 15 dinucleoside diphosphate selected from the group consisting of the compounds of the formula la, lia and Illa: Formula ± - where: X and X2 are each independently 0 ~ or S ~; And it is H or OH; Ri is selected from the group consisting of 0, imido, methylene and dihalomethylene; R2 is selected from the group consisting of H, halogen, alkyl, substituted alkyl, alkoxy and azido; R3 is selected from the group consisting of, H, alkyl, acyl, arylacyl, and arylalkyl; Y R is selected from the group consisting of -OR ', -SR' and N'RR '', wherein R 'and R "are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxy and aryloxy, and with the proviso that R 'is not present when R has a double bond of an oxygen atom or sulfur to the carbon in the 4-position of the pyrimidine ring. Formula lia where: Ri, Xi, X2 and Y are defined as in the Formula la; Z is H; Cl or SR, wherein R is C1-C20 alkyl, saturated or unsaturated; R3 and R are H while R2 is nothing and there is a double bond between N-1 and C-6, or R3 and R4 are H, while R2 is 0 and there is a double bond between N-1 and C-6, or R3. 4 and 2 taken together are -CH = CH-, forming a ring from N-6 to N-l with a double bond between N-6 and C-6; Formula Illa where: Ri, Xi, X2 and Y are defined as in the Formula la; Y_ R5 and R6 are H, while R7 is nothing and there is a double bond between N-3 and C-4, or R5, R6 and R7 taken together are -CH = CH-, forming a ring of N-3 to N-4 with a double bond between N-4 and C-4, optionally the hydrogen of the 4 or 5 position of the ring ethene it is substituted with alkyl, substituted alkyl, alkoxy, nitro, halo and azido.

2. The method according to claim 1, wherein the nucleoside diphosphate is 5 '-uridinadiphosphate, 5'-adenosine diphosphate or 5'-cytidine diphosphate.

3. A method to treat degenerative diseases of the retina, consists of: administering to a patient a pharmaceutical composition containing an effective therapeutic amount of a P2Y receptor agonist compound, wherein the amount is effective to increase the extracellular concentration of the agonist in the retina so that the P2Y receptors on the cell surface of the glial cells and neuronal cells of the retina are activated to mount a neuroprotective response, wherein the P2Y receptor agonist is a dinucleotide triphosphate selected from the group consisting of the compounds of the formula Ib and Illb: Formula Ib where: 63 * f T J "** X, X2 and X3 are each independently 0"or S; And it is H or OH; Ri is 0, imido, methylene and dihalomethylene; R2 is H or Br; R3 is selected from the group consisting of nothing, H, alkyl, acyl and arylalkyl; R4 is selected from the group consisting of -OR ', -SR' and N'RR '', wherein R 'and R "are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl , arylalkyl, alkoxy and aryloxy, and with the proviso that R 'is not present when R4 has a double bond of an oxygen atom or sulfur to the carbon in the 4-position of the pyrimidine ring; twenty r 25 Formula Illb ' where : Ri, Xi, X2, X3 and Y are defined as in Formula Ib, and R5 and Rg are H, while R7 is nothing and there is a double bond between N-3 and C-4, or R5, Rg and R7 taken together are -CH = CH-, forming a ring of N-3 to N-4 with a double bond between N-4 and C-4, optionally the hydrogen of the 4 or 5 position of the ring ethene it is substituted with alkyl, substituted alkyl, alkoxy, nitro, halogen and azide.

4. The method according to claim 3 wherein the nucleoside triphosphate is uridine 5'-triphosphate, :? * * 65 citidma 5 '-triphosphate or 4-nitrophenylenete cytidine 5'-triphosphate.

5. A method to treat degenerative diseases of the retina, consists of: administering to a patient a pharmaceutical composition containing an effective therapeutic amount of a P2Y receptor agonist compound, wherein the amount is effective to increase the extracellular concentration of the agonist in the retina so that the P2Y receptors on the cell surface of the glial cells and the neuronal cells of the retina are activated to mount a neuroprotective response, wherein the P2Y receptor agonist is a dinucleoside polyphosphate selected from the group consisting of the compounds of formula IV: Formula IV where : X is oxygen, methylene, difluoromethylene, imido; n = 0, 1 or 2; m = 0, 1 or 2; n + m = 0, 1, 2, 3 or.; B and B 'are each independently a purine residue or a pyrimidine residue attached by the 9 or 1 position, respectively; Z = OH or N3, Z '= OH or N3; Y = H or OH; and Y '= H or OH.

6. The method according to claim 5, wherein the polyphosphate dinucleoside is a compound of the formula IVa: Formula IVa where: X = 0; n + m = 1 or 2; Z, Z ', Y and Y' = OH B and B 'are uracil, thymine, cytosma, guanine, adenine, xanthe, hypoxantine or as defined in Formulas V and VI; or X = 0; n + m = 3 or 4; Z, Z ', Y and Y' = OH B = uracil; B 'is uracil, thymine, cytosma, guanine, adenine, xantham, hypoxanthine or as defined in formulas V and VI; or X = 0; n + m = 1 or 2; Z, Y and Z '= OH; Y '= H; B = uracil; B 'is uracil, thymine, cytosine, guanine, adenine, xanthine, hypoxantine or as defined in Formulas V and VI; or 68 .r ^ "» X = O; n + m = O, 1 or Z and Y = OH; Z '= N3; Y '= H B = uracil; B 'is thymine; or X = 0; 10 n + m = 0, 1 or 2; Z and Z '= N3; Y and Y '= = H B and B' = thymine; or X X = CH2, CF2 or NH; n and m = 1; Z, Z ', Y and Y' = OH; B and B 'are uracil, thymine, cytosine, guanine, adenine, xanthine, hypoxanthine or as defined in Formulas V and VI; • 25 Formula V where Ri is hydrogen, C? _e alkyl, C3_6 cycloalkyl, phenyl or phenyloxy; wherein at least one hydrogen of the C? _s alkyl, phenyl, phenyloxy, is optionally substituted with a portion selected from the group consisting of: halogen, hydroxy, C--. alkoxy, C alquilo _ alkyl, C ar_ aryl Carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulphonic acid, amino, C? _4 alkylamino, C? _ -di alkylamino, wherein the alkyl groups are optionally attached to form a heterocycle,? -A (alkyl) CONH (alkyl) - and? -A (alkyl) NHCO (alkyl) -, wherein A is amino, mercapto, hydroxy or carboxyl; R2 is 0, or it is not present; or Ri and R2 taken together form a fused, 5 membered imidazole ring, optionally substituted at the 4 or 5 positions of the ethene portion with C1-4 alkyl, phenyl or phenyloxy, wherein at least one hydrogen of C1-4 alkyl , phenyl, phenyloxy, is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C 1 -4 alkoxy, C alquilo _ alkyl, C ar ~ ar aryl, C7_2 arylalkyl, carboxy, cyano, nitro , sulfonamido, sulphonate, phosphate, sulfonic acid, amino, C 1-4 alkylamino, and C 1-4 dialkylamino, wherein the dialkyl groups are optionally attached to form a heterocycle; Y R3 is hydrogen, NH2, C? _s alkyl, phenyl or phenyloxy; wherein at least one hydrogen of the NH.sub.2, alkyl, phenyl or phenyloxy, is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C? _4 alkyl, Cg ~? aryl, arylalkyl, C7-12, C 4 alkoxy, C 7-12 arylalkyloxy, C 1 -4 alkylthio, phenylthio, C 7-12 aralkylthio, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulphonic acid, amino, C 1 - alkylamino 4, phenylamino, C7-12 arylalkylamino, di-C4 alkylamino, wherein the dialkyl groups are optionally attached to form a heterocycle,? -A (alkyl) CONH (alkyl) B- and? -A (alkyl) NHCO (alkyl) B-, where A and B are independently amino, mercapto, hydroxy or carboxyl. Formula VI where: R 4 is hydrogen, hydroxy, mercapto, amino, cyano, C 7-12 arylalkoxy, C 1 _ alkylthio, Ci-g alkoxy, C? _g alkylamino or C 1-4 alkylamino, wherein the alkyl groups are optionally joined together to form a heterocycle; R5 is hydrogen, acetyl, benzoyl, C? _ Alkyl, phenyloxy, C? _5 alkanoyl, aroyl or sulfonate; Rg is hydroxy, mercapto, C ?4 alkoxy, C7-12 arylalkoxy, C? _g alkyl, amino, disubstituted amino C? _5, triazolyl, C? _g alkylamino, or C 1-4 dialkylamino, wherein the dialkyl groups are optionally attached to form a heterocycle or attached to N to form a substituted ring; R5 and Rg taken together form a fused, 5-membered imidazole ring, enters positions 3 and 4 of the pyrimidine ring and forms a 3, N-ethenocytosine derivative, wherein the ethene portion is optionally substituted at positions 4 or 5 with alkyl of C1-4, phenyl or phenyloxy; wherein at least one hydrogen of the C ?4 alkyl, phenyl or phenyloxy is optionally substituted with a portion selected from the group consisting of halogen, hydroxy, C 1-4 alkoxy, C 1-4 alkyl, Cg_? o aryl, C7-12 arylalkyl, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulphonic acid, amino, C? _4 alkylamino and C? _4 dialkylamino, wherein the dialkyl groups are optionally attached to form a heterocycle; R7 is hydrogen, hydroxy, cyano, nitro or C2-8 alkenyl; wherein the alkenyl portion is optionally attached through an oxygen to form a ring, wherein at least one hydrogen of the alkenyl portion on the carbon adjacent to the oxygen is optionally substituted with C? _6 alkyl, phenyl, substituted C2-8 alkynyl, halogen, substituted C? _4 alkyl, CF3, C2_3 alkenyl, C2_3 alkynyl, allylamino, bromovinyl, ethylpropenoate or propenoic acid; or Rg and R7 together form a saturated or unsaturated ring of 5 or 6 members linked through N 0 to Rg, the ring optionally containing substituents which themselves contain functionalities; provided that when Rg is amino or substituted amino, R7 is hydrogen; Y Rs is hydrogen, amino or C 1-4 dialkylamino, C 1-4 alkoxy, 07-12 arylalkoxy, C 1-4 alkylthio, C 7-2 aralkylthio, carboxamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy or phenylthio.

7. The method according to claim 6, wherein the polyphosphate dinucleoside is U2P4, dUP4U, U2P3, U2P5, dCP4U, CP4U, IP5I, AP4A, CP3U, UP3A or A2P3.

8. The method according to any of claims 1-7, wherein the compound is administered to a patient by an intravitreal supply, a transesclerotic supply or a topical administration. lyj

9. The method according to claim 8, wherein the topical administration is by means of a carrier vehicle selected from the group consisting of drops of liquid, liquid washes, gels, ointments, sprays and liposomes.

10. The method according to claim 8, wherein topical administration comprises infusing the compound on an ocular surface by means of a device selected from the group consisting of a pump-catheter system, a selective or continuous delivery device and contact lenses. .

11. The method according to any of claims 1-7, wherein the administration is systemic administration of the compound.

12. The method according to any of claims 1-7, wherein the systemic administration is administered to the individual the compound in a form selected from the group consisting of: a liquid or liquid suspension for administration as nasal drops or nasal spray; a nebulized liquid for administration to the oral or nasopharyngeal routes; an oral form; an injectable form; a form of .s ^^^ Áá ^ Áá l¿j ^ Í suppository; a gel, cream, powder, foam, crystals, liposomes, spray or liquid suspension for intraoperative instillation; and a transdermal patch or a transdermal pad; so that an effective therapeutic amount of the compound comes into contact with the retinane tissues of the individual by systemic absorption and circulation.

13. The method according to any of claims 1-7, wherein the degenerative diseases of the retina are inherited degenerative diseases of the retina, acquired degenerative diseases of the retina or degenerative diseases of the retina induced by inflammation.

14. The method according to claim 13, wherein the degenerative disease of the inherited retina is macular degeneration, Stargardt's disease, Best's disease, glaucoma, retinitis pigmentosa or optic nerve degeneration.

15. The method according to claim 13, wherein the degenerative disease of the acquired retina is caused by cystoid macular edema, retinal detachment, phytic damage, ischemic retinopathies due to venous or arterial occlusion or other vascular disorders, retinopathies due to trauma, surgery or penetrating injuries of the eye, or vitreous peripheral retinopathy.

16. The method according to claim 13, wherein the degenerative disease of the retina induced by inflammation is caused by degeneration of the retina induced by viruses, bacteria or toxins, or uveitis.

17. The method according to claim 13, wherein the degenerative disease of the retina induced by inflammation gives rise to optic neuritis.